KR101783657B1 - Apparatus, Kits and Methods for Analyzing Biomolecuels - Google Patents

Abstract

The present invention relates to a biomolecule analyzing method using a nucleic acid analyzing technique. Specifically, an amplified nucleic acid capable of being amplified by reacting a specific ligand-binding substance, a specific nucleic acid and a specific gene with an indicator nucleic acid is prepared, And a method and an apparatus for determining the biological meaning of a biomolecule in a biological sample by analyzing the biomolecules contained in the biological sample with a single test.

Description

[0001] The present invention relates to a biomolecule analyzing method, a kit,

The present invention generally relates to a biomolecule analyzing method, and more particularly, to a biomolecule analyzing method, a kit and an apparatus for analyzing various biomolecules for analyzing biological semantics of biomolecules using nucleic acid analyzing techniques.

Biomolecules are substances such as proteins, nucleic acids, lipids, and carbides, which constitute biological samples. They are technologies for analyzing these biomolecules and information that combines quantitative states of biomolecules in biological samples, that is, a profile of biomolecules The technology to produce has been widely developed due to the development of physics, biochemistry and bioinformatics. However, there is a need for efficient new methods and devices due to problems with the use of existing methods and equipment, maintenance cost, ease, accuracy, sensitivity, Is very high.

Biomolecule analysis and profile production techniques are not the ultimate goal themselves but a means for achieving the goal, but they can be used in microorganisms, cells, tissues, etc., and are widely used in medicine, veterinary science, environmental engineering, food engineering and agriculture. Be applied to

Biomolecular analysis and profiles, including nucleic acids, proteins, and organic substances, which constitute tissues, cell masses, cells, and microorganisms, which are biological samples, are made in various ways using physical and chemical properties.

Clinical Decision Support System for analysis of biological meaning using biomolecule analysis and profile in biological sample supports the process of doctor making diagnosis and treatment decision making in patient treatment . The clinical decision support system is divided into Case Based Machine Learning Inference System and Expert System. The case-based machine learning reasoning system collects clinical information and biological information, ie, biomolecule profile data, of patients who have been diagnosed with the disease, and then uses machine learning to deduce or discriminate diseases based on given clinical information and biological information . The expert system is a system that diagnoses diseases using rules defined by medical experts in advance.

As for the nucleic acid and the protein which are the most representative biomolecules, the genetic information is stored in a very long molecular form of the oxyribonucleic acid (DNA) constituting the chromosome, and the chromosome is about 3 billion nucleotides . The sequence of the nucleotides in the chromosome plays a major role in determining the characteristics of each individual. Many common diseases are based on modifications in the nucleotide sequence of the human genome between individuals. Genetic codes contained in genomes of homologous living organisms do not coincide with each other, and there is a difference in nucleotide sequence called polymorphism. It is known that polymorphisms include deletion of one or more nucleotides, insertion of nucleotides, repeat of certain nucleotide sequences, and the like. A single nucleotide polymorphism (hereinafter abbreviated as "SNP") in which one base is substituted with another base is named.

Genotyping chemistries of many SNPs include PCR-restriction fragment length polymorphism analysis, single-strand conformation polymorphism detection, dideoxynucleotide sequencing oligodeoxynucleotide ligation assays, dideoxy minisequencing, oligonucleotide ligation assays, allele-specific polymerase chain reactions (AS PCRs), ligase chain reactions, Primer-required nucleotide incorporation assays and fluorescence energy transfer-based assays have been proposed (Landegren, U., et al., 1998, Genome Res, 8: 769-776; Gut, IG, 2001, Hum Mutat, 17: 475-492; Shi, MM, 2001, Clin Chem, 47: 164-172). Recent additions to the above list include mass spectrometry (Ross P et al., 2000, BioTechniques, 29: 620-629), which can accurately and directly determine the mass of short single DNA fragments, and oligonucleotides Oligonucleotide microarray-based analysis (see Wang, DG et al., 1998, Science, 280: 1077-1082).

Allelic specific hybridization was performed using the Affymetrix whole genome SNP array (see Komura D., et al., 2006, Genome Res. 2006; 16: 1575-84), Idaho Hi-Res Melting curve analysis system Dynamic allele-specific hybridization (DASH) (see Prince JA, et al., 2001, Genome Res. 11: 152-62) , And Illumina Golden Gate SNP Genotyping Arrays (Gunderson KL, et al., 2005, Nat Genet. 37: 549-54), fluorescence resonance energy transfer (FRET) Molecular beacons assays (see Barreiro LB, et al., 2009, Methods Mol Biol. 578: 255-76), and AS PCR The extension techniques utilized are described in the Illumina Infinium bead array (Oliphant A., et al., 2002, Biotechniques. Suppl: 56-8, 60-1), Beckman GenomeLab SNPstream system (Bell PA, et al. 2002, Biotechniques. 2002; Suppl: 70-2, 74, 76-7) and Sequenom MassARRAY SNP system (Hayes B.J., et al. 2007, Bioinformatics. 2007; 23: 1692-3).

Since the methods for identifying SNPs have relative advantages and disadvantages depending on the particular purpose, it is not possible to say with certainty what method is superior to other methods. DNA-based microarray technology, on the other hand, has received great attention as a simple method for analyzing the presence, quantity or expression pattern of a specific gene or group of genes (Schena et al., 1995, Science, 270: 467-470; DeRisi et al., 1996, Nature Genetics 14: 457-460).

Each cell has about 50,000 to 100,000 genes, but cells selectively use genes. Many of them are genes for life-sustaining activities or daily activities of cells themselves. These genes are called housekeeping genes (HKG). In addition, the endogenous standard expression gene may be a gene encoding a specific or a plurality of genes expressed by specific genes or a plurality of genes expressed by a variety of molecular biological purposes, such as revealing the function of a specific gene, searching for a gene having a specific function, A variety of gene expression assays using quantitative analysis of messenger RNA (mRNA) developed for comparison have been developed using the recently developed quantitative real-time polymerase chain reaction (RT-PCR) in reverse transcriptase polymerase chain reaction Quantitative real time PCR (qRT-PCR), serial analysis of gene expression (SAGE), and microarray.

However, since conventional DNA microarrays detect the target sequence only by the hybridization method, there arises a problem of genuine positivity due to the crossing reaction, and there is a problem that the reliability of the hybridization signal must be improved. In addition, in the case of a conventional microarray, detection is carried out by a hybridization method, which requires a complicated cleaning process after hybridization, and a process of making a target sequence into a single strand before hybridization is indispensably required. On the other hand, since the recently announced on-chip PCR is detected by hybridization or probe extension method, it is a heterogenous assay system like existing microarrays, and real-time detection is impossible and accurate quantification is difficult.

Recently, a protein chip or an aptamer chip (Smith et al., Mol Cell Protomics, 11-18. 2003; and McCauley et al.) Has been proposed as a high throughput screening technique for proteoglycans. , Anal Biochem, 319 (2), 244-250, 2003.) have been developed and used. Such supports for parallel high-speed analysis include glass slides, sensing surfaces of biosensors, beads, and nanoparticles.

In addition, a method of analyzing a profile to determine useful biomolecules, separating the biomolecules, and identifying their constituents with MALDI-TOF (Matrix Assisted Laser Desorption / Ionization-Time of Flight) Recently, many studies have been conducted on protein profiles by SELDI-TOFMS (Adam et al., Cancer Research, 62, 3609-3614. 2002; Li et al., Clinical Chemistry, 48, 1296-1304. 2002; and Petricoin et al., The Lancet, 359, 572-577, 2002). Another approach is to develop an immuno-PCR (IPCR) method for amplifying signals using DNA and nucleic acid polymerase (Sano et al., Science 258, 120-122 , 1992).

As described above, the immunoassay method has been developed to improve the detection sensitivity and improve the multi-analyzing ability, but still faces a technical problem of reducing the analysis cost, shortening the analysis time, improving the sensitivity, and increasing the reproducibility.

The present inventors have found that a reverse-SELEX (see Korean Patent Registration No. 10-0670799) producing a profile for a proteome, an abatamer-based nucleic acid chip (Korean Patent Registration No. 10-0464225) (Refer to Korean Patent Registration No. 10-0923048), gene mutation analysis method (refer to Korean Patent Application No. 10-2013-0118222), and method and apparatus for analyzing biomolecules (Korean Patent Application No. 10- 2013-0143495), etc. However, since there is a problem that a protein and a nucleic acid can not be analyzed by a single test in a biological sample, the present invention has been proposed to solve this problem.

As a result of studying to develop a technology capable of real-time analysis of biomolecules with improved efficiency and sensitivity by overcoming the problems of techniques for independently analyzing the conventional biomolecules described above, The object of the present invention has been achieved by developing a method for analyzing biomolecules by a single test.

Ultimately, biomolecule analysis or comprehensive analysis of biological samples can be performed by analyzing biomolecule analysis and profile related to a disease medically, biomolecules capable of diagnosing diseases, biomolecules capable of analyzing therapeutic results, Biomolecules that play an important role in development and progression, susceptibility-related biomolecules to disease, and target molecules in the development of new drugs.

In order to achieve the above object, the present invention provides a method for analyzing a specific biomolecule to be analyzed, which comprises a substance bound to a specific ligand in a sample, a specific nucleic acid, and one or more specific gene mutations, Preparing an amplified nucleic acid capable of amplifying and reacting the biomolecule with the indicator nucleic acid, amplifying the amplified nucleic acid, and detecting and analyzing the amplified intermediate product and the final product presence signal And a biomolecule analyzing method, kit, and equipment capable of analyzing one or more of the substance binding to the specific ligand, the specific nucleic acid, and the specific gene mutation by a nucleic acid analyzing method.

Also, the present invention provides a biomolecule analyzing method, kit, and equipment, wherein the biological sample is at least one selected from the group consisting of bacteria, fungi, viruses, cell lines, and tissues.

It is an object of the present invention to provide biomolecule analysis methods, kits, and equipment, and to analyze various biological meanings including biomolecules related disease information from efficiently produced information using them.

A biomolecule is a target molecule that constitutes and functions in the living body. Most of the major molecules are macromolecules such as proteins, nucleic acids, polysaccharides and lipids, and small molecules. Organic substances such as amino acids, nucleotides, monosaccharides, vitamins, Metals such as copper, and inorganic ions.

Ligands typically include antibodies, peptides, nucleic acids, and plasmids. The ligand binding substance may be a protein, a peptide, a nucleic acid, a carbohydrate, a lipid, a polysaccharide, a glycoprotein, a hormone, a receptor, an antigen, an antibody, a virus, a pathogen, a toxic substance, a substrate, a metabolite, and may be any chemical or biological effector and may be any size molecule that can be used, including, but not limited to, an enzyme, an enzyme, an enzyme, a cofactor, an inhibitor, a drug, a dye, a nutrient, And the like.

The ligand (s) and the particular substance comprise a cluster of molecules or molecules specific to one or more ligands that bind, interact or otherwise associate with a particular substance to affect, alter or nullify the function of the particular substance Structure.

An antibody is a substance that specifically binds to an antigen epitope of an antigen to cause an antigen-antibody reaction. Aptamers are small (20 to 60 nucleotides) single-stranded nucleic acid (DNA or RNA) fragments that are capable of binding with high affinity and specificity to a wide variety of substances, from small molecules to proteins.

Genetic variations include single nucleotide polymorphism (SNP) and structural variability. It is known that genetic mutations determine individual differences such as phenotype changes, sensitivity to disease, and response to therapeutic agents. In particular, mutations involved in disease development and progression are known as disease-associated gene mutations Disease-associated Genetic Variants. SNP means a genetic change or mutation that shows the difference of one base sequence (A, T, G, C) in DNA base sequence. Structural mutations refer to DNA structural variations such as deletions, inversions, additions, and replication.

Further, in the present invention, the analysis of nucleic acid methylation may include nucleotide modification of nucleic acid generated by treating bisulfite with nucleic acid. By treating the nucleic acid with bisulfite, the non-methylated cytosine residue is transformed into a uracil residue and the methylated cytosine residue is present in a state without modification. The nucleotide change before and after the treatment of bisulfite can be analyzed and the methylation of the nucleic acid can be confirmed as a result.

(Polymerase chain reaction), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), branched DNA, Invader method and RCA amplification, and the like.

The PCR method is a technique to mass-amplify a specific region of DNA or RNA in a test tube. Factors influencing PCR amplification efficiency include reaction temperature and time, number of cycles, reaction solution composition (template DNA, dNTP concentration, Mg2 + Concentration, etc.), primer design, and use DNA polymerase. In addition, some reaction additives (DMSO, nonionic surfactant, glycerol) may cause reaction promoting effects. To amplify a specific region of a gene by PCR, two synthesized single-stranded DNAs, which are primers, are required. PCR has been modified in a variety of ways including real-time PCR suitable for quantification of nucleic acids, isothermal PCR method differentiated at amplification temperature, and Stemloop RTPCR adapted for Loop-mediated isothermal amplification (LAMP) and short-length miRNA.

Primer design considerations include length, complementarity between primers, GC content, secondary structure in primer, Tm value, and concentration of use, but now also computer programs for primer design are available.

PCR requires two synthetic single-stranded DNAs to be primers. The position at which the primer binds determines which part of the DNA is amplified. In addition, the conditions of the PCR should be set according to the design of the primer and the sequence of the primer, which is the most important factor of the PCR. A primer of the sense strand (forward) on the upstream (5 ') side and an antisense strand (reverse) on the downstream (3') side of the target DNA is selected and referred to as an electron forward primer and the latter is referred to as a reverse primer .

The real-time PCR method was used to compare the progress of each PCR within the exponentially increasing range. The progress of the PCR amplification product in real time using a device integrated with the spectrophotometric spectrophotometer Thereby quantifying the amount of target DNA present in the initial sample.

Currently, detection methods used in real-time PCR are generally divided into nonspecific methods using Sybr Green I and specific methods using hybridization probes. Sybr Green I binds to double helix nonspecifically and emits fluorescence. Real-time PCR instruments can measure the amount of DNA by measuring the amount of this fluorescence.

Hybridization probes are hybridized to a specifically complementary base sequence and emit fluorescence during the PCR reaction. For example, as a typical hybridization probe, a taqman probe (dual labeled fluorogenic probe) has a fluorescent reporter at the 5 'end and a quencher at the 3' end. If the fluorescent reporter of the taxane probe is present in close proximity to the quencher, the fluorescence is canceled and not detected. When the TaqMan probe hybridizes to the specific target sequence and the PCR amplification proceeds, the TaqMan probe is decomposed into the 5 '→ 3' exonuclease activity of the Taq DNA polymerase, and the fluorescent reporter is released freely. As a result, And emits fluorescence. And the amount of target DNA fragments is monitored in real time.

FIG. 1 shows a nucleic acid sample obtained by separating a nucleic acid and a protein from a biological sample, reacting the protein with the indicator nucleic acid 1, and separating and purifying nucleic acid such as DNA and RNA isolated from the sample 1, And then amplified nucleic acids 2 and 3 are prepared by using oligonucleotides having a completely complementary bond to a specific region of a specific nucleic acid to analyze biomolecules and analyze the biological meaning thereof.

