KR20170101847A - Calculation Method of Molecules and Uses Thereof - Google Patents

Abstract

The present invention relates to a biomolecule analysis method using a molecule counting technology. More specifically, provided are a device and a method for determining biological identification of target molecule in biosamples through a single analysis of a plurality of target molecules contained in the biosamples. To this end, a probe, consisting of a probe capable of recognizing the target molecule and a signal production region forming patterns with various colors, is produced, and then an analysis is conducted on the probe bound to the target molecule.

Description

[0001] The present invention relates to a method of molecular counting,

The present invention relates generally to methods, kits and systems for determining target molecules, searching, quantifying and determining biological significance in biological samples in the field of searching, identifying, quantifying and determining biological significance of one or more target molecules. The present invention also relates to materials and methods for the enhancement of hue indicating barcode signals indicating target molecules.

In general, the present invention is specifically embodied by numerator coefficients in the field of biomolecular discovery, identification, quantification and determination of biological significance in a sample.

Genetic information encoded in DNA in a cell is inherited and transferred to offspring by replication of DNA itself, and genetic information is transferred from DNA to RNA and from RNA to protein. All cells are composed of biomolecules related to genetic information, and their presence pattern has an important effect on organism function.

The target molecule (biomarker) or set of target molecules is generally a clinically confirmed or trusted biomolecule for the intended intended use thereof. Biomolecules can include biomarkers that are secreted in parallel with the onset or progression of the disease, or which are destroyed by the cell, and are easily spread from the end-tissue to the tissue or lesion into the bloodstream.

It is nucleic acid and protein which are genetic material which is representative biomolecules. Chromosomal abnormalities affecting the expression process of genetic information, DNA methylation and gene variation. Genetic variations include single nucleotide polymorphism (SNP) and structural variability. SNP means a genetic change or mutation that shows the difference of one base sequence (A, T, G, C) in DNA base sequence. Structural mutations refer to DNA structural variations such as deletions, inversions, additions, and replication. Genetic mutations are known to determine individual differences, such as phenotype changes, susceptibility to disease, and response to therapeutic agents. In particular, mutations involved in disease development and progression are known as disease-associated genetic mutations (Disease-associated Genetic Variants).

Each cell has about 50,000 to 100,000 genes, but cells selectively use genes. Many of them are genes for life-sustaining activities or daily activities of cells themselves. The endogenous standard expression gene may be a gene that expresses the function of a specific gene or a gene of a specific function or the expression pattern of an organism under a specific condition and a variety of other molecular biological purposes, A variety of gene expression assays using quantitative analysis of messenger RNA (mRNA) have been developed.

A DNA microarray, which is a typical high-speed parallel analysis technique, detects a target sequence only by a hybridization method. Therefore, there is a problem that a positive result is caused by a cross-reaction, thereby improving the reliability of the hybridization signal. In addition, in the case of a conventional microarray, detection is carried out by a hybridization method, which requires a complicated cleaning process after hybridization, and a process of making a target sequence into a single strand before hybridization is indispensably required. On the other hand, since the recently announced on-chip PCR is detected by hybridization or probe extension method, it is a heterogenous assay system like existing microarrays, and real-time detection is impossible and accurate quantification is difficult.

The biomolecule may contain, in addition to nucleic acid, a protein, a peptide, a carbohydrate, a lipid, a polysaccharide, a glycoprotein, a hormone, a receptor, an antigen, an antibody, a virus, a pathogen, a toxic substance, a substrate, a metabolite, a transition state analog, But are not limited to, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues and the like. The scope of the invention is to be limited to almost any chemical or biological effector, Molecules, and it is desired to develop efficient real-time detection and precise quantitation of these.

Various biomolecular analytical methods have been developed to improve the detection sensitivity and improve the multi-analyzing ability, but they still face the technical problem of reducing the analysis cost, shortening the analysis time, improving the sensitivity and increasing the reproducibility.

Ultimately, biomolecule analysis or comprehensive analysis of biological samples can be performed by analyzing biomolecule analysis and profile related to a disease medically, biomolecules capable of diagnosing diseases, biomolecules capable of analyzing therapeutic results, Biomolecules that play an important role in development and progression, susceptibility-related biomolecules to disease, and target molecules in the development of new drugs.

As a result of studying to develop a technology capable of real-time analysis of biomolecules with improved efficiency and sensitivity by overcoming the problems of techniques for independently analyzing the conventional biomolecules described above, The object of the present invention has been achieved by developing a method for analyzing biomolecules.

SUMMARY OF THE INVENTION The present invention has been accomplished to solve the above problems, and it is an object of the present invention to provide a double-stranded nucleic acid having a signal-generating substance labeled thereon and a double-stranded nucleic acid having a signal- A signal tag, and a signal generation area composed of the same.

Another object of the present invention is to provide a method for producing the composite.

It is a further object of the present invention to provide a method for analyzing efficient biomolecules and determining biological significance.

Biomolecules are molecules that constitute and function in the living body. Major molecules such as proteins, nucleic acids, polysaccharides, and lipids are small molecules and small molecules. Organic substances such as amino acids, nucleotides, monosaccharides and vitamins, Etc., and inorganic ions. All human cells are composed of biomolecules and their presence patterns have an important effect on organism function.

Generally, biomolecules that are clinically identified, or are trusted for their intended intended use, are a set of target molecules (biomarkers) or target molecules. A biomolecule may contain target molecules that are secreted in parallel with the onset or progression of the disease or that the cells are destroyed and spread easily from the end tissues to the tissue or lesion into the bloodstream.

In the present invention, a probe is a molecule for identification and quantification of a target molecule, and a gene or a protein or a peptide, a carbohydrate, a lipid, a polysaccharide, a glycoprotein, a hormone, a receptor, an antigen, an antibody, a virus, a pathogen, , A substrate, a metabolite, a transition state analog, a cofactor, an inhibitor, a drug, a dye, a nutrient, a growth factor, a cell, a tissue and the like. Theoretically, It is meant to be all chemical or biological effectors, and molecules of any size are molecules for identification and counting of molecules that can be used.

Preferably, when the target molecule is a nucleic acid, the probe is a single-stranded nucleic acid, and in the case of a biomolecule other than the nucleic acid, the probe may be a ligand.

A ligand refers to a structure that includes a cluster of molecules or molecules that are specific for one or more ligands that bind to, interact with, or otherwise associate with, a particular substance, and that affect, alter, or nullify the function of a particular substance do. Ligands typically include antibodies, peptides, nucleic acids, and plasmids. An antibody refers to a protein molecule that specifically binds to an antigen epitope of an antigen to cause an antigen-antibody reaction. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker of the present invention, and such antibody can be prepared from the obtained protein by conventional methods. It also includes partial peptides that can be made from the protein.

Aptamers are small (20 to 60 nucleotides) single-stranded nucleic acid (DNA or RNA) fragments that are capable of binding with high affinity and specificity to a wide variety of substances, from small molecules to proteins.

When the target molecule is a nucleic acid, the probe means a nucleic acid fragment such as RNA or DNA corresponding to a nucleic acid that is a target molecule in a short period of time or a few hundred bases in a long period. The presence or absence of a specific mRNA Can be confirmed. Hybridization is performed using a probe complementary to the target molecule nucleic acid, and the presence of the target molecule nucleic acid can be predicted through hybridization. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

In the present invention, the term "nucleic acid quantitation" can be determined by measuring the amount of mRNA in the biological sample by confirming the presence or absence of mRNA and the expression level of the marker gene. RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), northern blotting (Northern blotting) blotting, or DNA microarray chip, but are not limited thereto.

Genetic variations on DNA encoding biometric information include Single Nucleotide Polymorphism (SNP) and Structural Variation. Genetic mutations are known to determine individual differences, such as phenotype changes, susceptibility to disease, and response to therapeutic agents. In particular, mutations involved in disease development and progression are known as disease- Disease-associated Genetic Variants. SNP means a genetic change or mutation that shows the difference of one base sequence (A, T, G, C) in DNA base sequence. Structural mutations refer to DNA structural variations such as deletions, inversions, additions, and replication.

Further, in the present invention, the analysis of nucleic acid methylation may include nucleotide modification of nucleic acid generated by treating bisulfite with nucleic acid. By treating the nucleic acid with bisulfite, the non-methylated cytosine residue is transformed into a uracil residue and the methylated cytosine residue is present in a state without modification. The nucleotide change before and after the treatment of bisulfite can be analyzed and the methylation of the nucleic acid can be confirmed as a result.

In the present invention, "protein quantitation" is a process of confirming the presence and the degree of expression of a target molecule protein in a biological sample. Using the antibody specifically binding to the protein expressed in the gene, Can be confirmed. Methods for this analysis include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, Rocket immunoelectrophoresis, Immunoprecipitation assays, complete fixation assays, FACS, protein chips, and the like, but are not limited thereto.

Quantification of biomolecules (DNA, RNA, proteins, viruses, bacteria) can be achieved by amplification of existing signals by enzymes and substrates such as enzyme-linked immunosorbent assay (ELISA) And nucleic acids such as RNA are based on amplified signals using nucleic acid amplification and fluorescent materials such as PCR.

Conventional methods such as amplifying existing signals or analyzing the entire amount of light have limitations in sensitivity, high-throughput and accuracy. The most accurate method for quantifying biomolecules is the most accurate method of counting biomolecules one by one. Without amplification, counting each biomolecule one by one and calculating the total sum would be as accurate as that.

The present invention provides a method and kit for identifying and quantifying target molecules at the same time by counting one or more target molecules in order to overcome the limitation of the method of analyzing biomolecules.

( US Patent No. 8,519,115 B2, and Nat Biotechnol. 2008 Mar; 26 (3): 293-4) which counts the target molecule and counts and quantifies mRNA as a biomolecule is presented, and nCounter Analysis system .

In the nCounter Analysis system, a digital color-coded barcode system is a system in which signal tags, which are short single stranded DNA (about 6.4 kb) and multiple short single stranded RNAs (about 0.9 kb) Is a color indicating barcode that is a signal region that is a structure in which a double-stranded nucleic acid is a structure in which hydrogen bonds are connected between base pairs. The structure of the nCounter Analysis system signal tag may be a DNA-RNA hybrid, and the manufacture of the signal tag may be performed by a known method. In the present invention, the structure in which the signal tag is continuously constructed is referred to as a "base pair signal generating region". The target molecule Molecule reporter is based on the form in which a signal tag, a single-stranded RNA that generates a signal, binds with a hydrogen bond of a base pair complementary to single-stranded DNA complementary to a signal generating region and a mRNA (US Patent No. 8,519,115 B2). ≪ / RTI >

The color indicating barcode of the nCounter Analysis system is a double-stranded nucleic acid in which a plurality of short single-stranded RNA (about 0.9 kb) signal tags are formed by complementary binding to a long single-stranded DNA (about 6.4 kb) .

The stability of the hydrogen bond between the base pairs constituting the double-stranded nucleic acid is influenced by temperature, pH, salt, ionic strength, and the like. The process of analyzing the target molecule of the nCounter Analysis system has an inherent limit in consideration of temperature, pH, salt, and ionic strength. In addition, the in vitro transcription method for the template can be used to produce a color-indicating barcode by a complicated manufacturing process such as various kinds of RNA manufacturing process and hybridization process of M13 DNA and manufactured RNA, there is a possibility that variation occurs.

The present invention proposes a new signal generation region to overcome the limitation of the base pair signal generation region of the nCounter Analysis system and provides a method and a kit for analyzing one or more target molecules with the first probe using the present signal generation region do.

The present invention is directed to a method and kit for analyzing one or more target molecules using a second probe to facilitate harvesting of the first probe coupled to the target molecule for efficient molecular count.

Specifically, the present invention provides a method for simultaneously identifying and quantifying one or more target molecules by analyzing a first probe and a second probe complex bound to a target molecule.

1. Constituent materials

1-1. The first probe

The present invention relates to a double-stranded nucleic acid (H signal tag) in which a signal generating substance is labeled, or a constituent unit signal tag which is a double-stranded nucleic acid (C signal tag) in which a signal generating substance is labeled and a covalent bond exists between constituent base pairs A method and kit for identifying, counting, and analyzing one or more target molecules with a first probe composed of a signal region, which is a color indicating barcode made up of a color indicator bar code.

The present invention can constitute a signal generation region with the signal tag. Preferably, the backbone of the signal tag is a double-stranded nucleic acid consisting of a hydrogen bond, or a double-stranded nucleic acid having a covalent bond between constituent base pairs. The double-stranded nucleic acid is characterized by single-stranded DNA and single-stranded DNA, single-stranded RNA and single-stranded RNA, single-stranded DNA and single-stranded RNA, single-stranded nucleic acids and single-stranded nucleic acid (PNA).

The present invention can produce the first probe using the signal generation region. The first probe may be an unfixed first probe consisting of a first probe (1 ^ST P) recognizing the target molecule and a signal generating region (SR), or a fixed first probe having additional components in the unfixed first probe There are two types.

The non-immobilized first probe may be useful for identifying and quantifying cells or viruses, and the immobilized first probe may be useful for identifying and quantifying proteins, gene mutations, methylated DNA, chromosomal anomalies, or mRNA.

The H signal tag, which is a double-stranded nucleic acid with a signal-generating substance labeled, is a double-stranded nucleic acid with a signal-generating substance labeled and a covalent bond between constituent base pairs. 1 probe.

1 shows a first probe used in the present invention.

The present invention relates to a method for producing a non-immobilized first probe by attaching a first probe (1 ^ST P) recognizing at least one target molecule to one end of a signal generation region (SR), and using one or more target molecules A method for identification and quantification, and a kit.

<1> has the structure of a first probe 5 ' non-fixed first probe (1 ^ST P) - the formula of the first probe is the signal generation region (SR) -3 'configuration is used in the present invention (I) Is as follows.

5'-1 ^ST P-SR-3 '(general formula I)

The fixed first probe of FIG. 1 includes a first probe (1 ^ST P), a fixation region (FR), a signal region (SR), and an affinity tag (AT) . The constituent unit may be coupled to the first probe by a shared or non-shared means.

The present invention is characterized in that the fixed first probe comprises a 5'-first probe (1 ^ST P) -fixed region (FR) -signal generating region (SR) -binding tag (AT) -3 ' (SR) -fixed region (FT) -first probe (1 ^ST P) -3 'structure, and a plurality of target molecules using the same are simultaneously identified and quantified.

5'-1 ^ST P-FR-SR-AT-3 '(general formula II)

5'-AT-SR-FT-1 ^ST P-3 '(formula III)

The spacer between the constituent units constituting the first probe is a single-stranded nucleic acid having a length of 5 to 1,000 nucleotides. Depending on the properties of the ligand or the target molecule binding to the reactive group of the first probe, .

The first probe is preferably a single-stranded nucleic acid or a protein, and more specifically, it includes DNA, RNA, PNA, aptamer, antigen, antibody, hapten and the like.

The reactive group of the first probe comprises a target nucleotide or any nucleophilic or electrophilic group suitable for selective coupling with a reactive group of the ligand and is selected from the group consisting of a reactive nucleophilic group diketone, acyl beta-lactam, An ester, a halo ketone, a cyclohexyldiketone group, an aldehyde or a maleimide. Other groups include lactones, anhydrides, and alpha-haloacetamides or epoxides and other known electrophilic groups. Preferred reactive groups include amino groups, carboxyl groups, thiol groups, and the like.

The fixed first probe of the present invention may include a framework, which is a fixed region (FR). The immobilization region may be preferably a structure in which single-stranded nucleic acid units are repeatedly linked with each other and covalently bonded to the signal generating region, and a unit composed of 10 to 50 nucleotides is repeatedly linked 5- to 10-unit repeating units back and forth. The base sequence is constructed to minimize the Tm (melting temperature) variation of the constituent units, and the preferred difference in Tm is 1 to 2 ° C. The base sequence of the immobilizing region may be complementary to the base sequence of the immobilizing nucleic acid molecule, thereby fixing the first probe to the solid support. The immobilized region can be bound to either the 5 'end or the 3' end of the signal generating region and serves to capture or immobilize an image or detection signal generating region, It can also be combined. Affinity of the first probe or the first probe-target complex or an oligonucleotide complementary to the first probe or the target molecule as the nucleic acid to be immobilized is used. The first probe is configured with at least one or more fixed regions serving as a binding tag for purification and / or fixation (on a solid surface).

