KR101810786B1 - PNA probe set for detecting Kudoa septempunctata - Google Patents

Abstract

The present invention relates to a PNA probe set for detecting a Kudoa septempunctata, including a specific peptide nucleic acid (PNA) probe in a Kudoa septempunctata gene. More specifically, the PNA probe is a PNA probe set of one among sequence numbers 3 to 5. Real-time PCR is conducted by using the PNA probe set, and thus, the present invention is able to be used for determining or detecting infection by a Kudoa septempunctata.

Description

PNA probe set for detection of Kudo achiosis {PNA probe set for detecting Kudoa septempunctata}

The present invention relates to a process for the production of Kudoa The present invention relates to a PNA probe set for detecting a Cuddly-aphakia which comprises a PNA (peptide nucleic acid) probe specific for a septempunctata gene.

The mushroom spider mites of Genus Kudoa are characterized by having four or more polar capsules and more than 90 species have been reported worldwide. Some species are parasitic to the fishes of the marine fishes but parasitic on the brain, heart, kidneys, ovaries, etc., and most are harmless (Yokoyama et al. 2012).

In recent years, in Japan, the cause of food poisoning has been unknown, and during the epidemiological survey, the flounder ( Paralichthys were Kudo Oh chungyi parasitic on muscles olivaceus) newly discovered, named Kudoa septempunctata (Matsukane et al. 2010 ), another Kudo ah over chunggwa is a certain concentration difficult to diagnose because the naked eye whether the infection is not confirmed, unlike Kudo ahchung (K . septempunctata) If hayeoteul reproductive infected flounder is reported that a person can cause food poisoning like symptoms (Sugita-Konishi et al. 2014 ), it is considered very important in the food hygienic aspects.

Flounder is a major aquaculture industry that accounts for more than half of the total production of marine fish culture in the country, and about 10% of its output is exported to Japan. In Japan, Kudoa , a parasitic flounder that is exported from Korea, septempunctata ) caused by food poisoning has been reported every year. As a result of strengthened safety management such as quarantine, exports of Japanese flounder are sharply decreasing. In order to minimize consumers' anxiety and to increase the consumption and export of domestic flounder, Kudo insects are increasingly being consumed due to consumer anxiety due to Kudo achi, which is parasitic on flounder, Appropriate prevention and control measures are needed.

In the case of the PCR method, which is mainly used for the diagnosis of Kudo-ace, there are many cases in which nonspecific bands are generated. Therefore, additional diagnostic methods such as sequencing are necessary. In order to overcome this problem, we have developed a method for detecting LAMP (Loop-mediated isothermal amplification) with high specificity and detection sensitivity (Jeon et al. 2014) , The flounder can be exported to Japan, and the recently developed LAMP method is being used in a limited manner. Therefore, it is necessary to develop a new diagnostic method that can satisfy the standards of the Japanese quarantine authorities and can be used for the examination of the Kudoa worm of domestic flounder.

1. Korea Patent No. 1609451 2. Korean Patent No. 1531296

1. Kor J Fish Aquat Sci 47 (5), 611-621, 2014

An object of the present invention is Kudo ahchung (Kudoa septempunctata gene-specific PNA (peptide nucleic acid) probe.

It is still another object of the present invention to provide a kit for detecting Kudoa septempunctata containing the probe set.

It is still another object of the present invention to provide a method for detecting DNA, comprising: (a) separating DNA from an object sample; (b) amplifying the target sequence by performing PCR (polymerase chain reaction) using the separated DNA as a template; (c) injecting the amplified product with a set of PNA probes according to any one of claims 1 to 5 and performing real-time PCR; (d) obtaining a melting curve by the real-time PCR; And (e) detecting a melting temperature of the melting curve to detect a Kudo athlete's mushroom.

In order to achieve the above object, the present invention Kudo ahchung (Kudoa The present invention provides a set of PNA probes for detection of Kudo athymia comprising a PNA (peptide nucleic acid) probe specific for the septempunctata gene.

