CN109750017B - Alkaline cellulase and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the field of molecular biology, and particularly relates to alkaline cellulase and a preparation method and application thereof. The gene of the alkaline cellulase is from a real alkaline cellulose environment alkaline bamboo pickling pool, and the specific preparation method of the alkaline cellulase comprises the following steps: obtaining a metagenome of a sample through a molecular biology means; then obtaining the gene sequence of the alkaline cellulase through high-throughput sequencing; then the alkaline cellulase gene is amplified and integrated into an expression vector, and the vector transforms host cells; and finally culturing the transformed cells to obtain fermentation liquor and extracting the fermentation liquor. The nucleotide sequence of the alkaline cellulase is shown as SEQ ID NO:1, the cellulase has similarity of not more than 49% with the existing cellulase, has higher enzyme activity under the condition of medium-alkaline pH, has good effect when being applied to textile polishing, and has obvious application effect in the industries of textile, washing, papermaking and the like.

Description

Alkaline cellulase and preparation method and application thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to alkaline cellulase and preparation and application thereof.

Background

Cellulose is a natural high molecular compound which is most abundant in the world, and most of the cellulose is synthesized by green plants through photosynthesis. The degradation and transformation of cellulose by microorganisms are the main links of carbon transformation in nature. Cellulases are a generic term for multi-component enzymes that degrade cellulose to glucose. At present, cellulase products are widely applied to industries such as textile, feed, brewing, pharmacy, paper making and the like, and particularly the application range of the cellulase products in the textile industry is continuously expanded at present.

The cellulase is widely available and can be produced by insects, mollusks, protozoa, bacteria, actinomycetes, fungi, etc. The main points are as follows: trichoderma koningii, trichoderma reesei, aspergillus niger, penicillium decumbens, bacillus, etc. Cellulases produced by filamentous fungi generally hydrolyze cellulosic substrates under acidic or neutral mildly acidic conditions, whereas cellulases produced by basophils function in the alkaline range. Cellulase produced by filamentous fungi is usually complete in enzyme system, comprises beta-1, 4-exoglucanase, beta-1, 4-endoglucanase and beta-glucosidase, and has high strength when acted on fabrics, so that the weight loss rate is high, and the finished fabrics are easy to damage. Alkaline cellulases are beta-1, 4-endoglucanases which act on the non-crystalline regions of cellulose with less damage to the fabric.

Aiming at alkaline cellulase, the previous research usually searches for enzyme with alkaline property in soil humus rich in cellulose or searches for alkaline-resistant strains in alkaline salt lake and other environments to test the cellulose degradation capability of the alkaline cellulase; in other words, the environmental sample selected by the conventional screened strain does not always have both the alkaline condition and the cellulose-rich condition. The alkaline cellulase obtained by the traditional screening method must be based on the fact that the strain can be successfully isolated and cultured in a laboratory, and some microorganisms which cannot be cultured in the laboratory have high possibility of having some rare or special alkaline cellulase.

Disclosure of Invention

In view of this, it is necessary to provide an alkaline cellulase gene and its preparation and application for the above problems, and the alkaline cellulase gene is directly separated and obtained from a real alkaline cellulose environment alkaline bamboo pickling pool by using a metagenomic molecular means, and is obtained by recombinant expression in an engineering yeast.

The invention is realized by the following technical scheme:

the amino acid sequence of the alkaline cellulase is shown as SEQ ID NO. 2.

Further, the nucleotide sequence of the alkaline cellulase is shown as SEQ ID NO:1 is shown.

Further, the alkaline cellulase has a similarity of not more than 49% with the existing cellulase.

A preparation method of alkaline cellulase comprises the following steps:

1) Analyzing, selecting and sampling a sample plot, and obtaining a metagenome of the sample by a molecular biology means;

2) Performing high-throughput sequencing on the metagenome in the step 1) to obtain a gene sequence of the alkaline cellulase;

3) Amplifying and integrating the alkaline cellulase gene obtained in the step 2) into an expression vector, and transforming a host cell by using the vector;

4) Culturing the transformed cells in 3) to obtain a fermentation liquor containing the recombinant alkaline cellulase;

5) Preparing the alkaline cellulase from the fermentation liquor obtained in the step 4).

Further, the method further comprises a step 6): the test analyzes the enzymatic properties of the alkaline cellulase.

Further, in the step 1), the sample is derived from an alkaline bamboo pickling pool.

Further, in the step 3), the host cell includes saccharomyces cerevisiae, kluyveromyces marxianus, saccharomyces hansenii, kluyveromyces, and the like. Pichia pastoris is preferred.

