KR101780942B1 - New yeast having improved ability of sucrose resolving - Google Patents

New yeast having improved ability of sucrose resolving Download PDF

Info

Publication number
KR101780942B1
KR101780942B1 KR1020140158572A KR20140158572A KR101780942B1 KR 101780942 B1 KR101780942 B1 KR 101780942B1 KR 1020140158572 A KR1020140158572 A KR 1020140158572A KR 20140158572 A KR20140158572 A KR 20140158572A KR 101780942 B1 KR101780942 B1 KR 101780942B1
Authority
KR
South Korea
Prior art keywords
sucrose
strain
acetic acid
fermentation
present
Prior art date
Application number
KR1020140158572A
Other languages
Korean (ko)
Other versions
KR20160057677A (en
Inventor
김상숙
안현주
박경진
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020140158572A priority Critical patent/KR101780942B1/en
Publication of KR20160057677A publication Critical patent/KR20160057677A/en
Application granted granted Critical
Publication of KR101780942B1 publication Critical patent/KR101780942B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12GWINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00Preparation of other alcoholic beverages
    • C12G3/02Preparation of other alcoholic beverages by fermentation
    • C12G3/024Preparation of other alcoholic beverages by fermentation of fruits other than botanical genus Vitis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12JVINEGAR; PREPARATION OR PURIFICATION THEREOF
    • C12J1/00Vinegar; Preparation or purification thereof

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 기탁번호 KACC93216P을 가지는 자당 분해능이 우수한 기탁번호 KACC93216P의 사카로마이시스 속 균주 및 이를 이용한 감귤 식초 또는 감귤주 제조방법에 관한 것이다. 본 발명은 당, 특히 자당 분해능력이 우수하고, 알코올 발효를 신속하게 수행할 수 있는 새로운 효모균을 확인하고 이를 제공하고자 한다. 또한 본 발명의 효모균주는 같은 초산균을 이용하더라도 초산 발효 시간을 더욱 단축시켜 초산 발효 효율을 향상시킬 수 있다.The present invention relates to a strain of Saccharomyces cerevisiae having the deposit number KACC93216P having an excellent sucrose resolution and having the deposit number KACC93216P, and a process for preparing citrus vinegar or citrus juice using the same. The present invention is to identify and provide novel yeasts capable of rapidly degrading sugars, particularly sucrose, and capable of rapidly fermenting alcohol. Also, the yeast strain of the present invention can further reduce the acetic acid fermentation time and improve the acetic acid fermentation efficiency even when using the same acetic acid bacteria.

Description

자당 분해능이 우수한 신규한 효모균{New yeast having improved ability of sucrose resolving}[0001] The present invention relates to a new yeast having improved sucrose resolution,

본 발명은 신규 효모균에 관한 것으로, 더욱 상세하게는 당 분해능이 우수하고 알코올 발효 및 초산 발효 효율이 뛰어난 신규 효모균에 관한 것이다.The present invention relates to a new yeast strain, more particularly, to a novel yeast strain having an excellent sugar-resolving ability and an excellent alcohol fermentation and acetic acid fermentation efficiency.

현재까지 제주산 감귤은 식품·영양학적인 측면에서는 비타민 공급원 (비타민C 31~40mg/과즙 100cc, 비타민A 11~50 I.U/과즙 100cc), 식이섬유 공급원 (셀룰로즈, 펙틴 등), 유기산 공급원 (구연산, 사과산 등) 및 유리당(포도당, 과당 등)의 공급원으로 이용되고 있고, 의약적 측면에서는 감귤 과피에 함유된 정유 성분(테레핀류, R-리모넨)이 항암물질·천연세정제 및 향료 추출에 이용되고 있으며, 플라보노이드(헤스페리딘, 나리진 등)은 모세혈관 강화제 및 암 억제 물질로 이용되고 있다.To date, citrus fruit from Jeju has been used as a source of vitamins (vitamin C 31 ~ 40mg / 100cc, vitamins A 11 ~ 50 IU / 100cc), dietary fiber sources (cellulose, pectin etc.) Malic acid (malic acid, malic acid, etc.) and free sugars (glucose, fructose, etc.). On the medicinal side, essential oil components (terfen, R-limonene) contained in citrus peel are used for anticancer substances, natural detergents, , Flavonoids (hesperidin, narijine, etc.) are used as capillary blood vessel enhancers and cancer inhibitors.

특히, 감귤의 기능성과 관련된 식품에 대한 연구가 활발히 이루어지고 있는데 그 중에서 음료류, 주류, 등에 대해서는 관심이 특히 높다. Particularly, studies on the foods related to the functionality of citrus fruits are being actively carried out. Among them, interest in beverage, liquor, etc. is particularly high.

한편, 식초는 동·서양을 막론하고 오랜 역사를 지니고 전해 내려온 발효식품이며 옛부터 우리 민족은 다양한 종류의 식초를 가정에서 제조하여 이용해 왔다. 식초는 소금과 함께 모든 음식의 조미에 이용될 뿐만 아니라 절임식품, 마요네즈, 케첩, 소스류 등의 제조원료로도 널리 사용되고 있다. 식초는 크게 합성식초와 양조식초로 분류되며 우리 나라의 경우 1960년대까지 저렴한 가격으로 강한 산미를 느낄 수 있는 합성식초가 주로 생산·소비되었다. 이후 경제수준의 향상으로 곡류, 과실 및 알콜 등을 이용한 양조 식초의 생산이 본격화되었으며 최근에는 유해성이 보고되고 있는 합성식초를 대신해서 식생활에 중요 조미료로 소비되고 있다. 또한 식초는 건강을 유지시켜 주는데 필요한 크레브스 싸이클이 잘 돌아가게 하며 혈액을 약한 알칼리성으로 만드는 등, 체내 대사조절기능이 보고되면서 식초의 용도도 다양화되어 조미료 이외에 식초음료 등이 개발되고 있다. 이밖에 품질면에서도 식생활 향상으로 소비자의 기호성과 풍미를 충족시키는 고급화 추세를 보이고 있다.On the other hand, vinegar is a fermented food that has been handed down over a long history, both east and west. Since ancient times, our nation has produced and used various kinds of vinegar at home. Vinegar is used not only for the seasoning of all foods with salt but also as a raw material for pickles, mayonnaise, ketchup and sauces. Vinegar is largely classified into synthetic vinegar and vinegar. In Korea, synthetic vinegar, which can feel strong acidity at low prices until the 1960s, was mainly produced and consumed. Since then, production of brewed vinegar using cereal, fruit and alcohol has been started with the improvement of economy level. Recently, it has been consumed as an important seasoning in the diet instead of synthetic vinegar which is reported to be harmful. In addition, vinegar has been reported to control the metabolic regulation of the body, such as making the crepes cycle necessary to maintain health, making the blood weak alkaline, and various uses of vinegar have been diversified so that vinegar drinks are being developed in addition to seasonings. In addition, the quality of food in the improvement of taste and palatability of consumers to meet the trend is becoming more advanced.

