KR101780942B1 - New yeast having improved ability of sucrose resolving - Google Patents

Abstract

The present invention relates to a strain of Saccharomyces cerevisiae having the deposit number KACC93216P having an excellent sucrose resolution and having the deposit number KACC93216P, and a process for preparing citrus vinegar or citrus juice using the same. The present invention is to identify and provide novel yeasts capable of rapidly degrading sugars, particularly sucrose, and capable of rapidly fermenting alcohol. Also, the yeast strain of the present invention can further reduce the acetic acid fermentation time and improve the acetic acid fermentation efficiency even when using the same acetic acid bacteria.

Description

[0001] The present invention relates to a new yeast having improved sucrose resolution,

The present invention relates to a new yeast strain, more particularly, to a novel yeast strain having an excellent sugar-resolving ability and an excellent alcohol fermentation and acetic acid fermentation efficiency.

To date, citrus fruit from Jeju has been used as a source of vitamins (vitamin C 31 ~ 40mg / 100cc, vitamins A 11 ~ 50 IU / 100cc), dietary fiber sources (cellulose, pectin etc.) Malic acid (malic acid, malic acid, etc.) and free sugars (glucose, fructose, etc.). On the medicinal side, essential oil components (terfen, R-limonene) contained in citrus peel are used for anticancer substances, natural detergents, , Flavonoids (hesperidin, narijine, etc.) are used as capillary blood vessel enhancers and cancer inhibitors.

Particularly, studies on the foods related to the functionality of citrus fruits are being actively carried out. Among them, interest in beverage, liquor, etc. is particularly high.

On the other hand, vinegar is a fermented food that has been handed down over a long history, both east and west. Since ancient times, our nation has produced and used various kinds of vinegar at home. Vinegar is used not only for the seasoning of all foods with salt but also as a raw material for pickles, mayonnaise, ketchup and sauces. Vinegar is largely classified into synthetic vinegar and vinegar. In Korea, synthetic vinegar, which can feel strong acidity at low prices until the 1960s, was mainly produced and consumed. Since then, production of brewed vinegar using cereal, fruit and alcohol has been started with the improvement of economy level. Recently, it has been consumed as an important seasoning in the diet instead of synthetic vinegar which is reported to be harmful. In addition, vinegar has been reported to control the metabolic regulation of the body, such as making the crepes cycle necessary to maintain health, making the blood weak alkaline, and various uses of vinegar have been diversified so that vinegar drinks are being developed in addition to seasonings. In addition, the quality of food in the improvement of taste and palatability of consumers to meet the trend is becoming more advanced.

Therefore, research on alcoholic beverage and vinegar or vinegar drink using citrus fruit which is recognized as an excellent food nutrition has been actively carried out.

Methods of industrially applicable vinegar production can be divided into horizontal fermentation, in which vinegar is made from alcohol as a substrate, and deep fermentation, in which vinegar is produced by aerating and stirring a mixture of acetic acid and alcohol.

In general, horizontal fermentation has a disadvantage in that the fermentation time is required to be higher than deep fermentation, despite the advantage that the equipment is relatively simple and the production cost is low and the final acidity is low and thus it is particularly suitable for producing vinegar drinks.

SUMMARY OF THE INVENTION Accordingly, the present invention has been made to solve the above problems and provide a method for improving the acetic acid fermentation efficiency by further shortening the acetic acid fermentation time even if the same acetic acid bacteria are used.

In addition, the inventors of the present invention intend to identify a new yeast strain capable of rapidly fermenting alcohol and having excellent glucose degrading ability, and provide the same.

In other words, a problem to be solved by the present invention is to provide a new yeast strain capable of not only rapidly performing alcohol fermentation but also significantly reducing acetic acid fermentation time using yeast bacteria having particularly excellent sucrose degrading ability.

In order to solve the above-mentioned problems, the present invention relates to a method for producing a saccharomyces Isis sp. CRSY14 ( Saccharomyces sp. CRSY14). The above-mentioned Sukaramishis sp. The CRSY14 strain has excellent ability to degrade various sugars, but particularly sucrose decomposition ability.

It was confirmed that the novel strain of the present invention exhibited a growth activity at a temperature of from pH 3 to 7 and from 13 to 30 캜.

The present invention provides a method for producing ethanol comprising the step of performing ethanol fermentation using the strain to achieve the object of the present invention.

On the other hand, the inventors of the present invention have found that, when ethanol fermentation is performed using the above-mentioned strains, the fermentation efficiency of acetic acid can be improved even when the same fermentation broth is used.