In one embodiment of the present invention, the PNA probe may be any one selected from the group consisting of SEQ ID NOS: 3 to 5.

In one embodiment of the present invention, the PNA probe may further comprise a reporter molecule and a quencher molecule.

In one embodiment of the present invention, the reporter material is selected from the group consisting of 6-carboxyfluorescein, HEX (2 ', 4', 5 ', 7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, TRITC (tetramethyl rhodamine isothiocyanate), FITC (fluorescein isothiocyanate), Oregon green, , Alexa Fluor, JOE (6-carboxy-4 ', 5'-dichloro-2', 7'-dimetoxyfluorescein), ROX (6-carboxy-X- rhodamine), Texas Red, TET (2 ', 7'-dichloro-6-carboxy-4,7-dichlorofluorescein), TAMRA (N, N, N', N'-tetramethyl-6-carboxyrhodamine), cyanine dyes and cydicarbos And thiadicarbocyanine dyes.

In one embodiment of the present invention, the minerals are selected from the group consisting of Dabcyl (dimethylaminoazobenzenesulfonic acid), Black Hole Quencher, Qxl quencher, Iowa black FQ, Iowa black RQ black RQ), IRDye QC-1, Deep Dark Quencher, Blackberry Quencher, ECLIPSE Quencher, and TAMRA quencher. have.

In addition, the present invention provides a kit for detecting Kudoa septempunctata comprising the probe set.

Further, the present invention provides a method for detecting a DNA fragment, comprising the steps of: (a) separating DNA from a target sample; (b) amplifying the target sequence by performing PCR (polymerase chain reaction) using the separated DNA as a template; (c) injecting the amplified product with a set of PNA probes according to any one of claims 1 to 5 and performing real-time PCR; (d) obtaining a melting curve by the real-time PCR; And (e) detecting a melting temperature of the melting curve to detect a Kudo athlete's womb.

In one embodiment of the present invention, the PCR in step (b) may be performed using a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2.

In one embodiment of the present invention, the melting curve of step (d) may be obtained by measuring fluorescence intensity relative to temperature by measuring fluorescence intensity while increasing temperature.

In one embodiment of the present invention, the fluorescence intensity may be measured while increasing the temperature from 40 캜 to 85 캜.

In one embodiment of the present invention, if the melting temperature is 58 ° C to 62 ° C, it may be determined to be Kudo achitosan.

According to the present invention, Kudoa septempunctata) Kudo in an animal, such as detection of quickly and accurately flatfish by performing real-time PCR using a PNA probe set for ahchung (Kudoa septempunctata) may be useful to determine or detect whether infection.

Fig. 1 is a cross- The nucleotide sequence of the 28S rDNA region of septempunctata (KS) and similar species was analyzed.
Figure 2 shows the Oligo test conditions for PNA probe verification.
FIG. 3 is Kudoa The results of the verification of the PNA probe for detecting the septempunctata (KS) are shown.
4 is Kudoa The experimental conditions for applying a PNA probe for detecting septempunctata (KS) to a sample are shown.
FIG. 5 is a cross- (Tm) curve after application of the PNA probe for detection of septempunctata (KS) to the sample.
FIG. 6 is a cross- The sensitivity of the PNA probe for detecting septempunctata (KS) was tested.
Figure 7 shows the results of real-time PCR using a PNA probe, Kudoa septempunctata (KS) detection criterion.

The term "PNA (peptide nucleic acids)" of the present invention is one of gene recognition materials such as LNA (Locked nucleic acid) and MNA (Morpholino nucleic acid) and is artificially synthesizable. . PNA has very good affinity and selectivity and is highly stable against nucleic acid degrading enzymes and thus is not degraded into existing restriction enzymes. In addition, it has the advantage of being easy to store and not to be easily decomposed because of high thermal / chemical property and stability. The PNA-DNA binding ability is much better than the DNA-DNA binding force, and the melting temperature can be varied by 10 to 15 ° C even in a single nucleotide miss match. This difference in binding force can be used to identify changes in nucleotide SNP (single nucleotide polymorphism) and insertion / deletion nucleotides. The Tm value is also changed depending on the nucleotide sequence of the DNA complementary to the nucleotide of the PNA probe, and the application thereof is actively performed.