이에 식품 영양학적으로 우수한 효과를 인정받은 감귤을 이용한 주류 및 식초 또는 식초 음료에 대한 연구가 활발하게 이루어 지고 있다. Therefore, research on alcoholic beverage and vinegar or vinegar drink using citrus fruit which is recognized as an excellent food nutrition has been actively carried out.

산업적으로 응용 가능한 식초의 생산방법에는, 크게 정치된 액의 표면에 초산균막을 형성시켜 알코올을 기질로 식초를 만드는 수평발효와 초산균과 알코올의 혼합액을 통기 교반하여 식초를 만드는 심부발효로 나눌 수 있다. Methods of industrially applicable vinegar production can be divided into horizontal fermentation, in which vinegar is made from alcohol as a substrate, and deep fermentation, in which vinegar is produced by aerating and stirring a mixture of acetic acid and alcohol.

일반적으로 수평발효는 설비가 비교적 간단하여 생산비용이 적게 소요되고, 특히 최종 산도가 낮아 식초음료 제조에 특히 적합하다는 장점에도 불구하고, 발효시간이 심부발효에 비해 더 많이 소요된다는 단점이 있었다.In general, horizontal fermentation has a disadvantage in that the fermentation time is required to be higher than deep fermentation, despite the advantage that the equipment is relatively simple and the production cost is low and the final acidity is low and thus it is particularly suitable for producing vinegar drinks.

따라서 본 발명은 위와 같은 문제점을 해결하고, 같은 초산균을 이용하더라도 초산 발효 시간을 더 단축시켜 초산 발효 효율을 향상시킬 수 있는 방법을 제공한다. SUMMARY OF THE INVENTION Accordingly, the present invention has been made to solve the above problems and provide a method for improving the acetic acid fermentation efficiency by further shortening the acetic acid fermentation time even if the same acetic acid bacteria are used.

또한, 본 발명의 발명자들은 당 분해능력이 우수하고, 알코올 발효를 신속하게 수행할 수 있는 새로운 효모균을 확인하고 이를 제공하고자 한다. In addition, the inventors of the present invention intend to identify a new yeast strain capable of rapidly fermenting alcohol and having excellent glucose degrading ability, and provide the same.

다시 말해, 본 발명이 해결하고자 하는 과제는 자당 분해 능력이 특히 우수한 효모균을 이용하여 알코올 발효를 신속히 수행할 뿐만 아니라, 초산 발효 시간도 현저히 단축할 수 있는 새로운 효모균을 제공하고자 하는 것이다.In other words, a problem to be solved by the present invention is to provide a new yeast strain capable of not only rapidly performing alcohol fermentation but also significantly reducing acetic acid fermentation time using yeast bacteria having particularly excellent sucrose degrading ability.

상기 과제를 해결하기 위하여 본 발명은 기탁번호 000을 가지는, 당 분해 능력이 우수한 사카로마이시스 sp. CRSY14 (Saccharomyces sp. CRSY14) 균주를 제공한다. 상기 사카로마이시스 sp. CRSY14 균주는 여러 종류의 당 분해 능력이 우수하나, 그 중에서도 특히 자당(sucrose) 분해 능력이 우수하다. In order to solve the above-mentioned problems, the present invention relates to a method for producing a saccharomyces Isis sp. CRSY14 ( Saccharomyces sp. CRSY14). The above-mentioned Sukaramishis sp. The CRSY14 strain has excellent ability to degrade various sugars, but particularly sucrose decomposition ability.

본 발명의 신규 균주는 pH 3-7, 13℃-30℃의 온도조건에 생육활성을 나타내는 것을 확인하였다. It was confirmed that the novel strain of the present invention exhibited a growth activity at a temperature of from pH 3 to 7 and from 13 to 30 캜.

본 발명은 본 발명이 목적으로 하는 과제를 달성하기 위하여, 상기 균주를 이용하여 에탄올 발효를 수행하는 단계를 포함하는 에탄올 제조방법을 제공한다. The present invention provides a method for producing ethanol comprising the step of performing ethanol fermentation using the strain to achieve the object of the present invention.

한편, 본 발명의 발명자들은 상기 균주를 이용하여 에탄올 발효를 수행한 후, 생산된 알코올 발효액을 이용하는 경우, 같은 초산균을 이용하더라도 더 우수한 초산 발효 효율을 얻을 수 있다는 것을 확인하였다. On the other hand, the inventors of the present invention have found that, when ethanol fermentation is performed using the above-mentioned strains, the fermentation efficiency of acetic acid can be improved even when the same fermentation broth is used.