The present invention relates to a substance which binds to a specific ligand, a substance which binds to the specific ligand, a specific nucleic acid and a specific biomolecule of a specific gene mutation in a sample containing one or more of a specific nucleic acid and a specific gene mutation, Preparing an indicator nucleic acid capable of being analyzed by an analytical technique, preparing an amplified nucleic acid capable of amplifying by reacting the biomolecule with the indicator nucleic acid, amplifying the amplified nucleic acid, And detecting and analyzing a product presence signal, wherein the substance that binds to the specific ligand, the specific nucleic acid, and the specific gene mutation can be analyzed by a nucleic acid analysis technique, and a substance binding to the specific ligand, And a biomolecule analyzing unit for analyzing one or more of the specific gene mutations by a nucleic acid analysis method To provide a kit and equipment.

1. Inducible nucleic acid

Inducible nucleic acids enable nucleic acid analysis of biomolecules to be analyzed with oligonucleotides prepared by selecting a nucleotide sequence so as to direct a ligand, a specific nucleic acid or a specific gene mutation to bind to a specific substance and amplify a signal of the presence .

The indicator nucleic acid can be used for analyzing a biomolecule, which is an oligonucleotide, which is a nucleotide sequence structure capable of amplifying a signal of a specific ligand and is bound to a specific ligand, by a nucleic acid analysis method. The indicator nucleic acid is a nucleic acid construct used for various methods such as PCR, LCR, SDA, TMA, bDNA, Invader method, and RCA capable of amplifying a nucleic acid existing signal and can be designed and manufactured by a known method.

Specifically, (i) an oligonucleotide linked to a ligand that binds to the specific substance to be analyzed and having a complementary binding with the PCR primer to form a partial double strand and enable amplification, (ii) An oligonucleotide which is linked to a nucleotide sequence recognizing the nucleic acid and which is complementary to the PCR primer to form a partial double strand and enable amplification; and (iii) an oligonucleotide linked to an open sequence recognizing the specific gene mutation to be analyzed And is complementary to the PCR primer to form a partial double strand and allow amplification.

As used herein, "complementary binding base sequence" means a nucleotide of sufficient length to allow hybridization of the oligonucleotide, the complementary base sequence is in the range of 6 to 1,000 nucleotides in length, and the preferred range is 8 ~ 30 nucleotides and optimally between 10 and 25 nucleotides.

In the present invention, an oligonucleotide located upstream from oligonucleotides completely complementary to each other in the same direction as the specific nucleic acid is referred to as an upstream oligonucleotide, and a site located downstream of the oligonucleotide is referred to as a downstream oligonucleotide.

The "upstream oligonucleotide" according to the present invention is preferably a nucleotide having a length of 6 to 100, more preferably 8 to 30, and most preferably 20 nucleotides.

The 3 'region of a "downstream oligonucleotide" according to the present invention is at least partially complementary to a particular nucleic acid, preferably 8 to 80 nucleotides and most preferably 10 to 20 nucleotides.

 "Capture probe" refers to unique nucleotide sequences used to identify polynucleotides in a reaction and / or to trace the origin of a polynucleotide. The capture probe sequence may be at the 5 'end or the 3' end of the signal primer. Acquisition probe base sequences can vary widely in size and composition; The following references provide guidance for selecting a set of capture probe base sequences suitable for particular embodiments (U.S. Patent No. 5,635,400; Brenner et al, 2000, PNAS, 97: 1665-1670; Shoemaker et al, 1996, Nature Genetics, 14: 450-456; European Patent Publication 0799897A1; U.S. Patent No. 5,981,179). Preferably, the capture probe base sequence can have a length ranging from 4 to 36 nucleotides, or from 6 to 30 nucleotides, or from 8 to 20 nucleotides. Also, in the present invention, the base sequence of the capture probe may be a specific base sequence of the target nucleic acid.

1-1. Certain ligand binding material indicator nucleic acids

The specific ligand and the nucleic acid moiety for analyzing the substance bound to the specific ligand by a nucleic acid analysis technique can be made into a nucleotide sequence that is a ligand-nucleic acid complex by a known method.

FIG. 2 is a view for explaining an amplified nucleic acid which is a substance-analyzing ligand complex which binds to a specific ligand in a biological sample, and the indicated nucleic acid is a complex in which a ligand and an oligonucleotide are linked and the oligonucleotide has a base sequence indicating a ligand and a universal PCR primer It is a nucleic acid consisting of a complementary base sequence.

Figure 3 is a plot of the specific material captured in solution using two ligands that bind to a substance that binds to a particular ligand and then analyzed by nucleic acid analysis techniques.

In one embodiment of the present invention, for quantitative analysis of mucin binding to the specific ligand, the oligonucleotide includes a base sequence region completely complementary to the forward primer of the pair of PCR primers, a base complementary to the capture probe A sequence region, a region having the same base sequence as the reverse primer of the pair of PCR primers, and the like.

In the present invention, an oligonucleotide is designed to analyze a substance bound to a specific ligand by a nucleic acid analysis technique. The structure of the oligonucleotide connected to a specific ligand is represented by the following general formula (I):

5'-P1? -T-P3? -3 '(I)

In the above general formula (I), P1 is a region completely complementary to the forward primer of the PCR primer pair, and T is a region completely complementary to the capture probe, and can be designed to be suitable as a probe used in a hybridization reaction have. P3 is a region having the same base sequence as the reverse primer of the PCR primer pair. ? and? represent the number of nucleotides, and? and? are integers of 8 to 30.

1-2. Specific nucleic acid-directed nucleic acid

The particular nucleic acid may comprise single-stranded nucleic acid or double-stranded nucleic acid DNA or RNA. DNA is a conjugate of a nucleotide composed of phosphoric acid (H3PO4), deoxyribose (C5H10O4), and a base, and RNA is a nucleic acid having D-ribose as a sugar component. RNA includes not only the transcript that directs the protein but also the noncoding RNA itself (miRNA, siRNA, etc.).

In particular, in the case of miRNAs of short length, various PCR methods for quantifying miRNAs have been developed. In the present invention, miRNA can be analyzed by a nucleic acid analysis technique after addition of the designed oligonucleotide by adding poly (A) to an miRNA using an enzyme and reverse transcription, and an oligonucleotide which is an indicator nucleic acid is designed in the Stem-loop RTPCR method To quantify miRNA.

An upstream oligonucleotide capable of indicating and amplifying the specific nucleic acid and a directed oligonucleotide, which is a downstream oligonucleotide, for analyzing the specific nucleic acid with a nucleic acid analysis technique, can be prepared by a known method, and this is referred to as an indicator nucleic acid 2.

FIG. 4 is a diagram showing a method of forming a partial double-stranded nucleic acid with an upstream oligonucleotide and a downstream oligonucleotide in a nucleic acid separated from a biological sample, and forming a complete double-stranded nucleic acid to quantitatively analyze the nucleic acid.

In the present invention, for the specific nucleic acid quantitative analysis, for example, the upstream oligonucleotide, which is the indicated nucleic acid 2, has a region which is a base sequence completely complementary to the forward signal primer and a base which is completely complementary to the specific nucleic acid The downstream oligonucleotide having the nucleotide sequence of SEQ ID NO: 2 is a nucleotide sequence which is completely complementary to the specific nucleic acid, a nucleotide sequence which completely complementarily binds to the capture probe, a reverse signal primer And a region which is a nucleotide sequence completely complementary to the nucleotide sequence. The signal primer may refer to a PCR primer attached with a fluorescent substance or an enzyme capable of generating a signal.

In addition, the present invention relates to a method for preparing the above-mentioned oligonucleotide, which is an upstream oligonucleotide and a downstream oligonucleotide, for the specific nucleic acid quantitative analysis, wherein the upstream oligonucleotide comprises (i) a forward primer in the PCR primer pair is completely A complementary binding region, and (ii) a substantially complementary hybridization sequence region with a specific nucleic acid to be hybridized.

In the above, the upstream oligonucleotide is represented by the following formula (II):

5'-P1? -H? 3 '(II)

In the above general formula (II), P1 is a region that completely complementarily binds to a forward primer in PCR primer pairs, and H is a substantially complementary hybridization sequence region with a target nucleic acid to be hybridized. ? and? represent the number of nucleotides, and? and? are integers of 8 to 30.

A perfectly complementary sequence may be used as the above-mentioned nucleotide 2 as an upstream oligonucleotide, but a substantially complementary sequence may be used as long as it does not interfere with the specific hybridization. have. Preferably, the upstream oligonucleotide comprises a sequence that is capable of hybridizing to a sequence comprising 10 to 30 contiguous nucleotide residues of a particular target nucleic acid of the invention.

The constitution of the downstream oligonucleotide which is the indicator nucleic acid 2 includes (i) a region which is completely complementary to the specific nucleic acid in the same direction as the upstream oligonucleotide, (ii) a region which is completely complementary to the capture probe, (iii) a region completely complementary to the reverse primer in the PCR primer pair.

In the above, the downstream oligonucleotide is represented by the following formula (III):

5'-Hα-Tβ-P3γ-3 '(III)

In the above general formula (II), H is a mutation adjacent specific region that completely complementary binds to the specific nucleic acid from the nucleotide sequence following the position at which the 3'end of the upstream oligonucleotide binds, T is a capture probe and complete To identify the target single-stranded nucleic acid as a complementary binding region, and can be designed to be suitable as a probe used in a hybridization reaction. P3 is a region that completes complementary binding with the reverse primer in the PCR primer pair. ?,? and? are the number of nucleotides and are an integer of 8 to 30.

1-3. Specific gene mutation indicating nucleic acid

An upstream oligonucleotide capable of directing and amplifying the specific gene mutation and a directed oligonucleotide, which is a downstream oligonucleotide, for analyzing the specific gene mutation by a nucleic acid analysis technique, can be prepared by a known method and referred to as an indicator nucleic acid 3 .

FIG. 5 shows a general flow chart for performing specific gene mutation analysis with a nucleic acid probe 3 containing a nucleic acid containing a specific gene mutation and completely complementary to a neighboring site by separating nucleic acid-containing biomolecules from a biological sample have.

In one embodiment of the present invention, in order to analyze the specific gene mutation, the upstream oligonucleotide, which is the nucleotide sequence of SEQ ID NO: 3, has a region that is completely complementary to the forward PCR primer and completely complementary to the target nucleic acid And a region which is a nucleotide sequence at which the nucleotide of the target nucleic acid can be distinguished at the 3 'end, and the downstream oligonucleotide of the nucleotide 3 is a nucleotide sequence completely complementary to the target nucleic acid, A region that is completely complementary to the capture probe, a region that is completely complementary to the reverse PCR primer, and the like. The upstream oligonucleotides can be classified into wild type and mutant types, and are allele specific oligonucleotides and the downstream oligonucleotides are Variation specific oligonucleotides.

In addition, the present invention relates to a method for preparing a nucleotide sequence comprising the steps of: (i) completely complementing a forward primer with a primer pair in a pair of PCR primers, in the step of preparing an upstream oligonucleotide and a downstream oligonucleotide, (Ii) a mutant region (H) having a complementary hybridization sequence completely complementary to the target nucleic acid, and (iii) a mutation region (V) corresponding to a nucleotide mutation, and the nucleotide mutation information Upstream oligonucleotides having two or more oligonucleotides and the like.

The above oligonucleotide having the nucleotide sequence of SEQ ID NO: 3, wherein the oligonucleotide is represented by the following formula (IV):

5'-P1? -H? -V? -3 '(IV)

In the above general formula (IV), P1 is a region in which the forward primer completely complementarily binds in the PCR primer pair, H is a mutation adjacent specific region having a completely complementary hybridization sequence with the target nucleic acid to be hybridized, and V is a nucleotide variation The corresponding mutation is a singular region. ?,? and? represent the number of nucleotides,? and? are integers of 8 to 30, and? is an integer of 1 to 3.

A perfectly complementary sequence may be used as an upstream oligonucleotide of the above-mentioned SNP 3, but a sequence substantially complementary within a range that does not disturb the specific hybridization may be used May be used. Preferably, the upstream oligonucleotide comprises a sequence capable of hybridizing to a sequence comprising 10 to 30 consecutive nucleotide residues comprising the SNP of the present invention. More preferably, the 3 ' end of the upstream oligonucleotide has a base complementary to the SNP base. Generally, the stability of a duplex formed by hybridization tends to be determined by the match of terminal sequences, so that terminal regions are not hybridized in an upstream oligonucleotide having a base complementary to the SNP base at the 3 'end Otherwise, such a duplex can be disjointed under stringent conditions.

The structure of the downstream oligonucleotide of the indicator nucleic acid 3 is (i) a region (H) that completely complementarily binds to the target nucleic acid in the same direction as the upstream oligonucleotide, (ii) a completely complementary binding Region (T) and (iii) a region (P3) completely complementary to the reverse primer in the pair of PCR primers.

The downstream oligonucleotide which is the above-mentioned indicator nucleic acid 3 is represented by the following general formula (V):

5'-Hα-Tβ-P3γ-3 '(V)

In the general formula (IV), H is a human specific region in which the complementary binding to the target nucleic acid is completely complementary, T is a region completely complementary to the capturing probe, and a single-stranded nucleic acid having a mutation-related nucleotide And can be designed to be suitable as a probe used in a hybridization reaction. P3 is a region that completes complementary binding with the reverse primer in the PCR primer pair. ?,? and? are the number of nucleotides and are an integer of 8 to 30.

Preferably, the step of preparing the indicator nucleic acid for analyzing the biomolecule to be analyzed by the nucleic acid analysis technique includes a step of detecting a ligand binding to the specific substance to be analyzed and the ligand, and the PCR primer is complementary Preparing a nucleic acid sequence 1 in which a nucleic acid portion that is prepared so as to be able to be amplified and ligated is linked to the specific nucleic acid to be analyzed, A step of preparing a specific nucleic acid, a nucleic acid sequence 2, and a PCR primer complementary to the nucleotide sequence containing the specific gene mutation to be analyzed and the complementary binding sequence, One or more of the steps of preparing the nucleotide sequence of SEQ ID NO: Also it provides a biomolecule analysis methods, kits and equipment.

2. Sample Processing

Analysis of a sample suspected of containing a biomolecule to be analyzed involves a series of sample preparation steps, which may include filtration, cell lysis, nucleic acid purification, and mixing with reagents. Control of the sample preparation process may be useful to have confidence in the results of nucleic acid analysis.

In the case of a sample containing cells for binding to the specific ligand, a specific nucleic acid and a biomolecule containing a specific gene mutation, a biomolecule containing a specific ligand binding substance is isolated from a fused sample obtained by melting the cell The concentrated and concentrated biomolecule sample can be used for purification or the sample to be analyzed can be used as a sample to be directly analyzed.

Preferably, the present invention provides a biomolecule analyzing method, a kit and an apparatus for directly injecting the sample into a nucleic acid subunit, which is the next step of the fusion subunit, in the dissolved sample having the biomolecule to be analyzed.

The sample may be treated (shaking or vortexing) with zirconium silicate (ZS) beads (Biospec products, USA), etc., to melt the cells.

Preferably, in the case of qualitative quantitative analysis, internal quality control is performed with biomolecules included in a biological sample to be analyzed for comparison in various tests and tests. The quality control material may be an exogenous material which is always contained in a sample to be analyzed in a predetermined amount, but is not included in the sample. If the sample to be analyzed is a biological sample, And < RTI ID = 0.0 > exogenous < / RTI > Quality management refers to internal quality control that manages the precision of a measurement by analyzing a group of inspection results obtained by each measurement without using external standards such as management samples.