Further, the alkaline cellulase is applied to the field of textile cloth polishing.

The invention has the beneficial effects that:

the alkaline pickled bamboo pool sampled by the invention is located in Deng village of Sihui city of Guangdong province, has long history, is recorded by local genealogy and county, migrates to the region in ancient times, brings the technology of bamboo paper making by the ancient method, and starts to set workshop for making paper by utilizing local rich bamboo resources and water resources. The bamboo-pickling pool is specially used for soaking bamboos in lime water, a carbon source for microorganisms in the pool only contains bamboo fibers, the pH value of the alkaline bamboo-pickling pool is 10 through detection, and the bamboo-pickling pool can be considered to have two conditions of alkalinity and rich cellulose at the same time and is a real alkaline cellulose environment. The evolution of microorganisms (especially alkaline cellulases) has occurred over the last millennium period in the pond. The technology of manufacturing bamboo paper by the ancient method is well protected and inherited, the alkaline bamboo-pickling pool is still used continuously at present and is stable in use state, the gene for expressing the alkaline cellulase can be repeatedly obtained at the same sampling point by the same method, and the mutation probability of the microbial gene in the alkaline cellulase is very small or even not mutated in a certain period under the condition that the use state of the bamboo-pickling pool is stable. The "certain period" here may be a hundred years.

The invention takes the sample of the alkaline bamboo-pickling pool which is alkaline and rich in cellulose as a research object, and bacteria growing in the bamboo-pickling pool take the cellulose as a dominant carbon source for a long time, thereby further developing stronger cellulose degradation capability suitable for alkaline pH. The cellulase gene is separated from the real alkaline cellulose environment by utilizing a molecular biological means, and the sequence analysis shows that the homology of the cellulase gene and the cellulase which is already reported is less than 50 percent. The isolated gene is further recombinantly expressed in a microorganism. The enzyme property analysis of the recombinant expression cellulase has high enzyme activity under the condition of medium alkaline PH and has good effect when being applied to textile polishing.

The alkaline cellulase gene obtained by the invention is obtained by screening from a real alkaline high-fiber environment through a metagenome technology, avoids the traditional bacteria screening and cloning processes, has obvious application effect, and can be used in the industries of spinning, washing, papermaking and the like.

Drawings

FIG. 1 is an electrophoretogram of metagenomic DNA of a sample.

FIG. 2 is an amplification electrophoresis diagram of alkaline cellulase gene CEL6561.

FIG. 3 expression vector pPIC9K-CEL6561.

FIG. 4 screening of transformants for their ability to degrade carboxymethylcellulose.

FIG. 5 pH characteristics of alkaline cellulase CEL6561.

FIG. 6 temperature profile of alkaline cellulase CEL6561.

FIG. 7 alkaline cellulase CEL6561 treatment of fabric polishing experiments.

Detailed Description

To better illustrate the problems addressed by the present invention, the technical solutions adopted and the effects achieved, reference will now be made to the following detailed description and related information. It should be noted that the present disclosure includes, but is not limited to, the following examples and combinations thereof.

Example 1

Obtaining metagenome of sample and sequencing

Firstly, 50mL of sample is placed in a 50mL centrifuge tube, violent oscillation is carried out, 100g of sample is centrifuged at low speed for 10min, bamboo fiber at the bottom is removed, the supernatant is transferred to a new centrifuge tube 4600g and centrifuged for 30min, the precipitate is taken and is re-centrifuged twice by using potassium phosphate buffer solution, and thalli are collected by centrifugation to be used as a sample extracted from the metagenome.

And (2) extracting metagenome DNA by using a rapid soil DNA separation kit (a biological organism), and detecting the extracted metagenome DNA by electrophoresis (figure 1), wherein the lanes 1 and 2 have obvious DNA bands, so that the metagenome DNA is successfully extracted. The extracted DNA sample is sent to Beijing and kang biotech Co., ltd for metagenome sequencing. Sequencing data show that the CEL6561 sequence contains a conserved structural domain of glycosyl hydrolysis family 9, the cellulose hydrolysis capacity is judged to be possessed, and the nucleotide sequence is classified as a cellulase gene sequence. The full length of the nucleic acid sequence of CEL6561 is 1602bp (shown in SEQ ID NO. 1), and 533 amino acids (shown in SEQ ID NO. 2). The alignment of the amino acid sequence uploaded to the NCBI database showed that the sequence CEL6561 has only 49% homology to the protein in the existing database (NCBI accession No. WP _ 073281770) at the most.