초산 발효는 식초 생성균인, 아세토박터 속(Acetobacter) 균 등을 이용하는 과정으로, 일반적으로 상기 아세토박터속 균의 종류 등에 따라 영향을 받는 것으로 알려져 있으며, 내산성 및 내열성이 높은 아세토박터 속 균주가 선호되고 있다. Acetic acid fermentation is a process using vinegar-producing bacteria such as Acetobacter bacteria, and it is generally known to be influenced by the kind of the above-mentioned Acetobacter species. Acetobacter sp. Having high acid resistance and high heat resistance is preferred have.

본 발명의 발명자들은 동일한 초산균을 사용하여 식초를 제조하였으나, 본 발명의 효모균으로 알코올 발효된 배양액이 초산 발효 효율이 더 우수하다는 것을 확인하게 되었다. The inventors of the present invention have made vinegar using the same acetic acid bacterium. However, it has been confirmed that the fermentation efficiency of acetic acid is superior to that of the yeast strain of the present invention.

본 발명은 본 발명이 목적으로 하는 과제를 달성하기 위하여, 상기 균주를 이용하여 에탄올 발효를 수행한 후, 초산균을 이용하여 초산발효를 수행하는 단계를 포함하는 식초 제조방법을 제공한다. The present invention provides a method for producing vinegar comprising the steps of: performing ethanol fermentation using the strain and performing acetic acid fermentation using acetic acid bacteria.

이하 본 발명을 상세히 설명한다. Hereinafter, the present invention will be described in detail.

본 발명에 있어서, 알코올 발효는 에탄올을 생산하는 발효과정을 포함하는 것으로, 당분이 효모에 의하여 이산화탄소와 알코올로 분해하여 이루어지는 발효를 의미한다. In the present invention, alcohol fermentation includes a fermentation process for producing ethanol, which means fermentation in which sugar is decomposed by carbon dioxide and alcohol by yeast.

본 발명의 신규 균주는 종래 사카로마이시스 속 균주들에 비해 특히 자당 분해 능력이 탁월하다.The novel strains of the present invention are superior to conventional strains of Saccharomyces cerevisiae, particularly in the ability to degrade sucrose.

상기 균주는 사카로마이시스 속 CRSY14 균주는 온주밀감으로부터 분리된 신균주로서, 농업유전자원정보센터 미생물은행에 2014년 11월 10일에 기탁되었다(기탁번호 : KACC93216P). This strain is a new strain isolated from Onchuan citrus, which was deposited on Nov. 10, 2014 (Accession No .: KACC93216P) in the microorganism bank of the National Institute of Agricultural Science and Technology.

상기 효모균주는 감귤 껍질과 설탕을 1:1 비율로 섞어 일주일간 25도에서 발효하고 일주일 후 시료를 채취하고, Y.M 고체배지에서 배양하였다. 25±1℃에서 48시간 배양하고 3회 계대배양하여 단일 콜로니 분리한 후 선발하였다.The yeast strain was mixed with citrus peel and sugar at a ratio of 1: 1 and fermented at 25 ° C. for one week. After one week, the sample was collected and cultured in a Y.M solid medium. The cells were cultured at 25 ± 1 ° C for 48 hours, subcultured three times, and isolated after single colony isolation.

서열번호 3 및 도 1에 기재된 상기 균주의 16S rRNA의 염기서열을 분석한 결과 S. cerevisiae 와 99% 상동성을 가지는 것으로 확인하였다. The nucleotide sequence of the 16S rRNA of the strain described in SEQ ID NO: 3 and FIG. 1 was analyzed to find that S. cerevisiae And 99%, respectively.

특히, 상기 균주는 감귤착즙액 50%, 당도 25 brix, 산도 0.36의 조성을 갖는 배지에서 15 내지 20℃ 온도 조건일 때, 기존 효모균에 비해 당 분해 속도가 우수하고, 알코올 발효 속도가 빠르다. 바람직하게 상기 균주는 15 내지 20℃ 온도 조건에서, 15 내지 25일 내에 13 내지 17%의 알코올 농도를 가질 수 있으며, 더 바람직하게는 10 내지 30일, 가장 바람직하게는 14 내지 21일 내에 목적으로 하는 알코올 농도를 가질 수 있다. In particular, when the strain has a composition of 50% citrus juice, 25 brix of sugar, and 0.36 acidity, the sugar degradation rate is higher and the alcohol fermentation rate is faster than that of existing yeasts when the temperature is 15 to 20 ° C. Preferably, the strain has an alcohol concentration of 13 to 17% within 15 to 25 days at a temperature of 15 to 20 占 폚, more preferably 10 to 30 days, most preferably 14 to 21 days Lt; / RTI >

즉, 기존 균주에 비해 알코올 발효 속도가 빠르다는 것을 알 수 있다. That is, it can be seen that the alcohol fermentation rate is faster than the existing strains.

본 발명은 선별된 감귤을 세척하여 과피를 제거하는 단계; 과피가 제거된 감귤을 착즙하여 감귤 착즙액을 얻는 단계; 상기 감귤 착즙액 및 자당 제공원을 물과 희석하여 22 내지 27 브릭스(Brix°의 자당 함유 기질을 제조하는 단계; 상기 자당 함유 기질에 기탁번호 KACC93216P의 사카로마이시스 균주로 접종하는 단계; 및 상기 기탁번호 KACC93216P의 사카로마이시스 균주가 접종된 자당 함유 기질을 15-20 ℃에서 10 내지 25일간 발효 후 알코올 농도가 13% 이상 되었을 때 발효 완료시키는 단계를 포함하는, 감귤주의 생산방법을 제공할 수 있다. The present invention relates to a method for removing citrus fruit by washing selected citrus fruits to remove pericarp; Extracting the citrus juice from which the peel is removed to obtain a citrus juice; Diluting the citrus juice and sucrose donor with water to produce a substrate containing sucrose of 22 to 27 Brrix, inoculating the sucrose-containing substrate with a Saccharomyces strain of Accession No. KACC93216P; Comprising fermenting the sucrose-containing substrate inoculated with the sucrose isis strain No. KACC93216P at 15-20 DEG C for 10 to 25 days and then fermenting when the alcohol concentration reaches 13% or more .