Acetic acid fermentation is a process using vinegar-producing bacteria such as Acetobacter bacteria, and it is generally known to be influenced by the kind of the above-mentioned Acetobacter species. Acetobacter sp. Having high acid resistance and high heat resistance is preferred have.

The inventors of the present invention have made vinegar using the same acetic acid bacterium. However, it has been confirmed that the fermentation efficiency of acetic acid is superior to that of the yeast strain of the present invention.

The present invention provides a method for producing vinegar comprising the steps of: performing ethanol fermentation using the strain and performing acetic acid fermentation using acetic acid bacteria.

Hereinafter, the present invention will be described in detail.

In the present invention, alcohol fermentation includes a fermentation process for producing ethanol, which means fermentation in which sugar is decomposed by carbon dioxide and alcohol by yeast.

The novel strains of the present invention are superior to conventional strains of Saccharomyces cerevisiae, particularly in the ability to degrade sucrose.

This strain is a new strain isolated from Onchuan citrus, which was deposited on Nov. 10, 2014 (Accession No .: KACC93216P) in the microorganism bank of the National Institute of Agricultural Science and Technology.

The yeast strain was mixed with citrus peel and sugar at a ratio of 1: 1 and fermented at 25 ° C. for one week. After one week, the sample was collected and cultured in a Y.M solid medium. The cells were cultured at 25 ± 1 ° C for 48 hours, subcultured three times, and isolated after single colony isolation.

The nucleotide sequence of the 16S rRNA of the strain described in SEQ ID NO: 3 and FIG. 1 was analyzed to find that S. cerevisiae And 99%, respectively.

In particular, when the strain has a composition of 50% citrus juice, 25 brix of sugar, and 0.36 acidity, the sugar degradation rate is higher and the alcohol fermentation rate is faster than that of existing yeasts when the temperature is 15 to 20 ° C. Preferably, the strain has an alcohol concentration of 13 to 17% within 15 to 25 days at a temperature of 15 to 20 占 폚, more preferably 10 to 30 days, most preferably 14 to 21 days Lt; / RTI >

That is, it can be seen that the alcohol fermentation rate is faster than the existing strains.

The present invention relates to a method for removing citrus fruit by washing selected citrus fruits to remove pericarp; Extracting the citrus juice from which the peel is removed to obtain a citrus juice; Diluting the citrus juice and sucrose donor with water to produce a substrate containing sucrose of 22 to 27 Brrix, inoculating the sucrose-containing substrate with a Saccharomyces strain of Accession No. KACC93216P; Comprising fermenting the sucrose-containing substrate inoculated with the sucrose isis strain No. KACC93216P at 15-20 DEG C for 10 to 25 days and then fermenting when the alcohol concentration reaches 13% or more .

Preferably, the strain may be inoculated at 5-10% by weight, more preferably 7-9% by weight, based on the total weight of the sucrose containing substrate.

The present invention also relates to a process for preparing a citrus fruit, comprising the steps of: washing a selected citrus fruit to remove pericarp; Extracting the citrus juice from which the peel is removed to obtain a citrus juice; Diluting the citrus juice and sucrose donor with water to prepare a substrate containing sucrose of 22 to 27 Brrix, inoculating the sucrose-containing substrate with a Saccharomyces strain of Accession No. KACC93216P; Fermenting the sucrose-containing substrate inoculated with Saccharomyces cerevisiae strain KACC93216P at an alcohol concentration of 8 to 15% after fermentation at 15 to 20 ° C for 10 to 25 days; and inoculating the alcohol fermented sucrose- And fermenting the mixture at 15 to 25 DEG C for 20 to 27 days to prepare an acetic acid fermentation broth.

Preferably, the acetic acid bacteria may be strain KCG326 KACC 91555P in the glucone acetobacterium.

The citrus vinegar is used not only as a sweetener but also as a diluted solution with water.

The present invention is to identify and provide novel yeasts capable of rapidly degrading sugars, particularly sucrose, and capable of rapidly fermenting alcohol.

The present invention can further shorten the acetic acid fermentation time by using the same acetic acid bacteria, thereby improving the acetic acid fermentation efficiency, and thereby reducing the possibility of contamination by germs.

In particular, it is possible to prevent the decrease in flavor and quality deterioration that may be caused by contamination.

Also, it is intended to provide a new yeast strain capable of not only rapidly performing alcohol fermentation but also significantly reducing acetic acid fermentation time by using a yeast strain having particularly excellent sucrose degrading ability.

In addition, since the time and process cost of producing the mainstream and vinegar using the yeast of the present invention can be reduced, the production cost can be greatly reduced.

