KR101849602B1 - PNA probe for detecting causative gene mutation of Wilson disease and the method of diagnosis using the same - Google Patents

Abstract

The present invention relates to a peptide nucleic acid (PNA) probe for detecting the c.2621C> T mutation of the ATP7B gene, which is a wilson disease causative gene mutation, and a use thereof for diagnosis of Wilson's disease , The PNA probe of the present invention can perform fluorescence-melting curve analysis with a fluorescent reporter and a quencher attached to a terminal to easily discriminate whether the ATP7B gene c.2621C> T mutation, which is a Wilson's disease gene mutation, is homozygous mutant The PNA probe of the present invention and the kit for diagnosing Wilson disease comprising the PNA probe of the present invention can be usefully used as a method for identifying a mutation site to provide information on the diagnosis or prediction of risk of Wilson's disease

Description

[0001] The present invention relates to a PNA probe for detecting a Wilson disease causative gene mutation and a method for diagnosing Wilson's disease using the same,

The present invention relates to a peptide nucleic acid (PNA) probe for detecting the c.2621C> T mutation of the ATP7B gene which is a wilson disease-causing gene mutation, and a use thereof for the diagnosis of Wilson's disease .

Wilson disease (hepatolenticular degeneration) is an autosomal recessive inherited disorder caused by deposition of copper taken from food due to congenital copper metabolism disorder in the liver, brain, cornea, kidney, and red blood cells. Of the total number of patients.

In a national survey of the clinical characteristics and prevalence of Wilson's disease in Korea at the Korea Hepatic Association in 2004, more than 500 patients with Wilson's disease were identified and some patients with missing Wilson's disease . Therefore, Wilson's disease is a rare disease that emphasizes the importance of early diagnosis and treatment of patients in terms of society and national policy.

The causative gene of Wilson's disease is located at the chromosome 13q14.3-q21.1 and is known to be caused by a mutation of ATP7B (ATPase, Cu ++ transporting, beta polypeptide) gene encoding a copper-carrying P-type ATPase protein. The gene of a patient with Wilson's disease is 57% of the nucleotide sequence of meningococcal disease, a reproductive genetic disease that causes copper-deficiency disorder due to copper metabolism disorder.

In the case of Wilson's disease, a mutation of the ATP7B gene causes an abnormality in the copper-carrying P-type ATPase protein, an enzyme involved in the absorption of copper, so that copper can not be released into the microbial cells in hepatocytes, And the free radicals (free readical) due to copper ions cause oxidative damage or neurological symptoms in the organs due to copper ions, .

 Because Wilson's disease is inherited by autosomal recessive, a patient with a 25% chance of birth can be born if both parents are present. Wilson's disease is a rare disease, but it is one of the most common genetic diseases in Korea in the last 10 years. Therefore, the importance of early diagnosis and subsequent treatment of Wilson's disease is emphasized.

In the diagnosis of Wilson's disease, a technique for diagnosing Wilson's disease by measuring the concentration of celluloplasmin in blood, which can be clinically or biochemically diagnosed, has recently been developed. However, the measurement of celluloplasmin concentration is still sufficient Patients with early Wilson disease who do not appear have difficulty in making accurate diagnosis and can not identify the donor. Therefore, molecular diagnostics can be used for the early diagnosis of Wilson's disease or the identification of the recipient. Molecular genetic diagnosis is to detect mutations of the ATP7B gene, which can identify gene abnormalities in about 80% of patients and can be helpful in confirming clinical and biochemical diagnosis.

Causes of Wilson's Disease As gene mutations, there are many types of ATP7B mutations reported worldwide, and there are differences between countries and species. Especially in Korea, three of c.2333G> T (p.R778L), c.2621C> T (p.A874V) and c.3809A> G (p.N1270S) account for more than 50% of total mutant alleles It is known. (P.G1186S), c.3257C > T (p.L1083F), and c.3556G > T (p.G1186S) To 8%. Thus, by analyzing these mutations, more than 60% of Wilson's disease can be diagnosed. However, in the case of the c.2621C> T (p.A874V) mutation, it is difficult to produce a probe in order to use the real-time PCR detection method due to the repeated sequence in the G base, Since it is a difficult mutation, it is required to develop a probe capable of effectively diagnosing c.2621C> T mutation and a diagnostic method using the same.