바람직하게, 상기 균주는 자당 함유 기질 전체 중량 대비 5-10중량% 로 접종될 수 있으며, 더 바람직하게는 7 내지 9 중량% 접종될 수 있다. Preferably, the strain may be inoculated at 5-10% by weight, more preferably 7-9% by weight, based on the total weight of the sucrose containing substrate.

본 발명은 또한, 선별된 감귤을 세척하여 과피를 제거하는 단계; 과피가 제거된 감귤을 착즙하여 감귤 착즙액을 얻는 단계; 상기 감귤 착즙액 및 자당 제공원을 물과 희석하여 22 내지 27 브릭스(Brix°의 자당 함유 기질을 제조하는 단계; 상기 자당 함유 기질에 기탁번호 KACC93216P의 사카로마이시스 균주로 접종하는 단계; 상기 기탁번호 KACC93216P의 사카로마이시스 균주가 접종된 자당 함유 기질을 15-20 ℃에서 10 내지 25일간 발효 후 알코올 농도가 8 내지 15%로 알코올 발효하는 단계; 및 상기 알코올 발효된 자당 함유 기질에 초산균을 접종하여 20 내지 27일간 15-25 ℃에서 발효시켜 초산발효액을 제조하는 단계를 포함하는, 감귤 식초의 제조방법을 제공할 수 있다. The present invention also relates to a process for preparing a citrus fruit, comprising the steps of: washing a selected citrus fruit to remove pericarp; Extracting the citrus juice from which the peel is removed to obtain a citrus juice; Diluting the citrus juice and sucrose donor with water to prepare a substrate containing sucrose of 22 to 27 Brrix, inoculating the sucrose-containing substrate with a Saccharomyces strain of Accession No. KACC93216P; Fermenting the sucrose-containing substrate inoculated with Saccharomyces cerevisiae strain KACC93216P at an alcohol concentration of 8 to 15% after fermentation at 15 to 20 ° C for 10 to 25 days; and inoculating the alcohol fermented sucrose- And fermenting the mixture at 15 to 25 DEG C for 20 to 27 days to prepare an acetic acid fermentation broth.

바람직하게 상기 초산균은 글루콘아세토박터 속 KCG326 KACC 91555P 균주를 이용할 수 있다. Preferably, the acetic acid bacteria may be strain KCG326 KACC 91555P in the glucone acetobacterium.

상기 감귤 식초는 감미료로 이용될 뿐만 아니라, 물과 희석하여 음용할 수 있다.The citrus vinegar is used not only as a sweetener but also as a diluted solution with water.

본 발명은 당, 특히 자당 분해능력이 우수하고, 알코올 발효를 신속하게 수행할 수 있는 새로운 효모균을 확인하고 이를 제공하고자 한다. The present invention is to identify and provide novel yeasts capable of rapidly degrading sugars, particularly sucrose, and capable of rapidly fermenting alcohol.

본 발명은 같은 초산균을 이용하더라도 초산 발효 시간을 더욱 단축시켜 초산 발효 효율을 향상시킬 수 있으며, 이로 인해 잡균에 의한 오염 가능성을 상대적으로 낮출 수 있다. The present invention can further shorten the acetic acid fermentation time by using the same acetic acid bacteria, thereby improving the acetic acid fermentation efficiency, and thereby reducing the possibility of contamination by germs.

특히, 오염으로 인해 발생할 수 있는 풍미 감소 및 품질 저하를 막을 수 있다. In particular, it is possible to prevent the decrease in flavor and quality deterioration that may be caused by contamination.

또한, 자당 분해 능력이 특히 우수한 효모균을 이용하여 알코올 발효를 신속히 수행할 뿐만 아니라, 초산 발효 시간도 현저히 단축할 수 있는 새로운 효모균을 제공하고자 하는 것이다.Also, it is intended to provide a new yeast strain capable of not only rapidly performing alcohol fermentation but also significantly reducing acetic acid fermentation time by using a yeast strain having particularly excellent sucrose degrading ability.

뿐만 아니라, 본 발명의 효모균을 이용한 주류 생산 및 식초 생산 시 소요되는 시간 및 공정상의 비용을 절감할 수 있어 생산 단가 감소에도 크게 기여할 수 있다. In addition, since the time and process cost of producing the mainstream and vinegar using the yeast of the present invention can be reduced, the production cost can be greatly reduced.

도 1은 본 발명의 사카로마이시스 속 균주의 16S rRNA의 염기서열을 분석한 결과를 나타낸 것이다.
도 2는 CRSY14 균주와 CMY28 균주의 시간에 따른 알코올 발효 정도를 나타낸 그래프이다.
도 3은 CRSY14 균주와 CMY28 균주에 의한 시간에 따른 알코올 발효에 의한 당도 변화를 나타낸 그래프이다.
도 4는 CRSY14 균주와 CMY28 균주의 초산 발효를 나타낸 그래프이다. 시간에 따라 당도와 산도 정도를 나타내었다.
도 5는 CRSY14 균주와 CMY28 균주의 발효에 의한 유리당 분석 결과를 나타낸 그래프이다. 그래프에서 확인할 수 있듯이, 본 발명의 CRSY14 균주는 CMY28 균주에 비해 자당 분해 속도가 빠른 것을 알 수 있다.
FIG. 1 shows the result of analysis of the base sequence of 16S rRNA of Saccharomyces cerevisiae strain of the present invention.
2 is a graph showing the degree of alcohol fermentation of CRSY14 strain and CMY28 strain over time.
FIG. 3 is a graph showing changes in sugar content by alcohol fermentation with time by strains CRSY14 and CMY28.
Fig. 4 is a graph showing the fermentation of the strains CRSY14 and CMY28 with acetic acid. The degree of sugar content and degree of acidity were shown by time.
5 is a graph showing the results of free sugar analysis by fermentation of strains CRSY14 and CMY28. As can be seen from the graph, it can be seen that the CRSY14 strain of the present invention has a higher sucrose decomposition rate than the CMY28 strain.