In conclusion, it can be determined that CEL6561 is a new alkaline cellulase different from the existing alkaline cellulase.

Example 2 recombinant expression of cellulase CEL6561 sequences

Based on the CEL6561 nucleic acid sequence, primers were designed:

6561-F：CCGGAATTCAGTACGATAAACAAGAAGATTAGAGG，

6561-R:ATAAGAATGCGGCCGCTTAAATGAGCACAGACAACAAAT

appropriate restriction sites EcoRI and NotI were introduced at both ends of the sequence. The amplification system is: primer 6561-F (10 mM) 1uL, primer 6561-R (10 mM) 1uL, template 1uL (10 ng/uL), prime STAR Mix 25uL, and complement ddH ₂ O to 50uL; the amplification procedure was as follows: at 98 ℃ for 10s;63 ℃ for 5s;72 ℃ for 10s; the number of cycles was 30. Electrophoresis detection of amplification products is shown in FIG. 2, 160There was a clear band at 0 bp. The obtained gene fragment was digested with EcoRI and NotI, and introduced into pPIC9K plasmid (purchased from NEB Co.), and the resulting recombinant plasmid was named pPIC9K-CEL6561 (FIG. 3), and was determined by digestion and sequencing (Ensiferic Elegand Biometrics Co., ltd.) to have a correct sequence as shown in SEQ ID No.3.

Enzyme digestion system (50 μ L): the total amount of restriction enzyme was 2. Mu.L, digestion buffer 5. Mu.L, plasmid < 1. Mu.g, and the remaining volume was filled with water.

Ligation system (15 μ L): 10 μ L of ligase reaction solution, 5 μ L of EcoRI-pPIC9K-NotI long fragment, 2.5 μ L of EcoRI-CEL6561-NotI short fragment, and 20-20 μ L of supplemental ddH.

After linearization of the plasmid pPIC9K-CEL6561 with SacII, GS115 Pichia pastoris was electrotransformed, transformants were selected on MD plates, transformants with higher copy number were selected on YPD plates supplemented with G418, and transformants with higher fiber-degrading ability were selected on YPC (1% yeast extract, 2% peptone, 1% carboxymethylcellulose) plates (FIG. 4). Transformant No.1 (designated GS115-CEL 1) had the largest hydrolysis cycle and the highest cellulose degradation activity.

Example 3 fermentation and enzymatic Properties analysis of recombinant cellulase

Selecting a single colony of a transformant GS115-CEL1 in a 250mL triangular flask containing a 50mLBMGY culture medium, and culturing at 30 ℃ and 250rpm overnight; centrifuging at room temperature of 3000g for 5min to collect thallus, and resuspending cells in a 50mL centrifuge tube by using 10mL BMMY culture medium to continue culturing; adding methanol with the final concentration of 0.5 percent every 24 hours to continue to induce the expression of the cellulase; sampling every 24h to detect the enzyme activity of the cellulase, wherein the enzyme activity on the fifth day is the highest and reaches 56U/mL, and the enzyme sample on the fifth day is used for enzyme property analysis, the optimal pH is 6-6.5, and more than 60% of the enzyme activity is also kept between pH7 and pH8 (figure 5); the optimal temperature is 40-60 deg.C (FIG. 6), and the enzyme activity loss is more serious when the temperature is over 70 deg.C.

Example 4 cellulase textile cloth polishing application experiment

Weighing 100g of dried cotton cloth, adding the dried cotton cloth into 8 kg of water with the pH value of 6.0, pouring the water and the cloth into a washing machine, adding 100g of cellulase liquid fermented by the method, controlling the temperature of the machine at 55 ℃, rotating the machine at 180rpm, and operating the machine for 1h; the enzyme solution was replaced with clear water in the control group, and the other conditions were unchanged. And after polishing, completely drying the cloth, weighing and calculating the weight loss rate. And the polishing effect (the reduction of the micro fluff on the surface of the cloth) was checked. The results are shown in fig. 7, and the experimental group has a better polishing effect, and the surface of the control group still has a large amount of tiny cilia. The weight loss rate of the experimental group is 2.1%, the weight loss rate of the control group is only 0.12%, and thus the cellulase CEL6561 has good polishing potential.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou institute of advanced technology of Chinese academy of sciences