Peptide nucleic acids (PNA) is an artificially synthesized DNA analogue with polyamide as the basic backbone as one of the gene recognition materials. PNA has strong affinity with DNA or RNA and has very good affinity and selectivity. It has the advantage of high stability against nucleic acid degrading enzyme such as not being degraded by existing restriction enzymes I have. In addition, it has high thermal and chemical properties and stability, which makes it easy to store and is used for various base sequence analysis.

Melting arrays have been developed using these features. The fusion analysis method is an analytical method for distinguishing genotypes of genomic SNPs or insertion / deletion (Indel) using PNA. Since PNA is more tightly bound to DNA than DNA (DNA-DNA) when bound to DNA (PNA-DNA), only one base is found between the PNA probe and its complementary DNA base sequence match), it shows a characteristic showing a difference in the Melting Temperature (Tm) value by a large width of about 10 to 15 ° C. Using these characteristics, it is expected that the presence of mutation sequence of a gene can be easily detected using a PNA probe and a real-time PCR device manufactured by combining a fluorescence reporter and a quencher at both ends have.

Accordingly, the present inventors have made efforts to develop a probe capable of efficiently diagnosing the ATP7B gene c.2621C> T mutation as a Wilson's disease-causing gene mutation and a diagnostic method using the same, and as a result, the ATP7B gene c.2621C> T mutation can be detected And a PNA probe having a fluorescence reporter and a quencher attached to its end was designed. The PNA probe is different from the ATP7B gene in the presence or absence of homozygous mutant or heterozygous mutant of c.2621C> T mutation Melting temperature, and completed the present invention.

Accordingly, the present inventors have completed the present invention by developing a peptide nucleic acid (PNA) probe for detecting the c.2621C> T mutation of the ATP7B gene, which is a gene mutation of Wilson disease.

Accordingly, an object of the present invention is to provide a PNA probe for detecting gene mutation caused by wilson disease.

Still another object of the present invention is to provide a kit for the diagnosis of Wilson's disease.

It is still another object of the present invention to provide a method for identifying a mutation site for providing information on the diagnosis or prediction of the risk of onset of Wilson's disease.

In order to accomplish the above object, the present invention provides a peptide nucleic acid (PNA) probe for detecting gene mutation that causes Wilson disease comprising the nucleotide sequence of SEQ ID NO: 5.

According to another preferred embodiment of the present invention, the Wilson's disease-causing gene mutation may be the c.2621C> T (p.A874V) mutation of the ATP7B gene.

According to another preferred embodiment of the present invention, the PNA probe may have a fluorescent reporter and a quencher at its ends.

The present invention also includes a Wilson disease diagnostic kit comprising the PNA probe and a primer pair complementary to and capable of amplifying the ATP7B gene.

According to another preferred embodiment of the present invention, the primer pair may be a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4.

The present invention also relates to

i) isolating genomic DNA from a sample derived from an individual;

ii) amplifying the ATP7B gene from the genomic DNA isolated in step i);

iii) hybridizing the ATP7B gene amplified in step ii) with the PNA probe of the present invention;

iv) analyzing a melting curve of the hybridized gene in step iii); And

v) determining a heterozygous mutation in the ATP7B gene when the temperature of a melting curve analysis in said step iv) is determined as a homozygous mutant of the ATP7B gene when 45 to 49 ℃, and 45 to 49 ℃ and from 59 to 63 ℃ A method for identifying a mutation site to provide information on the diagnosis or risk prediction of Wilson's disease.

According to another preferred embodiment of the present invention, the sample of step i) may be at least one selected from the group consisting of human sputum, blood, saliva, and urine.

According to another preferred embodiment of the present invention, the amplification of step ii) may be carried out with the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4.

According to another preferred embodiment of the present invention, the amplification of step ii) may be performed by a real-time PCR (RT-PCR) method.