이하, 본 발명을 보다 구체적으로 설명하기 위하여 하기 실시예 등을 들어 설명한다. 그러나, 본 발명에 따른 실시예들은 여러 가지 다른 형태로 변형될 수 있으며 본 발명의 범위가 아래에서 상술하는 실시예들에 한정되는 것으로 해석되어서는 안 된다. 본 발명의 실시예들은 본 발명의 구체적 이해를 돕기 위해 예시적으로 제공되는 것이다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the embodiments described below. The embodiments of the present invention are provided by way of example to facilitate a specific understanding of the present invention.

실시예Example 1. 균주의 분리 1. Isolation of strain

감귤껍질과 설탕을 1:1 비율로 섞어 일주일간 발효하여 샘플을 채취 후, 효모 균주들을 분리하였다. 상기 토양 샘플을 멸균된 식염수에 단계적으로 희석하여 미생물이 식염수 안에 부유하도록 하여 상등액을 100 마이크로리터 피펫을 사용하여 YM 고체 배지(Yeast Extract 3.0 g/L, Malt Extract 3.0 g/L, Peptone 5.0 g/L, Dextrose 10.0 g/L)에서 25±1℃ 48시간 3회 계대배양하였다. YM 배지에 plating 하여 20±1℃에서 48시간배양한 후, 단일 콜로니(Single colony)분리한 후 선발하였다.
The citrus peel and sugar were mixed at a ratio of 1: 1, fermented for one week to collect a sample, and yeast strains were isolated. The soil sample was diluted stepwise in sterilized saline to allow the microorganisms to float in saline. The supernatant was suspended in YM solid medium (Yeast Extract 3.0 g / L, Malt Extract 3.0 g / L, Peptone 5.0 g / L, Dextrose 10.0 g / L) for 3 hours at 25 짹 1 째 C for 48 hours. YM medium and cultured at 20 ± 1 ° C for 48 hours. Single colonies were isolated and screened.

실시예Example 2. 균주의 동정 2. Identification of the strain

상기 분리된 균주의 16S rDNA sequencing을 수행한 결과를 토대로 동정하였다.The isolates were identified based on the results of 16S rDNA sequencing of the isolates.

DNA sequencing은 하기와 같은 방법으로 수행하였다.DNA sequencing was performed as follows.

우선 상기 균주를 배양하고, 상기 배양액에 대해 원심분리를 수행하여 균체를 회수한 후에, 상기 균체로부터 genomic DNA 추출하였다. 상기 추출된 genomic DNA에 대하여, fD2(AGAGTTTGATCATGGCTCAG) 프라이머(서열번호 1)와 rP1(AAGTCGTAACAAGGTAACCGTA) 프라이머(서열번호 2)를 이용하여 중합효소연쇄반응(PCR)을 실시하였다. 하기 표 1에는 PCR mixture의 조성을 나타냈으며, 표 2에는 PCR 조건을 나타냈다.First, the strain was cultured, and the culture was centrifuged to collect the cells, followed by genomic DNA extraction from the cells. The extracted genomic DNA was subjected to polymerase chain reaction (PCR) using fD2 (AGAGTTTGATCATGGCTCAG) primer (SEQ ID NO: 1) and rP1 (AAGTCGTAACAAGGTAACCGTA) primer (SEQ ID NO: 2). Table 1 below shows the composition of the PCR mixture, and Table 2 shows the PCR conditions.

사용량(uL)Usage (uL) 주형 (10ng/mL)The template (10 ng / mL) 1One primer 10 pmol/uLprimer 10 pmol / uL 22 10X Taq polymerase buffer10X Taq polymerase buffer 55 dNTPdNTP 44 Taq polymeraseTaq polymerase 0.30.3 DWDW 5.75.7 합계Sum 2020

온도Temperature Cycle numberCycle number PredenaturationPredenaturation 95℃/2min95 ° C / 2 min AmplificationAmplification 95℃/30sec95 ° C / 30 sec 3030 50℃/1min50 ° C / 1 min 72℃/10min72 ° C / 10 min Final extensionFinal extension 72℃/10min72 ° C / 10 min

상기 분석결과, 서열번호 3의 염기서열을 확인하였으며, 새로운 사카로마이시스 속 균주임을 확인하였다.
As a result of the above analysis, the nucleotide sequence of SEQ ID NO: 3 was confirmed and confirmed to be a novel strain of Saccharomyces isi.

실시예Example 3.  3. 발효능Efficacy 확인 Confirm

감귤 착즙액 50%를 포함하는 배지에서 48시간 분리된 균주를 배양하여 알코올 발효에 사용하였다. 알코올 발효를 위한 본배양을 위해서는 감귤 착즙액 50%, 당도 25brix, 산도 0.3-0.5로 조정하여 전배양 균주 8%를 접종하여 15 ℃ ±2에서 알코올 발효를 수행하였다. 3 간격으로 알코올 량과 당도, 산도를 측정하였다. 최종 발효 후 유리당을 분석하였다.The strain isolated for 48 hours in a medium containing 50% citrus juice was cultured and used for alcohol fermentation. For the main cultivation for alcohol fermentation, citrus juice was adjusted to 50%, sugar content of 25brix, and acidity of 0.3-0.5 to inoculate 8% Alcohol fermentation was performed. Alcohol content, sugar content and acidity were measured at three intervals. Free sugars were analyzed after the final fermentation.

도 2에서 확인할 수 있는 바와 같이, CRSY14 균주는 기존 균주인 CMY28보다 당을 분해해서 알코올 발효를 하는 속도가 훨씬 빠르다는 것을 알 수 있었다. As can be seen in FIG. 2, it was found that the CRSY14 strain had a much faster rate of alcohol fermentation than the conventional strain CMY28 by digesting sugars.