The fixed first probe binding tag of the present invention may be biotin. Biotin is attached to the 5 'or 3' end of the signal generating region. The biotin / avidin system is widely used in biomolecule analysis because it can amplify the sensitivity by its strong affinity and signal amplification effect with avidin. In addition, biotin serves to capture or fix the image or detection signal generation region by allowing the first probe to bind to the avidin-coated solid substrate.

The biotin structure is a ureido ring that plays a major role in the strong noncovalent bond with avidin. Therefore, biotinyl derivatives of valeric acid side chains can be converted to biotinyl derivatives. Because avidin has a tetrameric structure as a glycoprotein, four biotin bonds per molecule are possible.

One of the signal generation regions can be combined with biotin and the other end with a fixed region or a spacer.

The color indicating barcode, which is a signal generating region of the present invention, is a structure in which a signal tag made of a signal generating material is a basic constituent unit, and a signal tag is continuously connected by covalent bonds so as to specifically indicate a target molecule, Lt; / RTI &gt; signal tags. The signal generating area may be used to mark signal tags with a large number of signal generating materials, and to strengthen signal strength by continuously connecting various kinds of signal tags.

(Signal tag)

The skeleton of the signal tag, which is a constituent unit of the signal generation region which is a color indicating bar code, may be a nanofiber or a double-stranded nucleic acid, and preferably, the skeleton of the signal tag may be a double-stranded nucleic acid.

An "H signal tag" can be classified into a hydrogen bond between base pairs of a signal tag constituting a double-stranded nucleic acid, and a "C signal tag" when there is a covalent bond between base pairs. C signal tag has higher stability of double stranded nucleic acid than H signal tag, so it can quantitatively analyze target molecule under various conditions.

The skeleton of the signal tag used in the present invention is a double-stranded nucleic acid. The double-stranded nucleic acid of the present invention is characterized in that the double-stranded nucleic acid comprises single-stranded DNA and single-stranded DNA, single-stranded RNA and single-stranded RNA, single-stranded DNA and single-stranded RNA, single-stranded nucleic acid and single- . Single-stranded nucleic acids constituting double-stranded nucleic acids can be prepared by organic synthesis or by enzymatic methods.

In order to prepare a single-stranded nucleic acid constituting a double-stranded nucleic acid, all four nucleotides or a mixture of modified nucleotides are added to each nucleotide addition step during the synthesis process, thereby including a nucleotide including a modified base. Any modified single-stranded nucleic acid can be used in both the above-mentioned methods, apparatus and kits.

The most representative DNA of the double-stranded nucleic acid is composed of a backbone chain and a base, all of which are linked by a covalent bond. The skeleton is a long chain like deoxyribose, a monosaccharide, linked to a phosphate. A base is a component of a nucleotide, which is a monomer of DNA or RNA. It forms a base pair through hydrogen bonding and is involved in DNA double helix formation. The main nucleotides are cytosine, guanine, adenine, thymine, and uracil, respectively, and are abbreviated as C, G, A, T, and U, respectively.

Single-stranded nucleic acids containing nucleotides with modified bases differ greatly from those of standard single-stranded nucleic acids containing naturally-occurring nucleotides (i.e., unmodified nucleotides). Modifications of nucleotides include the use of amide linkages. However, other suitable modification methods may be used.

The chemical modification of the nucleotide may be a sugar modification at the 2'-position, a pyrimidine modification at the 5-position (for example, 5- (N-benzylcarboxyamide) -2'-deoxyuridine, 5- Carboxamido) -2'-deoxyuridine, 5- (N- [1- [2- (1H-indol- (3-trimethylammonium) propyl] carboxamido) -2'-deoxyuridine chloride, 5- (N-naphthylcarboxyamide) -2'-deoxyuridine, or 5- 2,3-dihydroxypropyl)] carboxamido) -2'-deoxyuridine), purine modification at the 8-position, modification in exocyclic amines, substitution of 4-thiouridine, Such as substitution of 5-bromo-or 5-iodo-uracil, backbone modification, methylation, isobases isocytidine and isoguanidine, Unusual base-pairing combinations may be included alone or in combination. .

Polynucleotides may also be 2'-O-methyl- (2'-O-methyl-), 2'-O-allyl (2'-O-allyl), 2'- fluoro- (2'- 2'-azido-ribose, carbocyclic sugar analogs,? -Anomeric sugars, arabinose, xylose or lyxoses, Such as epimeric sugars, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs, and bases such as methyl ribose And include analogous forms of ribose or deoxyribose commonly known to those skilled in the art, including abasic nucleotide analogs.

As mentioned above, one or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linkages include those where the phosphate is P (O) S ("thioate"), P (S) S ("dithioate"), (O) NR2 ("amidate" Each R or R 'is independently H or an ether (-O-) bond, aryl (O) R', P (1-20C) optionally comprising an alkyl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all bonds in the polynucleotide need be identical. Substitution of similar forms of sugars, purines, and pyrimidines may be advantageous in designing end products, such as, for example, alternative basic framework structures such as polyamide basic backbones.

The method for producing a signal tag, which is a double-stranded nucleic acid of the present invention,

(I) A method for synthesizing a single-stranded nucleic acid using a nucleotide having a signal generating substance or a nucleotide reactive with a signal generating substance as a substrate,

A double-stranded nucleic acid is synthesized by hybridizing a single-stranded nucleic acid having a nucleotide with the (I-1) signal generating substance as a first nucleic acid and a second nucleic acid having a sequence complementary to the first nucleic acid or a sequence similar thereto , A step of synthesizing a double-stranded nucleic acid having the signal generating substance

A double-stranded nucleic acid is synthesized by using a single-stranded nucleic acid capable of binding to the (I-2) signal generating material as a first nucleic acid and hybridizing a second nucleic acid having a sequence complementary to the first nucleic acid or a sequence similar thereto , A step of synthesizing a double-stranded nucleic acid having the signal generating substance, a step of synthesizing the double-

(II) A method for synthesizing a double-stranded nucleic acid using a nucleotide having a signal generating substance or a nucleotide reactive with a signal generating substance as a substrate,

(II-1) Synthesis of double-stranded nucleic acid with signal generating substance

A double-stranded nucleic acid capable of binding to the signal generating material (II-2), and a double-stranded nucleic acid synthesized from the synthesized double-stranded nucleic acid.

Further, the kit of the present invention includes nucleic acid synthesizing means, a signal generating substance, and a signal generation frequency measuring means.

The double-stranded nucleic acid of the present invention has the above-described structure, for example, can be used as a labeling substance capable of effectively detecting a target molecule. However, the use of the double-stranded nucleic acid of the present invention is not limited to these, and may be used for any purpose.

The detection method may be a combination of fluorescent luminescence, chemiluminescence, radionuclides or an enzyme / substrate compound to produce a measurable signal. Multimodal signaling can have unique and advantageous properties in biomolecular analysis. The analysis method can analyze an enzyme / substrate compound that produces an analytical signal corresponding to the biomolecule value. In general, the enzyme can undergo chemical modification of chromogenic substrates which can be measured using a variety of techniques including spectrophotometry, fluorescence emission and chemiluminescence.

Preferably, the signal generating region may be a double-stranded nucleic acid unit or signal tag composed of a plurality of signal generating materials, and the unit bodies are constituent units of a signal generating region, which is a double-stranded nucleic acid in series.

Wherein the fluorescent label is a fluorescent dye molecule and the fluorescent dye molecule comprises at least one substituted indolium ring system wherein the substituent on the 3-carbon of the indolium ring comprises a chemical reactor or a conjugated substance, . The dye molecules include alexafluorine molecules such as AlexaFluor 488, AlexaFluor 532, AlexaFluor 647, AlexaFluor 680, or AlexaFluor 1000. do. The dye molecule comprises dye molecules of type 1 and type 2 such as two different &lt; RTI ID = 0.0 &gt; alexafluor &lt; / RTI &gt; molecules. The dye molecules include first and second dye molecules, and the two dye molecules have different emission spectra. The signal tag may be a nanofiber prepared by coating a dye molecule with a known technique to realize various colors in a visible light region, or a composite material formed by bonding gold and silver nanoparticles coated with a reactive group.

Fluorescence can be measured using a variety of instruments suitable for a wide range of analyzes. Spectroscopic photosystem microtiter plates, microscope slides, printed arrays, cuvettes, and the like can be analyzed.

The chemiluminescent substance can be selectively used for labeling the biomolecule / ligand complex so that the biomolecule value can be detected. Suitable chemiluminescent materials include any oxalyl chloride, rhodamine 6G, bipy 3 ²⁺ , tetrakis (dimethylamino) ethylene, pyrogallol (1,2,3-trihydroxybenzene) But are not limited to, pyrogallol (1,2,3-trihydroxibenzene), lucigenin, peroxyosalates, Aryl oxalates, Acridinium esters, dioxetanes, And the like.

The signal tag includes a fluorescent tag and chemiluminescence, and can be used to label a target molecule or a ligand so as to analyze a target molecule value. The signal tag can be configured to specifically point to a biomolecule or ligand using a known technique (see U.S. Patent No. 8,519,115 B2), and then used to detect a corresponding biomolecule value have.

Preferably, a large number of nucleic acid strands can be synthesized using Taq polymerase or RNA polymerase for DNA nucleic acid templates.

In the present invention, a signal tag, which is a double-stranded nucleic acid formed by hydrogen bonding between a first nucleic acid and a second nucleic acid chain of a signal tag, is referred to as an "H signal tag ", and interstrands crossovering is generated in an H signal tag A step of stabilizing the signaling region with a covalent bond between the first nucleic acid single-stranded nucleic acid of the signal tag and the second single-stranded nucleic acid complementary may be added. Cross-linking between chains in double-stranded nucleic acids can be induced by mitomycin C, psoralen, mustard gas, and the like. This is referred to as "C signal tag ".

A hydrogen bond is an attraction between a molecule having a strong electronegativity such as N (nitrogen), O (oxygen), or F (fluorine) and a hydrogen molecule between hydrogen atoms of neighboring molecules. Pull force). Hydrogen bonded materials have higher melting point and boiling point than other molecules of similar molecular weight, and have higher heat of fusion and higher heat of vaporization. Hydrogen bonding is not a chemical bond between atoms in a molecule, but a bonding by attraction between molecules. It is different from a chemical bond and is stronger than other kinds of intermolecular attraction. It is called a hydrogen bond. And other external factors, such as can be easily separated.

In order to overcome the limitations of the structural stability caused by the hydrogen bond between base pairs constituting the H signal tag, which is a color indicating bar code of the nCounter Analysis system, it is preferable that the base pairs constituting the double- Covalent bond to enhance the stability of the double-stranded nucleic acid, thereby solving the limitation of the color indicating barcode of the nCounter Analysis system.

The phenomenon of covalent bonding between base pairs constituting double-stranded nucleic acids is called crosslinking.

A covalent bond is a bond that is formed when the atoms to be bonded each emit electrons to form an electron pair, which is then shared by the atoms to share electrons in the chemical bond. The molecules that form covalent bonds are stabilized by attraction between the atomic nucleus and the electron pair and by interstitial repulsion.

The C signal tag is more stable than the H signal tag, so that the signal tag can be prevented from dissociating under various conditions of the analysis step.

Preferably, the present invention can also produce a double-stranded nucleic acid having a covalent bond between the constituent bases by artificially inducing a covalent bond between the pair of bases constituting the double-stranded nucleic acid.

(B) preparing at least two kinds of solutions for coating the polymeric nanofibers; and (c) preparing a solution of the polymer nanofibers, And coating the polymer nanofibers with the solution. The present invention also provides a method for producing polymer nanofibers having signal generating activity.

In addition, in the step (a), the polymer nanofiber may be manufactured using one kind of polymer selected from the group consisting of polystyrene, vinyl chloride resin, acrylonitrile butadiene styrene resin, polyethylene, acrylic resin, nylon and polyacetal resin .

In the step (a), the polymer is dissolved in a solvent such as ethyl acetate, tetrahydrofuran, acetone, methanol, ethanol, (BtOH), and 1-pentanol (PtOH) to prepare a polymer nanofiber.

Also, in the step (a), the polymer nanofiber may be produced by one of the methods selected from melt blown, composite spinning, split spinning and electrospinning.

The solution is characterized in that it is composed of a solution containing a fluorescent substance, a solution containing a metal oxide nanoparticle, and a solution containing a metal nanoparticle.

In addition, the fluorescent material may be selected from the group consisting of isothiocyanate, indocyanine, Hoechst, Propidium iodide, Phycoerythrin, Acridin orange, Actinomycin, Texas Red-based fluorescent material and Rhodamine-based fluorescent material.

The metal oxide nanoparticles may be selected from the group consisting of titanium dioxide rutile, titanium dioxide anatase (TiO2 anatase), zinc oxide (ZnO), tungsten oxide (WO3), strontium thianate (SrTiO3), cadmium sulfide (CdS), zirconium dioxide (ZrO2), tin oxide (SnO2), vanadium oxide (V2O3) and molybdenum diselenide (MoSe2).

Further, the metal nanoparticles may be formed of gold (Au) or silver (Ag).

The step (c) may further include the steps of (i) sulfonating the surface of the polymer nanofiber, (ii) coating the polymer nanofiber having the sulfonated surface with the fluorescent material, (iii) Coating the polymer nanofibers having the surface coated with the fluorescent material with the metal oxide nanoparticles; and (iv) coating the polymer nanofibers coated with the metal oxide nanoparticles with the metal particles. .

The fluorescent material used in the step (ii) may be selected from the group consisting of polyallylamine hydrochloride, Fluorescine isothiocyanate, Indocyanine, Hoechst, A fluorescent material such as Propidium iodide, Phycoerythrin, Acridin orange, Actinomycin, Texas Red, and Rhodamine fluorescent And the polymer nanofiber is coated with the fluorescent substance-containing solution which has been reacted with one selected from among materials.

Further, the method further comprises, after the step (iii), coating polyarylamine hydrochloride to fix the metal oxide nanoparticles to the nanofibers.

The present invention also provides a polymer nanofiber having the signal generating activity produced by the above method.

In addition, the polymer nanofibers have a signal generating activity in an ultraviolet region and a visible light region.

The present invention provides a stable signal tag constituting a color indicating barcode which has a covalent bond between base pairs constituting a double-stranded nucleic acid and which counts a target molecule with double-stranded nucleic acid to which a signal generating substance is labeled. Here, the hue indicating barcode indicates a system that indicates a target molecule by a combination of colors.

(Signal generation area color indication barcode)

The signal generating region is a barcode system, and the signal tag made in a state in which the same signal generating material is elongated is used as a basic unit. Signal tags made of various signal generating materials are connected in a certain combination, The target molecule can be specifically indicated by a combination of signal tags in a structure constructed to form a signal.

The signal generation area of the nCounter Analysis system is a barcode system, which consists of four types of dye (Alexa dye, Cy3), a structure made of RNA and single-stranded nucleic acid, which are designed to form a unique signal for each bar code. And biomolecules can be specifically directed, and up to 800 species can be formed to produce a unique signal. The reporter molecules form ~ 300 nm nanospots when photographed by an epifluorescence microscope, and have seven linear regions of each linear sequence.

Preferably, in the first probe of the present invention, the skeleton is a double-stranded nucleic acid having a covalent bond between a double-stranded nucleic acid or a constituent base pair, and a signal generating region composed of a combination of signal tags labeled with a plurality of fluorescent substances .

Preferably, the manufacture of the signal generating region, hue indicating barcode system of the present invention is as shown in FIG. 2 and may be as follows.

Constructing a set of signal tags with signal tags labeled with various signal generating materials;

One signal tag selected in the set is inserted into the tubes corresponding to the maximum number of signal tags and one type of signal tag selected from the signal tag set is inserted into each tube to mix the two signal tags. &Lt; / RTI &gt;

One kind of the two signal tag mixture solutions is put into the tubes corresponding to the maximum number of signal tags and the signal tag selected in the signal tag set is put into each tube and the signal tag is mixed with the two signal tag solutions &Lt; / RTI &gt; to produce a solution having three signal tag combinations; and

A reaction is performed to add signal tags one by one in the same manner as above to perform a connection reaction so as to form a structure in which signal tags are successively arranged in a solution having a combination of signal tags as desired so that a reporter library The color indicating barcode, which is a signal generating region, can be manufactured.

1-2. Second probe

The second probe means a separation support having a second probe attached to the surface of the solid support at least recognizing the biological target molecule to be detected. The second probe used in the present invention is shown in Fig.

As shown in Fig. 1, "second probe" refers to a structure in which a second probe and a solid support are combined, and a spacer, which is a single-stranded nucleic acid having 5 to 1,000 nucleotides between the second probe and the solid support, ).