According to another preferred embodiment of the present invention, the analysis of step iv) may be fluorescence melting curve analysis (FMCA).

According to another preferred embodiment of the present invention, the mutation of the step v) may be the c.2621C> T mutation of the ATP7B gene.

Accordingly, the present invention provides a kit for detecting Wilson disease including a peptide nucleic acid (PNA) probe for detecting the c.2621C> T mutation of the ATP7B gene, a Wilson disease-causing gene mutation, a PNA probe, Provides a method for diagnosing Wilson's disease.

The PNA probe of the present invention can accurately and easily diagnose the c.2621C> T mutation of the ATP7BATP7B gene which is difficult to accurately diagnose by the conventional molecular diagnostic method, so that it is effective for the early diagnosis of Wilson's disease and the carrier diagnosis.

FIG. 1 shows the nucleotide sequence analysis results related to the ATP7B gene, which is a gene causing Wilson's disease, and shows the positions for preparing the primers and PNA probes according to the present invention.
Fig. 2 shows amplified DAN containing the Wilson's disease ATP7B gene sequence, which is the target nucleic acid in the wild type and homozygous mutant, and the position where the PNA probe binds to the target nucleic acid.
Figure 3 shows the temperature and time conditions of fluorescence melting curve analysis (FMCA) using real-time PCR and PNA probes for Wilson disease discrimination.
FIG. 4 is a schematic diagram showing the results of matching the Ct value with SYBR in order to adjust the gene synthetic material corresponding to the normal gene and the heterozygous mutant according to the present invention to a concentration similar to that of HeLa gDNA.
Figure 5 shows the fluorescence melting curve using the PNA probe of the present invention; The blue line is a normal gene sample, the red line is a homozygous mutant sample; Green lines represent heterozygous mutated samples.

Hereinafter, the present invention will be described in more detail.

As described above, there have been no studies on probes capable of accurately and easily diagnosing ATP7B gene c.2621C> T mutations that are difficult to accurately diagnose as Wilson's disease causative gene mutations and diagnostic methods using the same.

The present invention can accurately and easily diagnose the c.2621C> T mutation of the ATP7B gene, which is difficult to accurately diagnose by a conventional molecular diagnostic method, and thus is effective for the early diagnosis of Wilson's disease and the diagnosis of the carrier.

Accordingly, the present invention provides a peptide nucleic acid (PNA) probe for detecting gene mutation caused by wilson disease comprising the nucleotide sequence of SEQ ID NO: 5.

The "Wilson's disease-causing gene mutation" of the present invention is preferably, but not limited to, the c.2621C> T (p.A874V) mutation of the ATP7B gene. The c.2621C> T mutation of the ATP7B gene is a nucleotide sequence variation in which the 2621th nucleotide sequence from the transcription start point of the ATP7B gene is replaced with a cytidine to thymine.

The "PNA probe" of the present invention preferably has a fluorescent reporter and a quencher at its ends. More specifically, a fluorescent reporter binds to the 5 'end of the PNA sequence and a quencher is attached to the 3' , But is not limited thereto.

The fluorescent reporter is composed of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) and CY5 And more preferably FAM (6-carboxyfluorescein). However, it is not limited thereto, and any material can be used as long as it is a substance known and used in the art as a fluorescent reporter material.

The quencher is preferably at least one selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2 and dabcyl, and more preferably Dabcyl, but is not limited thereto. It is possible to use it if it is a substance which is known and used as a small photon.

In a particular embodiment of the present invention, the inventors have found that Wilson's disease caused as a base sequence of the mutant gene DAN samples containing c.2621C> T mutation nucleotide sequence position of the ATP7B gene (SEQ ID NO: 2), and normal base sequence of the ATP7B gene DNA A sample (SEQ ID NO: 1) was prepared (Fig. 1). Further, a forward primer (SEQ ID NO: 3) and a reverse primer (SEQ ID NO: 4) for amplifying the DNA sample were prepared.