감귤주 생산시 알코올 도수를 15도 정도로 생산하는데 15도 생산 속도가 CRSY14 균주의 경우 21일, CMY28의 경우 28일이 소요되므로 일주일정도 빠르게 감귤주를 생산할 수 있어 시간과 공정상의 비용을 절감할 수 있다. The production of citrus juice is about 15 degrees, and the production rate of citrus juice is about 21 days for CRSY14 strains and 28 days for CMY28 strains. Therefore, citrus juice can be produced in about one week. have.

알코올 발효 동안 소요되는 비용을 고려할 때 생산 단가를 크게 줄여줄 수 있을 것으로 생각된다.
Considering the cost of alcohol fermentation, the production cost can be greatly reduced.

실시예Example 4.  4. 초산발효능Acetic acid efficacy 확인 Confirm

알코올 10%까지 발효 시킨 후 여과 필터하여 효모균을 제거하고 초산 발효를 위해 초산발효 배지액의 10%가 되도록 초산균을 접종하였다. 그후 3일 간격으로 산도와 당도를 측정하여 산도 5가 될때까지 발효시켰다. After fermentation to 10% of alcohol, it was filtered to remove yeast, and acetic acid bacteria were inoculated to 10% of acetic acid fermentation broth for acetic acid fermentation. Then, acidity and sugar content were measured at intervals of 3 days and fermented until the acidity reached 5.

본 발명의 신규 효모 균주가 알코올 발효에 미치는 영향뿐만 아니라, 초산발효에 미치는 영향을 확인하였다. The effect of the novel yeast strain of the present invention on the fermentation of acetic acid as well as the influence on the fermentation of alcohol was confirmed.

구체적으로, 감귤착즙액을 이용한 초산 음료 생산을 위해 기존 균주인 CMY28과 분리균주인 CRSY14 균주를 이용하여 각각을 알코올 도수 10%까지 알코올 발효 후, 초산균 KCG326를 사용하여 초산발효를 실시하였다. 도 4에서 확인할 수 있듯이, 초산 발효 시 기존 균주인 CMY28로 발효된 액상을 이용할 때보다 분리 CRSY14 균주로 알코올 발효된 배양액을 사용시 초산의 생산 속도가 현저히 빠른 것을 알 수 있었다. 일반적으로 초산 음료의 경우 산도 4-6 정도로 생산하는데, 본 발명의 신규 효모균을 이용하는 경우, 산도 5까지 발효되는 시간이 약 24일 정도 소요되었고, 기존 CMY28 균주는 40일 이상이 소요되었다. Specifically, for the production of acetic acid beverages using citrus juice, acetic acid fermentation was carried out using alcoholic fermentation using acetic acid bacteria KCG326 up to 10% alcohol concentration using CMY28 and CRSY14 isolates. As can be seen from FIG. 4, when acetic acid fermentation was performed, the production rate of acetic acid was remarkably faster when the culture fermented with alcohol was used as the isolated CRSY14 strain than when the liquid phase fermented with the CMY28 strain was used. Generally, the acetic acid beverage is produced at an acidity of about 4-6. When the novel yeast strain of the present invention is used, the fermentation time to an acidity of 5 takes about 24 days and the conventional CMY28 strain takes more than 40 days.

이러한 결과를 통해, 본 발명의 효모균주를 이용하여 알코올 발효된 배양액을 사용하는 경우, 2 배 정도 더 빠른 결과물을 얻을 수 있다는 것을 확인할 수 있었다.
From these results, it was confirmed that when using the yeast strain of the present invention, an alcohol-fermented culture broth can be used to obtain a product twice as fast.

실시예Example 5. 유리당 분석 결과 5. Free sugar analysis results

도 5에서 확인할 수 있듯이, 본 발명의 효모균주는 CMY28과 비교하여 자당의 분해 속도가 빨라 알코올 발효와 초산 발효에 영향을 미친다는 것을 확인할 수 있었다.
As can be seen from FIG. 5, it was confirmed that the yeast strain of the present invention has a higher decomposition rate of sucrose than CMY28, and thus affects alcohol fermentation and acetic acid fermentation.

실시예Example 6. 관능평가  6. Sensory Evaluation

본 발명의 효모균주를 이용하여 제조한 식초 음료 및 CMY 28 균주를 이용하여 제조한 식초 음료에 대해서 관능평가요원 25인을 대상으로 5점 척도법에 의거하여 기호도에 다한 관능평가를 5회 빈복 실시하여 그 결과를 평가하여 하기의 표 3에 나타내었다. 이때의 유의성 검정은 t-test(p<0.05)로 하였다.The vinegar beverage prepared by using the yeast strains of the present invention and the vinegar beverage prepared by using 28 strains of CMY were subjected to five sensory evaluations based on the five-point scale method, The results are shown in Table 3 below. The significance test at this time was t-test (p <0.05).

비교예 (CMY28)Comparative Example (CMY28) 실험예(CRSY14 균주)Experimental Example (CRSY14 strain) 색상color 3.03.0 4.34.3 flavor 2.52.5 4.54.5 incense 3.53.5 4.24.2 전체적인 기호도Overall likelihood 3.13.1 4.64.6

(5점 척도법: 5점. 매우좋음. 4점 좋음. 3점 보통. 2점 싫음. 1점 아주 싫음.)(5 points scale: 5 points, very good, 4 points good, 3 points average, 2 points liked, 1 point very liked.)

상기 결과에서 확인할 수 있듯이 전체적인 색상, 맛, 향 및 기호도가 비교예에 비해서 본 발명의 효모 균주가 우수한 것으로 나타났다. 특히 CRSY14 균주를 이용하는 경우, 향이 더욱 우수하고 상큼한 것으로 조사되었다.As can be seen from the above results, the yeast strains of the present invention were superior to the comparative examples in terms of overall color, taste, flavor, and taste. In particular, when the strain CRSY14 was used, the fragrance was more excellent and fresh.