<120> alkaline cellulase and preparation and application thereof

<130> CNP201710367

<141> 2017-11-06

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1602

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgagtacga taaacaagaa gattagagga aatcaagtag ggtatgatcc agaatttgag 60

aagatattga ttataaaaga tccaacttct ctaagatatc aattaaaaaa agatgaacaa 120

ctcatagaac agggaatatt aagtaaagct actactcacc catatacacg tgaggaggat 180

tatttttgtg acctcagtca tgtgaaagta gaaggtgttt atcaattaat gatagaagat 240

atggcgggat actttccttt tgtagttaag aaaaactgct acgaagattt attattaaat 300

accctgcgct ttttttatct tcagagatgc ggagaaaacc ttccagaaga atttgctaat 360

gagtttcagc atagaagttg tcacgatcag catgctcgta tttatggaac aaatcaaagg 420

atttctgtaa acggtggttg gcatgatgct ggtgattatg gtcgttatat cgttgccgca 480

gcggtgacag ttgctgattt attgttagca tttgaagaaa cgcacaaaat ttcaactctg 540

aatttaagaa tacctgaaag caaattacag attccagatt tgttgagtga gattcgctat 600

gaattggaat ggatgctttc catgcaaaat cagaataacg gacaagttta tcataaagta 660

acctgtgcca gtttttgtgg gtttattatg ccggaagaag agcaggaaga attagttgtt 720

acggagcctt cgattacagc aaccgcaacc tttgcagcta cgactgctat ggcagttgca 780

ttttatgaat cttttgacaa agatttttcg gaacgtttaa aacaagcttc gaaagcggct 840

tatgatgcat tgaaggacat gcatatgcca gaagggttta aaaatccaga tggagttgta 900

acaggagagt atggtgatgg aaaggatatt gacgaaagat actgggctgc agcggcatta 960

tataaggctt ttggagaatc aaagtatcga gaagactttg aaacattggc caaaaaagaa 1020

gttcttcatg gctatggatg ggaggaagtt ggaagttttg ggaatcaggc ttatctcaca 1080

acagaaaatt tcccgataga tgaaaattta cgggaagaaa ttcaaaaaca aatgatcaaa 1140

aaagcagatg aacttgagga aaaaatagcg atagaacctt atggagtttc gttttctgaa 1200

agcgattata tttggggcag taatatgtat gcggcagaaa atggcaatca tttatttgat 1260

gcttatagaa tcacaaagaa tgtcgcatat ttaaatcatg caagaagcca gctacattat 1320

ttgctaggga aaaatccatg cggatattgt tatgtaactg gatttggttt tttatcacca 1380

aagtacccac atcacagacc gtcttcggcc gtagggaaac caatggaagg tatgttggtt 1440

ggtggaccgg atcgtggtct gaatgatccc gcagcggtag aatttcttaa ggatcagtca 1500

gccccatgtt gctatgtaga tgatgaggga agttattcta caaatgaagt taccatttac 1560

tggaactctg cactggtgta tttgttgtct gtgctcattt aa 1602

<210> 2

<211> 533

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Thr Ile Asn Lys Lys Ile Arg Gly Asn Gln Val Gly Tyr Asp