In the present invention, the substance for internal quality control can be a biomolecule which is not contained in a human-derived biological sample when a human-derived biological sample is analyzed, and a plant-specific biomolecule can be used. Plant specific proteins have now been reported as a result of the termination of the human genome project and the Arabidopsis thaliana genome project, a plant species. In the present invention, a plant-specific protein can be used as a reference substance for analyzing a human-derived biological sample.

In the present invention, the internal quality control of the quantitative analysis of a substance bound to a specific ligand can be performed using a substance not included in the biological sample to be analyzed.

3. Preparation of amplified nucleic acid

In the present invention, the step of preparing the amplified nucleic acid for analyzing the biomolecule to be analyzed by the nucleic acid analysis technique comprises reacting the specific substance to be analyzed with the indicator nucleic acid 1 to obtain an amplified nucleic acid 1 Preparing an amplified nucleic acid 2 which is a complete double-stranded nucleic acid from a partial double-stranded nucleic acid formed by reacting the specific nucleic acid to be analyzed with the indicated nucleic acid 2, and Preparing an amplified nucleic acid 3 which is a complete double-stranded nucleic acid from a partially double-stranded nucleic acid formed by reacting the nucleic acid strand and the indicated nucleic acid 3, and providing the biomolecule analysis method, kit and equipment.

The amplified nucleic acid refers to a nucleic acid whose specific biomolecule information can be amplified by a nucleic acid analysis technique by a nucleic acid analysis technique. The amplified nucleic acid comprises (i) a complex formed by reacting the specific substance to be analyzed with the indicator nucleic acid 1 and a pair of PCR primers (Ii) a nucleic acid construct in which a pair of PCR primers reacts with a complete double-stranded nucleic acid in which a partial double-stranded nucleic acid formed by reacting the specific nucleic acid to be analyzed with the indicated nucleic acid 2 is converted, and (iii) Is a nucleic acid construct of a pair of complete double-stranded nucleic acid and PCR primer in which partial double-stranded nucleic acid formed by reaction of nucleic acid 3 is converted.

Preferably, as shown in FIG. 3, in order to analyze a substance bound to a specific ligand by a nucleic acid analysis technique, two ligands binding to a specific substance are selected, one of which is bound to a magnetic bead and referred to as a magnetic ligand, The oligonucleotide is ligated to prepare the indicated nucleic acid 1. The magnetic ligand-specific substance-indicating nucleic acid 1 complex may be formed by reacting the sample with the specific substance, the magnetic ligand and the indicator nucleic acid 1. The complex can be harvested by magnetic force in a solution and the amplified nucleic acid can be analyzed by nucleic acid analysis technology to analyze a specific substance.

In order to amplify a signal of the presence of a substance bound to a specific ligand, the present invention can obtain an amplified nucleic acid which is a complex formed by reacting the substance binding to the specific ligand, the magnetic ligand and the indicator nucleic acid 1 have.

Preferably, in another embodiment, a sample containing a specific substance is bound to a support, followed by reacting the indicated nucleic acid 1 to form a specific substance-indicated nucleic acid 1 complex, followed by a washing step to remove the unbound nucleic acid 1, The amplified nucleic acid can be analyzed by nucleic acid analysis technology to analyze a specific substance.

In order to amplify a signal of the presence of a substance bound to a specific ligand, the present invention can obtain an amplified nucleic acid, which is a complex formed by reacting the specific nucleotide to which the specific ligand is bound.

In order to produce an amplified nucleic acid for amplifying a specific nucleic acid-present signal, the present invention includes a reaction for elongating and ligating the partial double-stranded nucleic acid formed by hybridizing the target nucleic acid and the indicated nucleic acid 2 to form the complete double-stranded nucleic acid Oligonucleotides that are repeated two or more times can be used.

In amplified nucleic acid amplification for amplifying a signal of a specific nucleic acid, the present invention elongates and ligates a partial double-stranded nucleic acid formed by reacting the specific nucleic acid with the indicated nucleic acid 2 to obtain an amplified nucleic acid as a complete double-stranded nucleic acid .

The sample to be analyzed is reacted with the indicated nucleic acid 3 recognizing a specific gene mutation to form a partial double-stranded nucleic acid.

The upstream oligonucleotides and the downstream oligonucleotides used in the present invention are hybridized or annealed at one site of the template to form a partial double stranded structure. Nucleic acid hybridization conditions suitable for forming such a double stranded structure can be found in Nucleic Acid Hybridization < RTI ID = 0.0 > (" , A Practical Approach, IRL Press, Washington, DC (1985).

In the present invention, annealing is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the PCR primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables. The amplified target nucleic acid is a target nucleic acid molecule containing multiple target positions on one molecule, and can be used to simultaneously analyze multiple target positions.

In the present invention, in the partial double-stranded nucleic acid formed by hybridizing the target nucleic acid, the upstream oligonucleotide, and the downstream oligonucleotide, if there is a stretch region between two oligonucleotides, a stretch reaction and a linking reaction form a complete double stranded nucleic acid .

As used herein, the "stretch region" refers to nucleotides of sufficient length to allow extension of the oligonucleotide through nucleic acid polymerisation activity. The "stretch region" is present in some embodiments of the target and template nucleic acid. The "stretch region ", if present, is between the upstream oligonucleotide and the downstream oligonucleotide of the target or template nucleic acid. The "stretch region" is about 1 to 1000 nucleotides in length, preferably 1 to 100 nucleotides in length, more preferably 3 to 50 nucleotides, and most preferably 3 to 10 nucleotides in length.

The extension refers to extending the primer by adding nucleotides to the extension region using a polymerase. If the oligonucleotide is completely complementary bound to the nucleic acid, the nucleic acid acts as a template for the extension reaction. In the present invention, the DNA polymerase may be selected from the group consisting of Taq DNA polymerase and Pfu DNA polymerase, but not limited thereto, and any thermostable DNA polymerase can be used.

Ligation refers to enzymatic catalytic coupling of the 3 ' end of the upstream oligonucleotide or the 3 ' end of the extended upstream oligonucleotide to the downstream oligonucleotide. In the present invention, the ligase may be selected from the group consisting of E. coli DNA ligase, Taq DNA ligase, T4 DNA ligase and Ampligase ligase.

In the present invention, when the partial double-stranded nucleic acid formed by hybridizing the target nucleic acid with the upstream oligonucleotide and the downstream oligonucleotide has a nick between the two oligonucleotides, the double-stranded nucleic acid forms a complete double-stranded nucleic acid .

The linking reaction refers to a reaction capable of catalyzing the linkage of a nucleotide sequence by a ligase. After allowing two oligonucleotides of a specific length to be completely complementary to each other in the target nucleic acid, the nick site of the double helix formed at this time is amplified by a DNA ligase using a conventional Linking two oligonucleotides in a single stranded state through a linking reaction. Therefore, enzymes conventionally used in the art can be used without limitation as a ligase for inducing the linkage of nucleic acids.

The enzyme used in the coupling reaction may be selected from the group consisting of E. coli DNA ligase, Taq DNA ligase, T4 DNA ligase and Ampligase ligase, but not limited thereto, DNA binding activity Can be used.

In addition, the ligase reaction can be performed in a single reaction using a plurality of oligonucleotides capable of detecting a single target gene or a mutation as well as recognizing a plurality of targets. In this case, the ligase and the oligonucleotide suitable for each mutation position are selected so that the error of the melting temperature (Tm) value of the portion of the ligase oligonucleotide sequence hybridized with the target nucleic acid is within 5 ° C .

In order to produce an amplified nucleic acid for a nucleic acid presence signal of a specific gene mutation-associated amplified nucleic acid, the present invention relates to a method for hybridizing a target double-strand nucleic acid with a target nucleic acid, the upstream oligonucleotide and a downstream oligonucleotide, The reaction to form the strand nucleic acid can be carried out repeatedly two or more times.

In the production of an amplified nucleic acid to amplify a signal of a specific gene mutation, the present invention is characterized in that a partial double stranded nucleic acid formed by reacting the nucleic acid having the specific gene mutation and the nucleotide-indicating nucleic acid, Lt; RTI ID = 0.0 > full-duplex < / RTI >

4. Amplification of amplified nucleic acid

The amplification of the amplified nucleic acid can be performed by various methods such as PCR, LCR, SDA, TMA, bDNA, Invader method, and RCA.

In the present invention, preferably, the amplified nucleic acid is amplified to amplify a specific biomolecule. The signal primer may be composed of a reverse primer composed of a forward primer, which is a universal PCR primer having a labeling substance, and a universal PCR primer .

Wherein the signal primers are represented by the following formulas (VI) and (VII): < EMI ID =

Forward primer: 5'-X-P-3 '(VI);

Reverse primer: 5'-P-3 '(VII)

In the formulas (VI) and (VII), X is a detectable labeling substance. The quantitative analysis of the biomolecule is different between the target probe prepared in the control sample and the target substance used in the target probe prepared in the experimental sample Preferably, the former may be Cy3, and the latter may be Cy5.

In order to analyze the mutation of the nucleic acid, a fluorescent substance or a reporter molecule having a physical characteristic at the 5 'terminal end of the primer is used as a labeling substance to identify the type of mutation-related nucleotide, that is, the type of mutation, The wild type can be labeled with Cy3, and the mutation type with Cy5 depending on the nucleotide variation. P consists of a nucleotide sequence completely complementary to the nucleotide sequence of the upstream oligonucleotide and the region in which the signal primer of the downstream oligonucleotide undergoes complete complementary binding.

The forward primer (P1 or P2) in the pair of signal primers is composed of a heat sequence that completely complementarily binds to the base sequence of the region to which the signal primer binds in the configuration of the upstream oligonucleotide, and is preferably a universal PCR primer PCR primer) or a labeling substance (X) such as a fluorescent reporter molecule or a reporter molecule having a physical characteristic at the 5 'end of the signal primer is selected according to the nucleotide variation of the target nucleic acid, and the hybridization reaction is terminated and the nucleotide variation is determined The signal generated from the labeling substance is used.

In addition, the reverse primer (P3) in the signal primer pair is composed of a heat sequence which completely complementarily binds to the nucleotide sequence of the region to which the signal primer binds in the constitution of the upstream oligonucleotide, and is preferably a universal PCR primer. Universal PCR primers are oligonucleotides, which are generally used for nucleotide sequencing or PCR, and are often found in commercial cloning vectors.

FIG. 6 is a graph showing the results of the total nucleotide methylation analysis using an oligonucleotide having a complete complementary bond to a specific region of a target nucleic acid after bisulfite treatment of the nucleic acid isolated from a biological sample. Flow chart.

FIG. 7 is a diagram for analyzing the biomolecule by a nucleic acid analysis technique after converting a substance binding to a specific ligand, a specific nucleic acid, and a specific gene mutation to an amplifiable nucleic acid amplifiable using an indicator nucleic acid.

The present invention provides a method for analyzing a biomolecule to be analyzed by a nucleic acid analysis technique, the method comprising amplifying the amplified nucleic acid using a biomolecule analysis method comprising any one of PCR, LCR, SDA, TMA, bDNA, Invader method, And equipment.

In the present invention, the step of detecting the amplified signal for analyzing the biomolecule to be analyzed by the nucleic acid analysis technique includes a step of detecting the amplified signal using the amount or the base sequence of the amplification product produced in the amplification step, Methods, kits, and equipment.

5. Nucleic acid presence signal detection and analysis

There are a number of biomolecules in the sample, including proteins that bind to specific ligands. In this respect, a biomolecule has a function of detecting a ligand signal by forming a biomolecule-ligand complex, and a biomolecule analyzing technique has been developed based thereon.

A particular nucleic acid can be analyzed as a directed nucleic acid 2 that can direct a particular nucleic acid and amplify the signal of a particular nucleic acid present. The indicator nucleic acid is composed of a nucleotide sequence used for various methods such as PCR, LCR, SDA, TMA, bDNA, Invader method, and RCA capable of amplifying a nucleic acid existing signal and a nucleotide sequence indicating a specific nucleic acid. Can be designed and manufactured.

In the present invention, there is provided a method for producing a nucleic acid according to the present invention, comprising the steps of: preparing an upstream oligonucleotide completely complementary to the specific nucleic acid in the same direction as the specific nucleic acid and a nucleic acid 2 as a downstream oligonucleotide; Preparing a partial double-stranded nucleic acid as a complete double-stranded nucleic acid, labeling and amplifying the complete double-stranded nucleic acid as a template using a signal primer to prepare a target probe, and hybridizing the target probe and the capture probe Analyzing a signal occurring in the product; Lt; / RTI > can be prepared and analyzed.

FIG. 5 shows a general flow chart of performing a specific gene mutation analysis using an oligonucleotide including a nucleic acid 3 containing a nucleic acid-containing biomolecule and containing a specific gene mutation and having a complementary complementary bond to the adjacent site Giving.

For the specific gene mutation analysis, the indicator nucleic acid is a nucleic acid construct used for various methods such as PCR, LCR, SDA, TMA, bDNA, Invader method, and RCA capable of amplifying a nucleic acid existing signal and is designed and manufactured by a known method .

Preferably, for analysis of a specific gene mutation, a polynucleotide comprising a nucleotide sequence complementary to at least one portion of the downstream oligonucleotide and a region that is complementary to at least one portion of the upstream oligonucleotide, I will mention. The indicated nucleic acid 3 may have a stretch region or a nick between the two complementary binding regions of the oligonucleotide.

In the present invention, the step of detecting the amplified signal for analyzing the biomolecule to be analyzed by the nucleic acid analysis technique may include analyzing the amount of the amplification product produced in the amplification step by using a biomolecule analysis Methods, kits, and equipment.

According to the present invention, various methods can be used to confirm the real-time amplification of the amplification product in the real-time PCR for detection of the amplified nucleic acid, for example, an interchelating method, a molecular beacon method, TaqMan probe method and the like can be used.

The intercalating method is a method of detecting fluorescence that is generated by amplification and addition of an intercalator (intercalator: SYBR Green I, EtBr, etc.) that binds to double stranded DNA and shows fluorescence in the PCR reaction solution. interchelator) binds to double-stranded DNA synthesized by PCR reaction to emit fluorescence, and the amount of the amplification product can be measured by detecting the fluorescence intensity.

The molecular beacon method uses an oligonucleotide probe (Molecular Beacon probe) that forms a hairpin-type secondary structure modified with fluorescent markers (eg FAM, TAMRA, etc.) and a quencher (eg DABCYL) . Molecular beacon probes take a hairpin structure in the free state and are close to the fluorescent marker and the quencher material. However, when hybridizing specifically in the region complementary to the template DNA in the hybridization step, the fluorescent marker and the quencher substance And the fluorescent dye on the probe shows fluorescence due to the suppression by the quantum material. However, the nonhybridized molecular beacon probe maintains the hairpin structure and does not show fluorescence.

The TaqMan probe method is a method in which an oligonucleotide (TaqMan probe) labeled with a 5'-terminal as a fluorescent marker and a 3 'terminal as a quencher (for example, TAMRA) is added to the PCR reaction solution. DNA is specifically hybridized, but the fluorescence emission is inhibited by the quencher on the probe. In the polymerization step, only the TaqMan probe hybridized to the template due to the 5 '→ 3' exonuclease activity of the Taq DNA polymerase is degraded, Is released from the probe, the suppression by the quanta is released and the fluorescence is emitted.