이러한 결과는 기존의 CMY28 균주를 이용하는 감귤 식초 음료의 경우에는 초산 발효 시간이 상대적으로 더 오랜시간 이어져 상대적으로 맛이나 향의 변질에 영향을 미칠 수 있었기 때문일 것으로 생각이 된다. 반면에 본 발명의 효모균주를 이용한 초산 음료는 발효 시간이 상대적으로 짧아서 다른 미생물에 의한 오염으로 인한 영향이 상대적으로 적었으며, 이러한 결과로 인해 맛과 향이 우수한 음료를 얻을 수 있었다.These results suggest that the citrus vinegar beverage using the CMY28 strain may have a relatively longer duration of acetic acid fermentation, which may have affected the taste and flavor changes. On the other hand, the acetic acid beverage using the yeast strains according to the present invention had a relatively short fermentation time and thus had a relatively small influence due to contamination by other microorganisms. As a result, beverages having excellent taste and flavor were obtained.

국립농업과학원 농업유전자원센터 National Institute of Agricultural Science KACC93216PKACC93216P 2014101720141017 국립농업과학원 농업유전자원센터 National Institute of Agricultural Science KACC91555PKACC91555P 2010051120100511

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> New yeast having improved ability of sucrose resolving <130> P14-335 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fD2 <400> 1 agagtttgat catggctcag 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rP1 <400> 2 aagtcgtaac aaggtaaccg ta 22 <210> 3 <211> 960 <212> RNA <213> Saccharomyces sp. <400> 3 ttggaagtaa aagtcgtaac aaggtttccg taggtgaacc tgcggaagga tcattaaaga 60 aatttaataa ttttgaaaat ggattttttt gttttggcaa gagcatgaga gcttttactg 120 ggcaagaaga caagagatgg agagtccagc cgggcctgcg cttaagtgcg cggtcttgct 180 aggcttgtaa gtttctttct tgctattcca aacggtgaga gatttctgtg cttttgttat 240 aggacaatta aaaccgtttc aatacaacac actgtggagt tttcatatct ttgcaacttt 300 ttctttgggc attcgagcaa tcggggccca gaggtaacaa acacaaacaa ttttatctat 360 tcattaaatt tttgtcaaaa acaagaattt tcgtaactgg aaattttaaa atattaaaaa 420 ctttcaacaa cggatctctt ggttctcgca tcgatgaaga acgcagcgaa atgcgatacg 480 taatgtgaat tgcagaattc cgtgaatcat cgaatctttg aacgcacatt gcgccccttg 540 gtattccagg gggcatgcct gtttgagcgt catttccttc tcaaacattc tgtttggtag 600 tgagtgatac tctttggagt taacttgaaa ttgctggcct tttcattgga tgtttttttt 660 ccaaagagag gtttctctgc gtgcttgagg tataatgcaa gtacggtcgt tttaggtttt 720 accaactgcg gctaatcttt ttttatactg agcgtattgg aacgttatcg ataagaagag 780 agcgtctagg cgaacaatgt tcttaaagtt tgacctcaaa ccaggtagga gtacccgctg 840 aacttaagca tatcaataag cggagaaggg cgaattccag cacactggcg cgtactagtg 900 atccgagctc ggtacagctg cgtatcatgg tcatagctgt ttcctgtgtg aatgtatccg 960 960 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> New yeast having improved ability of sucrose resolving <130> P14-335 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fD2 <400> 1 agagtttgat catggctcag 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rP1 <400> 2 aagtcgtaac aaggtaaccg ta 22 <210> 3 <211> 960 <212> RNA <213> Saccharomyces sp. <400> 3 tgggaagtaa aagtcgtaac aaggtttccg taggtgaacc tgcggaagga tcattaaaga 60 aatttaataa ttttgaaaat ggattttttt gttttggcaa gagcatgaga gcttttactg 120 ggcaagaaga caagagatgg agagtccagc cgggcctgcg cttaagtgcg cggtcttgct 180 aggcttgtaa gtttctttct tgctattcca aacggtgaga gatttctgtg cttttgttat 240 aggacaatta aaaccgtttc aatacaacac actgtggagt tttcatatct ttgcaacttt 300 ttctttgggc attcgagcaa tcggggccca gaggtaacaa acacaaacaa ttttatctat 360 tcattaaatt tttgtcaaaa acaagaattt tcgtaactgg aaattttaaa atattaaaaa 420 ctttcaacaa cggatctctt ggttctcgca tcgatgaaga acgcagcgaa atgcgatacg 480 taatgtgaat tgcagaattc cgtgaatcat cgaatctttg aacgcacatt gcgccccttg 540 gtattccagg gggcatgcct gtttgagcgt catttccttc tcaaacattc tgtttggtag 600 tgagtgatac tctttggagt taacttgaaa ttgctggcct tttcattgga tgtttttttt 660 ccaaagagag gtttctctgc gtgcttgagg tataatgcaa gtacggtcgt tttaggtttt 720 accaactgcg gctaatcttt ttttatactg agcgtattgg aacgttatcg ataagaagag 780 agcgtctagg cgaacaatgt tcttaaagtt tgacctcaaa ccaggtagga gtacccgctg 840 aacttaagca tatcaataag cggagaaggg cgaattccag cacactggcg cgtactagtg 900 atccgagctc ggtacagctg cgtatcatgg tcatagctgt ttcctgtgtg aatgtatccg 960                                                                          960

Claims (6)