FIG. 1 shows the result of analysis of the base sequence of 16S rRNA of Saccharomyces cerevisiae strain of the present invention.
2 is a graph showing the degree of alcohol fermentation of CRSY14 strain and CMY28 strain over time.
FIG. 3 is a graph showing changes in sugar content by alcohol fermentation with time by strains CRSY14 and CMY28.
Fig. 4 is a graph showing the fermentation of the strains CRSY14 and CMY28 with acetic acid. The degree of sugar content and degree of acidity were shown by time.
5 is a graph showing the results of free sugar analysis by fermentation of strains CRSY14 and CMY28. As can be seen from the graph, it can be seen that the CRSY14 strain of the present invention has a higher sucrose decomposition rate than the CMY28 strain.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the embodiments described below. The embodiments of the present invention are provided by way of example to facilitate a specific understanding of the present invention.

Example  1. Isolation of strain

The citrus peel and sugar were mixed at a ratio of 1: 1, fermented for one week to collect a sample, and yeast strains were isolated. The soil sample was diluted stepwise in sterilized saline to allow the microorganisms to float in saline. The supernatant was suspended in YM solid medium (Yeast Extract 3.0 g / L, Malt Extract 3.0 g / L, Peptone 5.0 g / L, Dextrose 10.0 g / L) for 3 hours at 25 짹 1 째 C for 48 hours. YM medium and cultured at 20 ± 1 ° C for 48 hours. Single colonies were isolated and screened.

Example  2. Identification of the strain

The isolates were identified based on the results of 16S rDNA sequencing of the isolates.

DNA sequencing was performed as follows.

First, the strain was cultured, and the culture was centrifuged to collect the cells, followed by genomic DNA extraction from the cells. The extracted genomic DNA was subjected to polymerase chain reaction (PCR) using fD2 (AGAGTTTGATCATGGCTCAG) primer (SEQ ID NO: 1) and rP1 (AAGTCGTAACAAGGTAACCGTA) primer (SEQ ID NO: 2). Table 1 below shows the composition of the PCR mixture, and Table 2 shows the PCR conditions.

Usage (uL) The template (10 ng / mL) One primer 10 pmol / uL 2 10X Taq polymerase buffer 5 dNTP 4 Taq polymerase 0.3 DW 5.7 Sum 20

Temperature Cycle number Predenaturation 95 ° C / 2 min Amplification 95 ° C / 30 sec 30 50 ° C / 1 min 72 ° C / 10 min Final extension 72 ° C / 10 min

As a result of the above analysis, the nucleotide sequence of SEQ ID NO: 3 was confirmed and confirmed to be a novel strain of Saccharomyces isi.

Example  3. Efficacy  Confirm

The strain isolated for 48 hours in a medium containing 50% citrus juice was cultured and used for alcohol fermentation. For the main cultivation for alcohol fermentation, citrus juice was adjusted to 50%, sugar content of 25brix, and acidity of 0.3-0.5 to inoculate 8% Alcohol fermentation was performed. Alcohol content, sugar content and acidity were measured at three intervals. Free sugars were analyzed after the final fermentation.

As can be seen in FIG. 2, it was found that the CRSY14 strain had a much faster rate of alcohol fermentation than the conventional strain CMY28 by digesting sugars.

The production of citrus juice is about 15 degrees, and the production rate of citrus juice is about 21 days for CRSY14 strains and 28 days for CMY28 strains. Therefore, citrus juice can be produced in about one week. have.

Considering the cost of alcohol fermentation, the production cost can be greatly reduced.

Example  4. Acetic acid efficacy  Confirm

After fermentation to 10% of alcohol, it was filtered to remove yeast, and acetic acid bacteria were inoculated to 10% of acetic acid fermentation broth for acetic acid fermentation. Then, acidity and sugar content were measured at intervals of 3 days and fermented until the acidity reached 5.

The effect of the novel yeast strain of the present invention on the fermentation of acetic acid as well as the influence on the fermentation of alcohol was confirmed.

Specifically, for the production of acetic acid beverages using citrus juice, acetic acid fermentation was carried out using alcoholic fermentation using acetic acid bacteria KCG326 up to 10% alcohol concentration using CMY28 and CRSY14 isolates. As can be seen from FIG. 4, when acetic acid fermentation was performed, the production rate of acetic acid was remarkably faster when the culture fermented with alcohol was used as the isolated CRSY14 strain than when the liquid phase fermented with the CMY28 strain was used. Generally, the acetic acid beverage is produced at an acidity of about 4-6. When the novel yeast strain of the present invention is used, the fermentation time to an acidity of 5 takes about 24 days and the conventional CMY28 strain takes more than 40 days.

From these results, it was confirmed that when using the yeast strain of the present invention, an alcohol-fermented culture broth can be used to obtain a product twice as fast.