According to the present invention, a proper real-time PCR amplification confirmation method among the methods listed above can be selected taking into consideration reaction efficiency, time, type of fluorescent marker, and the like. In the present invention, it may be preferable to use the TaqMan probe method.

The present invention provides a biomolecule analysis method, a kit and an apparatus for detecting the single test by a method selected from an interchelating method, a TaqMan probe method and a molecular beacon method.

In the present invention, the acquisition probe may have a base sequence that completely complementarily binds to a single-stranded nucleic acid having a labeling substance of the target probe, and the acquisition probe is present in a single-stranded nucleic acid having a labeling substance of a target probe Which is completely complementary to the specific nucleotide sequence of the reverse downstream oligonucleotide.

The capture probes serve to identify and bind to the amplification product. The primer binding region (T) in the amplification product, which is obtained by amplifying the target nucleic acid as a template with a signal primer, Strand nucleic acid, oligonucleotide, and PNA (peptide nucleic acid) having a base sequence complementary to a single-stranded nucleic acid having a labeling substance based thereon.

In the present invention, the target probe may be composed of a control target probe manufactured in a control sample and an analysis target probe manufactured in an experimental sample.

In order to quantitatively analyze a biomolecule from a control and an experimental sample according to the present invention, a target nucleic acid DNA is prepared from a biomolecule isolated from a control sample, and the target nucleic acid DNA is amplified by PCR using a signal primer The target probe is prepared by PCR using the target nucleic acid DNA prepared from the probe and the experimental sample as a template. The prepared target probes and the analysis target probes are mixed to prepare a target probe. The labeling substance of the signal primer used in the production of the control target probe and the labeling substance of the signal primer used in the production of the control target probe can be made different from each other. Preferably, the former is Cy3 and the latter is Cy5 fluorescent material.

In the present invention, the acquisition probe may be coupled to a support and the support may be a glass slide, sensing surface of the biosensor, beads, nanoparticles, and the like.

FIG. 8 is a diagram for analyzing biomolecules by analyzing a signal generated after hybridizing the capture probe fixed to a glass slide substrate with a target probe having a labeling substance.

Preferably, the capture probe can be attached to a glass slide or a sensing surface of a biosensor, etc., which can be modified to enable binding, and this modification can be combined with a C1 to C20 alkyl group at the 5 ' end of the oligonucleotide , Materials such as thiols may be added to facilitate bonding with the glass slide or sensing surface. However, such a modification can be appropriately changed depending on the purpose.

In this way, the support to which the acquisition probe is fixed is a kind of microarray, which can be a biosensor sensing surface, and can detect any target substance by measuring a change caused by binding of the target substance. In particular, fluorescence changes can be measured by analyzing the fluorescent material of the labeling substance bound to the capture probe. What is available here is a glass slide, which is a conventional solid support.

In the above hybridization, the hybridization (annealing) temperature is 40 to 70 캜, more preferably 45 to 68 캜, still more preferably 50 to 65 캜, and most preferably 60 to 65 캜. Hybridization conditions are described in the following publications: Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press , Washington, DC (1985). ≪ / RTI > The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. These stringent conditions can be determined differently depending on the sequence to be hybridized. For example, high stringency conditions were hybridized under conditions of 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS) and 1 mM EDTA at 65 ° C, followed by hybridization in 0.1 x SSC (standard saline citrate) /0.1% SDS at 68 Lt; 0 > C. Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 ° C.

In the microarray, the acquisition probe is used as a hybridizable array element and immobilized on a substrate. Preferred gases include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports. The above-described acquisition probes are arranged and immobilized on the above-mentioned substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the capture probe may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element may be coupled to the gas through a linker (e.g., ethylene glycol oligomer and diamine).

In the above, a device for measuring a signal generated from a single-stranded nucleic acid having a nucleotide and a labeling substance of an amplification product bound to the capture probe is determined according to the type of signal, and after the hybridization, hybridization Signal is detected. The hybridization signal can be performed in various ways depending on, for example, the type of label attached to the capture probe.

On the other hand, the sample DNA to be applied to the microarray of the present invention can be labeled and hybridized with a capture probe on a microarray. Hybridization conditions can be varied. The detection and analysis of the hybridization degree can be variously carried out according to the labeling substance.

The labeling substance bound to the capture probe may provide a signal for detecting hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorescent moieties (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent moieties, magnetic particles, (Eg P32 and S35), mass markers, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), substrates for enzymes, heavy metals (eg gold) and antibodies, streptavidin, But are not limited to, haptens with specific binding partners such as biotin, digoxigenin and chelating groups. Markers may be obtained by a variety of methods routinely practiced in the art, such as the nick translation method, the Multiprime DNA labeling systems booklet (see Amersham (1989)) and the kaination method (Maxam & Gilbert , 1989, Methods in Enzymology, 65: 499). The label provides signals that can be detected by fluorescence, radioactivity, color measurement, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

In the above, the method of producing the microarray is synthesized and manufactured by any suitable method known in the art. Microarray fabrication equipment is also readily available through commercial sources. A variety of known methods (M. schena, 1999, DNA microarray; a practical approach, Oxford) allow acquisition probes to routinely produce nucleic acid chips.

In the present invention, the labeling substance is selected from the group consisting of Biotin, Cy2, GFP, YO-PRO-1, YOYO-1, Calcein, FITC, FlourX, ALEXA 488, Rhodamine 110, ABI 5-FAM, Oregon Green 500, Oregon green 488, RiboGreen, Rhodamine Green, Rhodamine 123, Magnesium Green, Calcium Green, TO-PRO-1, TOTO-1, ABI JOE, BODIPY 530/550, Dil, BODIPY TMR, BODIPY 558/568, BODIPY 564/570, Alexa 546 , TRITC, Magnesium Orange, Phycoerythrin R & B, Rhodamine Phalloidin, Calcium Orange, Pyronin Y, Rhodamine B, ABI TAMRA, Rhodamine Red, Cy3.5, ABI ROX, Calcium Crimson, Alexa 594, Texas Red, Nile Red, A fluorescent dye selected from PRO-3, YOYO-3, R-phycocyanin, C-phycocyanin, TO-PRO-3, TOTO-3, DiD DilC (5), Thiadicarbocyaine, Cy5.5, Cy5 or Cy3 is used.

The method of the present invention may further comprise the steps of fabricating a chip spotted with the acquisition probe, performing a hybridization reaction between the target probe and a probe immobilized on the chip surface, And a step of simultaneously analyzing the target nucleic acid amount and the mutation by measuring the fluorescence intensity according to the result of the hybridization reaction by scanning the chip with a laser having a wavelength specific to the fluorescent dye, The labeled amplification products are hybridized to analyze signals.

The present invention provides a biomolecule analyzing method, a kit and an apparatus for detecting the multiple test by a method selected from a TaqMan probe method, a molecular beacon method, a bead array or a solid array .

6. Biomolecular Analysis Equipment

In the present invention, a biomolecule analyzing a substance bound to a specific ligand, a specific nucleic acid, and a specific gene mutation using a nucleic acid analysis technique in a sample having a biomolecule to be analyzed may be composed of a main body and a polymer structure.

The polymer structure may be composed of two layers, and may be made of known processes such as extrusion, plasma deposition, and lamination, and may be made of polyester, polyethylene terephthalate (PET), polycarbonate, polypropylene, polymethyl methacrylate, And the bonding force should be low.

The polymer structure may also comprise reagents. Dry reagents are used hydrated.

Analysis of a sample suspected of containing a biomolecule of interest involves a series of sample preparation steps and is carried out in a sample processing assembly consisting of a reagent storage subunit and a dissolution subunit. These steps may include filtration, cell lysis, and mixing with reagents. Control of contamination of the sample preparation process may be useful to have confidence in the results of biomolecule analysis. A method for preparing a sample for nucleic acid amplification reaction and verifying the effectiveness of the sample preparation is provided.

The sample is considered to contain a target entity selected from the group consisting of cells, spores, microorganisms, and viruses, and the target entity comprises at least one target biomolecule. The method includes introducing the sample into a device having a mixing chamber for mixing with the sample and the sample preparation control. Sample Preparation Controls are selected from the group consisting of cells, spores, microorganisms and viruses, and the sample preparation control contains quality control materials. The apparatus also has a solubilization subunit and a reaction subunit. The sample is mixed with the sample preparation control at the dissolution sub-section.

The method also includes the steps of purifying the biomolecule by dissolving the target substance in the sample preparation control and the sample in the solubilized subunit, forming the specific substance-directed nucleic acid complex, separating the RNA, DNA and specific Exposing the substance-directed nucleic acid complex to nucleic acid amplification conditions in an amplification subunit; and detecting the presence or absence of at least one quality control substance. Positive detection of the quality control substance indicates that the sample preparation process is satisfactory, whereas if the quality control substance can not be detected, the sample is improperly prepared.

The present invention provides an amplification subunit for preparing a sample for nucleic acid amplification reaction and verifying the effectiveness of the sample preparation. The sample is considered to contain a target entity selected from the group consisting of cells, spores, microorganisms, and viruses, and the target entity comprises at least one target biomolecule. The apparatus includes a body having a first sub-body accommodating a sample preparation control to be mixed with the sample. Sample Preparation Controls are selected from the group consisting of cells, spores, microorganisms, and viruses, and the sample preparation control contains quality control materials.

The main body further includes a nucleic acid subunit that dissolves the target substance and the sample preparation control group when they are present in the sample, liberates the biomolecule from them, and separates the RNA and the DNA from the specific substance. The body also comprises a nucleic acid subunit which reacts with a specific substance liberated with the indicator nucleic acid 1 to form a specific substance-indicated nucleic acid 1 complex. The body also includes an amplification subunit that retains the nucleic acid for amplification and detection. The apparatus further comprises at least one flow controller for guiding the sample preparation control and the sample mixed into the dissolution subunit at the sample inlet and guiding the released biomolecule in the dissolution subunit to flow into the nucleic acid subunit and the amplification subunit.

The dissolution subunit contains an enzyme that captures the target entity when present in the sample and the sample preparation control when the sample flows through the solubilized subunit, at least one filter, and a solid phase material, The at least one flow controller may also direct the used sample fluid flowing through the dissolved solids flow to flow into the spent sub-section.

The apparatus further comprises an ultrasonic transducer coupled to a wall of the dissolution chamber to provide ultrasonic waves to the dissolving sub-sector. The device further comprises beads within the dissolved solubles to rupture the sample preparation control and the target entity.

According to another aspect of the present invention, the present invention provides a method for determining the effectiveness of a dissolution process. The method includes mixing a sample suspected of containing a target entity selected from the group consisting of cells, spores, microorganisms and viruses with a sample preparation control. The target entity comprises at least one quality control material. Sample Preparation Controls are selected from the group consisting of cells, spores, microorganisms and viruses, and the sample preparation control contains quality control materials. A mixture of the sample preparation control and the target substance when present in the sample is dissolved. The method further comprises the step of detecting the presence or absence of a quality control material to determine whether the biomolecule is liberated from the sample preparation control during the dissolution treatment. Positive detection of the quality control substance indicates that the sample preparation process is satisfactory, whereas if the quality control substance can not be detected, the sample is improperly prepared.

The method comprises the step of allowing a sample mixed with the sample preparation control to flow through a sub-body containing the solid phase material, before the dissolution treatment, in order to capture the sample preparation control and the target substance when present in the sample by solid matter .

The sample can be pre-filtered before mixing the sample with the sample preparation control. The dissolving treatment may include exposing the sample preparation control and the target entity to ultrasonic energy. The dissolution process also involves stirring the beads to rupture the sample preparation control and the target entity. Sample preparation Control group may be spores. The mixing step may involve degrading the dry bead containing the sample preparation control.

Subunits required for nucleic acid extraction can be channeled to facilitate mixing of reagents in the polymer structure. In the channel, the molten sample is transferred to the nucleic acid subunit and the subunits and channels are configured so that silica-based magnetic beads and appropriate buffer are supplied and the necessary reagents are supplied continuously according to the sample preparation method. The nucleic acid is bound to the beads and transferred to adjacent subunits, and the magnetic beads are washed with ethanol, isopropanol, or other organic washing solution. The purified nucleic acid is then continuously transferred through the channel to the amplified subunit.

The dissolving treatment includes contacting with a chemical dissolving agent. The marker nucleic acid sequence is detected by amplifying the marker nucleic acid sequence (e.g., by PCB) and detecting the amplified marker nucleic acid sequence. The marker nucleic acid sequence is detected by determining if the signal from the probe that can bind to the marker nucleic acid sequence exceeds a threshold value.

The reaction mixture in the reaction chamber of the reaction vessel of the amplification device is exposed to nucleic acid amplification conditions. Amplification of an RNA or DNA template using a reaction is known (U.S. Patent No. 4,683,195; U.S. Patent No. 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., 1990). Reference]. Nucleic acid amplification of DNA involves repetition of cycles consisting of thermally denaturing the DNA, annealing two oligonucleotide primers in a sequence that is adjacent to the DNA segment to be amplified, and extending the annealed primer by a DNA polymerase. Primers are crossed to opposite strands of the target sequence while DNA synthesis by the polymerase is oriented so as to proceed across the region between the primers, effectively doubling the amount of DNA segments. In addition, since the extension products are also complementary and capable of binding primers, each successive cycle substantially doubles the amount of DNA synthesized in the previous cycle. This leads to the exponential accumulation of a particular target segment at a rate of 2n per cycle (where n is the number of cycles). Methods such as amplification and ligase chain reaction (LCR) can be used to directly amplify the nucleic acid sequence of the target DNA sequence directly from mRNA, cDNA, genomic library or cDNA library. Isothermal amplification reactions are also known and can be used according to the methods of the present invention.

The nucleic acid amplification reaction is preferably carried out using a heat treatment equipment which heats and / or cools the reaction mixture in the reaction vessel to the temperature required for the amplification reaction. Such a thermal processing equipment may also include a marker nucleic acid sequence of the sample preparation control and one or more detection mechanisms for detecting one or more target nucleic acid sequences for testing in the sample. Preferred heat treatment equipment incorporating an optical detector for amplifying and detecting the nucleic acid sequence in the reaction vessel (US 6,369,893; US 6,391,541.) Can be used. There are also many other known methods suitable for the present invention to control the temperature of the reaction mixture and to detect the nucleic acid sequence in this reaction mixture.

It is also preferred that the detection of one or more quality control substances for testing in the quality control materials and samples of the sample preparation control is performed using probes. The reaction vessel preferably has at least one transparent or light-permeable wall through which a signal from a probe that can be optically detected passes. Preferably, an acquisition probe can be used to detect and quantify the nucleic acid sequence. There are numerous different assays that employ nucleic acid capture probes. Some of these capture probes produce signals with changes in fluorescence emission of fluorescent sources due to changes in interaction with other molecules or moieties.

In another preferred method for the detection of amplification products, the fluorescent probe is composed of oligonucleotides labeled by both fluorescent reporter dyes. The cleavage of the capture probe results in an increase in the fluorescent intensity of the reporter dye.

To ensure the detection of a target biomolecule in the sample or its lack, the contamination of the sample preparation should be controlled. This is why the sample preparation control must undergo the same treatment as the target substance in the sample (for example, a target cell containing a biomolecule, spore, virus or microorganism). If the quality control material of the sample preparation control is detected, the sample preparation is considered to be satisfactory. If the presence of a quality control substance can not be detected, the sample preparation is considered inappropriate and the result of the test for the target nucleic acid sequence is considered to be "tentative ". Preferably, the presence of the quality control material is such that the signal from the acquisition probe capable of binding to the target probe exceeds a threshold value, for example a predetermined fluorescence emission threshold that must be met or exceeded to be considered valid for the assay Is determined.