The second probe is preferably an oligonucleotide or a protein, and more specifically includes DNA, RNA, PNA, aptamer, antigen, antibody, hapten and the like. The second probe is made of a material that recognizes a first probe and at least a site recognizing a target molecule and a second site. The second probe may be present in a plurality of, but not exclusively, on the surface of the harvest particle Several tens to several hundreds of second probes may be present. Further, the second probe may have various lengths, and the length thereof may vary depending on the target material, the type of probe, and the like, and a person skilled in the art can easily determine an appropriate length under a given condition.

The solid support refers to any substrate having a surface on which molecules can be attached directly or indirectly through either covalent or noncovalent bonds and may be the material from which the device provided in the present invention is made, A substrate to which the labeled ligand can bind can be prepared by coating a specific component on the support, and a specific component can be coated on the support to produce a non-specific binding substrate. In the present invention, an apparatus for counting biomolecules may be produced from the support.

The support may be a membrane, a chip (e.g., a protein chip), a slide (e.g., a glass slide or a cover slip), a column, a hollow, a solid, a semi-solid, a fiber, a matrix, and a sample receptacle containing particles, gel, fiber optic material, having pores or cravities such as beads, You can have a variety of physical forms that you can do.

Representative sample vessels of support include sample wells, tubes, capillaries, vials, and any other vessel that can hold the sample, a groove or an indentation. The sample container may be included on a multi-sample platform such as a microtiter plate, a slide, a microfluidic device, and the like. The support may be composed of natural or synthetic materials, organic or inorganic materials. Other exemplary vessels include microdroplets and microfluid-controlled bulk oil / water emulsions within which calibration and related manipulations may occur.

Suitable solid supports may be selected from the group consisting of plastic, resin, polysaccharide, silica or silica material, functionalized glass, modified silicon, carbon, metal, inorganic glasses, , Natural fibers such as wool and cotton, polymers, and the like.

The polymeric support may be selected from the group consisting of polystyrene, polyethylene glycol tetraphthalate, polyvinyl acetate, polyvinyl chloride, polyvinyl pyrrolidone, polyacrylonitrile polyacrylonitrile, polymethyl methacrylate, polytetrafluoroethylene, butyl rubber, styrenebutadiene rubber, natural rubber, polyethylene, polypropylene, (Poly) tetrafluoroethylene, (poly) vinylidenefluoride, polycarbonate, and polymethylpentene. The term &quot; polytetrafluoroethylene &quot;

Suitable solid support particles that may be used include cord particles such as Luminex-type encoded particles, magnetic particles or glass particles.

In the present invention, the addition of the support to the second probe may be performed using a spacer or may be directly bonded.

When the second probe is a ligand or DNA to which the DNA is bound, the DNA ends may be coated with biotin and the separation particles may be coated with streptavidin and the two substances may be reacted. In addition, the separation support and the second probe may be combined using amine-succinyl anhydride, PNA-DNA binding, and various other methods. Separation of the reaction precursor remaining after the separation and coupling reaction can be carried out by using a magnet for separation by using a magnetic separation particle for separation, and the filtrate may be discarded. Alternatively, a method of collecting particles using a centrifugal separation method and discarding the filtrate Can be used.

Such as carboxy, amino or hydroxyl groups, used for attaching a second probe to a solid support, and a support capable of containing streptavidin, avidin, and the like.

The second probe may be directly attached on the surface of the separating support, but it is more preferable that the surface of the harvesting particle is treated with a surface treatment material and then attached as a linker in terms of efficiency. As such a surface treatment substance, a silane-based, epoxy-based, carboxyl-based, amine-based or aldehyde-based material can be used.

After coating the separating support, it binds the second probe which is partially complementary to the target substance. It is preferable that the reaction precursor remaining after the binding reaction is discarded after the separation process so as not to affect the analysis Do. At this time, the separation support and the second probe may be combined through various methods.

The shape of these magnetic materials is preferably spherical. It is difficult to limit the size of the magnetic material used in the present invention because it should be changed according to the analysis concentration and the analyte. Nevertheless, these magnetic materials are not limited thereto, but it is preferable that they have a particle diameter of 0.1 to 100 micrometers for separation using a general magnet. More preferably 1.0 to 2.8 micrometers, and most preferably 1.0 micrometer.

1-3. Competing molecule

In biomolecular analysis, if the target molecule is low molecular or where the probe can recognize, the useful assay may be a competitive assay. When a target molecule is reacted with a first probe prepared using the signal generating region of the present invention, competitive analysis can be performed using a competitive molecule, which is a substance capable of competing with the target molecule.

As shown in Fig. 1, "competing molecule" refers to a structure in which a target molecule or a target molecule analog to be analyzed is bound to the support, and is composed of 10 to 50 bases There may also be a spacer, a single-stranded nucleic acid. When a competitive molecule is prepared using the target molecule, it is a competitive molecule for the target molecule in the reaction between the first probe and the target molecule. A competitive molecule may be prepared using the target molecule, the analog of the target molecule and the first probe.

In the present invention, preferably, the production of competitive molecules may be performed using a spacer or by direct bonding with the addition of a solid support to the target molecule.

1-4. Fixed molecule

In the present invention, the immobilized molecule for immobilizing the immobilized first probe on the detection surface for molecular counting of the target molecule so as to form an image of an effective spot includes a single strand having a base sequence complementary to the base sequence of the constituent unit of the immobilization region And any substrate capable of being attached directly or indirectly to the sensing surface through either covalent or noncovalent bonds with the nucleic acid.

As shown in FIG. 1, the "fixed molecule" is a structure in which a single-stranded nucleic acid composed of a base sequence complementary to a base sequence of a unit constituting the immobilization region of the first probe is combined with a support-binding substance. Preferably the single-stranded nucleic acid is comprised of 10 to 50 nucleotides. The complex in which the immobilized molecules are formed by complementary binding to the immobilization region of the first probe is bonded to the support by the support bond material, thereby fixing the first probe to the solid support to form an image of an effective spot.

"Support binding material" refers to any substrate that can be attached directly or indirectly to a support through either covalent or non-covalent bonding. Specific components used in the production of " A cover slip coated with streptavidin, avidin on an acrylic support in one embodiment may be laminated with a cover slip, which is coated with streptavidin, avidin, .

Preferably, the support binding material for the nucleic acid molecule is biotin and can be labeled at one end of the single-stranded nucleic acid.

The present invention relates to a method for counting a target molecule for biological significance determination, comprising a method, a reagent, an apparatus, a system, and a kit for multiplexing a biomolecule.

2. Analysis method

2-1. cell

The number of single cells such as cells or bacteria differs depending on the type, but it reaches several ㎛. If the target molecule is a cell, it may be analyzed with a first probe and a second probe for the cell.

The first probe of the first probe is a ligand for a selected molecule among the biomolecules constituting the surface of the cell, and more specifically, it includes an aptamer, an antigen, an antibody, a hapten and the like. The signal generating region is coupled to the prepared ligand to prepare a first probe. The second probe connects the ligand of the target molecule or preferably the different target molecule used in the first probe to the solid support.

If the target molecule is a cell, the first probe may be non-immobilized or immobilized, and is preferably analyzed using a non-immobilized first probe.

The first probe and the second probe are treated and reacted with a sample having a target molecule, which is a target molecule, and the first probe-target molecule-second probe complex formed is separated and harvested and analyzed to identify and measure the cell .

The present invention relates to a method for preparing a probe, comprising: preparing a sample to be analyzed for one or more target molecules; exposing the non-immobilized first probe and the second probe to the prepared sample to form a first probe- , And purifying the non-immobilized first probe-target molecule-second probe complex formed in the reaction solution.

In the case of the glass slide, the solid support is a glass slide, and a spot formed by the presence signal of cells generated in the first probe of the complex in which the first probe is coupled to the second probe- Can be analyzed. The target cell can be counted using the spot formed.

Also, when the solid support is magnetic particles, the first probe and the bacterial complex may be separated and purified using a fixed second probe to analyze a signal generated in the first probe in the complex.

By using the color indicating barcode in the first probe, the target molecule is specifically indicated, and it is possible to simultaneously analyze many target molecule cells through color analysis of the complex.

2-2. virus

Viruses are complexes of nucleic acids (DNA or RNA) and their surrounding proteins. Their sizes are only about one-thousandth of the average size of bacteria. The rod shape is only a few hundred nm, and the round shape is only a few tens of nanometers in diameter. If the target molecule is a virus, the first probe and the second probe for the virus may be analyzed.

The first probe of the first probe is a ligand for a selected molecule among the biomolecules constituting the surface of the virus. More specifically, it includes an aptamer, an antigen, an antibody, a hapten, and the like. The signal generating region is coupled to the prepared ligand to prepare a first probe. The second probe is prepared by ligating the target molecule used in the first probe or preferably a ligand of a different target molecule as a second probe to a solid support.

If the target molecule is a virus, the first probe may be non-immobilized or immobilized.

The first probe and the second probe are treated and reacted with a virus-containing sample, which is a target molecule to be analyzed, and the first probe-target molecule-second probe complex formed is separated and harvested and analyzed to identify and measure the virus Can do

The first probe and the second probe are treated and reacted with a virus-containing sample, which is a target molecule to be analyzed, and then the first probe-target molecule-second probe complex is separated and harvested and analyzed to identify and measure the virus .

The present invention relates to a method for preparing a probe, comprising the steps of preparing a sample to be analyzed for one or more target molecules, exposing a fixed first probe and a second probe to the prepared sample to form a first probe- , And purifying the first probe-target molecule-second probe complex formed in the reaction solution.

When the second probe is fixed to the glass slide, the second probe is manufactured to uniformly distribute and bind the glass slide. A spot formed by generating a signal indicating the presence of a virus in the complex formed by combining the first probe with the virus bound to the second probe fixed to the glass slide can be analyzed. The target cell can be counted using the spot formed.

When the second probe is immobilized on the magnetic particle, the target molecule virus is bound to the second probe immobilized on the magnetic particle, and the first probes are bound to the virus, which is the target molecule, to generate the presence signal of the target molecule in the complex. The presence of the virus in the formed complex will generate a signal that corresponds to the magnetic particle.

In addition, the virus can be counted by separating and counting the first probe in the purified complex.

The color indicating barcode in the first probe is used to specifically indicate the target molecule, and the plurality of viruses can be simultaneously analyzed through the color analysis of the complex.

2-3. Biomolecule

2-3-1. Single stranded nucleic acid  Probes included

(Nucleic acid quantitation)

The nucleic acid includes DNA or RNA. DNA is a conjugate of a nucleotide composed of phosphoric acid (H3PO4), deoxyribose (C5H10O4), and a base, and RNA is a nucleic acid having D-ribose as a sugar component. RNA includes not only the transcript that directs the protein but also the noncoding RNA itself (miRNA, siRNA, etc.).

In particular, in the case of miRNAs of short length, various PCR methods for quantifying miRNAs have been developed. In the present invention, the miRNA can be analyzed by the present invention analysis technique after adding the designed oligonucleotide by adding poly (A) using an enzyme to the miRNA and reverse transcription, and in the stem-loop RT-PCR method, The nucleic acid can be designed to quantify miRNA.

FIG. 4 is a view showing a method of forming a partial double-stranded nucleic acid by using a first probe and a second probe on a nucleic acid separated from a biological sample, followed by quantitative analysis.

As used herein, "a probe that is a base sequence recognizing a specific nucleic acid" means a single-stranded nucleic acid having a length sufficient to allow hybridization of a single-stranded nucleic acid, and a complementary base sequence has a length of 6 to 1,000 bases The preferred range is from 8 to 50 nucleotides and optimally from 10 to 40 nucleotides.

In the present invention, a base sequence positioned upstream of the base sequences that completely complementarily bind in the same direction as the specific nucleic acid is referred to as a first probe, and a base located downstream of the base sequence is referred to as a second probe.

The "probe" according to the present invention is preferably a nucleotide having a length of 6 to 100, more preferably 8 to 80, and most preferably 10 to 50 nucleotides.

The distance between the first probe and the second probe is 0-500 nucleotides, preferably 10-50 nucleotides.

The present invention relates to a probe for nucleic acid quantitation comprising a fixed first probe and a second probe.

In one embodiment of the present invention, for the nucleic acid quantitative analysis, the first probe is composed of a region that is a base sequence completely complementary to the target molecule nucleic acid, and the second probe is completely complementary to the specific nucleic acid And a region which is a nucleotide sequence to be joined.

A first probe and a second probe for analyzing a target molecule gene with the probe can be prepared by known methods.

As a first probe of the first probe, a perfectly complementary sequence may be used for the specific nucleic acid, but a substantially complementary sequence may be used to the extent that it does not interfere with the specific hybridization have. Preferably, the first probe comprises a sequence that can hybridize to a sequence comprising 10 to 30 contiguous nucleotide residues of a particular target nucleic acid of the invention.

In the above general formula (II), the second probe (2 ^ND P) is completely complementary to the base sequence following the position at which the 3 'end of the first probe (1 ^{S T} P) binds to the specific nucleic acid And can be designed to be suitable as a probe used in a hybridization reaction.

The first probe and the second probe prepared above are treated with a nucleic acid-containing sample, which is a target molecule to be analyzed, to carry out a hybridization reaction. Then, the first probe-target molecule-second probe complex is separated and harvested and analyzed, Quantification is done.

By combining one kind of first probe and second probe in one target nucleic acid, the target nucleic acid can be counted by counting the first probe in the first probe-target nucleic acid-second probe complex and quantifying the target nucleic acid from this value have.

The first probe and the second probe used in the present invention are hybridized or annealed in one region of the template to form a partial double stranded structure. The conditions of nucleic acid hybridization suitable for forming such double-stranded structures are described by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, , Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

In the above, the hybridization (annealing) temperature in the hybridization reaction is 40 占 폚 to 70 占 폚, more preferably 45 占 폚 to 68 占 폚, still more preferably 50 占 폚 to 65 占 폚, and most preferably 60 占 폚 to 65 / RTI &gt; The stringent condition of hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. These stringent conditions can be determined differently depending on the sequence to be hybridized.

When the second probe is immobilized on the magnetic particles, the target molecule nucleic acid binds to the second probe immobilized on the magnetic particle, and the first probes bind to the nucleic acid as the target molecule to generate the presence signal of the target molecule in the complex. That is, the target nucleic acid can be counted by separating and counting the first probe from the purified complex, from which the target nucleic acid can be quantified.

By using the color indicating barcode in the first probe, the target molecule is specifically indicated, and it is possible to simultaneously analyze many target molecule nucleic acids through color analysis of the complex.

In addition, the first probe-target molecule nucleic acid-the first probe separated from the second probe complex may be subjected to molecular counting to identify and quantify the target molecule nucleic acid.

( Gene mutation )

Genetic variations on DNA encoding biometric information include Single Nucleotide Polymorphism (SNP), Structural Variation, and herniated abnormalities. SNP means a genetic change or mutation that shows the difference of one base sequence (A, T, G, C) in DNA base sequence. Structural mutations refer to DNA structural variations such as deletions, inversions, additions, and replication.

The present invention provides a kit and method for making a fixed first probe and a second probe for analyzing a specific gene mutation.

FIG. 5 is a graph showing the results of a total and genetic analysis of a specific gene mutation analysis by preparing first and second probes containing a nucleic acid containing a genetic mutation and having a completely complementary bond in a neighboring region by separating nucleic acid- Flow chart.

In one embodiment of the present invention, in order to analyze the specific gene mutation, the first probe may include a base sequence which is completely complementary to the target gene and a base sequence which can distinguish the base sequence of the target nucleic acid at the 3 ' Region and the like, and the second probe may be composed of a region which is a base sequence completely complementary to the target nucleic acid, or the like.

In the general formula (IV), the first probe is a mutant adjacent specific region having a completely complementary hybridization sequence with the hybridizing target nucleic acid, and includes a mutation specific region corresponding to a mutation of the gene.

As the first probe, a perfectly complementary sequence may be used in the sequence including the SNP, but a substantially complementary sequence may be used so long as it does not interfere with the specific hybridization . Preferably, the first probe comprises a sequence that can hybridize to a sequence comprising 10 to 30 consecutive nucleotide sequences, including the SNPs of the present invention. More preferably, the 3 ' end of the first probe has a base complementary to the SNP base. In general, the stability of a duplex formed by hybridization tends to be determined by the match of terminal sequences, so that in the first probe with a base complementary to the SNP base at the 3 'end, the terminal region is not hybridized Otherwise, such a duplex can be disjointed under stringent conditions.