1 5 10 15

Pro Glu Phe Glu Lys Ile Leu Ile Ile Lys Asp Pro Thr Ser Leu Arg

20 25 30

Tyr Gln Leu Lys Lys Asp Glu Gln Leu Ile Glu Gln Gly Ile Leu Ser

35 40 45

Lys Ala Thr Thr His Pro Tyr Thr Arg Glu Glu Asp Tyr Phe Cys Asp

50 55 60

Leu Ser His Val Lys Val Glu Gly Val Tyr Gln Leu Met Ile Glu Asp

65 70 75 80

Met Ala Gly Tyr Phe Pro Phe Val Val Lys Lys Asn Cys Tyr Glu Asp

85 90 95

Leu Leu Leu Asn Thr Leu Arg Phe Phe Tyr Leu Gln Arg Cys Gly Glu

100 105 110

Asn Leu Pro Glu Glu Phe Ala Asn Glu Phe Gln His Arg Ser Cys His

115 120 125

Asp Gln His Ala Arg Ile Tyr Gly Thr Asn Gln Arg Ile Ser Val Asn

130 135 140

Gly Gly Trp His Asp Ala Gly Asp Tyr Gly Arg Tyr Ile Val Ala Ala

145 150 155 160

Ala Val Thr Val Ala Asp Leu Leu Leu Ala Phe Glu Glu Thr His Lys

165 170 175

Ile Ser Thr Leu Asn Leu Arg Ile Pro Glu Ser Lys Leu Gln Ile Pro

180 185 190

Asp Leu Leu Ser Glu Ile Arg Tyr Glu Leu Glu Trp Met Leu Ser Met

195 200 205

Gln Asn Gln Asn Asn Gly Gln Val Tyr His Lys Val Thr Cys Ala Ser

210 215 220

Phe Cys Gly Phe Ile Met Pro Glu Glu Glu Gln Glu Glu Leu Val Val

225 230 235 240

Thr Glu Pro Ser Ile Thr Ala Thr Ala Thr Phe Ala Ala Thr Thr Ala

245 250 255

Met Ala Val Ala Phe Tyr Glu Ser Phe Asp Lys Asp Phe Ser Glu Arg

260 265 270

Leu Lys Gln Ala Ser Lys Ala Ala Tyr Asp Ala Leu Lys Asp Met His

275 280 285

Met Pro Glu Gly Phe Lys Asn Pro Asp Gly Val Val Thr Gly Glu Tyr

290 295 300

Gly Asp Gly Lys Asp Ile Asp Glu Arg Tyr Trp Ala Ala Ala Ala Leu

305 310 315 320

Tyr Lys Ala Phe Gly Glu Ser Lys Tyr Arg Glu Asp Phe Glu Thr Leu

325 330 335

Ala Lys Lys Glu Val Leu His Gly Tyr Gly Trp Glu Glu Val Gly Ser

340 345 350

Phe Gly Asn Gln Ala Tyr Leu Thr Thr Glu Asn Phe Pro Ile Asp Glu

355 360 365

Asn Leu Arg Glu Glu Ile Gln Lys Gln Met Ile Lys Lys Ala Asp Glu

370 375 380

Leu Glu Glu Lys Ile Ala Ile Glu Pro Tyr Gly Val Ser Phe Ser Glu

385 390 395 400

Ser Asp Tyr Ile Trp Gly Ser Asn Met Tyr Ala Ala Glu Asn Gly Asn

405 410 415

His Leu Phe Asp Ala Tyr Arg Ile Thr Lys Asn Val Ala Tyr Leu Asn

420 425 430

His Ala Arg Ser Gln Leu His Tyr Leu Leu Gly Lys Asn Pro Cys Gly

435 440 445

Tyr Cys Tyr Val Thr Gly Phe Gly Phe Leu Ser Pro Lys Tyr Pro His

450 455 460

His Arg Pro Ser Ser Ala Val Gly Lys Pro Met Glu Gly Met Leu Val

465 470 475 480

Gly Gly Pro Asp Arg Gly Leu Asn Asp Pro Ala Ala Val Glu Phe Leu

485 490 495

Lys Asp Gln Ser Ala Pro Cys Cys Tyr Val Asp Asp Glu Gly Ser Tyr

500 505 510

Ser Thr Asn Glu Val Thr Ile Tyr Trp Asn Ser Ala Leu Val Tyr Leu

515 520 525

Leu Ser Val Leu Ile

530

<210> 3

<211> 10866

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggccgcgaat taattcgcct tagacatgac tgttcctcag ttcaagttgg gcacttacga 60