The fluid control device may be controlled by a computer according to a desired protocol. Using a single valve can produce high manufacturing yields due to only one failure factor. The integration of the fluid control and treatment components allows obtaining a compact device (e.g. in the form of a small cartridge) and facilitating automation of molding and assembly. As discussed above, such systems may advantageously include dilution and mixing capabilities, intermediate cleaning capabilities, and reliable pressurization capabilities. The fluid path in the system is typically closed to minimize contamination of the fluid in the system and to facilitate its reception and control. The reaction vessel can conveniently be separated and exchanged and disposed of.

The present invention relates to a method for amplifying an amplified nucleic acid, which comprises amplifying an amplified nucleic acid by preparing an amplified nucleic acid by reacting a specimen containing a substance binding to the specific ligand, a specific nucleic acid and a specific gene mutation, A reaction region consisting of reaction subunits, and a search region consisting of a search subunit for detecting and analyzing nucleic acid presence signals, wherein the polymer having a structure for fluidly connecting between the reaction subunits and the reaction subunits and the search subunits, A body for performing a function of measuring, analyzing and controlling a dynamic operation element for operating and managing the polymer structure, and a software for operating, managing and analyzing reaction, analysis, and search processes with reaction intermediate products in the sample, And a biomolecule analyzing device.

The present invention provides a biomolecule analyzing apparatus wherein the dynamic operating element is composed of temperature, humidity and pressure.

The present invention provides a biomolecule analyzing apparatus which is fluidly connected or holds itself with a storage unit containing a reagent and a buffer solution necessary for performing the function, and the sub-unit constituting the reaction region and the search region.

In the present invention, the apparatus is provided with a sub-unit consisting of a sub-unit, which is a basic unit of the structure, and performs various functions as required. The sample includes a sample processing area for processing the sample to be suitable for biomolecule analysis to be analyzed, A storage area for storing the reagents and buffer solutions necessary for the reaction, detection and analysis of the reaction end product over the reaction intermediate product, and an extra material generated during the reaction, detection and analysis of the final product over the intermediate product in the sample , A pump for recognizing the sample and recognizing the sample, an inlet for injecting the reagent and the hydrated reagent and buffer solution into the polymer structure, and a pump for providing fluid power to the polymer structure composed of the fluid-connected subunit And provides one or more biomolecule equipment.

The present invention provides a method for amplifying an amplified nucleic acid for biomolecule analysis to be analyzed in the sample, the method comprising amplifying the biomolecule by using a fusion subunit comprising a fusion particle for melting the cell in the sample to be analyzed, A nucleic acid sample to be analyzed for the specific nucleic acid or a specific gene mutation is separated and purified, or a substance bound to the specific ligand is reacted with the nucleic acid to be analyzed, And reacting the amplified nucleic acid 1, the indicated nucleic acid 2, or the indicated nucleic acid 3 with the purified nucleic acid to prepare amplified nucleic acids 2 and 3 which are complete double-stranded nucleic acids, or one or more of the amplified nucleic acids 1, 2, Wherein said subunits are a fluid-linked polymer structure, said amplified subunit Stage amplification subunit having a primer capable of further amplifying the amplified nucleic acid, wherein the one or more injection ports are in fluid connection with the subunit and the injection port is connected to the subunit from the outside Wherein the sample is closed after the sample is injected into the polymer structure through the first inlet with the one or more injection ports being closed in a closed state and the other injection ports are continuously operated in the same manner as necessary, The amplified nucleic acid 1 formed by reacting the nucleic acid separated or purified from the melted sample or the nucleic acid 1 with the nucleic acid 1 and the amplified nucleic acid 1 formed by immersing the amplified nucleic acid 1 in the amplified subunit , And the amplified subunit Amplified nucleic acid 1, and amplified nucleic acid 2, 3, which is a complete double-stranded nucleic acid converted from a partial double-stranded nucleic acid formed by exposing the transferred nucleic acid to the indicated nucleic acid 2 or the indicated nucleic acid 3, The amplified nucleic acid is subjected to primary amplification of one or more amplified nucleic acids of the nucleic acid, the specific substance and the specific gene mutation, and the amplified nucleic acid is further divided into the additional secondary amplification subunits of the array, Molecular analysis methods, kits, and equipment.

The method for amplifying the amplified nucleic acid for analyzing a substance bound to a specific ligand to be analyzed in the sample includes a fusion particle which melts a cell in a sample to be analyzed for a substance bound to the specific ligand A nucleic acid subunit forming a amplified nucleic acid 1 by a reaction between the fusion sample and the indicator nucleic acid 1, and an amplification subunit for first amplifying the amplified nucleic acid 1, wherein the subunits are a fluid-linked polymer structure, Wherein the one or more injection ports are in fluid communication with the subunit and the injection port is connected to the subunit from the exterior to the subunit, It is the only path that is connected, The sample is injected into the polymer structure through the first injection port in a sealed state, and then the other injection port is continuously operated in the same manner as necessary. The fusion subunit is injected into the sample And the amplified nucleic acid 1 is magnetically transferred to the amplified subunit by reacting the fused sample with the indicator nucleic acid 1. The amplified subunit cleaves the transferred amplified nucleic acid 1 to amplification conditions A kit for biomolecule analysis, a kit for biomolecule analysis, and a kit for biomolecule analysis, wherein the amplified nucleic acid is first amplified, the amplified nucleic acid is transferred to an additional secondary amplification subunit of the array for fluid transport, and a secondary amplification is performed at an additional secondary amplification site.

The present invention is a method for amplifying an amplified nucleic acid for analysis of a specific nucleic acid to be analyzed in the sample, the method comprising amplifying a nucleic acid in a sample to be analyzed, An amplification nucleic acid 2 which is a complete double-stranded nucleic acid which is converted from a partial double-stranded nucleic acid formed by reacting the nucleic acid 2 with the purified nucleic acid and which separates and purifies the nucleic acid sample to be analyzed, Wherein said subunits are a fluidly connected polymer structure and are comprised of an array of secondary stepped amplification subunits in fluid communication with said amplified subunit and having a primer capable of further amplifying said amplified nucleic acid, Wherein the injection port is fluidly connected to the sub- The injection port is the only passage connected to the sub-stage from the outside and the sample is closed after the sample is injected into the polymer structure through the first injection port in a sealed state with all of the one or more injection ports closed, Wherein the fusion subunit melts the cells in the sample with a generated high velocity impact and the nucleic acid subunit is transported to the amplification subunit by a magnetic force by separating and purifying the nucleic acid subunit from the melted sample, An amplified nucleic acid 2 which is a complete double-stranded nucleic acid converted from a partial double-stranded nucleic acid formed by exposing the transferred nucleic acid to the reaction with the indicator nucleic acid 2 is subjected to amplification conditions to amplify the amplified nucleic acid first and then to an additional secondary amplification subunit The amplified nucleic acid is divided and transported, A biomolecule analysis method, a kit, and an apparatus in which a secondary step amplification is performed at a secondary step amplification site.

The present invention is a method for amplifying an amplified nucleic acid to analyze the specific gene mutation to be analyzed in the sample includes a fusion subunit comprising a fusion particle for melting a cell in a sample to be analyzed for the specific gene mutation, The amplified nucleic acid 3 which is a complete double-stranded nucleic acid converted from a partial double-stranded nucleic acid by reacting the nucleic acid 3 with the purified nucleic acid and separating and purifying the nucleic acid sample to be analyzed for the specific gene mutation in the sample, And an array of secondary step amplification subunits having a primer that is amplified by a first amplification subunit and the subunit is a fluidly connected polymer structure and is further connected to the amplification subunit and capable of further amplifying the amplified nucleic acid, One or more inlets may be connected to the sub- And the injection port is the only passage connected to the subordinate from the outside and the sample is injected into the polymer structure through the first injection port in a state in which all of the one or more injection ports are sealed and then closed, And the fusion subunit melts the cells in the sample with the generated high velocity shock and the nucleic acid subunit is transferred to the amplification subunit by the nucleic acid magnetic force separated and purified from the melted sample, Amplified nucleic acid 3, which is a complete double-stranded nucleic acid converted from a partial double-stranded nucleic acid formed by exposing the transferred nucleic acid to react with the nucleic acid to which the nucleic acid is transferred, is firstly amplified by exposure to amplification conditions, and the amplified nucleic acid 3 The amplified nucleic acid is divided and transported, A biomolecule analysis method, a kit and an apparatus in which a secondary step amplification is performed in a secondary step amplification site.

7. Biological mean prediction technology

In the present invention, the biological semantic prediction system using the biomolecule information data is exemplarily diagnosed but not limited thereto.

Many biomolecule information data generated by the present invention can produce various information related to cells, tissues, or diseases with information of a large amount of a substance having high dimensional characteristics. The module that performs the pre-processing in the analysis system using the input data finds the features that affect the patient's condition and the multivariate analysis method to improve the classification performance finds important parameters for accurate treatment and diagnosis, Which is a feature selection procedure that finds key attributes through reduction or transformation of characteristics.

Feature extraction can be classified into Unsupervised Learning or Supervised Learning depending on whether class information is used for learning. Principal Component Analysis (PCA) or Independent Component Analysis (ICA), which is mainly used in the non-supervised learning method, can extract qualities by considering the characteristics of variables. The supervisory method is a method of selecting variables using statistical significance between class information and variables or correlation between variables. This method can calculate the key properties through the performance applied to the classifier by sequentially adding or removing the features in forward or backward directions in a given feature set.

The module for performing the learning with the pre-processed result and generating the patient's model is a procedure for classifying the selected features by each class through an appropriate classifier.

In the present invention, an artificial neural network is used, and it is applied to various fields such as pattern recognition, function approximation, and classification technique because of its characteristics of determining behavior according to input and output. An artificial neural network is composed of several layers, nodes, and neural network connection weights. The neural network interlayer connection scheme used in the present invention is a feed-forward scheme. Based on the input pattern, the neural network connection weights for each node and the activation function were used to calculate the output value. If the estimated value is different from the actual result value through the generated combination information, the process of comparing the calculated value with the actual result value is repeatedly found to reduce the error.

Methods for generating the patient's model include linear models, support vector machines, neural networks, classification and regression trees, ensemble learning methods, Wherein the biomolecule is selected from the group consisting of discriminant analysis, nearest neighbor method, Bayesian networks, and independent components analysis. Lt; / RTI >

For most of the diseases for which an accurate and comprehensive mechanism has not been established, the case-based diagnosis is very important. However, the existing case - based machine learning reasoning system designed for specific machine learning techniques has low accuracy and development of improved system is continuously required. In addition, the existing system is designed only as a disease discriminator using all learned clinical test items, and does not provide a method to utilize the importance or priority of clinical test items for each disease.

The present invention relates to a system for diagnosing diseases and selecting test items using case-based machine learning reasoning for supporting a doctor's accurate diagnosis of diseases, and a neural network (a neural network) The present invention relates to a system for identifying a disease by analyzing test information of a new patient through a learning machine disease discriminator and selecting and providing a least important test item for final diagnosis of each disease by preliminary diagnosis. Diagnosis of disease through machine learning reasoning is composed by applying machine learning method individually. Methods for generating the patient's model include linear models, support vector machines, neural networks, classification and regression trees, ensemble learning methods, Discriminant analysis, nearest neighbor method, Bayesian networks, and independent components analysis.

The configuration and practical application of this system can be divided into two parts. It consists of a stand alone diagnostic system for diagnosis only and an integrated system linked with existing hospital information system such as OCS, PACS, LIS, etc. can do. For interworking with the integrated system, the system must be configured according to the HL7 and DICOM specifications. This system is an initial model and it is linked with PMS (Patient Monitoring System) to increase the accuracy of diagnosis. In addition, PMS, OCS, EMR, PACS and other systems linked to a variety of medical information developed by developing a more accurate diagnosis system that includes various disease factors can be developed.

According to the present invention, there is provided a biomolecule information analyzing system comprising: a module for receiving the biomolecule information of a patient group and the biomolecule information data of a control group and constructing a database; A module for performing preprocessing in the analysis system using the input information data; A module for generating a patient's model with the pre-processed result; A module that loads the generated model and applies the resultant to a patient who visited the patient to perform a diagnosis that is a blind test; And a module for evaluating the performance of the system through cross validation; The present invention also provides a method and apparatus for analyzing biomolecules.

The present invention can confirm the biological meaning of a biomolecule in a biological sample by analyzing the biomolecule using a nucleic acid analysis technique, and can detect it with high sensitivity by fluorescence. Furthermore, by analyzing various biomolecules in a single test, the method provides a method for efficiently determining the difference between individuals, such as a change in phenotype, sensitivity to disease, and response to a therapeutic agent in a biological sample.

FIG. 1 is a schematic view showing a method of separating and purifying a nucleic acid such as DNA and amplified nucleic acid 1 which is an amplifiable protein-directed nucleic acid 1 which is formed by reacting a protein with a nucleic acid indicator 1 after separating a nucleic acid and a protein from a biological sample, And then amplified nucleic acids 2 and 3 are prepared using an oligonucleotide which is completely complementary to a specific region of a specific nucleic acid to analyze biomolecules and analyze the biological meaning thereof.
2 is a complex formed by a substance binding to a specific ligand separated from a biological sample and a nucleic acid indicator 1,
FIG. 3 is a diagram for analyzing a specific substance by a nucleic acid analysis technique by preparing an amplified nucleic acid 1 capable of capturing and binding a substance bound to a specific ligand in a solution to a magnetic ligand and a nucleic acid-indicating nucleic acid 1,
FIG. 4 is a view for quantitatively analyzing a specific nucleic acid after converting a specific double-stranded nucleic acid into a partial double-stranded nucleic acid by binding a specific nucleic acid separated from a biological sample to an indicator nucleic acid 2,
FIG. 5 is a general flowchart for performing a specific gene mutation analysis using a nucleic acid analysis technique with a nucleic acid 3 that is completely complementary to a specific region of a target nucleic acid separated from a biological sample,
6 is a general flowchart for analyzing the presence or absence of target nucleic acid methylation separated from a biological sample,
FIG. 7 is a diagram showing a specific protein, a specific nucleic acid and a specific gene mutation reacted with an indicator nucleic acid to convert into an amplified nucleic acid and analyzing the amplified nucleic acid by a real-time PCR method,
FIG. 8 is a diagram for analyzing biomolecules by analyzing signals generated by hybridizing a target probe having a labeling substance with an acquisition probe on an array,
Figure 9 is a plot of platelets, mRNA, DNA mutations, and acquisition probes corresponding to IL17 and IL17RA corresponding to presence or absence of methylation,
FIG. 10 shows partial double-stranded nucleic acids and complete double-stranded nucleic acids prepared using oligonucleotides to analyze the protein, mRNA, DNA mutation and methylation corresponding to IL17 and IL17RA, and then PCR was performed using these as a template and signal primers And the target probe obtained by amplification is hybridized to the capture probe fixed to the array.

Hereinafter, a nucleic acid analysis method for analyzing a biomolecule in a biological sample composed of one or more biomolecules according to the present invention will be described in detail with reference to the accompanying drawings and embodiments. The following examples are illustrative of the present invention but are not intended to limit the scope of the invention.

The specific biomolecules used in the present invention are IL17 and IL17RA, and their protein, mRNA and DNA mutation are analyzed by a single test using an array.

IL-17 is a cytokine produced by CD17 + T cell Th17 cells, for example, a protein having an amino acid sequence represented by accession code AAH67505 or NP002181. IL-17 may also be referred to as IL-17A or CTLA-8. The IL-17 receptor refers to the cell surface protein to which IL-17 binds. As IL-17 receptor family, IL-17RA, IL-17RB, IL-17RC, IL-17RD and IL-17RE are known.

In the present invention, 'IL-17 mediated inflammatory diseases' include respiratory diseases caused or exacerbated by IL-17 secreted not only by Th17 cells but also by immunoreactive or inflammatory cells such as gamma / delta T cells, NK cells, macrophages and neutrophils; Digestive diseases; Skin disease blood vessel or metabolic disease; Osteoarthritis, and cranial nerve diseases.

Specifically, the respiratory diseases include rhinitis, nasal polyposis, asthma, bronchitis, chronic obstructive pulmonary disease, bronchiectasis, bronchiolitis, pneumonia, pulmonary fibrosis, lung cancer and the like. The gastrointestinal diseases include gastritis, esophagitis, gastritis, Inflammatory bowel disease, irritable bowel syndrome, cholangitis, pancreatitis, oral cancer, esophageal cancer, gastric cancer, colon cancer, bile duct cancer, gallbladder cancer, pancreatic cancer and the like.

The blood vessel or metabolic diseases include atherosclerosis, diabetes, gout, etc., and the osteoarthritis includes rheumatoid arthritis, osteoarthritis, osteoporosis, and the like. The neurological diseases include vascular dementia, Alzheimer's disease, degenerative brain diseases, and the like.

Quantitative analysis of protein and RNA quantification was performed using IL17 and IL17RA and the sequence information of the IL17 and IL17RA genes obtained from the GenBank data system (http: // www.ncbi.nlm.nih.gov) The accession number of IL17 is NM_002190, and the accession number of IL17RA is NM_014339).

DNA mutation analysis was performed on the SNPs of IL17 and IL17RA, and information was collected from http://www.ncbi.nlm.nih.gov/snp.

Nucleic acid methylation analysis was performed using the IL17 promoter-144 site (Thomas, R.M., et al., 2012, J Biol Chem. 287 (30): 25049-59).

The nucleotide sequence of the target nucleic acid specific region (H) Kinds Upstream oligonucleotide
(5 '- >3') Downstream oligonucleotide
(5 '- >3') line
number -actin mRNA gggcgacgaggcccagagcaagaga ggcatcctcaccctgaagtacccca One cagatcatgtttgagaccttcaaca ccccagccatgtacgttgctatcca 2 IL17 mRNA ccctcaggaaccctcatccttcaaa gacagcctcatttcggactaaactc 3 taaccggaataccaataccaatccc aaaaggtcctcagattactacaacc 4 IL17RA mRNA ggagcagaagcctcccagccactag ccttttgggctcagtctctccaata 5 gagtacaggataccacaatgcactc ttcctgcgtagagcacatgttccca 6 IL17 SNP rs10484879 AAACTCATCGTGAAGTCAAACATTCAA ATTGGAAGAAAGAGCTATAGAAAAT 7 AAACTCATCGTGAAGTCAAACATTCAC rs8193038 GGAATACTGTATATGTAGGATAGGAAA TGAAAGCTTTGGTAGGTATTTAAGT 8 GGAATACTGTATATGTAGGATAGGAAG rs8193037 TGTCACCCCTGAACCCACTGCGACACA CCACGTAAGTGACCACAGAAGGAGA 9 TGTCACCCCTGAACCCACTGCGACACG rs8193036 CCCCCCTGCCCCCCTTTTCTCCATCTC CATCACCTTTGTCCAGTCTCTATCC 10 CCCCCCTGCCCCCCTTTTCTCCATCTT rs4711998 TGTATTCCTGAGAAGGAACTATTCTCA AGGACCTGAGTCCAAGTTCATCTTA 11 TGTATTCCTGAGAAGGAACTATTCTCG rs3819025 TCATTGGTGGTGAGTCCTGCACTAACA TGCGATGCTCTTGCTGATTTGGACC 12 TCATTGGTGGTGAGTCCTGCACTAACG rs3819024 AACACCTGGCCAAGGAATCTGTGAGGA AAAGAAAGATCAAATGGAAAATCAA 13 AACACCTGGCCAAGGAATCTGTGAGGG rs3804513 CAAATGTATTTTGATCATTTGACTTCA TACAAATAAGTCTCTGTTCTGTGGA 14 CAAATGTATTTTGATCATTTGACTTCT rs3748067 TGGGCTGAACTTTTCTCATACTTAAAA TTCGTTCTGCCCCATCAGCTCCTTT 15 TGGGCTGAACTTTTCTCATACTTAAAG rs2275913 CTGCCCTTCCCATTTTCCTTCAGAAGA AGAGATTCTTCTATGACCTCATTGG 16 CTGCCCTTCCCATTTTCCTTCAGAAGG rs1974226 CTGAACTTTTCTCATACTTAAAGTTCA TTCTGCCCCATCAGCTCCTTTCTGG 17 CTGAACTTTTCTCATACTTAAAGTTCG IL17RA SNP rs151315255 GATGGCCTGCCTGCGGCTGACCTGATC CCCCCACCGCTGAAGCCCAGGAAGG 18 GATGGCCTGCCTGCGGCTGACCTGATT rs139412425 TGGATCATCTACTCAGCCGACCACCCC CTCTACGTGGACGTGGTCCTGAAAT 19 TGGATCATCTACTCAGCCGACCACCCK rs6518661 CTGTCACTAAGGAGTTAACCCCCGCAA AGCAGTTTTTCATCACATCTCTGA 20 CTGTCACTAAGGAGTTAACCCCCGCAG rs6518660 CATAGTAGATAGCAATCTATTCAACCA TTTCTAGTTTGATGGACATTTAGAT 21 CATAGTAGATAGCAATCTATTCAACCG rs5748864 gcaagttaggattagagggctgggacA tttagccccacccctttacccatca 22 gcaagttaggattagagggctgggacG rs4819554 TGGGAAGTAACGACTCTCTTAGGTGCA GCTGGGACACAGTCTCACAGACCAG 23 TGGGAAGTAACGACTCTCTTAGGTGCG rs2241049 GCATGGGAGGACCTATGGGAGGTTCCA ATAACATTCAGTAGCATCTCGGCCA 24 GCATGGGAGGACCTATGGGAGGTTCCG rs2241046 ATGCTATTTTCCCTTTTTCCTCTGTTC TCATTGCAGAACCAATTCCGGGTAA 25 ATGCTATTTTCCCTTTTTCCTCTGTTT rs2229151 CACCCCCTCTACGTGGACGTGGTCCTA AAATTCGCCCAGTTCCTGCTCACCG 26 CACCCCCTCTACGTGGACGTGGTCCTG rs882643 ACGCTTTCCCCAACCACAATCCTTCAC CTCAGGCATCTCCTCGGGGATCCCC 27 ACGCTTTCCCCAACCACAATCCTTCAG rs879577 TCAGCGGTGGGGGGATCAGGTCAGCCA CAGGCAGGCCATCTAAGGAAACAAG] 28 TCAGCGGTGGGGGGATCAGGTCAGCCG rs879576 TGGTCGGCTGAGTAGATGATCCAGACC TTCCTGGGCTTCAGCGGTGGGGGGA 29 TGGTCGGCTGAGTAGATGATCCAGACT rs879576 TGGTCGGCTGAGTAGATGATCCAGACC TTCCTGGGCTTCAGCGGTGGGGGGA 30 TGGTCGGCTGAGTAGATGATCCAGACT rs721930 GTTCTGAGGGGTGATTAGGGAGGAGAC TTTAGTTTAACTTGGAGTCCTTCAG 31 GTTCTGAGGGGTGATTAGGGAGGAGAG IL17 Abtamer ggucuagccggaggaguc aguaaucgguagacc 32 IL17RA Aptamer ACGCGCTAGGATCAA AGCTGCACTGAAGTG 33 IL17 methylation
(Promoter
144 position) tcaaatcaattttaacatta
tctacaacaag gtcatacttgtgggctgga gaccaaaagcc 34 tcaaatcaattttaacatta
tctacaacaaa

The complementary base sequence of the capture probe and the capture probe (zip-code base sequence indicating ligand) Kinds The acquisition probe 5 '? 3' The complementary base sequence (5 '- > 3') of the capture probe One GATTTGTATTGATTGAGATTAAAG CTTTAATCTCAATCAATACAAATC 2 TGATTGTAGTATGTATTGATAAAG CTTTATCAATACATACTACAATCA 3 GATTGTAAGATTTGATAAAGTGTA TACACTTTATCAAATCTTACAATC 4 GATTTGAAGATTATTGGTAATGTA TACATTACCAATAATCTTCAAATC 5 GATTGATTATTGTGATTTGAATTG CAATTCAAATCACAATAATCAATC 6 GATTTGATTGTAAAAGATTGTTGA TCAACAATCTTTTACAATCAAATC 7 ATTGGTAAATTGGTAAATGAATTG CAATTCATTTACCAATTTACCAAT 8 GTAAGTAATGAATGTAAAAGGATT AATCCTTTACATTCATTACTTAC 9 GTAAGATGTTGATATAGAAGATTA TAATCTTCTATATCAACATCTTAC 10 TGTAGATTTGTATGTATGTATGAT ATCATACATACATACAAATCTACA 11 GATTAAAGTGATTGATGATTTGTA TACAAATCATCATCACTTTTAATC 12 AAAGAAAGAAAGAAAGAAAGTGTA TACACTTTCTTTCTTTCTTTCTTT 13 TTAGTGAAGAAGTATAGTTTATTG CAATAAACTATACTTCTTCACTAA 14 AAAGTAAGTTAAGATGTATAGTAG CTACTATACATCTTACTATACTTT 15 TGAATTGATGAATGAATGAAGTAT ATACTTCATTCATTCATCAATTCA 16 TGATGATTTGAATGAAGATTGATT AATCAATCTTCATTCAAATCATCA 17 TGATAAAGTGATAAAGGATTAAAG CTTTAATCCTTTATCACTTTATCA 18 TGATTTGAGTATTTGAGATTTTGA TCAAAATCTCAAATACTCAAATCA 19 GTATTTGAGTAAGTAATTGATTGA TCAATCAATTACTTACTCAAATAG 20 GATTGTATTGAAGTATTGTAAAAG CTTTTACAATACTTCAATACAATC 21 TGATTTGAGATTAAAGAAAGGATT AATCCTTTCTTTAATCTCAAATCA 22 TGATTGAATTGAGTAAAAAGGATT AATCCTTTTTACTCAATTCAATCA 23 AAAGTTGAGATTTGAATGATTGAA TTCAATCATTCAAATCTCAACTTT 24 GTATTGTATTGAAAAGGTAATTGA TCAATTACCTTTTCAATACAATAC 25 TGAAGATTTGAAGTAATTGAAAAG CTTTTCAATTACTTCAAATCTTCA 26 TGAAAAAGTGTAGATTTTGAGTAA TTACTCAAAATCTACACTTTTTCA 27 AAAGTTGAGTATTGATTTGAAAAG CTTTTCAAATCAATACTCAACTTT 28 TTGATAATGTTTGTTTGTTTGTAG CTACAAACAAACAAACATTATCAA 29 AAAGAAAGGATTTGTAGTAAGATT AATCTTACTACAAATCCTTTCTTT 30 GTAAAAAGAAAGGTATAAAGGTAA TTACCTTTATACCTTTTCTTTTTAC 31 GATTAAAGTTGATTGAAAAGTGAA TTCACTTTTCAATCAACTTTAATC 32 GTAGATTAGTTTGAAGTGAATAAT ATTATTCACTTCAAACTAATCTAC 33 AAAGGATTAAAGTGAAGTAATTGA TCAATTACTTCACTTTAATCCTTT 34 TGAAATGAATGAATGATGAAATTG CAATTTCATCATTCATTCATTTCA

The base sequence of the universal PCR primer The forward primer (5 '- > 3') The reverse primer (5 '- > 3') P1: 5-ACTTCGTCAGTAACGGAC-3 P3: 5-GTCTGCCTATAGTGAGTC-3 P2: 5-GAGTCGAGGTCATATCGT-3

EXAMPLES 1. Preparation of biomolecules

Biomolecules were isolated from AllPrep DNA / RNA / Protein Mini kit (Qiagen, USA) from tissue samples made of cells or cells. In the present invention, human cartilage tissue (Promocell, Germany) was used as a biological sample. After the cartilage tissue was dissolved in the buffer provided in the manufacturer, the dissolved sample was treated on the column and centrifuged to bind the DNA to the column membrane and harvest the filtered solution. DNA separation in the column membrane was performed by washing the column with the DNA, extracting the DNA from the membrane, and harvesting the DNA by centrifugation. The harvested filtrate solution was processed into a column provided by the manufacturer, and the proteins were harvested by precipitation and centrifugation of the proteins in the filtered solution. In addition, the RNA in the column was washed, the RNA in the membrane was extracted, and then harvested by centrifugation.

Example 2. Preparation of indicated nucleic acid

2-1. Indicated nucleic acid 1 for protein analysis

2-1-1. Antibody and Abdominal Directed Nucleic Acid 1

IL-17 (Catalog No. BAF317) and IL17RA (Catalog No. BAF177) biotin-antibodies were purchased (R & D Systems Inc., USA) for the production of the protein-antibody analyte ligand complexes for quantitative analysis of specific proteins in the cartilage tissue.

The aptamers used for preparing the protein-platemporal complex to quantitatively analyze a specific protein in the cartilage tissue are IL17 (Korean Patent No. 10-1276519-0000) and IL17RA (Chen, L., et al. 2011, Osteoarthritis and Cartilage 19; 711-718). The nucleotide sequences are shown in Table 4. IL17 and IL17RA biotin-aptamer were prepared by organic synthesis (Bioneer. Korea).

The nucleotide sequence of IL17 and IL17RA squid Kinds The base sequence (5 '- > 3') Remarks IL17 GGUCUAGCCGGAGGAGUCAGUAAUCGGUAGACC IL17RA ACGCGCTAGGATCAAAGCTGCACTGAAGTG

Wherein the configuration of the biotin-nucleic acid portion of the antibody-directed nucleic acid for protein quantification is represented by the following general formula (I): < EMI ID =

5'-biotin-P1-T-P3-3 '(I)

In the above general formula (I), P1 is a region completely complementary to the forward primer in the signal primer pair and T is used to identify the target single-stranded nucleic acid as a completely complementary binding region with the capture probe, The probe can be designed to be suitable for use with the probe. P3 is a region that completely complementarily combines with the reverse primer in the signal primer pair.

The prepared biotin-antibody and biotin-abtamer were linked to the biotin-nucleic acid moiety with avidin to prepare a construct. The former was referred to as antibody-directed nucleic acid 1 or the latter as abatamer-directed nucleic acid 1. The biotin-oligonucleotide was added to 100 μl of biotin-antibody (10 μg / ml) and allowed to stand at room temperature for 30 minutes while adding avidin (7.2 μg / ml) to prepare antibody-indicating nucleic acid 1.