In the above general formula (IV), the second probe is a mutation adjacent specific region that completely complementary binds to the target nucleic acid and is used to identify a single-stranded nucleic acid having a mutation-related base sequence, . &Lt; / RTI &gt;

A sample having the target molecule gene mutation, a first probe and a second probe may be reacted to form a first probe-target molecule mutation-second probe. The complex can be harvested in solution to analyze target molecule gene mutations.

Preferably, a sample containing the target molecule gene mutation is reacted with a first probe and a second probe to form a first probe-target molecule mutation-second probe complex and a washing step to harvest the purified complex. The double stranded nucleic acid of the formed complex is elongated and ligated to form the complete double stranded nucleic acid. This reaction may be repeated two or more times to obtain a complete double stranded nucleic acid.

The first probe and the second probe used in the present invention are hybridized or annealed in one region of the template to form a partial double stranded structure. The nucleic acid hybridization suitable for forming such a double-stranded structure may be the same or similar to the contents of the nucleic acid quantification.

In the present invention, the annealing is carried out under the strict condition that enables the first probe and the second probe to undergo specific binding between one region of the template. The stringent conditions for annealing are sequence-dependent and vary with environmental variables. The amplified target nucleic acid is a target nucleic acid molecule containing multiple target positions on one molecule, and can be used to simultaneously analyze multiple target positions.

In the present invention, in the partial double-stranded nucleic acid formed by hybridization reaction with one region of the template, when the extension region exists between the two probes, the first probe and the second probe undergo a stretch reaction and a linking reaction to form a complete double-stranded nucleic acid .

As used herein, the "stretch region" refers to nucleotides of sufficient length to allow extension of the oligonucleotide through nucleic acid polymerisation activity. The "stretch region" is present in the form of the target and template nucleic acid. The "stretch region" is between the first probe binding position and the second probe binding position of the target or template nucleic acid. The "stretch region" is about 1 to 1000 nucleotides in length, preferably 1 to 100 nucleotides in length, more preferably 3 to 50 nucleotides, and most preferably 3 to 10 nucleotides in length.

The extension refers to extending the primer by adding nucleotides to the extension region using a polymerase. If the oligonucleotide is completely complementary bound to the nucleic acid, the nucleic acid acts as a template for the extension reaction. In the present invention, the DNA polymerase may be selected from the group consisting of Taq DNA polymerase and Pfu DNA polymerase, but not limited thereto, and any thermostable DNA polymerase can be used.

The ligation refers to enzymatic catalytic coupling of the 3'end of the first probe or the 3'end of the elongated first probe to the second probe. In the present invention, the ligase may be selected from the group consisting of E. coli DNA ligase, Taq DNA ligase, T4 DNA ligase and Ampligase ligase.

In the present invention, when the partial double-stranded nucleic acid formed by the hybridization reaction of the target nucleic acid, the first probe and the second probe is nicked between the first probe and the second probe, Can form a nucleic acid.

The linking reaction refers to a reaction capable of catalyzing the linkage of a nucleotide sequence by a ligase. After allowing two oligonucleotides of a specific length to be completely complementary to each other in the target nucleic acid, the nick region of the double helix formed at this time is amplified by a DNA ligase using a conventional Linking two oligonucleotides in a single stranded state through a linking reaction. Therefore, enzymes conventionally used in the art can be used without limitation as a ligase for inducing the linkage of nucleic acids.

In the case where the solid support is a second probe having magnetic particles, a target molecule gene mutation, a first probe and a second probe are bound to each other, the first probe and the second probe are bound to each other, By analyzing the signal pattern generated in the probe signal generation region, the type of the gene mutation can be known.

In one type of gene mutation, one kind of the first probe and the second probe are combined so that the first probe separated from the first probe-target nucleic acid-second probe complex can be subjected to molecular counting to count the target gene mutation.

By using the color indicating barcode in the first probe, the target molecule is specifically indicated, and it is possible to simultaneously analyze many target molecule gene mutations through color analysis of the complex.

(Methylated DNA)

The present invention provides a kit and method for making a fixed first probe and a second probe for analyzing methylated DNA.

One aspect of the present invention relates to a method for determining whether or not methylation of a gene occurs and a ratio thereof. This analysis method includes the following steps.

Referring to FIG. 1,

Treating the sample DNA to be analyzed with sodium bisulfite;

A first probe comprising a first probe composed of a single-stranded nucleic acid which enables ligation of a specific gene by confirming the methylation rule of the specific gene and a first probe comprising a base sequence complementary to the 3 ' end of the first probe, Preparing a second probe including a second probe that makes a perfectly complementary coupling;

Hybridizing the sodium bisulfite-treated nucleic acid with the prepared first probe and the second probe to form a partial double-stranded nucleic acid;

Forming a double stranded nucleic acid by a linking reaction between the 3 'end of the first probe and the 5' end of the second probe in the partial double strand; And

And analyzing a signal generated in a linked structure of the first probe and the second probe harvested by denaturing the formed complete double stranded nucleic acid. have.

The 'methylation' of the invention means that the methyl group is added to the 5th carbon of the cytosine of DNA. By treating the sample DNA with 'sodium bisulfate', the methylated cytosine is retained in the base sequence of the sample DNA and the unmethylated cytosine is converted to uracil.

The first probe containing the first probe (1 ^ST P), the first probe having the methylation information, is a single-stranded nucleic acid having guanine or thymine as a base to be cleaved with cytosine or uracil to distinguish methylation bases.

The first probe is a methylated adjacent specific region having a completely complementary hybridization sequence with the hybridizing target nucleic acid and includes a mutation specific region corresponding to a methylation base.

As the first probe, a sequence complementary to the sequence including the methylation base may be used, but a substantially complementary sequence may be used to the extent that it does not interfere with the specific hybridization have. Preferably, the first probe comprises a sequence capable of hybridizing to a sequence comprising 10 to 30 contiguous nucleotide residues comprising a methylation base of the invention. More preferably, the 3 ' end of the first probe has a base complementary to the methylation base. In general, the stability of a duplex formed by hybridization tends to be determined by the agreement of terminal sequences, so that in the first probe having a base complementary to the methylation base at the 3 'end, the terminal region is not hybridized Otherwise, such a duplex can be disjointed under stringent conditions.

The first probe is a single-stranded nucleic acid comprising a base sequence enabling ligation when the specific gene is methylated or a base sequence enabling connection when the specific gene is unmethylated.

The second probe is a methylated adjacent specific region which is completely complementary to the target nucleic acid and is used to identify a single-stranded nucleic acid having a methylated base and can be designed to be suitable as a probe used in a hybridization reaction.

The sample having the target molecule methylated DNA, the first probe and the second probe may be hybridized to form the first probe-target molecule methylated DNA-second probe. The complex can be harvested in solution to analyze the target molecule methylated DNA.

The first probe and the second probe used in the present invention are hybridized or annealed in one region of the template to form a partial double stranded structure. It is possible to analyze the DNA methylation status and the ratio by forming a complete double stranded structure by the long-term reaction and the linking reaction. The content of hybridization, kidney and connection may be the same as or similar to the above gene mutation analysis.

In the present invention, the annealing is carried out under the strict condition that enables the first probe and the second probe to undergo specific binding between one region of the template. The stringent conditions for annealing are sequence-dependent and vary with environmental variables. The amplified target nucleic acid is a target nucleic acid molecule containing multiple target positions on one molecule, and can be used to simultaneously analyze multiple target positions.

In the present invention, when the partial double-stranded nucleic acid formed by hybridizing the target nucleic acid with the first probe and the second probe has a nick between the first probe and the second probe, Stranded nucleic acid can be formed.

Preferably, the sample containing the target molecule methylated DNA is reacted with a first probe and a second probe to form a first probe-target molecule methylated DNA-second probe complex, followed by a washing step to harvest the purified complex. The double stranded nucleic acid of the formed complex is elongated and ligated to form the complete double stranded nucleic acid. This reaction may be repeated two or more times to obtain a complete double stranded nucleic acid.

In the present invention, in the partial double-stranded nucleic acid formed by hybridization reaction in one region of the template, when the extension region exists between the two probes, the first probe and the second probe undergo extension reaction and form a complete double-stranded nucleic acid .

In the case where the second probe is immobilized on the magnetic particle, it is preferable that the target molecule methylated DNA, the complex formed by the first probe and the first probe, undergoes a denaturation reaction with the kidney or a linking enzyme reaction, It is possible to analyze a signal pattern occurring in a probe signal generating region. The signal pattern indicates the presence signal of the methylated DNA in the formed complex, which indicates the signal corresponding to the methylation of the specific methylated DNA.

The target molecule is specifically indicated using the hue bar code in the first probe, so that many target molecule methylated DNAs can be simultaneously analyzed through color analysis of the complex.

The first probe-methylated DNA-second probe complex formed additionally may be subjected to molecular counting of the first probe separated from the first probe-methylated DNA-second probe complex to count the target molecule methylated DNA.

In addition, the present invention analyzes the signal pattern occurring in the signal generation region of the first probe, and provides information on the methylated DNA sequence to determine whether methylation is present or not.

Genes on the genome are methylated or unmethylated and vary depending on the physiological and pathological conditions of the biological sample.

Preferably, when the specific gene is unmethylated, signal analysis can be performed by marking with a bar code reporter of pattern A at the 5 'end of the first probe and a bar code reporter of pattern B when the methylation is the other. That is, when a signal generated from the labeling substance in the complex obtained by linking the first probe and the second probe with a specific gene as a template is analyzed, the number of A pattern spots / B pattern spots And the ratio of methylation and methylation in the biological sample is analyzed. From these, the ratio of methylation in the biological sample can be determined.

The kit according to the present invention is characterized in that the methylation of the gene and the ratio of the methylation of the gene are analyzed using the first probe and the first probe comprising the signal generating material, to provide.

2-3-2. Ligand Analysis used

The present invention provides a kit and method for making a fixed first probe and a second probe by known methods for analyzing biomolecules using a ligand.

The biomolecule can be a protein, peptide, carbohydrate, lipid, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, pathogen, toxin, substrate, metabolite, transition state analog, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues, etc. Theoretically, the scope is not limited and means almost all chemical or biological effectors.

Ligands typically include antibodies, peptides, nucleic acids, and plasmids. An antibody refers to a protein molecule that specifically binds to an antigen epitope of an antigen to cause an antigen-antibody reaction. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker of the present invention, including partial peptides that can be made from the protein. Aptamers are small (20 to 60 nucleotides) single-stranded nucleic acid (DNA or RNA) fragments that are capable of binding with high affinity and specificity to a wide variety of substances, from small molecules to proteins.

The present invention provides a method and kit for identifying and quantifying a target molecule using a ligand, a method of counting target molecules by a coating coefficient method, a capture counting method and a competitive counting method.

FIG. 3 is a flow chart of the coating coefficient method. As shown in FIG. 3, the present invention includes a method of preparing a sample to be analyzed for one or more target molecules, fixing the prepared sample to a coating paper support Preparing a reaction solution for forming a coating suspension-target molecule-first probe complex by treating a non-fixed first probe on the coated paper support on which the biomolecules are immobilized, a step of preparing a coating suspension- - Purifying the first probe complex.

The spacer between the constituent units constituting the fixed first probe is a single-stranded nucleic acid having a length of 5 to 1,000 nucleotides. The spacer is a ligand binding to the reactive group of the first probe, You can also determine the length.

The first probe is preferably a ligand, and more specifically, it includes an aptamer, an antigen, an antibody, a hapten, and the like.

The fixed first probe and the second probe are treated and reacted with a sample having a target molecule to be analyzed. Then, the fixed first probe-target molecule-second probe complex formed is separated and harvested and analyzed to identify and identify the target molecule. Quantification is done.

The coated paper support herein refers to any substrate having a surface to which a molecule can be directly or indirectly attached to a non-covalent bond, and may be a material for producing the apparatus provided in the present invention, A substrate on which the sample can bind can be prepared by coating the components, and an apparatus for counting biomolecules in the present invention can be manufactured from the support.

In the present invention, the "coating material" used in the coating coefficient method may be a nitrocellulose film, an ELISA plate, or a bead coated with a C4, C8 or C18 alkyl group (Alkyl group).

4 is a flow chart of a capture counting method. As shown in FIG. 4, the present invention includes a sample preparation method of preparing a sample to be analyzed for one or more target molecules, Preparing a reaction solution which exposes the second probe to form a first probe-target molecule-second probe complex, and purifying the first probe-target molecule-second probe complex formed in the reaction solution .

FIG. 5 is a flow chart of a competition counting method. The present invention relates to a method of preparing a sample to be analyzed for one or more target molecules, a reaction solution for forming a complex by exposing the prepared sample to competitive molecules and label molecules, And a step of purifying the competitive molecule-first probe complex formed in the reaction solution.

In the present invention, the labeling ligands of the complexes containing the labeled ligands purified by the coating method, the capture counting method and the competitive counting method are subjected to the coefficient analysis, and the biomolecule values of the samples are analyzed from the analysis results.

In the present invention, the target molecule present in the reaction solution in the coating coefficient method and the capture count method combines with the first probe to form the target molecule-first probe complex, and the degree of formation of the complex is proportional to the amount of the target molecule. The target molecule value, which is the result of quantitative analysis of the target molecule, is analyzed based on the result of analyzing the coefficient of the spot, which is a signal generated in the first probe which is dissociated in the finally purified complex.

Particularly, the competitive-counting method is determined by analyzing the first probe dissociated from the complex by separating the competitive molecule-first probe complex formed in the reaction solution. That is, the reaction of the target molecule and the competitive molecule to be analyzed with respect to the first probe forms a competitive probe with the target molecule-first probe complex and the competitive molecule-first probe complex. The degree of formation of the competition molecule-first probe complex in the reaction solution is determined depending on the degree of formation of the target molecule-first probe complex, so that the target molecule value can be determined by analyzing the signal of the competition molecule-first probe complex. Competitive Molecule - The target molecule value is analyzed based on the results obtained by analyzing the coefficient of the spot, which is a signal generated in the dissociated first probe, by harvesting only the first probe complex and dissociating the first probe.

The target molecule value, which is the result of quantitative analysis of the target molecule, is calculated by counting the first probe dissociated in the complex including the finally purified first probe, measuring the amount of the first probe binding to the target molecule using the standard curve And the target molecule value is determined.

The target molecule values of the coating counting method, capture counting method and competition counting method can be determined using multiple assays that enable continuous analysis of one or more target molecules in a biological sample.

In multiple assays, first probes with signal generating regions that are dissociated in individual complexes and point to individual target molecules are immobilized, either directly or indirectly, in covalent or noncovalent bonds at distinct locations on the support. Multiple assays are realized by a mechanism capable of distinguishing two or more target molecules by a unique signal generated in a signal generation region, such as a quantum dot in a first probe coupled to a specific region of a support. Each instrument is used for the analysis of one of each of the multiple target molecules to be detected in the biological sample. Each instrument can be configured to process each target molecule simultaneously in a biological sample. For example, microtiter plates may be used as if each well in the plate was used to specifically analyze one of the multiple target molecules to be analyzed in the biological sample.

3. Sample Processing

Analysis of a sample suspected of containing cells, viruses and biomolecules to be analyzed involves a series of sample preparation steps, which may include filtration, cell lysis, nucleic acid purification, and mixing with reagents . Control of the sample preparation process may be useful to have confidence in the results of nucleic acid analysis.

In the case of a sample containing cells for binding to the specific ligand, a specific nucleic acid, a methylated DNA, and a biomolecule containing a specific gene mutation, it is preferable that a sample containing a specific ligand binding substance The molecules can be separated, purified and concentrated, and the concentrated biomolecule sample can be used or the sample to be analyzed can be used as a sample to be directly analyzed.

Preferably, the present invention provides a biomolecule analyzing method, a kit and an apparatus for directly injecting the sample into a nucleic acid subunit, which is the next step of the fusion subunit, in the dissolved sample having the biomolecule to be analyzed.

The sample may be treated (shaking or vortexing) with zirconium silicate (ZS) beads (Biospec products, USA), etc., to melt the cells.

Preferably, in the case of qualitative quantitative analysis, internal quality control is performed with biomolecules included in a biological sample to be analyzed for comparison in various tests and tests. The quality control material may be an exogenous material which is always contained in a sample to be analyzed in a predetermined amount, but is not included in the sample. If the sample to be analyzed is a biological sample, And &lt; RTI ID = 0.0 &gt; exogenous &lt; / RTI &gt; Quality management refers to internal quality control that manages the precision of a measurement by analyzing a group of inspection results obtained by each measurement without using external standards such as management samples.