gaagaccggt cttgctagat tctaatcaag aggatgtcag aatgccattt gcctgagaga 120

tgcaggcttc atttttgata cttttttatt tgtaacctat atagtatagg attttttttg 180

tcattttgtt tcttctcgta cgagcttgct cctgatcagc ctatctcgca gctgatgaat 240

atcttgtggt aggggtttgg gaaaatcatt cgagtttgat gtttttcttg gtatttccca 300

ctcctcttca gagtacagaa gattaagtga gaagttcgtt tgtgcaagct tatcgataag 360

ctttaatgcg gtagtttatc acagttaaat tgctaacgca gtcaggcacc gtgtatgaaa 420

tctaacaatg cgctcatcgt catcctcggc accgtcaccc tggatgctgt aggcataggc 480

ttggttatgc cggtactgcc gggcctcttg cgggatatcg tccattccga cagcatcgcc 540

agtcactatg gcgtgctgct agcgctatat gcgttgatgc aatttctatg cgcacccgtt 600

ctcggagcac tgtccgaccg ctttggccgc cgcccagtcc tgctcgcttc gctacttgga 660

gccactatcg actacgcgat catggcgacc acacccgtcc tgtggatcta tcgaatctaa 720

atgtaagtta aaatctctaa ataattaaat aagtcccagt ttctccatac gaaccttaac 780

agcattgcgg tgagcatcta gaccttcaac agcagccaga tccatcactg cttggccaat 840

atgtttcagt ccctcaggag ttacgtcttg tgaagtgatg aacttctgga aggttgcagt 900

gttaactccg ctgtattgac gggcatatcc gtacgttggc aaagtgtggt tggtaccgga 960

ggagtaatct ccacaactct ctggagagta ggcaccaaca aacacagatc cagcgtgttg 1020

tacttgatca acataagaag aagcattctc gatttgcagg atcaagtgtt caggagcgta 1080

ctgattggac atttccaaag cctgctcgta ggttgcaacc gatagggttg tagagtgtgc 1140

aatacacttg cgtacaattt caacccttgg caactgcaca gcttggttgt gaacagcatc 1200

ttcaattctg gcaagctcct tgtctgtcat atcgacagcc aacagaatca cctgggaatc 1260

aataccatgt tcagcttgag cagaaggtct gaggcaacga aatctggatc agcgtattta 1320

tcagcaataa ctagaacttc agaaggccca gcaggcatgt caatactaca cagggctgat 1380

gtgtcatttt gaaccatcat cttggcagca gtaacgaact ggtttcctgg accaaatatt 1440

ttgtcacact taggaacagt ttctgttccg taagccatag cagctactgc ctgggcgcct 1500

cctgctagca cgatacactt agcaccaacc ttgtgggcaa cgtagatgac ttctggggta 1560

agggtaccat ccttcttagg tggagatgca aaaacaattt ctttgcaacc agcaactttg 1620

gcaggaacac ccagcatcag ggaagtggaa ggcagaattg cggttccacc aggaatatag 1680

aggccaactt tctcaatagg tcttgcaaaa cgagagcaga ctacaccagg gcaagtctca 1740

acttgcaacg tctccgttag ttgagcttca tggaatttcc tgacgttatc tatagagaga 1800

tcaatggctc tcttaacgtt atctggcaat tgcataagtt cctctgggaa aggagcttct 1860

aacacaggtg tcttcaaagc gactccatca aacttggcag ttagttctaa aagggctttg 1920

tcaccatttt gacgaacatt gtcgacaatt ggtttgacta attccataat ctgttccgtt 1980

ttctggatag gacgacgaag ggcatcttca atttcttgtg aggaggcctt agaaacgtca 2040

attttgcaca attcaatacg accttcagaa gggacttctt taggtttgga ttcttcttta 2100

ggttgttcct tggtgtatcc tggcttggca tctcctttcc ttctagtgac ctttagggac 2160

ttcatatcca ggtttctctc cacctcgtcc aacgtcacac cgtacttggc acatctaact 2220

aatgcaaaat aaaataagtc agcacattcc caggctatat cttccttgga tttagcttct 2280

gcaagttcat cagcttcctc cctaatttta gcgttcaaac aaaacttcgt cgtcaaataa 2340

ccgtttggta taagaacctt ctggagcatt gctcttacga tcccacaagg tgcttccatg 2400

gctctaagac cctttgattg gccaaaacag gaagtgcgtt ccaagtgaca gaaaccaaca 2460

cctgtttgtt caaccacaaa tttcaagcag tctccatcac aatccaattc gatacccagc 2520

aacttttgag ttcgtccaga tgtagcacct ttataccaca aaccgtgacg acgagattgg 2580

tagactccag tttgtgtcct tatagcctcc ggaatagact ttttggacga gtacaccagg 2640

cccaacgagt aattagaaga gtcagccacc aaagtagtga atagaccatc ggggcggtca 2700

gtagtcaaag acgccaacaa aatttcactg acagggaact ttttgacatc ttcagaaagt 2760

tcgtattcag tagtcaattg ccgagcatca ataatgggga ttataccaga agcaacagtg 2820

gaagtcacat ctaccaactt tgcggtctca gaaaaagcat aaacagttct actaccgcca 2880

ttagtgaaac ttttcaaatc gcccagtgga gaagaaaaag gcacagcgat actagcatta 2940

gcgggcaagg atgcaacttt atcaaccagg gtcctataga taaccctagc gcctgggatc 3000

atcctttgga caactctttc tgccaaatct aggtccaaaa tcacttcatt gataccatta 3060

ttgtacaact tgagcaagtt gtcgatcagc tcctcaaatt ggtcctctgt aacggatgac 3120

tcaacttgca cattaacttg aagctcagtc gattgagtga acttgatcag gttgtgcagc 3180

tggtcagcag catagggaaa cacggctttt cctaccaaac tcaaggaatt atcaaactct 3240

gcaacacttg cgtatgcagg tagcaaggga aatgtcatac ttgaagtcgg acagtgagtg 3300

tagtcttgag aaattctgaa gccgtatttt tattatcagt gagtcagtca tcaggagatc 3360

ctctacgccg gacgcatcgt ggccgacctg cagggggggg gggggcgctg aggtctgcct 3420

cgtgaagaag gtgttgctga ctcataccag gcctgaatcg ccccatcatc cagccagaaa 3480

gtgagggagc cacggttgat gagagctttg ttgtaggtgg accagttggt gattttgaac 3540

ttttgctttg ccacggaacg gtctgcgttg tcgggaagat gcgtgatctg atccttcaac 3600