In addition, the sequence of the target nucleic acid is determined using the SNP portion of the normal gene and the c.2621C> T base mutation gene sequence, and dabcyl is labeled at the 5'end and FAM is labeled at the 3'end A PNA probe (SEQ ID NO: 5) was prepared for analyzing the sequence of the base mutation position.

The present inventors also performed fluorescence melting curve analysis (FMCA) to confirm whether or not the presence of the c.2621C> T mutation in the ATP7B gene can be effectively determined using the PNA probe of the present invention. As a result, c .2621C> T according to whether or not to transition occurs the difference in the melting temperature (T _m), the melting temperature of the normal gene is 61 ℃, homozygous c.2621C> melting temperature T of the mutant gene was confirmed to be 47 ℃ ( 5).

Therefore, the PNA probe of the present invention can easily discriminate the presence of c.2621C> T mutation of the ATP7B gene, which is a Wilson's disease mutation gene mutation, through the melting temperature of the melting curve, and can easily discriminate homozygous mutant and heterozygous mutant mutations Therefore, the PNA probe of the present invention can be usefully used for detecting Wilson's disease-causing gene mutation.

The present invention also provides a kit for the diagnosis of Wilson's disease comprising a PNA probe according to the present invention and a pair of primers complementary to the ATP7B gene and capable of amplifying the same.

The primer pair of the present invention is preferably a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, but is not limited thereto. It may be complementary to the ATP7B gene, It is possible to use any pair of primers designed to amplify a sequence containing the 2621st nucleotide sequence.

The PNA probe of the present invention can easily discriminate the presence of the c.2621C> T mutation in the ATP7B gene sequence amplified as a primer pair in the sample through the melting temperature of the fusion curve, and can easily detect homozygous mutant and heterozygous mutant mutations Therefore, the Wilson disease diagnostic kit of the present invention can be useful for detecting Wilson's disease-causing gene mutation.

In addition,

i) isolating genomic DNA from a sample derived from an individual;

ii) amplifying the ATP7B gene from the genomic DNA isolated in step i);

iii) hybridizing the ATP7B gene amplified in step ii) with the PNA probe of claim 1;

iv) analyzing a melting curve of the hybridized gene in step iii); And

v) determining a heterozygous mutation in the ATP7B gene when the temperature of a melting curve analysis in said step iv) is determined as a homozygous mutant of the ATP7B gene when 45 to 49 ℃, and 45 to 49 ℃ and from 59 to 63 ℃ A method for identifying a mutation site for providing information on the diagnosis or risk prediction of Wilson's disease.

The "sample" of step i) of the present invention is preferably at least one selected from the group consisting of human sputum, blood, saliva, and urine, but is not limited thereto.

The amplification in step ii) of the present invention is preferably amplified by the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4, but is not limited thereto. It may be complementary to the ATP7B gene, The primer pair constructed so as to amplify the sequence including the 2621st nucleotide sequence from the primer pair can be used.

The "amplification" of step ii) of the present invention is preferably, but not exclusively, performed by a real-time PCR (RT-PCR) method.

The "analysis" of step iv) of the present invention is preferably but not limited to fluorescence melting curve analysis (FMCA).

In the fluorescence melting curve analysis, analysis can be performed by a fluorescent reporter and a small photon bonded to both ends of the PNA probe of the present invention. Fluorescent reporters emit fluorescent signals after hybridizing with the target nucleic acid of the present invention, and rapidly melt with the target nucleic acid at the melting temperature of the PNA probe as the temperature rises, so that the fluorescence signal is extinguished by the small photon at the PNA end . The presence or absence of a target nucleic acid or a mutation sequence can be detected through a high-resolution melting curve analysis obtained from the fluorescence signal at such a temperature change.

The "mutation" in step v) of the present invention is preferably the c.2621C> T mutation of the ATP7B gene.