The term "hybridization method" of the present invention uses FMCA (Fluorescence Melting Curve Analysis), and the FMCA analyzes the difference in binding force between a product made after completion of the PCR reaction and a putative probe by Tm. Unlike other SNP detection probes, they are constructed using 9-15 mer sequences including SNPs. Therefore, in order to design a probe having a desired Tm value, the Tm value can be adjusted by adjusting the Tm value according to the length of the PNA probe or by varying the probe sequence with the same length of the PNA probe. Because PNA has better binding ability than DNA, it has a basic Tm value, so it can be designed shorter than DNA, so it can detect SNPs that are close to each other.

For SNP analysis using PNA probes, it is possible to use a probe with a base containing a SNP and a Forward / Reverse primer set for PCR. The PCR conditions can be used as it is, and the melting process is required after the PCR is completed. The Tm value is obtained by measuring the intensity of fluorescence every 1 ° C. It is possible to measure all of them with a general real-time PCR device, and there is an advantage that additional programs such as HRM (High Resolution Melting) are not purchased and detailed temperature change is not required.

The technical methods for optimization of the results Liquid type MeltingArray ^TM Method and U-TOP ^TM (Universal Temperature of PNA) method, a hybridization process using a probe coupled with a reporter and a quencher to effectively detect the substitution of the base sequence of the target nucleic acid and the deletion or insertion of the base And a liquid-phase array method that does not require the probe to be fixed to the plate.

The kit of the present invention is characterized by high specificity Kudoa In order to detect septempunctata , we used PNA (peptide nucleic acid) to block the false-positive reaction with Sukjudaeae and to maximize the specificity of the method. The Japanese authorities (Ministry of Fisheries and Ministry of Health, 2012) I use the same target region and a base sequence presented in the inspection manual of the Kudo ahchung (Kudoa septempunctata) for the export-one halibut Kudo ahchung the domestic and export halibut (Kudoa septempunctata ). In addition, the more specific Kudoa for the specific detection of septempunctata), it demonstrated the specificity of the analogous species (iwatai K., K. lateolabracis, by experiment in K. thyrsites) Kudo ahchung (Kudoa septempunctata) detection kit.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

Example  One. Kudo Achitu ( Kudoa septempunctata ; KS) for detection primer  And Probe ≪ / RTI &

Kudoa septempunctata ; KS) was constructed in the same manner as the previously reported target site (Japan Fisheries Agency, 2012; Grabner et al. 2012). For the specific detection, the nucleotide sequence of the 28S rDNA region for five species of Kudo aster (Fig. 1).

As a result, there were various base sequences capable of discriminating KS, and based on this, PNA probes capable of specific detection were prepared. For the samples used in the experiments, Kudoa septempunctata (KS), Kudoa iwatai (KI), Kudoa lateolabracis (KL) and Kudoa thyrates (KT) genomic DNAs were used (Table 1).

No. Name PNA probe sequence (5'-3 ') One KS-F (Forward primer) GTGTGTGATCAGACTTGATATG (SEQ ID NO: 1) 2 KS-R (Reverse primer) AAGCCAAAACTGCTGGCCATTT (SEQ ID NO: 2) 3 KS PNA-1 (PNA probe) Dabcyl-TTTCAAATGAGATTGTG-O- (HEX) (SEQ ID NO: 3) 4 KS PNA-2 (PNA probe) Dabcyl-GTTGAGTGGAATG-O- (HEX) (SEQ ID NO: 4) 5 KS PNA-3 (PNA probe) Dabcyl-GTCAGGGCTATT-O- (HEX) (SEQ ID NO: 5) 6 KS PNA-1-PM (Oligo) CACAATCTCATTTGAAA (SEQ ID NO: 6) 7 KS PNA-2-PM (Oligo) CATTCCACTCAAC (SEQ ID NO: 7) 8 KS PNA-3-PM (Oligo) AATAGCCCTGAC (SEQ ID NO: 8)