tcagcaaaag ttcgatttat tcaacaaagc cgccgtcccg tcaagtcagc gtaatgctct 3660

gccagtgtta caaccaatta accaattctg attagaaaaa ctcatcgagc atcaaatgaa 3720

actgcaattt attcatatca ggattatcaa taccatattt ttgaaaaagc cgtttctgta 3780

atgaaggaga aaactcaccg aggcagttcc ataggatggc aagatcctgg tatcggtctg 3840

cgattccgac tcgtccaaca tcaatacaac ctattaattt cccctcgtca aaaataaggt 3900

tatcaagtga gaaatcacca tgagtgacga ctgaatccgg tgagaatggc aaaagcttat 3960

gcatttcttt ccagacttgt tcaacaggcc agccattacg ctcgtcatca aaatcactcg 4020

catcaaccaa accgttattc attcgtgatt gcgcctgagc gagacgaaat acgcgatcgc 4080

tgttaaaagg acaattacaa acaggaatcg aatgcaaccg gcgcaggaac actgccagcg 4140

catcaacaat attttcacct gaatcaggat attcttctaa tacctggaat gctgttttcc 4200

cggggatcgc agtggtgagt aaccatgcat catcaggagt acggataaaa tgcttgatgg 4260

tcggaagagg cataaattcc gtcagccagt ttagtctgac catctcatct gtaacatcat 4320

tggcaacgct acctttgcca tgtttcagaa acaactctgg cgcatcgggc ttcccataca 4380

atcgatagat tgtcgcacct gattgcccga cattatcgcg agcccattta tacccatata 4440

aatcagcatc catgttggaa tttaatcgcg gcctcgagca agacgtttcc cgttgaatat 4500

ggctcataac accccttgta ttactgttta tgtaagcaga cagttttatt gttcatgatg 4560

atatattttt atcttgtgca atgtaacatc agagattttg agacacaacg tggctttccc 4620

ccccccccct gcaggtcggc atcaccggcg ccacaggtgc ggttgctggc gcctatatcg 4680

ccgacatcac cgatggggaa gatcgggctc gccacttcgg gctcatgagc gcttgtttcg 4740

gcgtgggtat ggtggcaggc cccgtggccg ggggactgtt gggcgccatc tccttgcatg 4800

caccattcct tgcggcggcg gtgctcaacg gcctcaacct actactgggc tgcttcctaa 4860

tgcaggagtc gcataaggga gagcgtcgag tatctatgat tggaagtatg ggaatggtga 4920

tacccgcatt cttcagtgtc ttgaggtctc ctatcagatt atgcccaact aaagcaaccg 4980

gaggaggaga tttcatggta aatttctctg acttttggtc atcagtagac tcgaactgtg 5040

agactatctc ggttatgaca gcagaaatgt ccttcttgga gacagtaaat gaagtcccac 5100

caataaagaa atccttgtta tcaggaacaa acttcttgtt tcgaactttt tcggtgcctt 5160

gaactataaa atgtagagtg gatatgtcgg gtaggaatgg agcgggcaaa tgcttacctt 5220

ctggaccttc aagaggtatg tagggtttgt agatactgat gccaacttca gtgacaacgt 5280

tgctatttcg ttcaaaccat tccgaatcca gagaaatcaa agttgtttgt ctactattga 5340

tccaagccag tgcggtcttg aaactgacaa tagtgtgctc gtgttttgag gtcatctttg 5400

tatgaataaa tctagtcttt gatctaaata atcttgacga gccaaggcga taaataccca 5460

aatctaaaac tcttttaaaa cgttaaaagg acaagtatgt ctgcctgtat taaaccccaa 5520

atcagctcgt agtctgatcc tcatcaactt gaggggcact atcttgtttt agagaaattt 5580

gcggagatgc gatatcgaga aaaaggtacg ctgattttaa acgtgaaatt tatctcaaga 5640

tctctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga 5700

gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc 5760

agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg atagcggagt 5820

gtatactggc ttaactatgc ggcatcagag cagattgtac tgagagtgca ccatatgcgg 5880

tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc 5940

tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 6000

aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 6060

aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 6120

ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 6180

acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 6240

ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 6300

tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 6360

tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 6420

gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 6480

agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 6540

tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 6600

agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 6660

tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 6720

acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 6780

tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 6840

agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 6900

tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 6960

acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 7020

tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 7080

ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 7140

agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctgcagg catcgtggtg 7200

tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 7260

acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 7320

agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 7380

actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 7440

tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaacacg ggataatacc 7500

gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 7560

ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 7620

tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 7680

aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 7740

tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 7800

tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 7860

gacgtctaag aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg 7920

ccctttcgtc ttcaagaatt aattctcatg tttgacagct tatcatcgat aagctgactc 7980

atgttggtat tgtgaaatag acgcagatcg ggaacactga aaaataacag ttattattcg 8040

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 8100

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 8160

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 8220

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 8280

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 8340

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 8400

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 8460

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 8520

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt 8580

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 8640

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 8700

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 8760

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 8820

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 8880

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 8940

caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct 9000

tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact 9060

acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta 9120

gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg 9180

tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tcgagaaaag 9240

agaggctgaa gcttacgtag aattcagtac gataaacaag aagattagag gaaatcaagt 9300

agggtatgat ccagaatttg agaagatatt gattataaaa gatccaactt ctctaagata 9360

tcaattaaaa aaagatgaac aactcataga acagggaata ttaagtaaag ctactactca 9420

cccatataca cgtgaggagg attatttttg tgacctcagt catgtgaaag tagaaggtgt 9480

ttatcaatta atgatagaag atatggcggg atactttcct tttgtagtta agaaaaactg 9540

ctacgaagat ttattattaa ataccctgcg ctttttttat cttcagagat gcggagaaaa 9600

ccttccagaa gaatttgcta atgagtttca gcatagaagt tgtcacgatc agcatgctcg 9660

tatttatgga acaaatcaaa ggatttctgt aaacggtggt tggcatgatg ctggtgatta 9720

tggtcgttat atcgttgccg cagcggtgac agttgctgat ttattgttag catttgaaga 9780

aacgcacaaa atttcaactc tgaatttaag aatacctgaa agcaaattac agattccaga 9840

tttgttgagt gagattcgct atgaattgga atggatgctt tccatgcaaa atcagaataa 9900

cggacaagtt tatcataaag taacctgtgc cagtttttgt gggtttatta tgccggaaga 9960

agagcaggaa gaattagttg ttacggagcc ttcgattaca gcaaccgcaa cctttgcagc 10020

tacgactgct atggcagttg cattttatga atcttttgac aaagattttt cggaacgttt 10080

aaaacaagct tcgaaagcgg cttatgatgc attgaaggac atgcatatgc cagaagggtt 10140

taaaaatcca gatggagttg taacaggaga gtatggtgat ggaaaggata ttgacgaaag 10200

atactgggct gcagcggcat tatataaggc ttttggagaa tcaaagtatc gagaagactt 10260

tgaaacattg gccaaaaaag aagttcttca tggctatgga tgggaggaag ttggaagttt 10320

tgggaatcag gcttatctca caacagaaaa tttcccgata gatgaaaatt tacgggaaga 10380

aattcaaaaa caaatgatca aaaaagcaga tgaacttgag gaaaaaatag cgatagaacc 10440

ttatggagtt tcgttttctg aaagcgatta tatttggggc agtaatatgt atgcggcaga 10500

aaatggcaat catttatttg atgcttatag aatcacaaag aatgtcgcat atttaaatca 10560

tgcaagaagc cagctacatt atttgctagg gaaaaatcca tgcggatatt gttatgtaac 10620

tggatttggt tttttatcac caaagtaccc acatcacaga ccgtcttcgg ccgtagggaa 10680

accaatggaa ggtatgttgg ttggtggacc ggatcgtggt ctgaatgatc ccgcagcggt 10740

agaatttctt aaggatcagt cagccccatg ttgctatgta gatgatgagg gaagttattc 10800

tacaaatgaa gttaccattt actggaactc tgcactggtg tatttgttgt ctgtgctcat 10860

ttaagc 10866

Claims (3)

1. An alkaline cellulase, which is characterized in that the amino acid sequence of the alkaline cellulase is shown in SEQ ID NO. 2.

2. The alkaline cellulase of claim 1, wherein the nucleotide sequence of the alkaline cellulase is shown in SEQ ID No. 1.

3. Use of the alkaline cellulase of claim 1 or 2 for polishing textile cloth.

Images