The PNA probe of the present invention can easily discriminate the presence of the c.2621C> T mutation in the ATP7B gene sequence amplified as a primer pair in the sample through the melting temperature of the fusion curve, and can easily detect homozygous mutant and heterozygous mutant mutations The PNA probe of the present invention and the kit for diagnosing Wilson disease comprising the same can be usefully used as a method for identifying a mutation site to provide information on the diagnosis or prediction of the risk of onset of Wilson's disease.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Wilson bottle (Wilson disease)  The nucleotide sequence of the causative gene and the peptide nucleic acid (PNA) Of the probe  making

1-1) ATP7B  Generation of normal and base mutation sequences of genes

In order to prepare a sample to replace the sample of Wilson's disease in the present invention, a nucleotide sequence comprising the nucleotide sequence of the ATP7B gene or the nucleotide sequence for c.2621C> T (p.A874A) was prepared. The normal nucleotide sequence and the c.2621C> T base mutation sequence were prepared as shown in Table 1 below, and one base of the base mutation sequence was prepared to be C> T. After calculating the correct copy number, .

A comparison was made between the prepared normal nucleotide sequence and the c.2621C> T base mutation sequence to confirm a single nucleotide polymorphism (SNP) site showing significance, and a PNA probe and a portion usable for producing bidirectional primers (Fig. 1). Sequences of the forward primer and the reverse primer were designed as shown in Table 2 below to prepare a primer.

Sequence of ATP7B normal gene sample and c.2621C> T base mutation sequence sample SEQ ID NO: Synthetic gene name The sequence (5 '- > 3')
SEQ ID NO: 1
Normal gene TATCATAGCAGCTGTCAGGTCACATGAGTGCTGGATGGGGCTGAGCAAGTGACAGTTGTCTCTTTCCTACGTCTAGGAGAAGCCATGCCAGTCACTAAGAAACCCGGAAGCACTGTAATTG C GGGGTCTATAAATGCACATGGCTCTGTGCTCATTAAAGCTACCCACGTGGGCAATGACACCACTTTGGCTCAGATTGT
SEQ ID NO: 2
Homozygous mutation TATCATAGCAGCTGTCAGGTCACATGAGTGCTGGATGGGGCTGAGCAAGTGACAGTTGTCTCTTTCCTACGTCTAGGAGAAGCCATGCCAGTCACTAAGAAACCCGGAAGCACTGTAATTG T GGGGTCTATAAATGCACATGGCTCTGTGCTCATTAAAGCTACCCACGTGGGCAATGACACCACTTTGGCTCAGATTGT

The sequence of the primer for amplifying the gene sample of the present invention SEQ ID NO: Primer name The sequence (5 '- > 3') SEQ ID NO: 3 c.2621C> T_F  CAGGTCACATGAGTGCTGGATG SEQ ID NO: 4 c.2621C> T_R  GTGGTGTCATTGCCCACGTG

1-2) ATP7B  Production of fluorescent peptide nucleic acid specific for gene base mutation site

In order to perform the melting curve analysis using the binding fluorescent peptide nucleic acid of the present invention, a fluorescent peptide nucleic acid capable of specifically binding to the position of the c.2621C> T mutant sequence was prepared.

The sequence of the target nucleic acid is determined by using the SNP portion of the normal gene and the c.2621C> T base mutation gene sequence, and a dapcyl which is a quencher is labeled at the 5 'end and a reporter ( 6-carboxyfluorescein (FAM), which is a reporter, was designed to be labeled so as to prepare a PNA probe having the sequence shown in Table 3 below. PNA probes were synthesized by HPLC (high performance liquid chromatography) purification method from Panagene (Korea) and the purity of all synthesized probes was confirmed by mass spectrometry. Sequence design was designed so that unnecessary secondary structure of PNA is not generated for effective binding with target nucleic acid.

Further, in order to optimize the fusion temperature (T _m ), the nucleotide sequence of the amelogenin gene is located in the central portion of the PNA sequence associated with the PNA probe, so that the PNA probe is complementary to the central portion of the target nucleic acid .

The sequence of the PNA probe for detecting the c.2621C > T base sequence mutation of the ATP7B gene, which is a Wilson disease causative gene SEQ ID NO: Probe Name The sequence (5 '- > 3') SEQ ID NO: 5 c.2621C> T_probe  Dabcyl-TAA TTG CGG GGT C-O-K (FAM)

O is a linker and K is a lysine amino acid residue.