PNA probes are Kudoa Septempunctata (KS) detection was designed directly. All PNA probes (FAM-labeled, Dabcyl) used in the present invention were synthesized by HPLC purification method in Panagene (Korea). The purity of all synthesized probes was confirmed by mass spectrometry, The unnecessary secondary structure of the probe was avoided for effective coupling. The melting temperature of the PNA probe for KS detection was not exceeded 72 ° C, so that PCR amplification was not affected.

Example  2. Kudo Achitu ( Kudoa septempunctata ; KS) detection PNA Of the probe  Verification Result

The samples used for KS detection are listed in Table 2 below. Experiments were conducted to verify that the synthesis was correct for the PNA probes (KS PNA-1, KS PNA-2 and KS PNA-3 in Table 1) prepared for KS detection.

KS: Kudoa septempunctata ; KI: Kudoa iwatai ; KL: Kudoa lateolabracis ; KT: Kudoa thyrsites ; And NTC: Negative Control.

The experimental procedure for the verification of probes is as follows; 1 μl / 2.5 pmol of KS PNA-1-PM, 10 μl of 2 × qPCR PreMix (Seesaw Biomaterials, Korea), 0.5 μl / 10 pmol of KS PNA-1 probe and 8.5 μl of distilled water Lt; / RTI > Further, were the further experiments proceed in the same volume condition by replacing KS PNA-2-PM and KS PNA-2 probe, a further experiment was conducted by replacing the KS PNA-3-PM and KS PNA-3 probe, CFX96 ^TM Real-time PCT (Bio-Rad, USA) was used. The PCR conditions are shown in Fig.

As a result, it was confirmed that the PNA probe was accurately produced (FIG. 3).

Example  3. Kudoa septempunctata PNA for detection Of the probe  Selection result

In the experiment, five samples were selected from KS1-2, KI, KL, KT and NTC.

The composition for the experiment is as follows; 10 μl of 2 × qPCR PreMix (Seikai Biomaterials, Korea), 1 μl / 3 pmol of KS-F primer, 1 μl / 20 pmol of KS-R primer, 0.5 μl / 10 pmol of PNA probes (KS PNA-1, 2, 3) and 5.5 μl of distilled water were added to give a total volume of 20 μl. The PCR conditions were as shown in FIG.

As a result, in the KS PNA-1 probe, the temperature was 59 ° C only in the KS 1-2 sample, and the melting curve temperature was not detected in the remaining samples. Thus, the fluorescence value (RFU) And it was confirmed that it is the most efficient PNA probe even in sensitivity. However, the KS PNA-2 probe showed a unique melting curve temperature of 63.0 ° C in the KS 1-2 sample. However, the KS PNA-2 probe showed 59.0 ° C in KI, 58.5 ° C in KL, and 58.0 ° C in KT. And it is confirmed that it is inefficient because there is a possibility of confusion in the specific detection of only KS. In the case of the KS PNA-3 probe, all Kudoa spp. strain (RFU) and background noise including the control group was so severe that it could not be used as a probe.

Therefore, only the KS PNA-1 probe among the PNA probes is different from the other Kudoa spp . And it can be used for KS detection without interference.

Example  4. PNA In the probe  Confirm sensitivity for

Using the KS PNA-1 probe selected through the sample test, detection confirmation and sensitivity of all the specimens shown in Table 2 were measured. Experimental composition and conditions were the same as in Example 3.