In the present invention, the substance for internal quality control can be a biomolecule which is not contained in a human-derived biological sample when a human-derived biological sample is analyzed, and a plant-specific biomolecule can be used. Plant specific proteins have now been reported as a result of the termination of the human genome project and the Arabidopsis thaliana genome project, a plant species. In the present invention, a plant-specific protein can be used as a reference substance for analyzing a human-derived biological sample. In the present invention, the internal quality control of the quantitative analysis of a substance bound to a specific ligand can be performed using a substance not included in the biological sample to be analyzed.

4. Molecular counting equipment

As shown in FIG. 6, the biomolecular-weight analyzing apparatus 1 includes a sample processing port 20 for preparing a sample to be analyzed for one or more biomolecules, a complex from the biomolecules of the prepared sample A reagent 30 for dissociating the labeled ligand bound in the complex and an analyzer 40 for analyzing the dissociated labeled ligand are prepared and the sample 20, (50) for transferring a sample and a reagent to the nozzle (52) through the support (10), an operation control system (60) The biomolecule value determined from the analysis result is converted into the clinical test value to determine the biological meaning, input / output of biometric information, And biological means for transmitting and receiving crystals can also comprise a system 100. It is to be understood that the present invention is not limited to the above-described embodiments, but may be modified and changed without departing from the scope and spirit of the invention.

The apparatus 1 may include a sample processing unit 20, a reaction unit 30, an analysis unit 40 and nozzles 52 in a support 10.

Biomolecules and ligands that diagnose each desired disease are first selected. Information about the sample (or user) to be analyzed is input to the operation control system 60 and the fluid feed port 50 is connected to the reaction port 30 through the sample processing port 20 sequentially in the order of the sample, the capturing ligand, And mixed to prepare a reaction solution. The capture ligand contains the harvest material in a particular ligand and can bind ligands with biomolecules in the sample. The labeled ligand is composed of a ligand capable of binding with a biomolecule as a receptor and a reporter molecule including a signal generating region composed of a fluorescent tag or a quantum dot. Each reporter can uniquely identify a specific biomolecule as a signal in a signal generation region.

The sample processing port 20 may be a chamber for preparing a reaction solution by adding a reaction buffer or the like so that the ligand-receptor reaction can be performed on the sample, and performing a reaction for binding the sample to the coated paper in the coating coefficient method .

In the reaction vessel 30, the prepared reagent is added to the reaction solution transferred from the sample treatment port 20 through the nozzle 52, and reacted while being continuously rotated by the mixer 31 to produce a complex containing the labeled ligand Refine. The purified and complex containing the labeled ligand is purified by the magnet 32 with magnetic beads of the capturing ligand and heated with a heater 33 to dissociate the labeled ligand of the complex and then harvest the supernatant containing the dissociated labeled ligand .

The supernatant harvested from the reaction vessel 30 is transferred to the assay port 40 and the dissociated labeled ligand is immobilized on the surface, for example, on the streptavidin-coated surface 41 as the binding support, by biotin of the labeled ligand And the labeled ligand can be immobilized. The washing solution may be injected and the washing may be performed 2-3 times.

Prior to microscopically imaging the surface 41 with the imaging device 44 with the management of the operating control system 60, an electrophoresis device 42 (not shown) is used to align all the complexes on the surface 41 in the same direction. ), And when the fixed nucleic acid molecule is injected, the reporter single-stranded nucleic acid of the dissociated marker ligand and the single-stranded nucleic acid of the fixed nucleic acid molecule are complementary to each other and the biotin of the fixed nucleic acid molecule is added to the surface 41 And the labeled ligand can be immobilized. The residue is transferred to the residue collector (43).

As described above, commercialized products may be used for the purpose of quantitative analysis by the coefficient of biomolecules. A commercially available nCounter ™ Analysis System (NanoString, Seattle, Wash.) Can, but is not limited to, perform this analysis and other systems may be used for such analysis.

A microfluidic device (e.g., a "lab-on-a-chip") device can be used in the method of the present invention for quantitative analysis of biomolecules in a sample. The sample processing port 20, the reaction port 30, the analysis port 40 and the fluid port 50 constituting the biomolecule analysis apparatus 1 of the present invention can be driven by the microfluidic device. Such devices can be used for the analysis of specific biomolecules in unprocessed samples as described herein.

A variety of imaging devices 44 may be used to detect changes in the level of a particular biomolecule. Thus, such microfluidic chip technology can be used in diagnostic and prognostic devices for use in the methods described herein. These microfluidic devices can incorporate laser excitation of labeled quantum dots and other reporters. These devices can also incorporate the detection of the resulting emission through various digital imaging sensor methods, including cameras based on charge-coupled devices and various detection mechanisms including visible light. These devices can also incorporate image processing and analysis capabilities to translate the resulting signal and data into diagnostic information.

Is detected by any means 44 available in the art capable of detecting a particular signal of a reporter. When the reporter is a fluorescent label, a suitable light source is a lamp, a xenon lamp, a laser, a light emitting diode, and the like. An appropriate optical source system-related optical detection system uses an inverted fluorescent microscope, an epi-fluorescent microscope or a confocal microscope. The microscope is used so that it can detect with enough spatial resolution to determine the fluorescent tag sequence of the spot corresponding to the reporter. It is possible to form a complex with the target molecule to obtain an image of the reporter fixed on the solid support. When the reporter was used in three different colors, Alexa 488, Cy3 and Alexa 647, each dyeing reagent was analyzed in different channels and the first and second The register allows several pixels to be digitized, each registering individually (US Pat. No. 7,4103,767).

An important consideration for microscope objectives is the optical resolution determined by the numerical aperture (NA). If you use a large NA, the optical resolution is higher. The required NA is based on? = 0.61? / NA (? = Optical resolution and? = Wavelength) and is preferably 1.07. The amount of light collected by the objective lens is determined by NA ⁴ / magnification ² of the objective lens. Therefore, in order to collect as much light as possible, eyepieces with high NA and low magnification should be used.

When choosing a CCD camera, the first consideration is the final pixel size, which in part determines the resolution of the imaging system. Optimal optical resolution is not determined only by the CCD camera. For each spot corresponding to a biomolecule to be clearly distinguished by at least two pixels, the optical resolution must be 210 to 300 nm, which corresponds to 12.6 to 18 μm on a CCD chip after 60 X magnification. Alternatively, the pixel size of the CCD chip should be approximately 6.3 to 9.0 μm. The second consideration is the detection sensitivity, which is determined by many factors such as pixel size, quantum efficiency, read noise and dark noise. In order to achieve high sensitivity, a large pixel size, high quantum efficiency, and low noise qualification cameras that can give a large integration area should be chosen. The camera that meets this criterion is the Hamamatsu Orca-Ag camera. If the chip size is 1344 x 1024 pixels and a 60-mm objective is used, the field of view is 144 x 110 μm ² .

The biomolecule of the present invention was measured at a low femtomolar range concentration of 1,000 t. This is about four orders of magnitude lower than biomarker discovery experiments obtained using 2D gels and / or mass spectrometry.

As shown in FIG. 5, the present invention includes a sample treatment device 20 for preparing one or more biomolecules from a user for the purpose of counting one or more biomolecules and producing a biological meaning, (30) for forming a biomolecule-labeled ligand complex and a capturing ligand-labeled ligand complex in the reaction solution by exposing the capturing ligand and the labeled ligand to the sample, and analyzing the reporter of the formed capturing ligand-labeled ligand complex A fluid inlet 50 for transferring a sample, a reagent and a fluid by connecting the syringe 40, the sample processing port 20, the reaction port 30 and the analysis port 40 with a nozzle, From the analysis result of the reporter inputted in the analysis section, one or more biomolecules And provides a biomolecule counting device configured as an operation control system 60. [ It is to be understood that the present invention is not limited to the above-described embodiments, but may be modified and changed without departing from the scope and spirit of the invention.

5. Biological mean prediction technology

In the present invention, the biological semantic prediction system using the biomolecule information data is exemplarily diagnosed but not limited thereto.

Many biomolecule information data generated by the present invention can produce various information related to cells, tissues, or diseases with information of a large amount of a substance having high dimensional characteristics. The module that performs the pre-processing in the analysis system using the input data finds the features that affect the patient's condition and the multivariate analysis method to improve the classification performance finds important parameters for accurate treatment and diagnosis, Which is a feature selection procedure that finds key attributes through reduction or transformation of characteristics.

Feature extraction can be classified into Unsupervised Learning or Supervised Learning depending on whether class information is used for learning. Principal Component Analysis (PCA) or Independent Component Analysis (ICA), which is mainly used in the non-supervised learning method, can extract qualities by considering the characteristics of variables. The supervisory method is a method of selecting variables using statistical significance between class information and variables or correlation between variables. This method can calculate the key properties through the performance applied to the classifier by sequentially adding or removing the features in forward or backward directions in a given feature set.

The module for performing the learning with the pre-processed result and generating the patient's model is a procedure for classifying the selected features by each class through an appropriate classifier.

In the present invention, an artificial neural network is used, and it is applied to various fields such as pattern recognition, function approximation, and classification technique because of its characteristics of determining behavior according to input and output. An artificial neural network is composed of several layers, nodes, and neural network connection weights. The neural network interlayer connection scheme used in the present invention is a feed-forward scheme. Based on the input pattern, the neural network connection weights for each node and the activation function were used to calculate the output value. If the estimated value is different from the actual result value through the generated combination information, the process of comparing the calculated value with the actual result value is repeatedly found to reduce the error.

Methods for generating the patient's model include linear models, support vector machines, neural networks, classification and regression trees, ensemble learning methods, Wherein the biomolecule is selected from the group consisting of discriminant analysis, nearest neighbor method, Bayesian networks, and independent components analysis. Lt; / RTI &gt;

For most of the diseases for which an accurate and comprehensive mechanism has not been established, the case-based diagnosis is very important. However, the existing case - based machine learning reasoning system designed for specific machine learning techniques has low accuracy and development of improved system is continuously required. In addition, the existing system is designed only as a disease discriminator using all learned clinical test items, and does not provide a method to utilize the importance or priority of clinical test items for each disease.

The present invention relates to a system for diagnosing diseases and selecting test items using case-based machine learning reasoning for supporting a doctor's accurate diagnosis of diseases, and a neural network (a neural network) The present invention relates to a system for identifying a disease by analyzing test information of a new patient through a learning machine disease discriminator and selecting and providing a least important test item for final diagnosis of each disease by preliminary diagnosis. Diagnosis of disease through machine learning reasoning is composed by applying machine learning method individually. Methods for generating the patient's model include linear models, support vector machines, neural networks, classification and regression trees, ensemble learning methods, Discriminant analysis, nearest neighbor method, Bayesian networks, and independent components analysis.

The configuration and practical application of this system can be divided into two parts. It consists of a stand alone diagnostic system for diagnosis only and an integrated system linked with existing hospital information system such as OCS, PACS, LIS, etc. can do. For interworking with the integrated system, the system must be configured according to the HL7 and DICOM specifications. This system is an initial model and it is linked with PMS (Patient Monitoring System) to increase the accuracy of diagnosis. In addition, PMS, OCS, EMR, PACS and other systems linked to a variety of medical information developed by developing a more accurate diagnosis system that includes various disease factors can be developed.

According to the present invention, there is provided a biomolecule information analyzing system comprising: a module for receiving the biomolecule information of a patient group and the biomolecule information data of a control group and constructing a database; A module for performing preprocessing in the analysis system using the input information data; A module for generating a patient's model with the pre-processed result; A module that loads the generated model and applies the resultant to a patient who visited the patient to perform a diagnosis that is a blind test; And a module for evaluating the performance of the system through cross validation; The present invention also provides a method and apparatus for analyzing biomolecules.

The present invention can detect a target molecule with high sensitivity and reproducibility in a biological sample by analyzing a target molecule using a molecular counting technique and confirm the biological meaning of the target molecule. Furthermore, by analyzing various biomolecules in a single test, it is possible to efficiently determine differences between individuals such as changes in phenotype, susceptibility to diseases, and response to therapeutic agents in a biological sample, thereby providing a biological meaning And a method for determining whether or not to use the method.

Hereinafter, a nucleic acid analysis method for analyzing a biomolecule in a biological sample composed of one or more biomolecules according to the present invention will be described in detail with reference to the accompanying drawings and embodiments. The following examples are illustrative of the present invention but are not intended to limit the scope of the invention.

Example 1. Manufacture of reagents

1-1. The first probe

The first probe has a function of generating a corresponding signal by combining with a target molecule, and a structure is a structure in which a signal generating region indicating a target molecule and a first probe are coupled to each other. In addition, a fixed region and a binding tag can be added have.

<Manufacture of Signal Tag>

The signal tag is a unit constituting the signal generation region. In this experiment, the PCR primer is designed and manufactured to produce the PCR product size of about 900bp for the M13 DNA (Korea, Bioneer). The backbone DNA of the signal tag is M13 DNA The nucleotide sequence information (accession number NC_003287) of M13 DNA obtained from the GenBank data system (http: // www.ncbi.nlm.nih.gov) is.

The DNA fragment (903 bp) was prepared by PCR using the PCR primer pairs described below as a template for M13 DNA.

Forward primer atcaggcgaatccgttattg

Reverse primer tcggccttgctggtaatatc

The DNA fragment obtained from the M13 DNA was used as a template, and three kinds of dNTPs and aminoallyl-dCTPs were used to perform PCR again with the above primer pairs to prepare aminoallyl-dCTP labeled DNA fragments.

The nucleotide sequence of the restriction enzyme adapter

Adapters of [Table 3] consisting of restriction enzymes that can not cleave DNA products were purchased from Gene Link, USA. The adapter was ligated to an aminoallyl-dCTP labeled DNA fragment as follows.

1 ^ST domain: 5'-Blunt end-DNA fragment-Eco R1 / Sma I adapter-3 '

2 ^ND domain: 5'-Eco RI / Sma I adapter-DNA fragment -Sal I / Bam HI adapter-3 '

3 ^TH domain: 5'-Sal I / Bam HI adapter-DNA fragment-Hind III / Not I adapter-3 '

4 ^TH domain: 5'-Hind III / Not I adapter-DNA fragment-Xho I / Pst 1 adapter-3 '

5 ^TH domain: 5'-Xho I / Pst1 adapter-DNA fragment -Sal I / Bam HI adapter-3 '

6 ^TH domain: 5'-Sal I / Bam HI adapter-DNA fragment-Eco R1 / Sma I adapter-3 '

7 ^TH domain: 5'-EcoRl / Sma I adapter-DNA fragment -3 '

1 ^ST domain is EcoRI, 2 ^ND domain is EcoRl and BamHI, 3 ^TH domain is BamHI and HindIII, 4 ^TH The domains include HindIII and Xho I, 5 ^TH The domains are Xho I and Sal I, 6 ^TH Domain was treated with Sal I and Sma I, 7 ^TH domain was treated with Sma I, and purified, and the adapter was cleaved and aminoallyl-dCTP labeled PCR fragment was obtained.

The signal generating region used in the present invention is a structure in which four signal tags are arranged in seven consecutive domains in a combination of four types of signal tags and a structure in which four kinds of signal tags are continuously arranged in seven domains is described as follows: .

N-hydroxysuccinimide (NHS) -ester (ester) fluorescence (Alexa 488, Alexa 594, Alexa 647 (USA)) was used to quantitatively quantify biomolecules such as nucleic acid quantitation, nucleic acid variation, methylated DNA, Invitrogen) or Cy3 (USA, GE Healthcare).

The PCR fragment digested with restriction enzymes is divided into four tubes and reacted with one kind of dyeing reagent. Thus, PCR fragments that can be used in all domains were labeled.

Specifically, a PCR fragment (903 bp) obtained by PCR using bacteriophage M13 DNA as a template as a forward primer and a reverse primer was used as a template and PCR was performed so that 50% amino-allyl UTP (Sigma) was labeled. The PCR fragment was ligated with an adapter having a restriction enzyme cleavage site, followed by restriction enzyme treatment. One of the four types of NHS-ester fluorescence (Alexa 488, Alexa 594, Alexa 647 (Invitrogen) or Cy3 (GE Healthcare)) was first ligated to each of the PCR fragments labeled with amino-allyl UTP and with restriction enzyme cleavage sites Signal tags with double-stranded DNA, in which signal generating substances were labeled, were produced by sequentially connecting four kinds of DNAs and referred to as "H signal tags ".

<Cross-Coupling Induction and Verification>

The resulting H signal tag was dissolved in reaction buffer (10 mM Tris (pH 7.0), 200 mM NaCl), and 8-methoxypsoralen (8-MOP; USA, Sigma) was added to a final concentration of 71.0 mg / Lt; / RTI &gt; for 1 hour. Covalent bond between the signal tag constituent base pairs was induced by cross-linking the H signal tag chain for 3 hours while injecting 365 nm wavelength (4 W) of ultraviolet light into the reaction product. Thus, a "C signal tag" containing a covalent bond was prepared.

The H signal tag and the corresponding C signal tag were measured in absorbance at 260 nm with UV-1800 (Shimadzu, Japan) while raising the temperature to 0.5 ° C by 95 ° C, The double-stranded nucleic acid was dissociated into a single-stranded nucleic acid with an increase in temperature, and the Tm was about 85 ° C and was present as a single-stranded nucleic acid at 95 ° C, while the C-signal tag retained double-stranded nucleic acid at 95 ° C Could know.

&Lt; Signal Generation Area, Production of Color Indication Barcode &gt;

In order to produce a signal-generating region color-coded barcode using the manufactured H-signal tag or C-signal tag, four kinds of signal tags for the first domain are put into four tubes as shown in FIG. 2 The signal tag of the selected tube is divided into four tubes, and four types of signal tags for the secondary domain are inserted into each tube. The remaining three signal tags for the secondary domain are also processed as described above to mix the two types of signal tags. The procedure of dividing the solution of the tube with the two kinds of signal tags into four tubes again and putting four kinds of signal tags for the tertiary domain into each tube was repeatedly performed for the solution mixed with all the two kinds of tags Prepare a solution with three types of signal tags. Repeat this procedure to prepare a tube with a total of seven signal tags.

The T4 ligase was treated in a tube with seven signal tags for the domain and ligated to produce a final structure in which signal tags for seven domains were arranged in a row and called "signal generation region".

The signal generation region is a biomolecule-specific barcode system, and it is made to be able to form a unique signal for each of four kinds of dyes (Alexa dye, Cy3) elongated in a long signal tag. The first probe molecule forms ~ 300 um nanospots when photographed by an epifluorescence microscope, and has seven linear labeled regions of each linear sequence.

<Fabrication of probe>

The first probe is a material that recognizes and binds biomolecules and generates a specific signal to direct and visualize a target molecule. The probe is a structure in which the first probe and the signal generating region are combined.

Preferably, the first probe used in the present invention may be a ligand such as an antibody and aptamer in order to quantify a biomolecule except a single-stranded nucleic acid and a nucleic acid for analysis of nucleic acid quantification, nucleic acid mutation or methylated DNA.

The non-immobilized first probe may have a 5'-signal generating region-spacer-first probe-3 'structure and may be used mainly for counting bacteria, cells, viruses and the like.

Spacer; 5'-AGAAGCGCAGAGCTTGGGCGCAGAACAC-3 '

A first probe, a single stranded nucleic acid, was prepared by ordering a 5'-spacer-first probe-3 '(Integrated DNA Technologies, USA). The non-immobilized first probe was prepared by combining the prepared 5'-spacer-first probe-3 'single-stranded nucleic acid and the prepared signal-generating region by a ligase coupling reaction.

In addition, when the first probe as the ligand is a 5'-spacer-first probe-3 'structure and the ligand is platamer, the framework of the 5'-spacer-first probe- (Integrated DNA Technologies, USA). In the case where the ligand is an antibody, a reactive group addition reaction to the antibody was carried out according to the protocol of the Thunder-Link ㄾ oligo conjugation system (Innova Biosciences Ltd., UK), and the antibody to which the reactive group was added was prepared. A single stranded nucleic acid, a spacer with a reactive group, was also custom made (Integrated DNA Technologies, USA). The 5'-spacer-antibody structure was prepared by reacting the antibody to which the reactive group was added with a single-stranded nucleic acid which was a spacer having the reactive group.

The non-immobilized first probe was prepared by binding the 5'-spacer-first probe-3 'structure prepared above and the signal generating region with a ligase coupling reaction.

The immobilized first probe may be used for quantitation by mainly counting nucleic acid and protein with a 5'-first probe-spacer-immobilized region-signal generating region-biotin-3 '(Formula 1) structure.

Fixed region: 5 '- (GCCACAGCACCTTGGTGCGTAGGATCTG) ₁₀ -3'

First, a first probe is used to prepare a fixed first probe using a single-stranded nucleic acid as a first probe.

A 5'-spacer-fixed region-3 'single stranded nucleic acid was prepared by customization (Integrated DNA Technologies, USA). Biotin was added to the signal generation region to prepare a 5'-signal generating region-biotin-3 'structure. The 5'-spacer-fixed region-3 'and the 5'-signal generating region-biotin-3' structure were ligated to each other to form a 5'-spacer-fixed region-signal generating region-biotin-3 ' And purified. A first probe having a 5'-first probe-spacer-fixed region-signal generating region-biotin-3 '(Formula 1) was prepared by performing a coupling reaction between the prepared purified reactant and a first probe.

The fixed first probe using the first probe uses an antibody is a 5'-antibody-spacer-fixed region-signal generating region-biotin-3 'structure.

First, in order to produce a fixed first probe, a 5'-signal generating region-biotin-3 'structure was prepared by adding biotin to 3'of one side of the signal generating region. A 5'-spacer-fixed region-3 'single stranded nucleic acid was prepared by customization (Integrated DNA Technologies, USA).

The 5'-spacer-fixed region-3 'single-stranded nucleic acid and the 5'-signal generating region-biotin-3' 1) structure was prepared.

At the 5 'end of the 5'-spacer-immobilized region-signal generating region-biotin-3' structure, the reactive group addition was carried out according to the protocol using a Thunder-Link ㄾ oligo conjugation system (Innova Biosciences Ltd., UK). 100 μl of 60-100 μM construct was added to the Oligo Activation Reagent tube and reacted at room temperature for 1 hour to activate. The activated reaction solution was desalted using a prepared column to perform the reactive group addition.

Addition of the reactive group to the antibody was carried out by adding 100 μl of 1 mg / ml antibody to the Antibody Activation Reagent tube and reacting at room temperature for 1 hour.

The reacted group-added antibody and the desalted structure were mixed at an appropriate ratio and reacted at room temperature for 12 to 24 hours. The Conjugate Clean Up Reagent was added to the reaction solution for 10 minutes, centrifuged at 15,000 g for 5 minutes, and the Conjugate Clean Up Reagent was added to the harvested reaction solution, followed by further centrifugation to remove the purified 5'- The first probe, the antibody-spacer-fixed region-signal generating region-biotin-3 'structure, was harvested.

The fixed first probe using platamer as a ligand may be a structure composed of a 5'-platemaker-spacer-fixed region-signal generating region-biotin-3 '(Formula 2).

In the production of the fixed first probe, biotin is added to the 3'-end of the signal generating region to prepare a 5'-signal generating region-biotin-3'structure, and a 5'-abtamer-spacer- Single stranded nucleic acids were custom made (Integrated DNA Technologies, USA). A 5'-plastomer-spacer-immobilized region-signal generated by ligating the 5'-signal generating region-biotin-3 'structure with the 5'-first probe- spacer- Region-biotin-3 ' structure.

(Second probe and competing molecule)

The second probe was prepared by combining a second probe and a solid support, and the competitive molecule was prepared by binding a target molecule or a target molecule analog to a solid support.

Hereinafter, the ligand and the target molecule are collectively referred to as a molecule.

The second probe or competing molecule is prepared by binding a magnetic bead directly to the molecule, or binding a single-stranded nucleic acid labeled with biotin, followed by binding magnetic beads. The ligands and biomolecules used in the present invention are shown in Tables 1 and 2.

Molecules and activated magnetic beads (M-280 Tosylactivated magnetic beads, Dynal Biotech ASA, Norway) were placed in a buffer solution (0.1 M borate buffer, pH 9.5) and reacted at room temperature for 48 hours. The magnetic beads to which the molecules are bonded can be separated using magnets, and unbound molecules are removed by washing the beads with the same buffer solution. Molecularly coupled magnetic beads (hereinafter referred to as "capture ligands") were washed and reacted with 0.1% BSA (Bovine Serum Albumin, Sigma Co.) solution at 37 ° C. for 4 hours to inactivate the tosyl groups . After several washes, magnetic beads were mixed with buffer solution (0.1 M PBS, pH 7.4) and stored at 4 ° C.

Harvesting the Spacer for the Molecules The material addition was first performed by custom biotinylation of the molecule with a single stranded nucleic acid (Biotin labeled at one end and a reactive group at the other end (Integrated DNA Technologies, USA). The addition of reactive groups to the molecules was performed according to the protocol using a Thunder-Link ㄾ oligo conjugation system (Innova Biosciences Ltd., UK).

Addition of the reactive group to the molecule was carried out by adding 100 μl of 1 mg / ml molecule to the Antibody Activation Reagent tube and reacting at room temperature for 1 hour. The binding of the reactive group-added molecule to the custom-made single-stranded nucleic acid is performed by desalting the activated reaction solution using the prepared column, mixing the desalted molecule with the single-stranded nucleic acid at an appropriate ratio, Lt; / RTI &gt; Conjugate Clean Up Reagent was added to the reaction solution for 10 minutes, centrifuged at 15,000 g for 5 minutes to add Conjugate Clean Up Reagent to the harvested biotin labeled molecule, and centrifuged again to remove the purified biotin labeled molecule Were harvested to produce biotin-labeled molecules.

The prepared biotin-labeled molecules and streptavidin-coated magnetic beads (Streptavidin-coupled Dynabeads, Dynal Biotech ASA, Norway) were reacted with each other while rotating continuously to produce a magnetic bit- Probe or competitive molecule ".

(Fixed molecule)

The immobilized molecule is a base sequence complementary to the nucleotide sequence of the repetitive structural part of the reporter molecule, and a single-stranded nucleic acid labeled with biotin at the 5 'end was prepared and prepared (Integrated DNA Technologies, USA).

Example  2. Bacteria

Representative food poisoning bacteria such as E. coli, Salmonella, Listeria and Staphylococci were counted by using the antibody of Table 2 and the non-fixed first probe and second probe prepared from the aspirator of Table 3.

The first probe used for bacterial counting can be used as a signal generating region composed of signal tags labeled with the same dye indicator in all seven domains. The second probe may be produced by fixing biotin or various solid supports to the second probe.

An antibody that binds to the surface molecule of food poisoning bacteria

Nucleotide sequence of platamer binding to food poisoning bacteria

 In the present invention, the bacteriological analysis reaction is a ligand-receptor reaction occurring in the following reaction solution.

The reaction solution contained 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, pH 7.4) in the case of the antibody ligand, and the celex buffer (20 mM Tris-Cl buffer, pH 7.6 contained 100 0.05 mM of sodium azide for inhibiting bacterial growth, 0.1 to 0.3% of bovine serum albumin for inhibiting nonspecific binding, 0.1 mM of sodium chloride, %. Preferably, the reaction temperature is a temperature of 20 to 30 占 폚.

15 μl of the first probe and 15 μl of the second probe structure to which biotin was added were reacted with 70 μl of the sample containing the bacteria for 30 minutes while shaking. 20 mu l of the reaction solution was treated on a glass slide coated with avidin to cover the cover slip. The biotin of the coated avidin reacts with the biotin of the second probe and the bacteria bound to the first probe are immobilized on a glass slide. The target cells were counted by counting spots generating a presence signal of bacteria in the complex formed by the first probe (FIG. 9).

Biotin was added to one end of the first probe to react with a first probe added with biotin and reacted with a glass slide coated with avidin to capture the presence signal of the cell in the complex formed by capturing the bacterial first probe complex The resulting formed spots were counted to count the target molecule bacteria.

The first probe may be prepared to specifically indicate various bacteria to various signal generation regions, and various kinds of bacteria may be simultaneously identified and counted by color analysis of the first probe and the bacterial complex.

Example 3. virus

In this experiment, hepatitis C virus type C was counted in serum or plasma using non-immobilized first and second probes.

AxSYM HCV version 3.0 (Abbott Laboratories, Abbott Park, IL, USA). AxSYM HCV version 3.0 is a method for qualitatively detecting hepatitis C virus antibody in patient's serum or plasma using MEIA (microparticle enzyme immunoassay) method, which is a form of enzyme assay. Results were judged to be positive if the anti-HCV ELISA S / CO value was> 1.

The probe of the unfixed first probe is a polyclonal hepatitis C virus (HCV) antibody and the probe of the second probe is a hepatitis C virus (HCV) NS3 antibody (EastCoat Bio.

The first probe used for the virus count may be used as a signal generation region composed of signal tags labeled with the same dye indicator in all seven domains. The second probe may be produced by fixing biotin or various solid supports to the second probe.

The reaction for virus analysis was performed by treating the first probe and the second probe with serum or plasma to perform an antigen-antibody reaction. For the reaction solution, 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, pH 7.4) was used.

The reaction solution may contain 0.05 to 0.2% of sodium azide for inhibiting bacterial growth, and 0.1 to 0.3% of bovine serum albumin for inhibiting non-specific binding. The reaction temperature is preferably a reaction temperature of 20 to 30 占 폚.

15 [mu] l of the first probe and 15 [mu] l of the second probe structure added with biotin were reacted with 70 [mu] l of HCV-containing serum for 30 minutes while shaking. 20 mu l of the reaction solution was treated on a glass slide coated with avidin to cover the cover slip. The biotin of the coated avidin reacts with the biotin of the second probe and the HCV to which the first probe is bound is immobilized on the glass slide. The spots generating the presence signal of HCV in the complex formed by the first probe were counted to count the target molecule HCV.

Alternatively, biotin is added to one end of the first probe to react with HCV and a biotin-added first probe, and then reacted with avidin-coated glass slide to capture HCV-first probe complex to form HCV-present complex And the target molecule HCV was counted.

A first probe can be prepared to specifically indicate various HCVs in various signal generation regions, and simultaneously, various types of HCV can be identified and counted through color analysis of the first probe and the HCV complex.

Example  4. Biomolecular Coefficient Sample Preparation

4-1. Single stranded nucleic acid  Probes included

(Nucleic acid quantitation)

The probes of the general formula (II) and the general formula (III) were subjected to organic synthesis with reference to specific base sequences of? -Actin, IL17 and IL17R mRNA of Table 11 (Bioneer, Korea). RNA quantitation for quantitative analysis was performed using IL17 and IL17RA, and the nucleotide sequence information of the IL17 and IL17RA genes (obtained from the GenBank data system (http: // www.ncbi.nlm.nih.gov) The accession number is NM_002190, and the accession number of IL17RA is NM_014339).

The probe sequence for the target mRNA

Biomolecules were isolated from AllPrep DNA / RNA / Protein Mini kit (Qiagen, USA) from tissue samples made of cells or cells. In the present invention, human cartilage tissue (Promocell, Germany) was used as a biological sample. After the cartilage tissue was dissolved in the buffer provided in the manufacturer, the dissolved sample was treated on the column and centrifuged to bind the DNA to the column membrane and harvest the filtered solution. DNA separation in the column membrane was performed by washing the column with the DNA, extracting the DNA from the membrane, and harvesting the DNA by centrifugation. The harvested filtrate solution was processed into a column provided by the manufacturer, and the proteins were harvested by precipitation and centrifugation of the proteins in the filtered solution. In addition, the RNA in the column was washed, the RNA in the membrane was extracted, and then harvested by centrifugation.

The first probe and the second probe were hybridized and washed with 100 ng of the total RNA to prepare a partial double-stranded nucleic acid as a first probe-target mRNA-second probe complex to prepare a sample of nucleic acid molecule count for nucleic acid quantification .

Hybridization conditions were hybridized in 0.5 M NaHPO4, 7% SDS (sodium dodecyl sulfate), 1 mM EDTA at 65 ℃ and washing was performed at 6 x SSC / 0.1% SDS at 48 ℃ and 0.1 x SSC (standard saline citrate) SDS at 42 ° C in 0.2 x SSC / 0.1% SDS at 68 ° C.

To harvest the first probe dissociated from the washed probe-target mRNA-second probe complex, 100 μl of 0.1X SSPE / 0.1% tween-20 solution was added to the purified material and incubated at 95 ° C for 5 minutes After treatment, the supernatant containing the first probe dissociated in the complex was harvested.

45 μL of the total reaction solution was dispensed in 9 μL aliquots and used as an analytical sample for the target molecule count analysis. For sample analysis, 3 μL of total reaction solution was analyzed 3 times.

Targeting mRNA is specifically indicated using the color indicating barcode in the first probe, and many target mRNAs can be simultaneously analyzed through color analysis of the complex.

The first probe-target mRNA-second probe complex formed additionally may be subjected to molecular counting to identify and quantify the target molecule nucleic acid.

(Nucleic acid Structure )

(I) a binding tag (AT); (ii) a signal generating region (SR); (iii) a signal generating region And a first probe (1 ^ST P) consisting of a mutation region (V) corresponding to a mutation adjacent region having a complementary hybridization sequence completely complementary to the target nucleic acid and a nucleotide mutation, and (iv) , And the first probe having nucleotide variation information is two kinds or more.

DNA mutation analysis was performed on the SNPs of IL17 and IL17RA, and information was collected from http://www.ncbi.nlm.nih.gov/snp.

An analytical sample was prepared by ligating the DNA with the first probe and the second probe to prepare a partial double-stranded nucleic acid, and then ligating the partial double-stranded nucleic acid to a complete double-stranded nucleic acid.

Hybridization conditions were hybridized in 0.5 M NaHPO4, 7% SDS (sodium dodecyl sulfate), 1 mM EDTA at 65 ℃ and washing was performed at 6 x SSC / 0.1% SDS at 48 ℃ and 0.1 x SSC (standard saline citrate) SDS at 42 ° C in 0.2 x SSC / 0.1% SDS at 68 ° C.

The 10-ml reaction solution contained 20 mM TrisHCl (pH 7.6), 25 mM sodium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, 1 mM NAD +, 0.1% Triton X-100, the washed reactants, 1 unit Taq DNA ligase (New England Biolabs, , USA) and reacted for 4 hours. And then washed and separated and harvested using magnetic particles of the first probe-target gene-second probe complex.

Probe sequence for analysis of gene structure variation

To harvest the first probe dissociated from the washed probe-target gene mutation-second probe complex, 100 μl of a 0.1X SSPE / 0.1% tween-20 solution was added to the purified material, After the differential treatment, the supernatant containing the first probe dissociated in the complex was harvested.

45 μL of the total reaction solution was dispensed in 9 μL aliquots and used as an analytical sample for the target molecule count analysis. For sample analysis, 3 μL of total reaction solution was analyzed 3 times.

The chromosome bar code in the first probe specifically indicates the gene mutation and the mutation type. Thus, many target gene mutations and mutation types can be simultaneously analyzed through the color analysis of the complex.

(Methylated DNA)

Nucleic acid methylation analysis was performed using the IL17 promoter-144 site (Thomas, R.M., et al., 2012, J Biol Chem. 287 (30): 25049-59).

The H of the above general formulas (IV) and (V) was subjected to organic synthesis by referring to the specific base sequence of whether IL17 methylation was shown in [Table 1], T for [Table 2] and P for [Table 3] Biona, Korea).

Probe sequence for IL 17 promoter methylation analysis

(I) a binding tag (AT), (ii) a signal generating region (SR), (iii) a second probe And a first probe (1 ^ST P) consisting of a methylation adjacent region having a complementary hybridization sequence completely complementary to the target nucleic acid and a region (V) corresponding to the methylation base, wherein the methylation information Is a single-stranded nucleic acid having guanine or thymine, which is a base complementary to cytosine or uracil in order to distinguish methylation bases. The first probe may be connected to the signal generation region A corresponding to unmethylation, and the signal generation region B corresponding to methylation.

To analyze the presence or absence of methylation of specific DNA in the cartilage tissue, genomic DNA was extracted from cartilage tissue using a kit and its concentration was measured using Nano Drop. Approximately 1 ~ 2 ㎍ of the extracted DNA was mixed with 0.5 N sodium hydroxide to make 16 캜 and reacted at 37 캜 for 15 minutes to transform the DNA into single stranded form. Sodium bisulfate (3.5 M) and hydroquinone (0.01 M) reagent were added and reacted at 56 ° C for 16 hours. Then, the precipitated reaction with ethanol was performed to concentrate only the transformed DNA, and then pure water was separated and dissolved with tertiary distilled water at 50 ° C. Then, sodium hydroxide was added to a concentration of 0.1M, and the reaction was allowed to proceed at room temperature for 15 minutes. And then concentrated again by ethanol precipitation. Finally, the solution was dissolved in tertiary distilled water at 30 ° C and stored at 20 ° C, and used as a target nucleic acid for the presence or absence of methylation.

Hybridizing the first probe with the second probe to produce a first probe-methylated DNA-second probe partial double-stranded nucleic acid, and then ligating the partial double-stranded nucleic acid into a complete double-stranded nucleic acid The methylated DNA can be analyzed by preparing an assay sample.

Hybridization conditions were hybridized in 0.5 M NaHPO4, 7% SDS (sodium dodecyl sulfate), 1 mM EDTA at 65 ℃ and washing was performed at 6 x SSC / 0.1% SDS at 48 ℃ and 0.1 x SSC (standard saline citrate) SDS at 42 ° C in 0.2 x SSC / 0.1% SDS at 68 ° C.

The 10-ml reaction solution contained 20 mM TrisHCl (pH 7.6), 25 mM sodium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, 1 mM NAD +, 0.1% Triton X-100, the washed reactants, 1 unit Taq DNA ligase (New England Biolabs, , USA) and reacted for 4 hours. Washed and separated and harvested using magnetic particles of the first probe-methylated DNA-second probe complex.

To harvest the first probe dissociated from the washed probe-methylated DNA-second probe complex, 100 μl of 0.1X SSPE / 0.1% tween-20 solution was added to the purified material and incubated at 95 ° C for 5 minutes After treatment, the supernatant containing the first probe dissociated in the complex was harvested.

45 μL of the total reaction solution was dispensed in 9 μL aliquots and used as an analytical sample for the target molecule count analysis. For sample analysis, 3 μL of total reaction solution was analyzed 3 times.

The chromaticity indicator barcode in the first probe specifically indicates the methylation of the methylated DNA. Thus, the methylation of many target methylated DNA and the methylation rate can be simultaneously analyzed through color analysis of the complex.

Preferably, when the specific DNA is unmethylated, fluorescence analysis can be performed in the signal generation region A at the 5 'end of the first probe and in the signal generation region B5 in the other case of methylation. That is, the first probe and the second probe are ligated to each other using a specific DNA as a template, and they are present as complete double-stranded DNA or partially double-stranded DNA depending on the complementary binding of the 5 'end of the first probe do. That is, the methylated DNA forms a complete double strand connected to the signal generating region B, and the unmethylated DNA forms a double strand of the first probe and the second probe connected to the signal generating region A.

The kit according to the present invention is characterized in that the methylation of the DNA and the ratio of the methylation of the DNA are analyzed through the methylation of the specific DNA using the first probe and the second probe and the ratio analysis method.

4-2. Ligand  Probes included

The ligands used in the present invention were prepared as shown in Table 1 and Table 2 using antibodies and platamers.

Molecular counting and quantification of the target molecule may also be performed using a fixed first probe and a second probe, both made of antibodies and an aptamer ligand.

The first probe for protein quantitative analysis may be composed of a ligand recognizing a specific site of the target molecule protein and the second probe may be composed of a ligand recognizing a site different from a site recognized by the first probe of the specific protein have.

The target molecule used in the ligand-based assay and the corresponding antibody

The target molecule used in the ligand-based assay and its corresponding platemaker

The present invention provides a method and kit for identifying and quantifying a target molecule using a ligand by quantifying a target molecule by a coating coefficient method, a capture counting method and a competitive counting method.

□ Target molecule

Biomolecular Coefficient by Coating Method, Capture Coefficient Method and Competition Coefficient Method The following biomolecules were prepared at a concentration of 100 μg / mL, respectively, and stored at 4 ° C. The solution was diluted stepwise to obtain the final concentration of biomolecules 1000 pg / mL, 100 pg / mL, 10 pg / mL 0.1 pg / mL, and 0 pg / mL. For analysis, each biomolecule was mixed with a reaction solution, and analytical samples were prepared and used.

(TGF), phospho-Tau (pSer400), C Reactive Protein (CRP), TGF (TGF), and amyloid beta Two types of proteins and standard substances were used: E. coli Enoyl-ACP Reductase (Fabl, 28kD) and Phototropin 1 (nph, 120kD), including alpha, IL1 beta, Serum Amyloid A, p53, CEACAM5 and alpha Fetoprotein .

Biomolecules for Coating Counting and Ablamin Ligands are CEA, HER-2, Interferon-γ, EGFR, PSMA, Thrombin, Tumor Necrosis Factor-alpha (TNFa), VEGF (165), Prion Protein, Acetylcholine Receptor Antibody, Human Osteopontin , ErbB2, HIV-1 R5 gp120 and HIV-1 R5 SU Glycoprotein were used.

The target molecules of the capture coefficient method and molecular ligand-based assay method are NGF / NGFβ, Amyloid beta (A4) Precursor Protein (APP), τ (Tau), phospho-Tau (pSer400), C Reactive Protein Three kinds of bacteria such as E. coli, Listeria and Salmonella CSA-1 and 11 kinds of proteins such as alpha, IL1 beta, Serum Amyloid A, p53, CEACAM5 and alpha Fetoprotein and E. coli Enoyl-ACP Reductase (Fabl, 28kD) and Phototropin 1 (nph, 120kD) were used.

Two biomolecules such as CEA, HER-2 and Interferon-y and Salmonella typhimurium and Staphylococcus aureus were used for the capture method and the biomolecule for the aptamer ligand.

The target molecule of the competitive counting method and molecular ligand-based assay method is composed of six kinds of low molecular steroid hormones such as cortisol, cortisone, testosterone, progesterone, androstendione and aldosterone and NGF / NGFβ, Amyloid beta (A4) Precursor Protein (Tau), phospho-Tau (pSer400), C Reactive Protein (CRP), TGF alpha, IL1 beta, Serum Amyloid A, p53, CEACAM5 and alpha Fetoprotein, and E. coli Enoyl Two types of ACP Reductase (Fabl, 28kD) and Phototropin 1 (nph, 120kD) were used.

Biomolecules for capture and counting and aptamer ligands are composed of two low-molecular antibiotics such as Kanamycin and Streptomycin, and a combination of CEA, HER2, Interferon-y, EGFR, PSMA, Thrombin, Tumor necrosis factor-alpha (TNFa), VEGF Protein, Acetylcholine Receptor Antibody, Human Osteopontin, ErbB2, HIV-1 R5 gp120 and HIV-1 R5 SU Glycoprotein.

□ Target molecule and probe reaction

Performing Target Molecular Coefficient with Coating Counting Method, Capture Counting Method and Competitive Counting Method In the following, a sample containing a target molecule was prepared as follows.

In the present invention, the reaction for biomolecule analysis is a ligand-receptor reaction occurring in the following reaction solution. The reaction solution contained 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl, pH 7.4) in the case of the antibody ligand, and the celex buffer (20 mM Tris-Cl buffer, pH 7.6 contained 100 mM NaCl, 2 mM MgCl2, 5 mM KCl, 1 mM CaCl2 and 0.02% Tween) was used.

The reaction solution may contain 0.05 to 0.2% of sodium azide for inhibiting bacterial growth, and 0.1 to 0.3% of bovine serum albumin for inhibiting non-specific binding. The reaction temperature is ideally at a temperature lower than the SELEX performance temperature in the case of the platamer ligand, and the reaction temperature is preferably 20 to 30 占 폚.

(Coating coefficient method)

25 μl of the biomolecule solution was added to 75 μl of the reaction solution, and the sample was prepared by reacting with a nitrocellulose membrane disc as a coating paper for 30 minutes while shaking. 1 μl of the first probe solution prepared above was added and reacted for 30 minutes to form a target molecule-first probe complex adhered to the disk. To remove the first probe nonspecifically combined with the excess first probe, the disk with the formed target molecule-first probe complex in the reaction solution was added with 150 μl of 0.1X SSPE / 0.1% tween-20 solution Washed three times and purified.

To harvest the first probe dissociated from the target molecule-first probe complex adhered to the washed disco, 100 μl of 0.1X SSPE / 0.1% tween-20 solution was added to the purified material and incubated at 95 ° C for 5 minutes After treatment, the supernatant containing the first probe dissociated in the complex was harvested.

45 μL of the total reaction solution was dispensed in 9 μL aliquots and used as an analytical sample for the target molecule count analysis. For sample analysis, 3 μL of total reaction solution was analyzed 3 times.

(Capture counting method)

25 μl of the biomolecule solution, 1 μl of the first probe solution and 1 μl of the second probe solution were added to 100 μl of the reaction solution while being continuously rotated for 30 minutes at room temperature to form a first probe-biomolecule- Complex.

In order to remove the excess probe, the first probe-biomolecule-second probe complex, and the first probe coupled with non-specific binding, 150 μl of the reaction solution / 0.1% tween-20 solution was added to the reaction solution, Followed by successive rotations, followed by three rounds of purification by magnetic beads of a second probe (Invitrogen, USA). To remove the first probe by non-specific binding, 150 [mu] l of 0.1X SSPE / 0.1% tween-20 solution was further added to the harvested precipitate and harvested with magnetic beads of the second probe (Invitrogen, USA) 3 times.

To harvest the first probe dissociated from the washed probe-target molecule-second probe complex, 100 μl of 0.1X SSPE / 0.1% tween-20 solution was added to the purified material and incubated at 95 ° C for 5 minutes After treatment, the supernatant containing the first probe dissociated in the complex was harvested.

45 μL of the total reaction solution was dispensed in 9 μL aliquots and used as an analytical sample for the target molecule count analysis. For sample analysis, 3 μL of total reaction solution was analyzed 3 times.

(Competitive coefficient method)

The competitive coefficient method is an analysis using a competitive ligand-receptor reaction occurring in a biomolecule, a competitive molecule and a first probe constituting the sample, which occurs in the reaction solution.

25 μl of the biomolecule solution, 1 μl of the competing molecular solution and 1 μl of the first probe solution were added to 100 μl of the reaction solution while continuously rotating for 30 minutes at room temperature to form a biomolecule-first probe complex and a competitive molecule 1 probe complex.

In order to remove the first probe bound to the biomolecule-first probe complex by non-specific binding, 150 μl of the reaction solution / 0.1% tween-20 solution was added to the reaction solution, and the mixture was continuously rotated for 5 minutes. (Invitrogen, USA). To remove the first probe with non-specific binding, 150 [mu] l of 0.1X SSPE / 0.1% tween-20 solution was further added to the harvested precipitate and harvested with magnetic beads of competitive molecules (Invitrogen, USA) .

In order to harvest the first probe dissociated from the washed competitive molecule-first probe complex, 100 μl of 0.1X SSPE / 0.1% tween-20 solution was added to the purified material, treated at 95 ° C for 5 minutes, A supernatant containing the first probe dissociated from the complex was harvested.

45 μL of the total reaction solution was dispensed in 9 μL aliquots and used as an analytical sample for the target molecule count analysis. For sample analysis, 3 μL of total reaction solution was analyzed 3 times.

In the present invention, the first probe of the composite including the first probe purified by the Coefficient Counting Method, the capture counting method and the competition counting method is subjected to the coefficient analysis and the biomolecule value of the sample is analyzed from the analysis result.

In the present invention, the target molecule present in the reaction solution in the coating coefficient method and the capture count method combines with the first probe to form the target molecule-first probe complex, and the degree of formation of the complex is proportional to the amount of the target molecule. The target molecule value, which is the result of quantitative analysis of the target molecule, is analyzed based on the result of the coefficient analysis of the spot, which is a signal generated in the first probe, which is dissociated in the complex containing the purified first probe .

Particularly, the competitive-counting method is determined by analyzing the first probe dissociated from the complex by separating the competitive molecule-first probe complex formed in the reaction solution. That is, the reaction of the target molecule and the competitive molecule to be analyzed with respect to the first probe forms a competitive probe with the target molecule-first probe complex and the competitive molecule-first probe complex. The degree of formation of the competitive molecule-first probe complex in the reaction solution is determined depending on the degree of formation of the biomolecule-first probe complex, so that the target molecule value can be determined by analyzing the signal of the competitive molecule-first probe complex. Competitive Molecule - The target molecule value is analyzed based on the results obtained by analyzing the coefficient of the spot, which is a signal generated from the dissociated first probe, by harvesting only the first probe complex and dissociating the first probe.

The target molecule value, which is the result of quantitative analysis of the target molecule, is calculated by counting the first probe dissociated in the complex including the finally purified first probe, measuring the amount of the first probe binding to the target molecule using the standard curve And the target molecule value is determined.