2-1-2. Antibody-directed nucleic acid 1 for solution capture reaction

In order to analyze a specific substance by a nucleic acid analysis technique using two ligands binding to a specific substance, the production of the indicator nucleic acid 1 was performed by using a polyclonal antibody IL17 antibody and a biotin-IL17 antibody (R & D Systems Inc. USA) (Streptavidin magnetic bead) (Thermo Scientific, USA) were combined to prepare labeled nucleic acid 1 by binding a designed ligand (biotin-IL17 antibody (R & D Systems, USA) and biotin-designed oligonucleotide Respectively.

2-2. Inducible nucleic acid 2 for nucleic acid analysis

Wherein the configuration of the upstream oligonucleotide for nucleic acid quantitative analysis is represented by the following general formula (II):

5'-P1-H-3 '(II)

In the above formula (II), P1 is a region that completely complementarily binds to the forward primer in the signal primer pair and H is a substantially complementary hybridization sequence region with the target nucleic acid to be hybridized.

Wherein the configuration of the downstream oligonucleotide is represented by the following general formula (III):

5'-H-T-P3-3 '(III)

In the above general formula (III), H is a human specific region in which the complementary binding is completely complementary to the base sequence following the position at which the 3'end of the upstream oligonucleotide binds to the target nucleic acid, T is the capture probe and complete To identify the target single-stranded nucleic acid as a complementary binding region, and can be designed to be suitable as a probe used in a hybridization reaction. P3 is the region that completes the complementary binding with the reverse primer in the signal primer pair.

H of the above general formulas (II) and (III) are as shown in Table 2, and specific nucleotide sequences of β-actin, IL17 and IL17R mRNA of Tables 1 and 2 are shown in Table 2, Organic synthesis (Bioneer, Korea)

2-3. Inducible nucleic acid 3 for gene mutation analysis

Characterized in that the goodness of the upstream oligonucleotide for the target nucleic acid mutation analysis is represented by the following general formula (IV):

5'-P2-H-V-3 '(IV)

In the above general formula (IV), P2 is a region in which the forward primer completely complementarily combines in the signal primer pair, H is a mutation adjacent specific region having a completely complementary hybridization sequence with the target nucleic acid to be hybridized, and V is a nucleotide variation The corresponding mutation specific region is two or more upstream oligonucleotides.

Wherein the structure of the downstream oligonucleotide is represented by the following general formula (V):

5'-H-T-P3-3 '(V)

In the above general formula (V), H is a mutation adjacent specific region that completely complementary binds to the target nucleic acid, and T is a region that completely complementarily binds to the capturing probe and identifies a single-stranded nucleic acid having a mutation-related nucleotide And can be designed to be suitable as a probe used in a hybridization reaction. P3 is the region that completes the complementary binding with the reverse primer in the signal primer pair.

H of the general formula (IV) and the general formula (V) are the SNPs of IL17, SNPs of IL17R and the specific nucleotide sequence of methylation of IL17 and T of [Table 2] and [Table 3] (Bioneer, Korea).

Example 3. Preparation of single-stranded nucleic acid for quality control

The reference material consists of five plant-specific proteins, A, B, C, D and E, obtained from http://genomics.msu.edu/plant_specific/ [see Table 5].

Plant-specific protein Kinds Locus Contents Accession number A At1g65390.1 defense / immunity protein GO: 0003793 B At5g39310.1 cell elongation GO: 0009826 C At4g15910.1 Drought-Induced Protein (Di21) GO: 0009414 D At1g12860.1  Bhlh Protein GO: 0003677 E At4g02530.1 Chloroplast Thylakoid Lumen Protein GO: 0009543

The selected five plant-specific proteins were expressed using the Escherichia coli expression system, and the expressed proteins were isolated and analyzed by standard SELEX method (Ellington, AD and JW Szostak, 1990). In vitro selection of RNA molecules that bind specific L. Green, S. Macdougal, and D. Tasset, Nature, 346: 818-822; Gold, L., P. Allan, J. Binkley, D. Brown, D. Schneider, SR Eddy, 1993. RNA: the shape of things to come, pp. 497-510. In: RF Gestelend and JF Atkins (eds.), The RNA World, Cold Spring Harbor Press, Cold Spring Harbor, NY) Single stranded nucleic acid.

The biotin-oligonucleotide was named as a single-stranded nucleic acid with a degree of control. The biotin-oligonucleotide was prepared from the biotin-controlled single-stranded nucleic acid corresponding to the single-stranded nucleic acid and the biosynthesis- A construct prepared by linking a biotin-oligonucleotide with avidin to a biotin-qualified single-stranded nucleic acid was referred to as a quality-controlled ligand.

Example 4. Preparation of amplified nucleic acid

4-1. Amplified nucleic acid 1

4-1-1. ELISA plate capture reaction

A microtiter well containing 100 μl of the protein solution separated from the cartilage tissue prepared above was coated with 0.05 M carbonate buffer (pH 9.6) at 4 ° C overnight or at 37 ° C for 2 hours.

Wells were washed twice with phosphate buffered physiological saline with 3% skim milk powder, 0.1 mM ethylenediaminetetraacetic acid, 0.02% sodium azide block (180 / well) and phosphate buffered saline - tween twice, 100 핵 of nucleic acid 1 (10 / / ml) was added and cultured at 37 캜 for 2 hours. The wells were washed 5 times for 5 minutes with a twin-phosphate buffered saline solution and then rinsed 4 times for 5 minutes with distilled water to remove non-specifically bound biotin-oligonucleotides. About 50 μl of the PCR reaction solution was added to the wells, and the biotin-oligonucleotides were pre-denatured at 96 ° C for 3 minutes in order to separate bound biotin-oligonucleotides. The contents in each well were transferred to a 500 μl Eppendorf tube, stored and used as target nucleic acid DNA by protein quantification.

4-1-2. Solution capture reaction

 A magnetic ligand-IL17-directed nucleic acid 1 complex formed by reacting IL-17 magnetic ligand and IL17 indicator nucleic acid 1 in a sample containing IL-17 in a well as in FIG. 3 was harvested with a magnet. The harvested complexes were transferred to new tubes and stored as amplified nucleic acids for protein quantification. In this method, the complex can be harvested using the magnetic force during the easy washing with the washing solution, so that the indirect effect by the non-specific binding material can be minimized.

4-1-3. Abtamer

100 μl of the prepared biotin-IL17 abtamer (10 μg / μl) and 100 μl of biotin-IL17RA abtamer (10 μg / μl) were kept at room temperature for 30 minutes while avidin (7.2 μg / - oligonucleotide (10 占 퐂 / 占 퐇) was added to prepare an platamer-avidin-oligonucleotide construct, which was referred to as an platamer assay ligand.

The protein solution separated from the prepared cartilage tissue was treated and fixed on a nitrocellulose disk and treated with the protein-attached disk and the IL17 and IL17RA platelet indicator nucleic acid in a CELEX buffer for 30 minutes, A purified protein-abstamase-directed nucleic acid complex was prepared by washing the non-specifically bound plasmalamer with the formation of a rat analyte-ligand complex, and used as an amplified nucleic acid for quantitative analysis of proteins.

4-2. The amplified nucleic acids 2 and 3

4-2-1. RNA

To analyze quantitative analysis and variation of specific RNA, 10 ng of total RNA purified from cartilage tissue, dT ₂₀ primer (100 pmoles / 20 μl reaction product of bioneer), 200 μl reaction solution of MMLV reverse transcriptase (200 U / ), 2 [mu] l of 10x Reaction Buffer, RNasin (Promega, USA); 15 U / 20 반응 reaction solution) and betaine (Sigma, USA); 500mM / 20μl reaction solution) were mixed to prepare a reverse transcription reaction solution. The reaction was carried out at 42 ° C and 52 ° C for 10 minutes, 20 minutes, 40 minutes, 60 minutes, 2 minutes at 37 ° C, and 3 minutes at 50 ° C. The reaction was repeated twice, four times, eight times, and twelve times in a cycle of 4 times, 8 times, 12 times, 1 minute at 37 ° C, 3 minutes at 47 ° C, and 1 minute at 55 ° C. Respectively. The resulting cDNA was used as the following target nucleic acid.

4-2-2. DNA mutation

Genomic DNA was extracted from cartilage tissue using a kit to analyze the presence or absence of methylation of a specific DNA in the cartilage tissue. The concentration of the genomic DNA was measured using Nano Drop and used as a target nucleic acid for DNA mutation analysis.

4-2-3. Methylation

To analyze the presence or absence of methylation of specific DNA in the cartilage tissue, genomic DNA was extracted from cartilage tissue using a kit and its concentration was measured using Nano Drop. About 1 ~ 2 ㎕ of the extracted DNA was mixed with 0.5 N sodium hydroxide to make 16 캜 and reacted at 37 캜 for 15 minutes to transform the DNA into a single stranded form. Then, 3.5 M sodium bisulfite and 0.01 M hydroquinone reagent were added and the reaction was carried out at 56 ° C for 16 hours. Then, the precipitated reaction with ethanol was performed to concentrate only the transformed DNA, and then pure water was separated and dissolved with tertiary distilled water at 50 ° C. Then, sodium hydroxide was added to a concentration of 0.1M, and the reaction was allowed to proceed at room temperature for 15 minutes. And then concentrated again by ethanol precipitation. Finally, the solution was dissolved in tertiary distilled water at 30 ° C and stored at 20 ° C, and used as a target nucleic acid for the presence or absence of methylation.

4-2-4. Manufacture of amplified nucleic acids 2 and 3

The method for producing the amplified nucleic acid in the nucleic acid containing the indicated nucleic acid to be analyzed in the RNA and DNA separated from the cartilage tissue is as follows.

In Example 4-2, isolated RNA was transformed into reverse transcriptase for RNA quantitation, isolated genomic DNA for DNA mutation analysis, and nucleotide sequence reflecting genomic DNA methylation information for methylation analysis Of the target DNA was prepared.

The amplified nucleic acid was prepared by performing a hybridization reaction between the DNA and the two oligonucleotides to prepare a partial double stranded nucleic acid and then a partial double stranded nucleic acid to complete double stranded nucleic acid.

The reaction mixture was denatured at 95 ° C for 1 minute, 70 ° C for 1 minute, 68 ° C for 1 minute, 66 ° C for 1 minute, and 64 ° C for 3 minutes The cycle proceeded to 10 times.

The 10-ml reaction solution contained 20 mM TrisHCl (pH 7.6), 25 mM sodium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, 1 mM NAD +, 0.1% Triton X-100, the upstream oligonucleotide prepared in Example 2 and the downstream oligonucleotide ), 1 unit Taq DNA ligase (New England Biolabs, MA, USA) and 100 μg DNA prepared as described above.

Example 5. Amplification reaction

The amplification reaction was performed at 95 ° C for 10 seconds, at 56 ° C for 10 seconds, and at 72 ° C for 20 seconds for 42 cycles after denaturation at 95 ° C for 3 minutes using PCR apparatus in 20 μl of the reaction solution below. The 25-ml reaction solution contained 10 mM TrisHCl (pH 8.6), 50 mM KCl, 2.5 mM MgCl2, 5% (V / V) glycerin, 1 U Taq DNA polymerase, 1 pmol forward signal primer Mutation analysis consisted of P1 and P2), 20 pmol reverse signal primer (P3), and 2 ml of the reaction solution of Example 3.

The signal primer for quantitative analysis is a signal primer that has a completely complementary bond to a single-stranded nucleic acid having a nucleotide sequence corresponding to an amplified nucleic acid, such as a forward primer (P1) and a target nucleic acid reverse primer (P3) .

The signal primer for the mutation analysis is a universal PCR primer corresponding to the mutation of the target nucleic acid, and the forward signal primer is labeled with Cy3 (P1 primer) or Cy5 (P2 primer) labeling substance and two or more, and the downstream primer Is composed of a universal PCR primer (P3). The nucleotide sequences of the universal PCR primers are shown in Table 2.

Example 6. Fabrication of arrays

In order to identify the target nucleic acids, the above-mentioned capture probes were provided with oligomers having base sequences corresponding to the target nucleic acids (Table 3), and the capture probes prepared by organic synthesis (Bioneer) were fixed to the array according to FIG.

When designing the downstream oligonucleotides, the capture probes in Table 3 were directed to specific regions of the target nucleic acid that completely complementary bind the downstream oligonucleotides in Table 4.

Specifically, the type 1 capture probe of [Table 1] has a completely complementary binding site of the downstream oligonucleotide of the β-actin mRNA having the sequence number 1 of [Table 2], the type 3 of the [Table 1] The capture probe was designed to direct the region of complete complementarity of the downstream oligonucleotide of IL17 mRNA, SEQ ID NO: 3 in [Table 2].

The array can be manufactured by using a microarrayer system, and each trapping probe is dissolved in a buffer to adjust the concentration. At this time, the humidity in the layer is maintained at 70 to 80% to perform spotting do. The substrate may be coated with an amine group or an aldehyde group. For example, an array is prepared by arranging the above-described acquisition probes in a predetermined order using a UltraGAPSTM Coated Slide (Corning) as a glass slide coated with GAPS (Gamma Amino Propyl Silane).

The spotted slides are left in a humidified chamber and then baked in a UV crosslinker.

As such, the array according to the present invention can be obtained by immobilizing captured single-stranded nucleic acids on a glass slide in a manner well-known in the related art, immediately after centrifuging the slides, and storing them in a state of being shielded from light until use .

Example 7. Array Hybridization and Analysis

Target probes comprising a base sequence of the specific region of the target nucleic acid in Table 1 and a region that makes a complete complementary binding with the capture probe were treated with the capture probe of the array of the present invention and hybridized at 60 ° C for 4 to 12 hours Lt; RTI ID = 0.0 > 42 C < / RTI >

At this time, the hybridization solution contains 1 M sodium chloride, 0.3 M sodium citrate, 0.5% SDS or 100 μg / μl salmon sph DNA, 0.2% bovine serum albumin or single stranded nucleic acid. After performing hybridization, the array was washed with wash solution.

The composition of the washing solution is, for example, 1X SSC + 0.2% SDS, 1X SSC + 0.2% SDS, 0.5X SSC + 0.2% SDS and 0.01X SSC + 0.2% SDS. Respectively.

Example 8. Real-time PCR

In order to analyze the biomolecule by the nucleic acid analysis technique, the amplified nucleic acid present signal was amplified. For the detection analysis, the corresponding primer and amplified template amplified nucleic acid were mixed according to the real time PCR reaction liquid composition in Table 6, Real-time PCR was performed under the conditions of PCR reaction. Real-time PCR instrument was 7500 FAST real-time PCR (Applied biosystems; USA).

Reaction solution composition of real-time PCR Name Concentration volume Forward primer 4 pmol / μl 1 μl Reverse primer 4 pmol / μl 1 μl 2x master mix 10 μl Template DNA 2 μl Distilled water 5.6 μl Sybr Green I 0.4 μl Sum 20 μl Premix Ex Taq (2X, Perfect Real time, Takara)

Reaction conditions of real-time PCR Temperature time cycle 95 ℃ 1 minute 1 time 95 ℃ 15 seconds 45 times 60 ° C 1 minute

Example 9. Spot detection and analysis of nucleic acid chips

After the washing of Example 6 was completed, the glass slide was dried by centrifugation, and then a laser scanner (GenePix4000, manufactured by Fuji Photo Film Co., Ltd.) having a suitable wavelength laser (Cy5, 635 nm) for exciting the used fluorescent dye, Axon). The fluorescence images were stored in a multi-image TAG (TIFF) format and analyzed with appropriate image analysis software (GenePix Pro 3.0, Axon).