Example  5. Free sugar analysis results

As can be seen from FIG. 5, it was confirmed that the yeast strain of the present invention has a higher decomposition rate of sucrose than CMY28, and thus affects alcohol fermentation and acetic acid fermentation.

Example  6. Sensory Evaluation

The vinegar beverage prepared by using the yeast strains of the present invention and the vinegar beverage prepared by using 28 strains of CMY were subjected to five sensory evaluations based on the five-point scale method, The results are shown in Table 3 below. The significance test at this time was t-test (p <0.05).

Comparative Example (CMY28) Experimental Example (CRSY14 strain) color 3.0 4.3 flavor 2.5 4.5 incense 3.5 4.2 Overall likelihood 3.1 4.6

(5 points scale: 5 points, very good, 4 points good, 3 points average, 2 points liked, 1 point very liked.)

As can be seen from the above results, the yeast strains of the present invention were superior to the comparative examples in terms of overall color, taste, flavor, and taste. In particular, when the strain CRSY14 was used, the fragrance was more excellent and fresh.

These results suggest that the citrus vinegar beverage using the CMY28 strain may have a relatively longer duration of acetic acid fermentation, which may have affected the taste and flavor changes. On the other hand, the acetic acid beverage using the yeast strains according to the present invention had a relatively short fermentation time and thus had a relatively small influence due to contamination by other microorganisms. As a result, beverages having excellent taste and flavor were obtained.

National Institute of Agricultural Science KACC93216P 20141017 National Institute of Agricultural Science KACC91555P 20100511

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> New yeast having improved ability of sucrose resolving <130> P14-335 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fD2 <400> 1 agagtttgat catggctcag 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rP1 <400> 2 aagtcgtaac aaggtaaccg ta 22 <210> 3 <211> 960 <212> RNA <213> Saccharomyces sp. <400> 3 tgggaagtaa aagtcgtaac aaggtttccg taggtgaacc tgcggaagga tcattaaaga 60 aatttaataa ttttgaaaat ggattttttt gttttggcaa gagcatgaga gcttttactg 120 ggcaagaaga caagagatgg agagtccagc cgggcctgcg cttaagtgcg cggtcttgct 180 aggcttgtaa gtttctttct tgctattcca aacggtgaga gatttctgtg cttttgttat 240 aggacaatta aaaccgtttc aatacaacac actgtggagt tttcatatct ttgcaacttt 300 ttctttgggc attcgagcaa tcggggccca gaggtaacaa acacaaacaa ttttatctat 360 tcattaaatt tttgtcaaaa acaagaattt tcgtaactgg aaattttaaa atattaaaaa 420 ctttcaacaa cggatctctt ggttctcgca tcgatgaaga acgcagcgaa atgcgatacg 480 taatgtgaat tgcagaattc cgtgaatcat cgaatctttg aacgcacatt gcgccccttg 540 gtattccagg gggcatgcct gtttgagcgt catttccttc tcaaacattc tgtttggtag 600 tgagtgatac tctttggagt taacttgaaa ttgctggcct tttcattgga tgtttttttt 660 ccaaagagag gtttctctgc gtgcttgagg tataatgcaa gtacggtcgt tttaggtttt 720 accaactgcg gctaatcttt ttttatactg agcgtattgg aacgttatcg ataagaagag 780 agcgtctagg cgaacaatgt tcttaaagtt tgacctcaaa ccaggtagga gtacccgctg 840 aacttaagca tatcaataag cggagaaggg cgaattccag cacactggcg cgtactagtg 900 atccgagctc ggtacagctg cgtatcatgg tcatagctgt ttcctgtgtg aatgtatccg 960                                                                          960

Claims (6)

delete delete delete Washing the selected citrus fruits to remove pericarp;
Extracting the citrus juice from which the peel is removed to obtain a citrus juice;
Diluting the citrus juice and sucrose with water to produce a substrate containing 22 to 27 Brrix of sucrose;
Inoculating the sucrose-containing substrate with a Saccharomyces cerevisiae strain of Accession No. KACC93216P;
Fermenting the sucrose-containing substrate inoculated with the Saccharomyces cerevisiae strain of KACC93216P with 10 to 25 days of fermentation at 10 to 25 DEG C and alcohol concentration of 8 to 12%; And
Fermenting the fermented acetic acid to the alcohol-fermented sucrose-containing substrate and fermenting the fermented broth at 10 to 25 ° C for 20 to 27 days,
Wherein the acetic acid is KCG326 strain of Accession No. KACC91555P. delete 5. The method according to claim 4, wherein the alcohol concentration in the alcohol fermentation step is 10 wt%.

Images