As a result, Tm in KS 1-1, KS 1-2, KS 1-3, KS 2-1, KS 2-2, KS 2-3, KS 3-1, KS 3-2 and KS 3-3 59 or 60 占 폚, and the rest was not detected (Fig. 6). Table 3 summarizes the results of quantitative values and Tm for each sample from the results of FIG.

Thus, it was confirmed that the KS PNA-1 probe specifically detected only KS and could be detected at a concentration of 0.1 ng.

Using a KS PNA-1 probe, a judgment table was prepared based on a sensitivity of 0.1 ng (Fig. 7).

<110> Industry-Academic Cooperation Foundation of Gangneung-Wonju National University <120> PNA probe set for detecting Kudoa septempunctata <130> PN1608-310 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 1 gtgtgtgatc agacttgata tg 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 2 aagccaaaac tgctggccat tt 22 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 3 tttcaaatga gattgtg 17 <210> 4 <211> 13 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 4 gttgagtgga atg 13 <210> 5 <211> 12 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 5 gtcagggcta tt 12 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 6 cacaatctca tttgaaa 17 <210> 7 <211> 13 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 7 cattccactc aac 13 <210> 8 <211> 12 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 8 aatagccctg ac 12

Claims (11)

A composition for detection of Kudoa septempunctata comprising a PNA (peptide nucleic acid) probe represented by the nucleotide sequence of SEQ ID NO: 3. delete The method according to claim 1,
Wherein the PNA probe further comprises a reporter molecule and a quencher molecule. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt; The method of claim 3,
The reporter material may be selected from the group consisting of 6-carboxyfluorescein, HEX (2 ', 4', 5 ', 7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein, Rhodamine green, rhodamine red, TRITC (tetramethyl rhodamine isothiocyanate), FITC (fluorescein isothiocyanate), Oregon green, Alexa Fluor, 6-carboxy-X-rhodamine, Texas Red, TET (2 ', 7'-dichloro-2', 7'-dimethoxyfluorescein) 6-carboxy-4,7-dichlorofluorescein, TAMRA (N, N, N ', N'-tetramethyl-6-carboxyrhodamine), cyanine dyes and thiadicarbocyanine dyes Wherein the Kudoa septempunctata is selected from the group consisting of: The method of claim 3,
The minerals may be selected from the group consisting of Dabcyl (dimethylaminoazobenzenesulfonic acid), Black Hole Quencher, Qxl quencher, Iowa black FQ, Iowa black RQ, IRDye QC- deep dark kwoncheo (deep dark quencher), blackberry kwoncheo (blackberry quencher), Eclipse kwoncheo (ECLIPSE quencher) and Tamra kwoncheo (TAMRA quencher) to Kudoa septempunctata detecting composition, characterized in that at least one selected from the group consisting of. A kit for detecting Kudoa septempunctata comprising a PNA (peptide nucleic acid) probe represented by the nucleotide sequence of SEQ ID NO: 3. (a) separating DNA from the target sample;
(b) amplifying the target sequence by performing PCR (polymerase chain reaction) using the separated DNA as a template;
(c) injecting a PNA probe represented by the nucleotide sequence of SEQ ID NO: 3 into the amplified product and performing real-time PCR;
(d) obtaining a melting curve by the real-time PCR; And
Detection of Kudoa septempunctata containing; (e) detecting a Kudoa septempunctata to determine the melting temperature of the melting curve. 8. The method of claim 7,
Wherein the PCR of step (b) is performed using a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2. 8. The method of claim 7,
Wherein the melting curve of step (d) is obtained by measuring fluorescence intensity relative to temperature by measuring fluorescence intensity while increasing temperature. 10. The method of claim 9,
Wherein the fluorescence intensity is measured while increasing the temperature from 40 캜 to 85 캜. 8. The method of claim 7,
Characterized in that it is judged to be Kudoa septempunctata when the melting temperature is 58 ° C to 62 ° C.

Images