ATP7B  The fluorescence melting curve analysis for discrimination of the c.2621C> T base sequence mutation of the gene (fluorescence melting curve analysis, FMCA ) Perform

FMCA analysis was performed to confirm whether the c.2621C> T base sequence of the ATP7B gene, one of the causative gene mutations of Wilson's disease, can be effectively discriminated using the PNA probe of the present invention.

Specifically, the normal nucleotide sequence of the ATP7B gene prepared in Example 1-1 was prepared as a normal gene sample, and the c.2621C> T base mutation sequence was prepared as a homozygous mutant sample. In addition, the normal nucleotide sequence and the c.2621C> T base mutation sequence were mixed at a ratio of 5: 5 to prepare a heterozygous mutant sample. Then, 3 占 퐇 (15 ng / 占 퐇) of the prepared normal gene sample, homozygous mutant sample or heterozygous mutant sample was dissolved in 10 占 퐇 of 2 占 qPCR PreMix (Seed Biomaterials, Korea) (10 pmole) of the forward primer c.2621C> T_F, 10 pmole of the reverse primer c.2621C> T_R, and 0.5 μl of the PNA probe c.2621C> T_probe prepared in the above Example 1-2 10 pmole), and samples of real-time PCR were prepared by adding distilled water to a total volume of 20 μl.

Each of the prepared normal gene samples, homozygous mutant samples, or heterozygous mutant samples was subjected to real-time PCR amplification and melting curve analysis under the conditions shown in FIG. 3 in the CFX96 ™ Real-Time system (BIO-RAD, USA) . Real-time PCR amplification was performed at 95 ° C for 10 minutes, followed by reaction at 95 ° C for 30 seconds, 58 ° C for 45 seconds, and 72 ° C for 45 seconds. This procedure was repeated 42 times. Respectively. After the real-time PCR amplification was completed, a dissolution curve analysis was performed to measure the fluorescence while changing the dissolution temperature. The dissolution curve analysis conditions were a denaturation step at 95 ° C for 5 minutes, hybridization at 35 ° C for 5 minutes, and a dissolution curve analysis to measure fluorescence by increasing the temperature from 20 ° C to 85 ° C by 0.5 ° C. The stationary state was maintained for 5 seconds between each step. All tests were measured in one well per sample and no further manipulations were required.

As a result, as shown in FIG. 5, a difference in melting temperature (T _m ) occurred according to the c.2621C> T mutation of the ATP7B gene, which is the causative gene of Wilson's disease, and the melting temperature of the normal gene was 61 ° C., It was confirmed that the fusion temperature of the junctional c.2621C> T mutant gene was 47 ° C (FIG. 5). The melting temperature indicated by the DNA containing the amplified ATP7B gene sequence corresponding to the target nucleic acid and the DNA comprising the PNA probe bound thereto is as shown in Table 4 below and the respective melting temperatures according to the base mutation are completely And the same results were obtained.

Melting temperature of ATP7B gene with or without c.2621C> T mutation Variant type Gene mutation The melting temperature (Tm) Normal gene c.2621C 61 ℃ Homozygous mutation c.2621T 47 C Heterozygous mutation c.2621C / T 47 ° C / 61 ° C

Using fluorescence melting curve analysis ATP7B  Identification of c.2621C> T mutation in the gene

Based on the results shown in Example 2, in order to confirm whether the normal gene or the mutated gene in the sample can be effectively discriminated according to the fluorescence melting curve analysis using the PNA probe, the range of the melting temperature was determined and the fluorescence melting curve analysis was performed Respectively.

Specifically, based on the difference in the melting temperature with or without the c.2621C> T mutation of the ATP7B gene identified in Example 2, the fluorescence of the PNA probe in the fluorescence melting curve analysis The final melting temperature was determined considering the temperature error range. A high melting temperature can be observed for normal genes and a low melting temperature for homozygous mutant genes. Next, real-time PCR analysis and fluorescence melting curve analysis were performed at the fusion temperature condition shown in Table 5 below in the same manner as in Example 2 to determine the range of the melting temperature with and without the c.2621C> T mutation of the ATP7B gene Respectively.