The target molecule values of the coating counting method, capture counting method and competition counting method can be determined using multiple assays that enable continuous analysis of one or more target molecules in a biological sample.

In multiple assays, first probes with signal generating regions that are dissociated in individual complexes and point to individual target molecules are immobilized, either directly or indirectly, in covalent or noncovalent bonds at distinct locations on the support. Multiple assays are realized by a mechanism capable of distinguishing two or more target molecules by a unique signal generated in a signal generation region, such as a quantum dot in a first probe coupled to a specific region of a support. Each instrument is used for the analysis of one of each of the multiple target molecules to be detected in the biological sample. Each instrument can be configured to process each target molecule simultaneously in a biological sample. For example, microtiter plates may be used as if each well in the plate was used to specifically analyze one of the multiple target molecules to be analyzed in the biological sample.

Example  5. Coefficient analysis

 The process of converting the information of the target molecule to the signal generating region of the first probe through the probe that specifically recognizes and binds to the target molecule, such as nucleic acid quantification, nucleic acid mutation, methylated DNA, ligand, . Therefore, if the signal generation region of the first probe in the analytical sample prepared in the embodiment is subjected to molecular counting, the information of the target molecule can be analyzed.

The analytical sample prepared in the above procedure was processed as follows to make the molecular count of the first probe signal generation region.

The nucleic acid quantification using a single stranded nucleic acid probe can be performed by washing and harvesting the first probe-target nucleic acid-second probe complex to quantify the target nucleic acid by counting the dissociated first probe. The target mRNA and the first probe bind one-to-one, so that the coefficient value of the first probe corresponds to the count value of the mRNA. MRNA was quantified using mRNA coefficient values determined using a pre-written standard curve.

The presence and type of the gene mutation can be detected by the first probe-gene mutation-second probe complex, a first probe dissociated from the reaction product obtained by an enzymatic reaction such as a elongation reaction or a linking reaction, 1 probe - the second probe connector can be counted. The former means that the mutation site of the target nucleic acid and the V region of the first probe are mis-tagged in a state in which the elongation reaction or linkage reaction can not be performed.

The presence or proportion of DNA methylation can be determined by comparing the first probe-methylated DNA-second probe complex with the first probe or the first probe in the reaction product obtained from the reaction, the first probe being dissociated from the reaction product obtained by the enzymatic reaction such as the elongation reaction or the linking reaction, 1 probe - the second probe connector can be counted. The former means that the target DNA methylation site and the V region of the first probe are mis-tagged in a state in which the elongation reaction or linkage reaction can not be performed.

Target molecule analysis in which the probe is a ligand can be quantified by counting and dissociating the first probe-target molecule-second probe complex and harvesting the first probe. The target molecule and the first probe bind in one-to-one association so that the count value of the first probe corresponds to the count value of the target molecule. MRNA was quantified using the target molecular count values determined using a pre-written standard curve.

The first probe count analysis in the reaction was performed as follows.

For biomolecular count analysis, the samples were processed through an n-counter prep station (Nanostring Technologies, Seattle, WA-USA) according to the assay method of the present invention with reference to the manufacturer's protocol, and an n-counter digital analyzer Technology, Seattle, WA-USA).

1 μl of a reagent diluted 1: 5,000 in 0.1% Tetraspeck fluorescence microsphere solution (Invitrogen, USA) was added to the purified complex solution prepared in the above Example 4 to prepare an assay sample. The prepared analytical sample was rotated in a NanoString fluid device containing a streptavidin-coated cover slip (Optichem, Accelr8 Technology Corporation) to produce a microfluidic channel with a depth of 30 μm. The analytical sample migrated to the channel by water pressure and bound strongly to the biotin of the first probe dissociated in the complex and streptavidin in the channel of the binding support. After fixation, the surface was washed once with 90 [mu] l of 1x TAE solution, and 40 [mu] l of TAE was added to each well to spread out. The first probe was aligned with the fluid channel by applying 160 V / cm for 1 minute. The expanded first probe was further immobilized on the surface by the addition of 60 [mu] l of 500 nM fixed molecule (biotin labeled oligonucleotide complementary to all of the first probe present repeating structures). During the immobilization process, the current was maintained for 5 minutes. After fixing, the TAE solution was removed and an anti-photobleaching SlowFade reagent (Invitrogen) was added for photographing.

The combined support with the first probe was a Perfect Focus, 1.4 NA Plan Apo VC 60X oil-immersion lens (Nikontk, Japan), anX-cite 120 metal halide light source (Exfo, USA), automated H117 stage (Prior Scientific) And Nikon Eclipse (Nikon Eclipse) TE2000E equipped with Smart Shutter (Sutter Instrument, USA). A typical photographic density counts between 100 and 200 reporters per FOV. For each field of view, four images at different excitation wavelengths (480, 545, 580, 622) were measured using MetaMorph (Universal Imaging Corporation, USA) or Orca Ag CCD camera (Hamamatsu, Japan) (Fig. 10).

The analyzer resolution was set to 600 FOV (field of view). Data was downloaded and analyzed on Excel as recommended (n-counter data analysis guidelines). The data normalized the reference material and the target molecule in the sample using the standard curve of the positive control group provided at the beginning. The normalized values were obtained by performing averaging over the whole of the target molecule values using the values of the reference materials contained in the sample. Calculated by taking the average of the target molecule values in three runs for individual target molecules.

As a result of quantitative analysis of mRNA in the specific biological sample used, a spot formed by the presence signal of the target molecule generated by the first probe dissociated in the first probe-specific mRNA-second probe complex was confirmed. This was similar to the RT-PCR result for the target mRNA.

As a result of checking the gene mutation of the used biological sample by the molecular counting method, a spot formed by a signal corresponding to the color pattern of the signal generation region of the first probe indicating the specific gene mutation type was confirmed. All of the mutation types were wild type, mutant type, wild type and mutant type. This was the same as the results confirmed by the nucleotide sequence method.

The presence or absence of DNA methylation and its ratio were confirmed by a molecular counting method. As a result, a spot formed as a signal corresponding to existence was identified according to the color pattern of the signal generation region of the first probe indicating the presence or absence of specific DNA methylation. DNA methylation patterns were present in the same sample in either methylated or unmethylated form and the ratio could be investigated as a percentage of a specific color pattern. It was confirmed that this is similar to the results obtained by the conventional nucleotide sequence method.

For the reaction using the antibody ligand by the above coating coefficient analysis, 11 kinds of proteins, 2 kinds of standard substances, and 14 kinds of proteins were analyzed for the reaction using the platamer ligand. The reaction using the antibody ligand by the capture factor analysis was analyzed for 11 kinds of proteins, 3 kinds of bacteria, 2 kinds of standard substances, and 3 types of proteins and 2 kinds of bacteria for the reaction using the platamer ligand. The reaction using the competitive ligand method using the antibody ligand was carried out by using six low-molecular steroid hormones, 11 proteins, two standard substances, and an enzymatic ligand as two small-molecule antibiotics and 14 proteins Respectively.

The control was composed of mock comparator composed of two kinds of reference materials by biomolecule counting method and control material composed of various materials including standard material 3 times. Analysis results using antibody ligands are as follows. Mock comparisons made of standard materials were used to normalize the data with slight differences in reaction, purification and collection efficiencies, and standard concentration curves for all reactions. First, the linearity, dynamic range and reproducibility of two kinds of standard materials were investigated (FIG. 11). The image was analyzed and the standard material by trapping and counting method 10, 13 is to capture counting method, 14 is a result of measuring a simulation comparing a standard substance by the sphere race counting method, (N = 6). Reproducibility was very high between 0.5 fM and 50 fM of the control signal values (counts) for each analysis, as indicated by overlapping points on the log-log plot. The analysis also showed that the linear regression coefficient of concentration versus count was highly linear from ≥0.2 to ≥0.998.

We then looked at sampling efficiency and limits of detection. The efficiency of the sampling system can be estimated by dividing the number of counts for biomolecules by the number of theoretical molecules of interest in the reaction. For example, in each reaction ~ 0.1 fM biomolecules are ~ 1,800 molecules. The average measurement for a biomolecule is 25 counts, so the sampling efficiency is ~ 1%. The detection limit of the assay was determined by comparing the counts of the negative controls with those of the lowest control positive controls using the Student t-test. The lowest detection limit in the present invention reaction was between 0.1 and 0.5 fM.

The reproducibility of the system for measuring proteins of 14 kinds of biomolecules using 13 protein molecules by the capture counting method using the antibody ligand and the platamer ligand by the coating coefficient method was evaluated. Normalized numbers for two independent reactions for 13 biomolecules using antibody ligands were expressed on a log-log scale (Fig. 15). The linear regression analysis of the data of the system of the present invention shows that the correlation coefficient is 0.9982 and the reproducibility is high. Similar results were obtained when the plastomer ligand was used.

Example  6. Analysis of biological meaning

A blood sample is used to diagnose chronic diseases such as acute myocardial infarction or septicemia. In general, three to four biomolecules for patient monitoring are examined and only the cut-off value of the result is referred to for diagnosis.

In Vitro Diagnostic Multivariate Index Assay (IVDMIA), which is a method to quantitatively analyze the functional relationship between normal population and patient group based on the results of quantitative examination of several target biomolecules, "Score", "index", etc. as the patient's specific results by combining multiple results of a target biomolecule using analytical functions for the purpose of diagnosing, treating, alleviating, treating, Is a device or technology that calculates the output power.

The Clinical Decision Support System which determines the biological meaning of the present invention is composed of data obtained by correcting the standard material and target molecule analysis result produced through the molecular factor analysis method and patient information of the operation control system . The output has a screen for entering and confirming the results of the clinician's analysis, a screen for explaining the risk and classification of the diagnosis to the patient, and a screen for explaining to the patient visually. The biological semantic analysis system should have an amplification product analyzer, OCS and interface, and should be able to store the results obtained from Data Mining into DB. It has an XML Repository to handle the XML data defined in HL7. You can set up the necessary items for Data Mining and control the mining engine.

As shown in FIG. 4, the learning engine module of the clinical decision support system is an artificial intelligence learning engine module necessary to determine a disease using a result of a molecular coefficient analysis using a probe indicating the target molecule.

The biological semantic analysis system supports HL7. Designing a data structure to include the Schema defined in HL7 when processing data within a biological semantic analysis system. It has XML Repository Module and XML Repository Client for storing and using Schema information of XML document.

In order to analyze the results of molecular analysis using a probe that indicates a target molecule, the molecular module has an interface module as a result of analyzing the molecular parameters for interlocking with the analyzing device. If the software development kit (SDK) is provided from the results of the molecular counting analysis, the gateway should be developed in principle. The OCS Interface Module reads patient information from OCS and provides the information needed for data mining. In addition, disease information analyzed by Data Mining is stored in OCS (LIS).

As shown in FIG. 5, the biological semantic analysis of the clinical decision support system is largely composed of four partial systems. The module for generating a data analysis / prediction model, which is a biological semantic determination engine, Module, and an amplification product analyzer interface, which is an interlocking module with the amplification product analyzer that generates the abdominal machine data, and a communication server, which is responsible for communication and data storage between the other modules. The operation of the system is largely divided into system construction phase and system application phase.

In the system construction phase, ① a normal person / patient sample set is constructed to reflect the characteristics of the disease, ② the molecular analysis of the target molecule using the standard substance for quality control and measurement for the relevant sample set, ③ Inputting the target molecule molecular analysis information into the system through the 'module for analyzing the device for the analysis of molecules', ④ 'learning data' generation of the artificial neural network algorithm by performing basic preprocessing in 'data analysis / prediction model generation module', ⑤ artificial neural network algorithm , And then the generated biological semantic analysis model is stored in the computer.

As shown in FIG. 6, the system application steps are as follows: (1) a biological semantic analysis model stored in a DB is installed in a biological semantic analysis client, (2) a biological semantic analysis client is driven, (3) ④ Data input through 'Molecular Coefficient Analyzer Interface' ⑤ Biological Semantic Analysis and Result Visualization in 'Biological Semantic Analysis Client' ⑥ Biological Semantic Analysis Result is stored in DB.

As shown in FIG. 7 and shown in FIG. 7, the result of the target molecule analysis indicates the degree of the target molecule. The numerical data is obtained from the numerator data, and each value represents the value of one target molecule, and the numerical value means the degree of the mode for each target molecule.

In addition to the target molecule information, the input from the system is clinical information for each patient. Clinical information about each patient such as age, gender, blood pressure, history of disease in family history, and smoking status are also input to each patient. All of these data are stored in the database. The clinical data used for constructing the system is basically received by the collaborating medical institution, and the mode data of the target molecule is obtained by using the molecular coefficient data.

As shown in Fig. 8, the results of the analysis of the molecular coefficient are converted into numerical data through a molecular coefficient analyzer. In order to directly use this data in the disease biological significance determination system, it is necessary to link the biological significance determination system with the molecular coefficient analyzing apparatus capable of reading the molecular coefficient using the probe indicating the target molecule. Therefore, we develop a gateway for interfacing with the clinical decision support system that determines the biological meaning based on the use of the molecular factor analyzing device that provides the SDK.

On the other hand, clinical data for biologic semantics allows the patient information of the OCS system to be input. It reads the patient information from the OCS through the OCS interface module and provides the system engine with the information necessary for data mining.

As shown in Figure 8, the indicator prediction for biological semantic determination of disease is based on information in the database. By applying various machine learning methods using stored information, it is possible to analyze the indicators for diseases. Representative machine learning methods such as artificial neural network, decision tree, Bayesian network, and support vector machine (SVM) are used as key algorithms for analysis. In general, these methods allow the prediction of new data by learning the vector form of numerical data as input. Artificial neural networks and support vector machines are the most used classification algorithms in the field of machine learning because they show excellent performance in classification of data. In addition, the decision tree and the beige mesh have the advantage that the results can be visualized so that they can be easily understood by humans. This biological significance system optimizes the learning model through the continuous testing through the artificial neural network algorithm, so that the prediction performance of the disease indicator can be improved.

When one or more target molecules for a new patient using standard materials for quality control and calibration are input into the analysis result information and clinical information produced by the molecular probe analysis method using a probe, As well as indicators of specific diseases. It shows information that can help doctors make decisions about the disease. Clients can display disease indicators more visibly through biological networks as well as simple numerical information on disease indicators. The results of the analysis on specific diseases will help not only the medical staff but also the patients to understand the indicators related to their diseases and their causes.

The communication server controls the communication of the clinical decision support system which determines the biological meaning. It controls all aspects of data flow, such as molecular coherence analyzer interface, biological semantics engine, biological semantics client, and database server. That is, the patient's experimental information is input to the DB, the biological semantic determination engine fetches and diagnoses the patient's experimental information, stores the biological semantic determination result in the DB, and outputs the biological semantic determination result to the biological semantic determination client screen It is responsible for all aspects of data management. The database server stores various data such as patient's test information, patient's experimental information, learning information necessary for determining the biological meaning, biological semantic determining engine model information, system setting information, system log information, and biological semantic determination result information. The communication server and the database have a close relationship with each other and manage data transmission for each module.

As shown in FIG. 9, it is possible to confirm the analysis result of the target molecule based on the analysis result of the reference material in the blood sample by using the molecular count analysis method for the blood sample to which the standard substance for quality control and correction is added The biological significance can be determined by confirming that the results of analysis of serum biomolecules in acute myocardial infarction patients or sepsis patients are different.

10 is a flow chart for diagnosing a disease by producing a biomolecule analysis result for a blood sample of a specific person by using a database composed of disease groups and an artificial neural network as a clinical decision support system. As shown in FIG. 11, biological data can be determined as useful information obtained by analyzing a database constructed from analysis results produced from many biological samples using bioinformatics technology.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is obvious that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

The present invention can detect target molecules in a biological sample with high sensitivity and reproducibility in a single analysis using the molecular counting technique for the target molecule, and can efficiently confirm the biological meaning of the target molecules. Accordingly, the present invention provides a method for efficiently determining the difference between individuals by analyzing various target molecules in a single test, such as a change in phenotype, sensitivity to disease, and response to a therapeutic agent in a biological sample, By contributing to the development of technology, it is highly regarded to overcome human disease, and there is very useful effect in the medical industry in the economic dimension.

Claims (1)

A method for indicating a target molecule comprising a cell or a virus to a signal generation region consisting of a combination of double-stranded nucleic acid (H signal tag) or H signal tag with a signal generating substance labeled and one or more target molecules being subjected to molecular counting.