8, which is an example obtained by the above experiment, protein quantitative analysis, quantitative analysis of mRNA, analysis of DNA mutation and analysis of DNA methylation can be performed on a living body sample with spot fluorescence on the array.

FIG. 9 shows partial double-stranded nucleic acids and complete double-stranded nucleic acids prepared using oligonucleotides to analyze protein, mRNA and DNA mutations corresponding to IL17 and IL17RA, and then PCR and labeling and amplification thereof with a signal primer as a template And an obtained target probe is hybridized to the acquisition probe fixed to the array.

In FIG. 10, the degree of fluorescence of the spot varies depending on the nature of the double strand formed by the target probe having the capture probe and the labeling substance, and is determined according to the signal of the target probe having the labeling substance in a spot composed of a single acquisition probe.

The base sequence of the target probe and the array capture probe with the labeling substance originating from the amplification product obtained by PCR with the target nucleic acid in the biomolecule is determined by the double-stranded stability of the single-stranded nucleic acid-capture probe, The amount of target probe affects the degree of fluorescence.

Therefore, in quantitative analysis of biomolecules, the degree of fluorescence in FIG. 9 represents the amount of the target probe having the labeling substance, and the amount of the target probe having the labeling substance is the amount of the biomolecule corresponding to the target nucleic acid in the biological sample .

When the target probe is prepared as a signal primer which is labeled with Cy3 and Cy5 as the labeling materials, which are different from each other, the target nucleic acids separated from the control sample and the sample of the experimental sample, that is, - The color spectrum of the red color appears as the ratio of the target probe labeled with Cy-3 attached to the capture probe and the target probe labeled with Cy-5, and the degree of color spectrum of the specific spot is measured by the control sample This corresponds to the presence of specific biomolecules in old samples.

In the case of analysis of a specific gene mutation, a specific gene mutation in the nucleic acid can be identified in a biological sample containing a nucleic acid having a specific gene mutation corresponding to the spot from the color spectrum of the spot. Since the amplification products are generated only when the complementary nucleotide of the specific region of the nucleic acid is completely complementary and a target probe is formed using the template as a template, the color spectrum of the spot is finally analyzed to check the degree of all the spots in the array Variations of specific genes can be identified in biological samples. That is, in FIG. 7, the red spot is generated by the Cy5 labeling substance, which indicates that SNP corresponding to the acquisition probe on the array in the biological sample corresponding to the signal primer P2 related to the mutation exists.

The signal primer P1 corresponding to the methylation specific methylation specific upstream oligonucleotide P1 is Cy3 and the signal primer P2 corresponding to the unmethylated upstream oligonucleotide P2 is labeled with Cy5. In FIG. 7, the IL17 methylation spot is blue. IL17 promoter 144 position cytosine is methylated.

Example 10. Analysis of biomolecules including non-tagged molecules of E. coli

10-1. Amp ^R  Production of oligonucleotides for gene analysis

The structure of the oligonucleotide for analyzing the Amp ^R gene in the plasmid pUC19 was synthesized by designing the upstream oligonucleotide and the downstream oligonucleotide according to the formula (IV) and the formula (V) as shown in [Table 8] Biona, Korea).

Oligonucleotides for the analysis of Amp ^R gene Item The base sequence (5 '- > 3') Upstream oligonucleotides (wild type) 5-GCAGCACTGCATAATTCTCTTACTGTCAT G-3 Upstream oligonucleotides (mutated) 5-GCAGCACTGCATAATTCTCTTACTGTCAT A -3 Downstream oligonucleotide 5-CCATCCGTAAGATGCTTTTCTGTGACTGGT-3

10-2. Production of surface marker molecule-directed nucleic acid

The nucleotide sequences of the E. coli -binding single-stranded nucleic acids proposed by the present inventors (see Korean Patent No. 10-0730359) are shown in Table 9, and the biotin-single-stranded nucleic acid ligands and the biotin-oligonucleotides are represented by the general formula I) by referring to [Table 2] and [Table 3] (Biona, Korea)

Base sequence of abtamer bound to the surface molecule of Escherichia coli Serial number The base sequence (5 '- > 3') One cgcaguuugc gcgcguucca aguucucuca ucacggaaua 2 acacugcgug cuuacgacuu cuggucccau cauucggcua 3 aguucgauga gggugacacc gccaggagug uuugcuagac 4 acccgucgau aaugacugaa cuuccucuau cuuaaagggg 5 ggguaagggg auguuucugg gauucaagcg ccugauucug 6 ucuguauuug uacgcaccga agauaagaga gggaguggau 7 caugggcggg ccgcggucua uucgggauua uugcggaucc 8 ucagggugug aaguucuucc gcgcuagugg cuuguauguu 8 gucgggguug caaggcgucg uagcguguau uugugauggu 10 gcguaugggc gggucauuag gacaauuuaa ccacucgcga 11 auugucugug ugacuagucg gucuagugug ggggagaaga 12 uuaccacuga guuaauuugu acggucugcg guguacuuua 13 gcuaucaaua uuauagaggc ggucggggua gugucaucgu 14 uaggagagcg ggagcugaga acuuagaggc gccgauacac 15 gacguauuac aguuaaguug gcgccauucg auuucugauc 16 auaccagcuu auucaauuau accagcuuau ucaauuuugu 17 ccguaagucc ggucuuccuu gcugagucgc ccuuucaggu 18 uuggugggga gggccaguua ggucuaauuu ccgacgcgca

The prepared biotin-oligonucleotide (10 μg / μl) was added to each 100 μl of avidin (7.2 μg / μl) and allowed to stand at room temperature for 30 minutes. The prepared biotin-oligonucleotide (10 μg / Avidin-oligonucleotide construct was prepared and designated as platamer-directed nucleic acid 1.

10-3. Isolation and analysis of biomolecules in amplified nucleic acid, an E. coli -induced nucleic acid complex

The plasmid-directed nucleic acid pool prepared in (Example 10-2) was reacted with the E. coli, and the amplified nucleic acid, which was an E. coli-abdomen-directed nucleic acid complex, was washed and separated by centrifugation. The amplified nucleic acid was amplified by reacting the indicator nucleic acid prepared in Example 10-1 with DNA isolated from E. coli. In a nucleic acid amplification harvested from the prepared total nucleic acid containing a single-stranded nucleic acid and the Amp ^R gene analyst the amplified nucleic acid of E. coli bound to the surface. The DNA amplified by the method of Example 5 was prepared using the amplified nucleic acid as the template as the template. The array prepared in Example 7 was analyzed by the method of Example 6 and amplified. Amp ^R gene was confirmed and the profile of the surface of the biomolecule E. coli.

Claims (19)

(a) (i) obtaining a target protein-analyte ligand complex by reacting a target protein of a biological sample to be analyzed with an analyte ligand to which an oligonucleotide is ligated to an antibody or aptamer which is a ligand that specifically binds to the target protein; ii) hybridizing the target nucleic acid of the same biological sample as the biological sample with an upstream oligonucleotide and a downstream oligonucleotide that specifically bind to the target nucleic acid, and then hybridizing the separated region between the upstream oligonucleotide and the downstream oligonucleotide To obtain a complete double-stranded nucleic acid;
(b) mixing the complex with the double-stranded nucleic acid; And
(c) simultaneously detecting the oligonucleotide of the complex and the double-stranded nucleic acid in the mixture
A method for simultaneous analysis of a target protein and a target nucleic acid in a biological sample.
The method according to claim 1,
Wherein the target nucleic acid is at least one selected from the group consisting of RNA, cDAN obtained by reverse transcription of RNA, and genomic DAN.
The method according to claim 1,
Wherein the target nucleic acid is a wild-type target nucleic acid or a mutant target nucleic acid.
The method according to claim 1,
The step (c)
(c-1) simultaneously amplifying the oligonucleotide of the complex and the double-stranded nucleic acid in the mixture; And
(c-2) simultaneously detecting an amplicon of the oligonucleotide of the complex and an amplicon of the double-stranded nucleic acid.
5. The method of claim 4,
(c-1) has a region in which the oligonucleotide of the complex and the double-stranded nucleic acid bind to the reverse primer having the same sequence as the region to which the forward primer having the same sequence binds, so that a set of forward primer Lt; RTI ID = 0.0 > primer. ≪ / RTI >
5. The method of claim 4,
The oligonucleotide of the complex has a region that enables the target protein to be specifically bound by the ligand to be identified and to identify the target protein,
Wherein the double-stranded nucleic acid has a region that allows the upstream and downstream oligonucleotides to specifically identify the target nucleic acid to which the target nucleic acid is bound,
Wherein the step (c-2) is performed by simultaneously detecting an identification region of the target protein and an identification region of the target nucleic acid in the amplification product.
6. The method of claim 5,
Wherein one of the forward primer and the reverse primer is a primer for generating a detection signal,
And the step (c-2) comprises detecting the detection signal from the amplified product.
8. The method of claim 7,
Wherein the primer generating the detection signal is a forward primer.
The method according to claim 1,
The oligonucleotide of the analyte ligand constituting the complex is capable of identifying a target protein to which a ligand binds specifically between a region to which a forward primer binds and a region to which a reverse primer binds and a ligand is specifically bound between these regions , ≪ / RTI >
Wherein the upstream oligonucleotide constituting the double-stranded nucleic acid comprises a region to which the forward primer binds and a region that specifically hybridizes to the target nucleic acid downstream of the upstream oligonucleotide,
The downstream oligonucleotide constituting the double-stranded nucleic acid includes a region for hybridizing with a downstream region of the target nucleic acid region recognized by the specific hybridization region of the upstream oligonucleotide and a region for binding the reverse primer downstream of the hybridization region and,
Wherein the region that enables the upstream and downstream oligonucleotides to specifically identify the target nucleic acid to which the target nucleic acid is bound and to identify the target nucleic acid is located between the forward primer binding region and the hybridization region of the upstream oligonucleotide or between the hybridization region of the downstream oligonucleotide Is present between the reverse primer binding regions,
The oligonucleotide of the complex and the upstream and downstream oligonucleotides of the double-stranded nucleic acid have a region in which the reverse primer of the same sequence as the region to which the forward primer of the same sequence binds,
By doing so,
The step (c)
(ci) simultaneously amplifying the oligonucleotide of the complex and the double-stranded nucleic acid in the mixture with a set of forward primer and reverse primer; And
(c-ii) simultaneously detecting the target protein identification region and the target nucleic acid identification region in an amplification product of the oligonucleotide of the complex and the amplification product of the double-stranded nucleic acid.
10. The method of claim 9,
Wherein the forward primer is a primer for generating a detection signal,
Wherein the simultaneous detection of the target protein identification region and the target nucleic acid identification region in step (c-ii) is performed by detecting the detection signal.
10. The method of claim 9,
The detecting step (c-ii)
The amplification product is treated with a microarray to which a capture probe complementary to the identification region of the target protein and a capture probe having a sequence complementary to the identification region of the target nucleic acid are adhered to induce hybridization between the capture probe and the amplification ;
Removing unhybridized amplicons; And
And detecting the detection signal from the hybridization amplification product with the capture probe.
10. The method of claim 9,
The target nucleic acid of step (a) is a target nucleic acid suspected of having a mutated sequence,
Wherein step (a) is performed by reacting an additional upstream oligonucleotide having a sequence complementary to the mutated sequence, with the target nucleic acid together with the upstream and downstream oligonucleotides,
Wherein the step (ci) is performed by adding an additional forward primer for the additional upstream oligonucleotide together with the forward primer and the reverse primer,
Wherein the additional upstream oligonucleotide comprises a region to which the forward primer binds, a region that specifically hybridizes to the target nucleic acid downstream thereof, and a sequence complementary to the mutated sequence downstream of the hybridization region,
Wherein the additional forward primer has a different sequence than the forward primer.
13. The method of claim 12,
Wherein the mutated sequence consists of from 1 to 3 nucleotides.
10. The method of claim 9,
The target nucleic acid of step (a) is a target nucleic acid having a modified sequence obtained by treating a non-sulfide with a genomic nucleic acid presumed to contain a methylated sequence,
Wherein step (a) is performed by reacting an additional upstream oligonucleotide having a hybridization region that specifically binds to the modified sequence with the target nucleic acid together with the upstream and downstream oligonucleotides,
Wherein the step (c) is performed by adding an additional forward primer for the additional upstream oligonucleotide together with the forward primer and the reverse primer,
Wherein the additional upstream oligonucleotide comprises a region to which the forward primer binds and a region that specifically hybridizes to the target nucleic acid downstream thereof and a sequence complementary to the modified sequence downstream of the hybridization region,
Wherein the additional forward primer has a different sequence than the forward primer.
10. The method of claim 9,
Wherein the target nucleic acid is a target nucleic acid presumed to contain a deleted sequence,
Wherein the upstream oligonucleotide or the downstream oligonucleotide has a sequence in which the hybridization region specifically binds to the deleted sequence.
10. The method of claim 9,
In the step (a), an external protein-analyte ligand complex is obtained by reacting one or more quantified external proteins that are not present in the biological sample with an analyte ligand to which an oligonucleotide is ligated to a ligand that specifically binds to the external protein Step < RTI ID = 0.0 >
The step (b) is performed by mixing the outer protein-analyte ligand complexes together,
(Ci) is performed by amplifying an oligonucleotide of an external protein-analyzing ligand complex together,
The step (c-ii) is performed by detecting an oligonucleotide amplification of the external protein-analyzing ligand complex together,
Wherein the amount of detection of the oligonucleotide amplification of the outer protein-analyte ligand complex is available for quantification of the target protein.
delete (a) an analyte ligand to which an oligonucleotide is ligated to a ligand that specifically binds to the target protein;
(b) a set of upstream oligonucleotides and downstream oligonucleotides that specifically bind to the target nucleic acid; And
(c) instructions describing the use of the analytical ligand and upstream and downstream nucleotides,
The oligonucleotide of the analyte ligand includes a region in which a region to which a forward primer binds and a region in which a reverse primer binds and a region in which a ligand specifically binds between these regions is indicated to enable identification of the target protein and,
Wherein the upstream oligonucleotide comprises a region to which a forward primer having a sequence identical to a region to which the forward primer of the analyte ligand oligonucleotide binds and a region to hybridize specifically to the downstream target nucleic acid,
The downstream oligonucleotide recognizes downstream of the target nucleic acid region recognized by the upstream oligonucleotide-specific hybridization region and hybridizes with the downstream region of the upstream oligonucleotide downstream of the region in which the upstream primer of the analyte ligand oligonucleotide binds Wherein the reverse primer comprises a region to which an inverted reverse primer binds,
Wherein the region that enables the upstream and downstream oligonucleotides to specifically identify the target nucleic acid to which the target nucleic acid is bound and to identify the target nucleic acid is located between the forward primer binding region and the hybridization region of the upstream oligonucleotide or between the hybridization region of the downstream oligonucleotide Lt; RTI ID = 0.0 > reverse primer < / RTI >
A kit for simultaneously analyzing a target protein and a target nucleic acid in a biological sample.
11. The method of claim 10,
Wherein the target nucleic acid is at least one selected from the group consisting of RNA, cDAN obtained by reverse transcription of RNA, and genomic DAN.

Images