As a result, it was confirmed that the normal gene sample, the homozygous mutant sample, and the heterozygous mutant sample can be classified into the range of the set melting temperature.

Melting temperature range set according to presence or absence of c.2621C> T mutation of ATP7B gene Variant type Gene mutation The melting temperature (Tm) Normal gene c.2621C 59 to 63 ° C Homozygous mutation c.2621T 45 to 49 ° C Heterozygous mutation c.2621C / T 45 to 49 ° C
59 to 63 ° C

<110> Pai Chai University Industry-Academic Cooperation Foundation <120> PNA probe for detecting causative gene mutation of Wilson disease          and the method of diagnosis using the same <130> 1060555 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 200 <212> DNA <213> Homo sapiens <220> <221> gene &Lt; 222 > (1) .. (200) <223> ATP7B <400> 1 tatcatagca gctgtcaggt cacatgagtg ctggatgggg ctgagcaagt gacagttgtc 60 tctttcctac gtctaggaga agccatgcca gtcactaaga aacccggaag cactgtaatt 120 gcggggtcta taaatgcaca tggctctgtg ctcattaaag ctacccacgt gggcaatgac 180 accactttgg ctcagattgt 200 <210> 2 <211> 200 <212> DNA <213> Homo sapiens <400> 2 tatcatagca gctgtcaggt cacatgagtg ctggatgggg ctgagcaagt gacagttgtc 60 tctttcctac gtctaggaga agccatgcca gtcactaaga aacccggaag cactgtaatt 120 gtggggtcta taaatgcaca tggctctgtg ctcattaaag ctacccacgt gggcaatgac 180 accactttgg ctcagattgt 200 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> c.2621C> T_F <400> 3 caggtcacat gagtgctgga tg 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> c.2621C> T_R <400> 4 gtggtgtcat tgcccacgtg 20 <210> 5 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> c.2621C> T_probe <400> 5 taattgcggg gtc 13

Claims (11)

A peptide nucleic acid (PNA) probe for detecting c.2621C> T (p.A874V) mutation of ATP7B gene, which is a gene mutation for Wilson disease including the nucleotide sequence shown in SEQ ID NO: ).
delete The PNA probe according to claim 1, wherein the PNA probe has a fluorescent reporter and a quencher at its ends, and the c.2621C > T (p.A874V ) PNA probes for mutation detection.
A kit for the diagnosis of Wilson disease comprising the PNA probe of claim 1 and a primer pair complementary to and capable of amplifying the ATP7B gene.
5. The kit for diagnosing Wilson's disease according to claim 4, wherein the primer pair is a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4.
i) isolating genomic DNA from a sample derived from an individual;
ii) amplifying the ATP7B gene from the genomic DNA isolated in step i);
iii) hybridizing the ATP7B gene amplified in step ii) with the PNA probe of claim 1;
iv) analyzing a melting curve of the hybridized gene in step iii); And
v) A homozygous mutant of c.2621C> T mutation in the ATP7B gene is judged to be a mutation of homozygous mutant in the ATP7B gene when the temperature range of the melting curve analyzed in the above step iv) is 45 to 49 ° C, and when ATP7B A mutation site identification method for providing information on the diagnosis or risk prediction of Wilson's disease, including a step of judging the mutation of the c.2621C &gt; T mutation in the gene as a heterozygous mutation.
7. The method according to claim 6, wherein the sample of step i) is at least one selected from the group consisting of human sputum, blood, saliva and urine. How to identify sites.
7. The method according to claim 6, wherein the amplification of step ii) is carried out using the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4 to provide information on the diagnosis or prediction of the risk of Wilson's disease A method for identifying a mutation site for the mutation site.
7. The method according to claim 6, wherein the amplification of step ii) is performed by a real-time PCR (RT-PCR) method. Identification of mutant sites for.
7. The method according to claim 6, wherein the analysis of step iv) is fluorescence melting curve analysis (FMCA).
delete

Images