삭제delete 삭제delete 삭제delete 선별된 감귤을 세척하여 과피를 제거하는 단계;
과피가 제거된 감귤을 착즙하여 감귤 착즙액을 얻는 단계;
상기 감귤 착즙액 및 자당을 물과 희석하여 22 내지 27 브릭스(Brix°의 자당 함유 기질을 제조하는 단계;
상기 자당 함유 기질에 기탁번호 KACC93216P의 사카로마이시스 속 균주로 접종하는 단계;
상기 기탁번호 KACC93216P의 사카로마이시스 속 균주가 접종된 자당 함유 기질을 10-25 ℃에서 10 내지 25일간 발효 후 알코올 농도가 8 내지 12%로 알코올 발효하는 단계; 및
상기 알코올 발효된 자당 함유 기질에 초산균을 접종하여 20 내지 27일간 10-25 ℃에서 발효시켜 초산발효액을 제조하는 단계를 포함하며,
상기 초산균은 기탁번호 KACC91555P의 KCG326 균주인 것을 특징으로 하는 감귤 식초의 제조방법.
Washing the selected citrus fruits to remove pericarp;
Extracting the citrus juice from which the peel is removed to obtain a citrus juice;
Diluting the citrus juice and sucrose with water to produce a substrate containing 22 to 27 Brrix of sucrose;
Inoculating the sucrose-containing substrate with a Saccharomyces cerevisiae strain of Accession No. KACC93216P;
Fermenting the sucrose-containing substrate inoculated with the Saccharomyces cerevisiae strain of KACC93216P with 10 to 25 days of fermentation at 10 to 25 DEG C and alcohol concentration of 8 to 12%; And
Fermenting the fermented acetic acid to the alcohol-fermented sucrose-containing substrate and fermenting the fermented broth at 10 to 25 ° C for 20 to 27 days,
Wherein the acetic acid is KCG326 strain of Accession No. KACC91555P.
삭제delete 제4항에 있어서, 상기 알코올 발효 단계의 알코올 농도는 10 중량%인 것을 특징으로 하는 감귤 식초의 제조 방법.5. The method according to claim 4, wherein the alcohol concentration in the alcohol fermentation step is 10 wt%.
KR1020140158572A 2014-11-14 2014-11-14 New yeast having improved ability of sucrose resolving KR101780942B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140158572A KR101780942B1 (en) 2014-11-14 2014-11-14 New yeast having improved ability of sucrose resolving

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140158572A KR101780942B1 (en) 2014-11-14 2014-11-14 New yeast having improved ability of sucrose resolving

Publications (2)

Publication Number Publication Date
KR20160057677A KR20160057677A (en) 2016-05-24
KR101780942B1 true KR101780942B1 (en) 2017-09-25

Family

ID=56113816

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140158572A KR101780942B1 (en) 2014-11-14 2014-11-14 New yeast having improved ability of sucrose resolving

Country Status (1)

Country Link
KR (1) KR101780942B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102419123B1 (en) * 2021-11-29 2022-07-07 임채홍 Method of manufacturing natural fermented vinegar using fruits and the natural fermented vinegar thereby

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101098765B1 (en) * 2011-02-08 2011-12-26 주식회사 건강을 지키는 사람들 Saccharomyces cerevisiae m(s)-2-71 for preparing fermented product of plant and its use

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101098765B1 (en) * 2011-02-08 2011-12-26 주식회사 건강을 지키는 사람들 Saccharomyces cerevisiae m(s)-2-71 for preparing fermented product of plant and its use

Also Published As

Publication number Publication date
KR20160057677A (en) 2016-05-24

Similar Documents

Publication Publication Date Title
CN101346458B (en) Microbiologically stabilized beer
CN111004752B (en) Ethanol-resistant lactobacillus plantarum and application thereof in fermented food
JP6669708B2 (en) Beverage flavor improver
KR20130050554A (en) Manufacture of fermented schizandrae extract having gaba
KR20140062907A (en) Novel microorganism with high productivity of acetic acid and method for producing organic acid using the same
KR101137833B1 (en) High Quality Vineager and method of preparing thereof using the fine apple juses
KR101703249B1 (en) Novel Saccharomyces cerevisiae Y28 yeast strain and preparation method of mixed wine of kiwi and permission fruits using the strain
KR101480308B1 (en) Brewing yeast saccharomyces cerevisiae 192-4 and brewed alcohol made therewith
KR101451706B1 (en) Novel Acetobacter sp. SEA623-2, Citrus Mandarin vinegar and preparation method thereof
KR101330274B1 (en) Carbonated fermentate beverage and method of production there for using natural materials
KR101780942B1 (en) New yeast having improved ability of sucrose resolving
KR101199545B1 (en) Brewing yeast Saccharomyces cerevisiae 90-1 and brewed alcohol made therewith
KR101743526B1 (en) Osmotolerant Saccharomyces cerevisiae strain isolated from Korean Grapes
KR101671584B1 (en) Flavour-enhancing yeast Saccharomyces cerevisiae and brewed alcohol made therewith
KR101199544B1 (en) Brewing yeast Saccharomyces cerevisiae 89-5-3 and brewed alcohol made there with
KR101510418B1 (en) Freezed fermentation agent containing aromatic yeast and the preparation thereof
KR101815389B1 (en) Novel acetobacter pasterianus and producing method of persimmon vinegar using the same strain
KR20110098570A (en) A method of preparing for onion fermented-beverage
KR101486222B1 (en) Pichia guilliermondii SY46 strain and preparation of Kiwi wine by using the strain
KR20160060616A (en) Flavour-enhancing yeast Saccharomyces cerevisiae and brewed alcohol made therewith
Ngwang The usage of banana (Musa Acuminata) for Novel beverage production
KR20160031623A (en) Method of onion-vinegar using onion low-temperature extracts
KR20160137719A (en) Brewing yeast saccharomyces cerevisiae n4 and a distillated liquor made there with and method for producing the distillated liquor
KR20160116664A (en) The manufacturing method of fermentation vinegar using sevenberry concentration solution and beverage base composition containing sevenberry fermentation vinegar
KR20210076295A (en) Preparing method for wine containing high polyphenol

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant