KR101743442B1

KR101743442B1 - Vaccine composition for preventing or treating porcine edema disease comprising ghost Salmonella mutant expressing Enterotoxigenic Escherichia coli antigen as effective component

Info

Publication number: KR101743442B1
Application number: KR1020160000234A
Authority: KR
Inventors: 이존화; 원가연
Original assignee: 전북대학교산학협력단
Priority date: 2016-01-04
Filing date: 2016-01-04
Publication date: 2017-06-05

Abstract

본 발명은 장독소성 대장균(Enterotoxigenic Escherichia coli) 유래 주요 병인성 인자 Stx2eB, FedA 및 FedF 항원을 각각 발현하는 고스트 살모넬라 변이주의 혼합물, 돼지 부종병의 예방 또는 치료용 고스트 살모넬라균 변이주의 혼합물 제조방법, 상기 방법에 의해 제조된 돼지의 부종병 예방 또는 치료용 고스트 살모넬라 변이주의 혼합물, 상기 고스트 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 돼지 부종병의 예방 또는 치료용 백신 조성물 및 상기 고스트 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 돼지 부종병의 예방 또는 개선용 사료 첨가제에 관한 것으로, 본 발명의 고스트 살모넬라 변이주의 혼합물은 돼지 부종병의 예방 및 치료에 유용하게 사용될 것으로 기대된다.The present invention relates to a method for preparing a mixture of ghost salmonella mutants expressing respectively the major pathogenic factors Stx2eB, FedA and FedF antigens derived from enterotoxigenic Escherichia coli , a mixture of ghost salmonella mutants for the prevention or treatment of swine swine disease, A vaccine composition for preventing or treating swine swine disease comprising a mixture of the ghost salmonella mutant strains for preventing or treating swine swine disease produced by the method, a mixture of the ghost salmonella mutant strains as an active ingredient, and a mixture of the ghost salmonella mutant strain The present invention relates to a feed additive for preventing or ameliorating swine vaginosis diseases, and the mixture of the ghost salmonella mutant strains of the present invention is expected to be useful for prevention and treatment of swine swine disease.

Description

[0001] The present invention relates to a vaccine composition for preventing or treating a porcine edema disease, which comprises as an active ingredient a ghost salmonella mutant expressing a fungus Escherichia coli antigen. [0002] The present invention relates to a vaccine composition for preventing or treating porcine edema disease,

본 발명은 장독소성 대장균 항원을 발현하는 고스트 살모넬라 변이주를 유효성분으로 포함하는 돼지 부종병 예방 또는 치료용 백신 조성물에 관한 것이다.The present invention relates to a vaccine composition for the prevention or treatment of swine edema disease comprising as an active ingredient a ghost salmonella mutant expressing a virulent fungal Escherichia coli antigen.

돼지 부종병 (porcine edema disease, ED)은 1938년 아일랜드에서 처음 그 존재가 확인된 질병으로, 장독소성 대장균 (Enterotoxigenic E. coli, ETEC 또는 Shiga toxin-producing E. coli, STEC)에 의해 이유 후 7-10일 내의 자돈(8-16 주령)에서 주로 발병하는 것으로 알려져있으나 연령대에 상관없이 국내 뿐만 아니라 전 세계적으로 산발적인 발병이 보고되고 있다. 감염돈 군에서는 15-30%의 발병율을 보이며 90%가 넘는 사망률로 양돈 산업에 심각한 경제적 손실을 야기하고 있다. 100두 규모의 농장에서 부종병 발생시 대략 30%의 폐사율을 적용하면 연간 2억원 정도의 피해가 발생된다고 추정되며, 이와 함께 폐사돈 처리 비용을 감안하면 피해는 더욱더 커질 것이라 예상된다.Porcine edema disease (ED) was first identified in Ireland in 1938 by Enterotoxigenic E. coli (ETEC or Shiga toxin-producing E. coli , STEC) It is known to occur mainly in piglets (8-16 weeks of age) within 10 days, but sporadic outbreaks have been reported worldwide as well as at home, regardless of age. Infected pigs have an incidence of 15-30%, and mortality rates above 90% are causing serious economic losses to the pig farming industry. 100 It is estimated that about 30% of the cases of edema disease occur on two scale farms, causing about 200 million won damage every year. In addition, considering the cost of disposing of our money, the damage is expected to increase even more.

돼지 부종병은 건강상태가 좋고 충분한 사료섭취를 하고 있는 돼지에서 갑작스러운 발생으로 이유 후 1-2주 후에 자돈이 갑자기 폐사하거나 눈주위와 안면의 부종 근육의 진전 및 간헐적 경련 등의 신경증상을 보이며 신속히 폐사하는 것이 특징으로, 이 질병은 감별하기 쉬운 임상증상이 나타나지 않고 폐사된 후에 발견되는 경우가 대부분이다. 일반적으로 부종병 발생 농장은 임상증상이 나타나기 전부터 관련 장독소성 대장균의 배출이 폭발적으로 증가하는 경향을 보이며 동반되는 항생제 처치로 인해 실제로 감염 자돈에서는 그 병원성 대장균의 분리는 낮지만 동거축들은 꾸준히 분변으로 장독소성 대장균을 배출하기 때문에 항생제 처치만으로는 치료효과를 기대하기 어렵다.Swine edema disease is a sudden onset of swine in a well-fed, well-fed pig. After 1-2 weeks, the piglet suddenly suffers from a sudden death, swelling of the eyes around the eyes and facial muscles, and occasional convulsions It is characterized by the rapid death of the disease. Most of the disease is found after death without clinical symptoms that are easy to distinguish. In general, the edema-causing farms show a tendency to increase explosively in the presence of the associated enteric-coated coliform before the clinical symptoms appear. In the case of the infected piglets, the isolation of the pathogenic Escherichia coli is low due to the accompanying antibiotic treatment, It is difficult to anticipate the effect of treatment with antibiotics only because it releases Escherichia coli.

이에 본 질병에 대한 예방 대책이 시급한 실정이지만, 국내에서 시판되고 있는 돼지 자가 대장균증 백신은 대장균으로 인한 설사증을 예방하기 위하여 수동 면역 유도(passive immune response)를 목적으로 모돈을 대상으로 하고 있으며 현재 돼지 부종병을 예방하기 위한 상용화된 백신은 없는 상황이다. 또한 최근 돼지 설사의 주 원인인 돼지 유행성 설사 (porcine epidemic diarrhea, PED)의 백신효율의 저하로 인한 상재화(연중발생)와 사료내 항생제 금지 조치는 자돈과 모돈의 면역력을 낮추고 있어 기존에 억제되어 왔던 세균성 질병에 의한 피해 우려가 높아지고 있는 실정이다.In order to prevent diarrhea caused by Escherichia coli, the pig self-colony vaccine, which is commercially available in Korea, is targeted for sows for the purpose of passive immune response. There is no commercially available vaccine to prevent disease. In addition, topical (annual) and antibiotic bans in feeds due to decreased vaccine efficiency of porcine epidemic diarrhea (PED), the main cause of recent diarrhea in pigs, have lowered the immunity of piglets and sows, There is a growing concern about the damage caused by the bacterial diseases that have come.

돼지 부종병의 원인균인 돼지 장독소성 대장균 (porcine Enterotoxigenic E. coli, ETEC)은 주요 발현 섬모군(fimbriae)에 따라 다섯가지 종류로 분류된다. 돼지에서 지금까지 알려진 ETEC의 주요 섬모군에는 K88(F4), K99(F5), 987P(F6), F41(F7), F18 등이 있으며, 이들 섬모군 중 돼지 부종병을 일으키는 주요 섬모군은 F18로 알려져 있다. F18 섬모군은 F18 수용체의 여분의 프롤린(extra proline) 아미노산 유무로 인해 항원성의 차이가 결정되는 FedA 이형체(variants)에 따라 부종병을 일으키는 f18ab 섬모군과 이유 후 설사와 관련이 있는 f18ac 섬모군으로 나누어진다.Porcine Enterotoxigenic E. coli (ETEC), a causative organism of swine edema disease, is divided into five types according to the major expression fimbriae. The most common islets of ETEC are F88 (F4), K99 (F5), 987P (F6), F41 (F7) and F18 . The F18 islet group is composed of f18ab and f18ac, which cause edema due to the FedA variants in which the difference in antigenicity is determined by the presence of extra proline amino acids in the F18 receptor .

돼지 장독소성 대장균의 주요 병인성 인자는 부착인자(adhesin)으로 작용하는 섬모군(F18ab)과 신경 증상과 부종 증상을 일으키는 Shiga toxin 2e(stx2e) 독소이다. 체내에 들어온 대장균은 돼지 소장 상피세포 솔가장자리(brush border)에 있는 F18 수용체와 결합 및 부착하여 집락화(colonization)를 시작하고, stx2e 유전자의 발현으로 인한 shiga 독소가 장 상피세포에서 rRNA의 작용을 저해함으로써 단백질 합성을 방해한다. 이는 혈액의 액상 성분이 조직으로 빠져나오게 만들어 부종을 일으키며, 또한 뇌압의 증가로 인한 신경 증상의 발현을 초래한다.The major pathogenic factor of porcine coliform E. coli is Shiga toxin 2e (stx2e) toxin, which causes adenomatous (F18ab) and neurological and edema symptoms. Escherichia coli entering the body binds and adheres to the F18 receptor on the brush border of the small intestinal epithelium of pigs to initiate colonization and the shiga toxin caused by the expression of the stx2e gene inhibits the action of rRNA in the epithelial cells Thereby inhibiting protein synthesis. This causes the liquid component of the blood to escape into the tissue, causing edema, and also causing the expression of nerve symptoms due to an increase in the intracranial pressure.

섬모군을 부착인자로 사용하여 점막에 부착하여 독소를 분비함으로써 질병 유발이 시작되기 때문에 돼지 부종명의 면역을 위해서는 병원성 세균의 섬모와 독소를 중화시킬 수 있는 유도 항체의 형성이 무엇보다도 중요하다. 독소의 중화에 작용하고 운동성 박테리아의 섬모와 편모에 특이적인 항체의 작용으로 미생물의 운동이 정지되어 조직표면에의 집락화를 막는 면역글로불린 G(immunoglobulin G, IgG)의 역할이 돼지 부종병의 예방을 위한 면역반응에 필수적으로, 백신에 의해 체액성 면역반응을 증진시키는 Th2 기전의 유도가 무엇보다 중요하다.Since the disease induction begins by secretion of toxin by adhering to the mucous membrane by using the islet parent group as an adhesion factor, formation of an inducing antibody which can neutralize the ciliates and toxins of the pathogenic bacteria is most important for immunization of swine swine. The role of immunoglobulin G (IgG), which acts on neutralization of toxins and stops the movement of microorganisms by the action of antibody specific to the ciliates and flagella of motility bacteria and prevents the colonization on the tissue surface, The induction of the Th2 mechanism that promotes the humoral immune response by the vaccine is of primary importance for the immune response.

돼지 부종병을 예방하기 위한 상용화된 백신이 없는 현 상태에서 주로 DNA 재조합 백신의 형태나 정제된 단백질을 화학적 면역증강제와 함께 직접 접종하는 방식의 백신 개발이 이루어져 왔지만, 본 발명의 백신은 약독화 살모넬라 균주를 운반체 균주로 이용하여 그 자체만으로도 살모넬라에 의한 돼지 설사증을 예방하는데 탁월한 효과가 있도록 구성하였고, 3개의 F18+ 대장균의 주요 항원을 선정하여 항원을 효과적으로 발현시킬 수 있는 고스트 백신 시스템을 이용하여 살모넬라성 돼지 설사병과 돼지 부종병을 동시에 예방할 수 있는 다가 백신을 개발하였다. 용해(lysis) 유전자에 의해 유도되는 세포막의 구멍 발생에 의해 세포의 빈껍질만 남는 상태인 고스트화된 살모넬라 균주는 용해과정 동안 실활되지 않기 때문에 주요 면역 자극 요소가 그대로 보존되며 이는 병원체 관련 분자 패턴(pathogen-associated molecular patterns, PAMPs)으로 작용하여 특이적으로 체액성 및 세포매개성 면역을 유도하기 때문에 고스트 살모넬라 균주 자체가 돼지 살모넬라증 예방 뿐만 아니라 돼지 부종병 예방을 위한 면역반응을 증강시킬수 있도록 본 발명의 백신을 구성하였다. 또한 F18+ ETEC의 편모 단백질(flagellin)을 발현하는 FliC 유전자를 애주번트(adjuvant)로 선정하였다.Although the vaccine has been developed in the form of a DNA recombinant vaccine or a method of directly inoculating the purified protein together with a chemical immunity enhancer in a state where there is no commercially available vaccine to prevent swine edema disease, Using a ghost vaccine system that can effectively express antigens by selecting three major F18 + Escherichia coli strains, Salmonella typhimurium can be used as a carrier strain for the prevention of swine diarrhea caused by Salmonella by itself. We developed a multivalent vaccine that can prevent pig diarrhea and swine edema at the same time. Ghosted Salmonella strains, which are left in the cell's free skin only by the formation of pores in the cell membrane induced by the lysis gene, are not inactivated during the dissolution process, so that the major immunostimulatory elements are preserved, pathogen-associated molecular patterns (PAMPs), thereby specifically inducing humoral and cell-mediated immunity. Therefore, in order to enhance the immune response not only to prevent swine salmonellosis but also to prevent swine edema disease, The vaccine was constructed. In addition, the FliC gene expressing flagellin of F18 + ETEC was selected as an adjuvant.

본 발명자들은 백신으로 인한 면역 반응의 증강과 돼지 부종병을 예방하기 위하여 F18+ 대장균의 주요 병인성 인자 유전자를 선정하여 ompA 신호 서열 기반의 주변세포질 분비(ompA signal sequence-based periplasmic secretion) 시스템을 지닌 고스트 발현 플라스미드(pMMP184; Asd+vector, pBR ori, Lysis E gene, 6xHis, 한국특허공개 제2014-0091083호)에 조합한 후, 운반체로 이용되어질 약독화 살모넬라 균주에 형질 전환하여 고스트 백신 균주를 완성하였다.The present inventors selected a major pathogenicity factor gene of F18 + Escherichia coli as a vaccine to enhance the immune response due to the vaccine and to prevent swine edema disease. The present inventors selected a ghost factor gene having an ompA signal sequence-based periplasmic secretion system (PMMP184; Asd + vector, pBR ori, Lysis E gene, 6xHis, Korean Patent Laid-Open Publication No. 2014-0091083) and transformed into attenuated salmonella strain to be used as a carrier to complete a ghost vaccine strain .

한편, 한국등록특허 제1178415호에는 '돼지의 병원성 대장균의 부착인자가 형질전환된 약독화 살모넬라균 변이주 및 이를 포함하는 돼지의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물'이 개시되어 있고, 한국등록특허 제1456160호에는 '고스트 살모넬라 및 이를 함유하는 세균성 소화기 질환 예방용 백신'이 개시되어 있으나, 본 발명의 장독소성 대장균 항원을 발현하는 고스트 살모넬라 변이주를 유효성분으로 포함하는 돼지 부종병의 예방 또는 치료용 백신 조성물에 대해서는 기재된 바가 없다.Korean Patent No. 1178415 discloses a vaccine composition for the prevention and treatment of pathogenic Escherichia coli and Salmonella spp. Of a porcine comprising an attenuated Salmonella mutant strain transformed with an adherence factor of a pathogenic Escherichia coli of a pig, Korean Patent No. 1456160 discloses 'ghost salmonella and a vaccine for preventing bacterial digestive diseases containing the same', but it is also possible to prevent the swine edema disease that contains the ghost salmonella mutant expressing the enteric fungal microbial antigen of the present invention as an active ingredient Or a therapeutic vaccine composition has not been described.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자는 장독소성 대장균의 주요 병인성 인자로 Stx2eB, FedA 및 FedB, 그리고 면역증강용 인자로 FliC를 선정하여 상기 단백질들을 발현하는 고스트 살모넬라 변이주를 제작하였다. 상기 제작된 고스트 살모넬라 변이주를 혼합한 후 실험동물에 처리하여 실험동물의 체액성 및 세포매개성 면역 반응의 유도를 확인하였고, 상기 고스트 살모넬라 변이주 혼합물을 실험동물에 접종한 후 도전 감염시킨 결과, 무접종 대조구 실험동물들에 비해 상기 고스트 살모넬라 변이주 혼합물을 접종한 실험동물군에서 40% 이상의 높은 생존율을 확인함으로써, 본 발명을 완성하였다.The present invention has been made in view of the above-mentioned needs. The present inventors have found that Stx2eB, FedA and FedB as major pathogenic factors of enterotoxin-producing E. coli, and FliC as an immune enhancing factor are selected as Ghost Salmonella mutants expressing the above proteins Respectively. The prepared ghost salmonella mutant was mixed and then treated in an experimental animal to confirm the induction of humoral and cell mediated immune response in the experimental animal. The ghost salmonella mutant mixture was inoculated into experimental animals, The survival rate was confirmed to be higher than 40% in the experimental animal group inoculated with the ghost salmonella mutant mixture as compared with the inoculated control experimental animals, thereby completing the present invention.

상기 과제를 해결하기 위해, 본 발명은 장독소성 대장균(Enterotoxigenic Escherichia coli) 유래 주요 병인성 인자 Stx2eB, FedA 및 FedF 항원을 발현하는 고스트 살모넬라 변이주의 혼합물을 제공한다.In order to solve the above problems, the present invention provides a mixture of Ghost Salmonella mutants expressing the major pathogenic factors Stx2eB, FedA and FedF antigen from Enterotoxigenic Escherichia coli .

또한, 본 발명은 돼지의 부종병 예방 또는 치료용 고스트 살모넬라균 변이주의 혼합물을 제조하는 방법을 제공한다.The present invention also provides a method for preparing a mixture of ghost salmonella mutant strains for the prevention or treatment of edema of swine.

또한, 본 발명은 상기 방법에 의해 제조된 돼지의 부종병 예방 또는 치료용 고스트 살모넬라 변이주의 혼합물을 제공한다.The present invention also provides a mixture of ghost salmonella mutants for the prevention or treatment of edema of swine produced by the method.

또한, 본 발명은 상기 고스트 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 돼지의 부종병 예방 또는 치료용 백신 조성물을 제공한다.In addition, the present invention provides a vaccine composition for preventing or treating a swine disease of swine comprising the mixture of the ghost salmonella mutant as an active ingredient.

또한, 본 발명은 상기 고스트 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 돼지의 부종병 예방 또는 개선용 사료 첨가제를 제공한다.The present invention also provides a feed additive for preventing or ameliorating a swine disease of swine comprising the mixture of the ghost salmonella mutant as an active ingredient.

본 발명의 고스트 살모넬라 변이주의 혼합물은 사균 백신으로, 약독화 생균 백신과 유사한 방어 효과를 나타내면서 동시에 약독화 생균 백신에서 나타나는 병원성 복귀로 인한 독성 위험 및 생태계 오염의 우려가 전혀 없는, 안전하고 경제적이며 간편하게 접종할 수 있는 백신으로 돼지 부종병의 예방 및 치료에 유용하게 사용될 것으로 기대된다.The mixture of the ghost salmonella mutant of the present invention is a deadly vaccine. It is a safe, economical and easy-to-use vaccine which has a similar protective effect to an attenuated live vaccine vaccine and at the same time has no toxicity risk and ecosystem contamination- This vaccine is expected to be useful for the prevention and treatment of swine swine disease.

도 1은 후보 항원 단백질의 고스트 살모넬라 변이주에서의 발현 여부를 확인한 결과이다.
도 2는 개별 백신(각 항원 단백질을 발현하는 고스트 살모넬라 변이주) 투여 후, 실험동물의 IgG 및 sIgA의 수준을 측정한 결과이다.
도 3은 개별 백신 투여 후, 실험동물의 IgG1 및 IgG2a의 수준을 측정한 결과이다.
도 4는 혼합 백신(각 항원 단백질을 발현하는 고스트 살모넬라 변이주의 혼합물) 투여 후, 실험동물의 IgG 및 sIgA의 수준을 측정한 결과이다.
도 5는 개별 또는 혼합 백신 투여 후 실험동물의 지라세포를 분리하고, 개별 항원으로 자극시킨 후 면역 사이토카인 수준을 측정한 결과이다.
도 6은 개별 또는 혼합 백신 투여 후 실험동물의 지라세포를 분리하여 T 세포의 분화 정도를 분석한 결과이다.
도 7은 개별 또는 혼합 백신 투여 후 실험동물의 지라세포를 분리하고, 개별 항원으로 자극시킨 후 MTT 분석을 통해 세포의 증식을 확인한 결과이다.
도 8은 준치사량(sublethal dose)으로 도전 감염 후 실험동물의 체중 변화를 관찰한 결과이다.
도 9는 반수치사량(lethal dose 50)으로 도전 감염 후 실험동물의 생존율을 확인한 결과이다.
도 10은 반수치사량으로 도전 감염 4주후 생존한 실험동물의 소장 시료로부터 도전 감염 균주의 회복을 확인한 결과이다.FIG. 1 shows the results of confirming the expression of the candidate antigen protein in the Ghost Salmonella mutant.
FIG. 2 shows the results of measuring levels of IgG and sIgA in experimental animals after administration of individual vaccines (Ghost Salmonella mutant expressing each antigen protein).
Figure 3 shows the results of measuring levels of IgG1 and IgG2a in experimental animals after administration of individual vaccines.
FIG. 4 shows the results of measuring levels of IgG and sIgA in experimental animals after administration of a mixed vaccine (a mixture of Ghost Salmonella mutants expressing each antigen protein).
FIG. 5 shows the result of measuring immunocytochemical levels after separating splenocytes from experimental animals after individual or mixed vaccine administration and stimulating them with individual antigens.
FIG. 6 is a result of analysis of the degree of differentiation of T cells by separating splenocytes from experimental animals after administration of individual or mixed vaccine.
FIG. 7 shows the result of confirming cell proliferation through MTT assay after separating splenocytes from experimental animals after individual or mixed vaccination and stimulating with individual antigen.
FIG. 8 shows the result of observing weight change of experimental animals after challenge infection with sublethal dose.
FIG. 9 shows the survival rate of the experimental animals after the challenge with 50% lethal dose.
FIG. 10 shows the results of confirming the recovery of the challenged strain from the small intestine of an experimental animal surviving 4 weeks after the challenge with half the lethal dose.

본 발명의 목적을 달성하기 위하여, 본 발명은 장독소성 대장균(Enterotoxigenic Escherichia coli) 유래 주요 병인성 인자 Stx2eB, FedA 및 FedF 항원을 각각 발현하는 고스트 살모넬라 변이주의 혼합물을 제공한다.In order to achieve the object of the present invention, the present invention relates to a method for producing enterotoxigenic Escherichia coli) provides a mixture of the ghost Salmonella mutants that each express a derived key pathogenic factor Stx2eB, and FedA FedF antigen.

상기 장독소성 대장균(Enterotoxigenic E. coli, ETEC 또는 Shiga toxin-producing E. coli, STEC)은 돼지 부종병의 원인균으로 알려져 있다.Enterotoxigenic E. coli (ETEC or Shiga toxin-producing E. coli , STEC) is known to be a causative organism of swine edema.

본 발명의 상기 Stx2eB 항원은 장독소성 대장균의 독소 단백질로, Stx2e는 한 개의 A 서브유닛(Stx2eA)과 다섯 개의 B 서브유닛(Stx2eB)으로 구성되어 있는데, 본 발명에서는 Stx2eB 독소 단백질을 생산하는 Stx2eb 유전자를 돼지 부종병을 예방하기 위한 본 백신의 첫번째 항원으로 선정하였다. 호모펜타머(homopentamer) Stx2eB 부분은 소장 상피세포 표면의 Gb4(globoriaosylceramide) 수용체와 결합하여, 세포독성을 야기하는 Stx2eA의 발현을 도와주는 역할을 한다. 여러개의 단백질이 결합하여 독소를 발현하는 완전독소(holotoxin)인 A 부분의 특성상 백신으로 사용하기 위해 점 돌연변이(point mutation)로 몇 개의 치명적 독소 유전자를 제거하더라도 언제든 원독소(native toxin)로 돌아갈수 있는 여지가 남아 있어 B 부분을 선정하였다. 또한 Stx2eB의 중화항체 형성시 Gb4 수용체와의 결합을 저해하여 A부분의 독소 발현을 근원적으로 차단함으로 본 백신의 효율을 더욱 높힐 수 있을 것이다.The Stx2eB antigen of the present invention is a toxin protein of Escherichia coli, Stx2e is composed of one A subunit (Stx2eA) and five B subunits (Stx2eB). In the present invention, Stx2eb gene producing Stx2eB toxin protein Were selected as the first antigens of this vaccine to prevent swine edema. Homopentamer The Stx2eB moiety binds to Gb4 (glob- larosylceramide) receptors on the surface of small epithelial cells and helps to express Stx2eA, which causes cytotoxicity. Because of the nature of part A, which is a holotoxin that combines several proteins and expresses the toxin, it is possible to return to native toxin any time, even if several fatal toxin genes are removed by point mutation for use as a vaccine Part B was selected because there was room left. In addition, when Stx2eB neutralizing antibody is formed, it is possible to further enhance the efficiency of the vaccine by inhibiting the binding with the Gb4 receptor and thus blocking the expression of the toxin in the A region.

F18 대장균은 주요 섬모군이 부착에 관여하는 다른 돼지 장독소성 대장균(F4)과는 다르게 아 섬모군이 부착에 주요하게 영향을 미친다. F18 부착인자를 구성하는 주요 섬모군(major subunit, FedA)과 아 섬모군(minor subunit, FedF)은 병인체가 체내에 들어와 소장 세포(small intestinal enterocytes)에 부착하는 것과 병인체의 집락화를 주도한다. 본 발명에서는 F18ab+ 대장균의 주요 섬모군인 FedA 단백질과 섬모부착인자로 알려진 아 섬모군 FedF 단백질을 주요 항원으로 선정하였다.F18 E. coli differs from other porcine follicular coliforms (F4) which are involved in attachment of major stem cells, and mainly affects adhesion of the embryo arm. The major subunit (FedA) and the minor subunit (FedF) that constitute the F18 adherence factor lead to the adherence of the human body to the small intestinal enterocytes and the colonization of the diseased human body . In the present invention, FedA protein, which is the major ciliary body of F18ab + Escherichia coli, and the familial FedF protein, which is known as the ciliate attachment factor, were selected as major antigens.

본 발명에 따른 상기 Stx2eB 항원의 범위는 서열번호 1로 표시되는 아미노산 서열을 갖는 단백질 및 이의 기능성 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 1로 표시되는 아미노산 서열과 적어도 60% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 1로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 돼지 부종병 백신 활성을 의미한다. 본 발명은 또한 Stx2eB 항원의 단편, 유도체 및 유사체(analogues)를 포함한다.The range of the Stx2eB antigen according to the present invention includes a protein having the amino acid sequence represented by SEQ ID NO: 1 and functional equivalents thereof. Is at least 60% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, more preferably 90% or more, Refers to a protein having a homology of at least 95% and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 1. "Substantially homogenous physiological activity" means vaccine swine vaccine activity. The invention also encompasses fragments, derivatives and analogues of Stx2eB antigens.

본 발명에 따른 FedA 및 FedF 항원의 범위는 각각 서열번호 2 및 서열번호 3으로 표시되는 아미노산 서열을 갖는 단백질 및 이의 기능성 동등물을 포함한다. 단백질의 기능적 동등물의 구체적인 내용은 전술한 바와 같다. 본 발명은 또한 FedA 및 FedF 항원의 단편, 유도체 및 유사체를 포함한다.The ranges of the FedA and FedF antigens according to the present invention include proteins having the amino acid sequence shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively, and functional equivalents thereof. The specific contents of the functional equivalents of the proteins are as described above. The present invention also includes fragments, derivatives and analogs of FedA and FedF antigens.

본 발명의 고스트 살모넬라 변이주는 asd 유전자가 결실된 것일 수 있다. 바람직하게는 lon, cpxR 및 asd 유전자가 결실된 살모넬라 변이주일 수 있으나, 이에 제한되지 않는다.The ghost salmonella mutant of the present invention may be one in which the asd gene has been deleted. Preferably, the Salmonella mutant strain in which the lon, cpxR and asd genes are deleted is not limited thereto.

본 발명의 일 구현 예에 따른 살모넬라 변이주에 있어서, lon, cpxR 및 asd 유전자가 결실된 살모넬라 변이주(Δlon ΔcpxR Δasd Salmonella Typhimurium, JOL912)는 asd 유전자가 결실된 DAP(diaminopimellic acid) 요구주로서 항생제없이 항원 재조합 균주를 선택할 수 있도록 제작되었을 뿐만 아니라, cpxR을 결실시킴으로써 림프조직 침투력이 증가되어 면역원성을 높이고, lon 유전자를 결실하여 병원성이 약독화될 수 있다. 상기 균주는 항원으로 작용할 수 있는 세포외 다당류(extracellular polysaccharide)의 생산에는 아무 영향을 주지 않아 그 자체로 항원의 역할을 하여 안정성을 지니면서 충분한 체액성 점막성 세포성 면역 반응을 일으킨다고 알려져 있다.In Salmonella mutant strains in accordance with one embodiment of the invention, lon, cpxR and asd gene is a Salmonella mutant deleted (Δlon ΔcpxR Δasd Salmonella Typhimurium, JOL912 ) are antigen without antibiotics as DAP (diaminopimellic acid) which the asd gene deletion request weeks Not only is it made to select recombinant strains, it can increase lymphocyte infiltration ability by deletion of cpxR , increase immunogenicity, lose lon gene and attenuate pathogenicity. It is known that the strain has no effect on the production of extracellular polysaccharide which can act as an antigen, and thus acts as an antigen itself, resulting in sufficient humoral mucosal cellular immune response with stability.

또한, 본 발명의 살모넬라 변이주에 있어서, 상기 살모넬라균은 살모넬라 티피무리움(Salmonella typhimurium), 살모넬라 타이피(Salmonella typi), 살모넬라 파라타이피(Salmonella paratyphi), 살모넬라 센다이(Salmonella sendai), 살모넬라 갈리나리움(Salmonella gallinarium) 또는 살모넬라 엔테리티디스(Salmonella enteritidis) 등일 수 있고, 바람직하게는 살모넬라 티피무리움일 수 있으나, 이에 제한되지 않는다.Further, in the Salmonella mutants of the present invention, wherein the Salmonella is Salmonella typhimurium (Salmonella typhimurium), Salmonella tie blood (Salmonella typi), Salmonella para tie blood (Salmonella paratyphi), Salmonella Sendai (Salmonella sendai), Salmonella Galina Solarium Salmonella gallinarium or Salmonella enteritidis , and the like, preferably Salmonella typhimurium, but is not limited thereto.

본 발명은 또한, 돼지의 부종병 예방 또는 치료용 고스트 살모넬라균 변이주의 혼합물을 제조하는 방법을 제공한다. 본 발명의 제조방법은 구체적으로는,The present invention also provides a method for preparing a mixture of ghost salmonella mutant strains for the prevention or treatment of Swine Disease. The production method of the present invention is, specifically,

(a) asd(aspartate β-semialdehyde dehydrogenase) 유전자, PR 프로모터/cI28 리프레서(repressor)에 작동가능하게 연결된 세포 용해 유전자(E-lysis), pBR 복제기점(ori), ompA 신호 서열(signal sequence) 및 상기 ompA 신호 서열과 연결된 장독소성 대장균(Enterotoxigenic Escherichia coli) 유래 Stx2eB, FedA 및 FedF 항원 코딩 유전자로 이루어진 군에서 선택되는 어느 하나의 유전자를 포함하는 고스트 유도 재조합 벡터를 제조하는 단계; (a) asd (aspartate β- semialdehyde dehydrogenase) gene, PR promoter / cI28 repressor (repressor) cell lysis gene (E-lysis) operatively connected to, pBR origin of replication (ori), ompA signal sequence (signal sequence) And a gene selected from the group consisting of Stx2eB, FedA and FedF antigen-encoding genes derived from Enterotoxigenic Escherichia coli linked to the ompA signal sequence;

(b) 살모넬라 균주의 게놈 DNA에서 lon, cpxR 및 asd 유전자를 결실시켜 약독화된 살모넬라 변이주를 제조하는 단계; (b) deleting the lon, cpxR and asd genes from the genomic DNA of Salmonella strains to produce attenuated Salmonella mutants;

(c) 상기 (a) 단계의 재조합 벡터로 상기 (b) 단계의 lon, cpxR 및 asd 유전자가 결실된 살모넬라 변이주를 형질전환시키는 단계; (c) transforming a salmonella mutant in which the lon, cpxR and asd genes of step (b) have been deleted as the recombinant vector of step (a);

(d) 상기 형질전환된 살모넬라균 변이주를 선별하는 단계;(d) selecting said transformed Salmonella mutant strains;

(e) 선별된 살모넬라 변이주를 아라비노즈를 함유하는 배지에서 25~30℃ 조건으로 배양하는 단계;(e) culturing the selected Salmonella mutant strain in a medium containing arabinose at 25 to 30 DEG C;

(f) 상기 배양액의 세포밀도(OD₆₀₀)가 0.6~1.0에 도달하면 아라비노즈를 함유하지 않는 배지에서 40~43℃의 조건으로 46~50시간 추가로 배양하는 단계; 및(f) further culturing in the medium containing no arabinose at a temperature of 40 to 43 ° C for 46 to 50 hours when the cell density (OD ₆₀₀ ) of the culture solution reaches 0.6 to 1.0; And

(g) 상기 배양액의 세포밀도가 중지되었을 때 상기 Stx2eB, FedA 및 FedF 항원을 각각 발현하는 살모넬라 변이주를 수득하고 이들을 혼합하는 단계를 포함하는 것일 수 있다.(g) obtaining a Salmonella mutant expressing the Stx2eB, FedA and FedF antigens respectively when the cell density of the culture medium is stopped, and mixing them.

상기 asd(aspartate β-semialdehyde dehydrogenase) 유전자는 세포벽 합성에 있어서 펩티도글리칸의 크로스 연결에 관여하는 DAP(diaminopimellic acid) 합성의 개시지점에 관련된 효소로, DAP가 결핍된 배지에서 asd 유전자 결핍주에 asd 유전자의 도입 여부를 확인할 수 있어, 이는 유용한 플라스미드의 선택표지이다.The asd (aspartate β-semialdehyde dehydrogenase) gene is an enzyme involved in the synthesis of DAP (diaminopimellic acid) involved in the cross-linking of peptidoglycan in cell wall synthesis. In the asd gene deficient state in a medium lacking DAP asd gene, which is a selectable marker of useful plasmids.

본 발명의 상기 "세포 용해 유전자(E-lysis)"는 대장균의 외막에 터널을 구성하여 구멍을 내서 대장균 세포 내 핵산성분을 빼내어 용해(lysis)시키는 역할이 있다는 사실이 알려져 있으며, 세포 용해 유전자(E-lysis)에 의한 세포 용해의 결과, 핵산 성분을 포함한 모든 세포 내용물이 세포 외부로 유출되고, 외막(outer membrane), 주변 세포질 공간(periplasmic space) 및 내막(inner membrane)만이 남게 된다.It is known that the above-mentioned "cell lysis gene" of the present invention plays a role of forming a tunnel in the outer membrane of E. coli and piercing it to extract nucleic acid components in E. coli cells and lysis them. As a result of cell lysis by E-lysis, all the cell contents including the nucleic acid component flow out of the cell, leaving only the outer membrane, the periplasmic space and the inner membrane.

pBR 복제기점(ori)은 고 카피(high copy) 복제기점으로 갑자기 많은 항원과 E-lysis 발현을 조절하기 위해 역방향 아라비노즈 시스템(arabinose system)으로 조절이 필요하다. 즉 급격한 항원 및 E-lysis 발현은 결국 숙주 세포에 악영향을 미쳐 숙주 세포가 과부하가 걸리는 현상이 생기는 경우가 많다. 이를 극복하기 위해 아라비노즈 시스템이 필요하며 또한 이의 성장을 위해서는 아라비노즈를 첨가하여야 하는 번거로움이 있다.The origin of the pBR replication (ori) is a high copy origin of replication and needs to be regulated by a reverse arabinose system to regulate many antigens and E-lysis expression abruptly. That is, the rapid expression of the antigen and E-lysis may adversely affect the host cell and cause the host cell to overload. To overcome this, an arabinose system is required, and arabinose is added for the growth of the arabinose system.

상기 ompA 신호 서열(signal sequence)은 세포 부착인자를 세포외벽에 다량 발현시키기 위해 사용되었다.The ompA signal sequence was used to express large amounts of the cell adhesion factor on the outer wall of the cell.

용어 "벡터(vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동 가능하게 연결된 DNA 서열을 함유하는 DNA 생성물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주 게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호 교환적으로 사용된다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 것이 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주세포당 수백 개의 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록 하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 선별 표지 및 (c) 외래 DNA 절편이 삽입될 수 있는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation)할 수 있다.The term "vector" means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

본 발명의 상기 Stx2eB, FedA 및 FedF 항원 단백질을 코딩하는 유전자는 각각 서열번호 5, 서열번호 6 및 서열번호 7의 염기서열로 이루어질 수 있다. 또한, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 5, 서열번호 6 및 서열번호 7의 염기서열로 이루어진 군으로부터 선택되는 염기서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.The genes coding for the Stx2eB, FedA and FedF antigen proteins of the present invention may comprise the nucleotide sequences of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, respectively. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has at least 70%, more preferably at least 80%, even more preferably at least 90% sequence identity with the nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: , And most preferably at least 95% sequence homology. "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

본 발명은 또한, 상기 방법에 의해 제조된 돼지의 부종병 예방 또는 치료용 고스트 살모넬라 변이주의 혼합물을 제공한다.The present invention also provides a mixture of ghost salmonella mutants for the prevention or treatment of edema of swine produced by the method.

상기 고스트 살모넬라 변이주는 약독화된 것이 바람직하다. 상기 약독화된 고스트 살모넬라 변이주는 전술한 바와 같다.The ghost salmonella mutant is preferably attenuated. The attenuated ghost salmonella mutant is as described above.

본 발명은 또한, 본 발명의 고스트 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 돼지의 부종병 예방 또는 치료용 백신 조성물을 제공한다.The present invention also provides a vaccine composition for preventing or treating swine swine disease comprising a mixture of the ghost salmonella mutant of the present invention as an active ingredient.

본 발명의 상기 백신 조성물은 장독소성 대장균 유래 FliC 항원을 발현하는 고스트 살모넬라 변이주를 추가로 포함하는 돼지 부종병 예방 또는 치료용 백신 조성물일 수 있으나, 이에 제한되지 않는다.The vaccine composition of the present invention may be, but is not limited to, a vaccine composition for preventing or treating porcine edema disease, which further comprises a ghost salmonella mutant expressing the Fischer-Escherichia coli-derived FliC antigen.

상기 FliC 항원은 세균의 움직임을 조절하는 세포 표면의 편모(flagella) 단백질로, 편모는 보통 병원체 관련 분자 패턴(PAMPs)으로서 작용하여 숙주 안에서 선천성 면역체계(innate immunity)의 구성요소로서 후천성 면역체계의 활성화를 자극시키는 요소중 하나인 TLR5(Toll like recepter 5)와 상호작용으로 대식세포(macrophage)에서 NF-κB의 활성화로 후천성 면역체계 활성화에 기여한다. F18+ 장독소성 대장균의 병인 기전에서 편모가 소장에 부착과 집락화를 돕는다는 최근의 연구결과를 토대로 하여 편모 단백질을 발현하는 FliC 유전자를 애주번트(adjuvant) 역할을 하는 제4의 항원 유전자로 선정하였다.The FliC antigen is a flagella protein on the cell surface that regulates the movement of bacteria. The flagella usually act as pathogen-associated molecular patterns (PAMPs), which are components of the innate immunity in the host, Activation of NF-κB in the macrophage by interaction with TLR5 (Toll like receptor 5), one of the stimulants of activation, contributes to the activation of the acquired immune system. The FliC gene expressing the flagellin protein was selected as the fourth antigenic gene, which acts as an adjuvant, based on the recent study that the flagella help to adhere and colonize the small intestine in the pathogenesis of F18 + enterococci.

본 발명에 따른 FliC 항원의 범위는 서열번호 4로 표시되는 아미노산 서열을 갖는 단백질 및 이의 기능성 동등물을 포함한다. 단백질의 기능적 동등물의 구체적인 내용은 전술한 바와 같다. 또한 본 발명은, FliC 항원의 단편, 유도체 및 유사체를 포함한다.The scope of the FliC antigen according to the present invention includes proteins having the amino acid sequence shown in SEQ ID NO: 4 and functional equivalents thereof. The specific contents of the functional equivalents of the proteins are as described above. The invention also encompasses fragments, derivatives and analogs of FliC antigens.

또한, 본 발명에 따른 상기 FliC 항원 단백질을 코딩하는 유전자는 서열번호 8의 염기서열로 이루어질 수 있으며, 상기 염기서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적인 내용은 전술한 바와 같다.In addition, the gene encoding the FliC antigen protein according to the present invention may comprise the nucleotide sequence of SEQ ID NO: 8, and homologues of the nucleotide sequence are included within the scope of the present invention. The concrete contents are as described above.

용어 "애주번트(adjuvant)"는 면역반응을 높이기 위한 첨가 물질로, 어떤 항원과 함께 동물 조직 내에 주입된 경우 그 항원에 대한 면역 효과가 뚜렷하게 증가되는 물질을 말한다.The term "adjuvant" is an additive material for enhancing the immune response, and refers to a substance in which the immune effect on the antigen is markedly increased when it is injected into an animal tissue together with an antigen.

본 발명의 백신 조성물은 장독소성 대장균 유래 주요 병인성 인자 Stx2eB, FedA 및 FedF 항원 각각을 세포외벽에 발현하는 고스트 살모넬라 변이주의 혼합물에 추가로 FliC 항원을 세포외벽에 발현하는 고스트 살모넬라 변이주를 유효성분으로 포함하며, 상기 백신 조성물을 동물에 처리하여 돼지 부종병을 예방 또는 치료할 수 있는 것이다.The vaccine composition of the present invention comprises, in addition to a mixture of Ghost Salmonella mutants expressing each of the major pathogenic factors derived from enterotoxin-producing E. coli, Stx2eB, FedA and FedF antigens on the cell wall, the Ghost Salmonella mutant expressing the FliC antigen on the outer wall as an active ingredient And the vaccine composition can be administered to an animal to prevent or treat swine edema disease.

상기 백신 조성물은 모돈 또는 자돈에 접종할 수 있고, 바람직하게는 자돈에 접종하는 것일 수 있으나, 이에 제한하지 않는다.The vaccine composition may be inoculated into sows or piglets, preferably inoculated into piglets, but is not limited thereto.

본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 근육 내, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 바람직하게는 고스트 백신을 경구 또는 근육 내 투여할 수 있으나, 이에 제한되지 않는다. 또한 상기 조성물의 투여량은 돼지의 무게, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양하다.The composition of the present invention may be administered orally or parenterally (for example, intramuscularly, intravenously, subcutaneously, intraperitoneally or topically), preferably by oral or parenteral But are not limited thereto. The dosage of the composition varies depending on the weight, age, sex, health condition, diet, administration time, administration method, excretion rate, severity of disease and the like.

본 발명에서 용어 "백신"은 생체에 면역을 주는 항원을 함유한 생물학적인 제제로서, 감염증의 예방을 위하여 사람이나 동물에 주사하거나 경구 투여함으로써 생체에 면역이 생기게 하는 면역원 또는 항원성 물질을 말한다. 생체 내 면역은 병원균의 감염 후에 생체 내 면역력이 자동으로 얻어지는 자동 면역과 외부에서 주입한 백신에 의하여 얻어지는 수동 면역으로 크게 나누어진다. 자동 면역은 면역에 관계하는 항체의 생성기간이 길고 지속적인 면역력의 특징이 있는 반면, 백신에 의한 수동 면역은 감염증 치료에 즉시 작용하나 지속력이 떨어지는 단점이 있다.The term "vaccine " in the present invention refers to a biological agent containing an antigen that immunizes a living body. The term " vaccine " refers to an immunogenic or antigenic substance that causes immunization to a living body by injection or oral administration to a human or animal for the prevention of infection. In vivo immunity is largely divided into autoimmunity, which is obtained automatically in vivo after infection with pathogenic bacteria, and passive immunization, which is obtained by externally injected vaccine. While autoimmunity has a long period of immune-related antibody production and is characterized by persistent immunity, passive immunization by vaccine acts immediately for the treatment of infectious diseases but has a disadvantage that its persistence is poor.

상기 백신 조성물은 안정제, 유화제, 수산화알루미늄, 인산알루미늄, pH 조정제, 계면활성제, 리포솜, 이스콤 (iscom) 보조제, 합성 글리코펩티드, 증량제, 카복시폴리메틸렌, 서브바이랄 (subviral) 입자 보조제, 콜레라 독소, N,N-디옥타데실-N',N'-비스(2-하이드록시에틸)-프로판디아민, 모노포스포릴 지질 A, 디메틸디옥타데실-암모늄 브로마이드 및 이의 혼합물로 구성된 군에서 선택된 어느 하나 이상의 제 2 보조제를 추가로 함유할 수 있다.The vaccine composition may contain one or more of a stabilizer, an emulsifier, aluminum hydroxide, an aluminum phosphate, a pH adjuster, a surfactant, a liposome, an iscom adjuvant, a synthetic glycopeptide, an extender, a carboxy polymethylene, a subviral particle adjuvant, , N, N-dioctadecyl-N ', N'-bis (2-hydroxyethyl) -propanediamine, monophosphoryl lipid A, dimethyl dioctadecyl- ammonium bromide, The second auxiliary agent may be further contained.

또한, 상기 백신 조성물은 수의학적으로 허용 가능한 담체를 포함할 수 있다. 본 발명에서 용어 "수의학적으로 허용 가능한 담체"란 임의의 및 모든 용매, 분산 매질, 코팅제, 항원 보강제, 안정제, 희석제, 보존제, 항균제 및 항진균제, 등장성 작용제, 흡착 지연제 등을 포함한다. 백신용 조성물에 포함될 수 있는 담체, 부형제, 희석제로는 락토즈, 덱스트로스, 슈크로스, 솔비톨, 만니톨, 자일리톨, 말티톨, 전분, 글리세린, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등을 들 수 있다.In addition, the vaccine composition may comprise a veterinarily acceptable carrier. The term "veterinarily acceptable carrier" as used herein includes any and all solvents, dispersion media, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, Examples of the carrier, excipient and diluent which can be contained in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

또한, 상기 백신용 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형 및 드립 (drip) 또는 스프레이 등의 비강용 제형 그리고 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 제제화할 경우에는 보통 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제할 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 레시틴 유사 유화제에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트 (calcium carbonate), 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용할 수 있다. 경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등을 사용할 수 있으며, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수용성제, 현탁제, 유제, 동결건조제제가 포함된다. 비수용성제제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리 에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있으나, 이에 제한되지 않는다. 비강내 투여를 위한 제제에 적합한 침투제는 일반적으로 당업자에게 공지되어 있다. 그러한 적합한 제형물은 안정성과 순응도를 위해 바람직하게 무균, 등장 및 완충되도록 제형화된다. 비강내 투여를 위한 제제는 또한 정상적인 섬모 작용을 유지시키기 위해 점액 분비를 여러 측면에서 자극하도록 제조되며, 문헌 (Remington's Pharmaceutical Science, 18th Ed., Mack Publishing Co., Easton, PA(1990))에 기술된 바와 같이, 적합한 제형이 바람직하게 등장성의, pH 5.5 내지 6.5를 유지하는 약간 완충된 제형이며, 가장 바람직하게 항미생물 방부제 및 적합한 약물 안정화제를 포함한다.In addition, each of the above-mentioned compositions for the vaccine may be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, and nasal formulations such as drips or sprays, And the like. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, Or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. As the liquid preparation for oral administration, suspensions, solutions, emulsions, syrups and the like may be used. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and freeze-drying agents. Examples of the suspending agent include propylene glycol, polyethyleneglycol, vegetable oil such as olive oil, injectable ester such as ethylolate, and the like, but the present invention is not limited thereto. Penetrants suitable for formulation for intranasal administration are generally known to those skilled in the art. Such suitable formulations are preferably formulated to be sterile, emollient and buffered for stability and compliance. Formulations for intranasal administration are also prepared to stimulate mucus secretion in several ways to maintain normal ciliary action and are described in Remington's Pharmaceutical Science, 18th Ed., Mack Publishing Co., Easton, PA (1990) As noted, suitable formulations are preferably isotonic, slightly buffered formulations that maintain a pH of 5.5 to 6.5, and most preferably comprise an antimicrobial preservative and a suitable drug stabilizing agent.

본 발명은 또한, 본 발명의 고스트 살모넬라 변이주의 혼합물을 유효성분으로 포함하는 돼지의 부종병 예방 또는 개선용 사료 첨가제를 제공한다.The present invention also provides a feed additive for preventing or ameliorating a swine disease of a swine comprising a mixture of the ghost salmonella mutant of the present invention as an active ingredient.

본 발명의 상기 사료 첨가제는 장독소성 대장균 유래 FliC 항원을 발현하는 고스트 살모넬라 변이주를 추가로 포함하는 돼지 부종병의 예방 또는 개선용 사료 첨가제일 수 있으나, 이에 제한되지 않는다.The feed additive of the present invention may be, but is not limited to, a feed additive for preventing or ameliorating swine edema disease, which further comprises a ghost salmonella mutant expressing the FliC antigen derived from the challenged E. coli.

본 발명의 사료 첨가제는 고스트 살모넬라균 변이주의 혼합물을 원형 그대로 사용하거나 또는 추가적으로 가축에 허용되는 곡류 및 그 부산물 등의 공지된 담체, 안정제 등을 가할 수 있으며, 필요에 따라 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성 피로인산염, 폴리인산염 (중합인산염) 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제, 항생물질, 항균제 및 기타의 첨가제 등을 가할 수도 있으며, 그 형상으로서는 분체, 과립, 펠릿, 현탁액 등의 적당한 상태일 수 있으며, 상기 사료첨가제를 공급하는 경우는 가축 등에 대하여 단독으로 또는 사료에 혼합하여 공급할 수 있다.
The feed additive of the present invention can be prepared by using the mixture of ghost salmonella mutant strains as it is or adding a known carrier such as cereal grains and by-products thereof, stabilizers and the like which are allowed to be added to livestock and, if necessary, adding citric acid, fumaric acid, , Polyphosphoric acid, catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, citric acid, and the like, such as organic acids such as lactic acid, malic acid, sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate Natural antioxidants such as chitosan, tannic acid, and phytic acid, antibiotics, antimicrobial agents, and other additives may be added, and the form thereof may be a proper state such as powder, granule, pellet, suspension, etc. When the feed additive is supplied Can be supplied to livestock or the like alone or in a mixed form.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

재료 및 방법Materials and methods

1. F18+ 대장균의 주요항원 발현 살모넬라 티피뮤리움(1. Expression of major antigens of F18 + E. coli Salmonella typhimurium ( Salmonella typhimuriumSalmonella typhimurium ) 균주의 제작) Production of strain

고스트 시스템(ghost system)은 E 용해 유전자(lysis gene)를 바탕으로 하여 일정한 온도가 되면 활성화되어 숙주에 구멍을 뚫게 만든다. 그리고 그 안의 세포질을 빠져나가게하여 숙주균을 화학적 처리나 물질적 스트레스 없이 자연적으로 사멸시킨다. 따라서 숙주가 가진 외막 단백질(outer membrane protein)의 항원성을 그대로 유지할 수 있으며 내부에 세포질이 없어 더 높은 항원 제시 효과를 나타낼 수 있다. 항원 운반 카세트(antigen delivery cassette)의 작용기작을 보면 고스트 세포를 28℃에서 배양시키면 cI28 리프레서(repressor)가 활성화되고, 활성화된 cI28은 오퍼레이터(operater)의 작용을 억제함으로써 항원의 발현을 중단시킨다. 반면 고스트 세포를 42℃에서 배양시키면 cI28이 비활성화되어 항원의 발현을 시작하게 된다. 고스트 카세트(ghost cassette)의 작용기작을 보면 고스트 세포를 28℃에서 0.2% 아라비노즈(arabinose)를 첨가하여 배양시키면 고스트 세포가 성장하게 되고 동시에 활성화된 cI28 리프레서::PR 프로모터가 E 용해 유전자의 발현을 억제시킨다. 하지만 약하게 E 용해 유전자가 발현되어지고 동시에 아라비노즈에 의해 작용되는 ParaBAD 프로모터가 anti-E 용해 유전자를 발현시킨다. E 용해 유전자는 anti-E 용해 유전자에 의해서 억제되어 stringent E 용해 유전자의 발현을 조절하게 된다.The ghost system, based on the lysis gene, activates when it reaches a certain temperature, causing it to puncture the host. And the cytoplasm inside it, allowing the host bacteria to naturally die without chemical treatment or physical stress. Therefore, it can maintain the antigenicity of the outer membrane protein of the host, and it can exhibit a higher antigen presentation effect because there is no cytoplasm in the inside. When the ghost cells are cultured at 28 ° C, the cI28 repressor is activated and the activated cI28 stops the expression of the antigen by inhibiting the action of the operator. . On the other hand, when ghost cells are cultured at 42 ° C, cI28 is inactivated and antigen expression is initiated. In the ghost cassette, ghost cells are grown by adding 0.2% arabinose at 28 ° C. At the same time, the activated cI28 repressor :: PR promoter activates E-soluble gene Lt; / RTI > However, a weakly E-soluble gene is expressed and at the same time, the ParaBAD promoter, which is acted by arabinose, expresses an anti-E-soluble gene. E-soluble gene is inhibited by the anti-E-soluble gene and controls the expression of the stringent E-lytic gene.

항원으로 선별되어진 4개의 유전자는 전라북도 남원의 양돈 농장에서 분리된 ETEC 야외균주(JOL500)에서 5' 부분에 EcoRI 제한효소 자리를, 3' 부분에 HindⅢ 제한효소 자리를 더한 각 유전자의 프라이머(표 1)를 합성하여 Taq 중합효소를 이용하여 PCR을 통해 분리되었다.The four genes selected as antigens were the EcoR I restriction enzyme site in the 5 'portion and the HindIII restriction site in the 3' portion of the ETEC outdoor strain (JOL500) isolated from the pig farm of Namwon, Jeollabukdo Table 1) was synthesized and isolated by PCR using Taq polymerase.

항원 유전자 증폭을 위한 프라이머 정보Primer information for antigen gene amplification 항원 유전자Antigen gene 프라이머 염기서열(5'→3')The primer sequence (5 'to 3') 증폭산물 크기Amplification product size Stx2eBStx2eB 정방향Forward ccgccaattcaagaagatgtttatggcg (서열번호 9)ccgccaattcaagaagatgtttatggcg (SEQ ID NO: 9) 261bp261 bp 역방향Reverse ccgcaagcttgtcattattaaactgcac (서열번호 10)ccgcaagcttgtcattattaaactgcac (SEQ ID NO: 10) FedAFeda 정방향Forward ccgcgaattccagcaaggggatgttaaat (서열번호 11)ccgcgaattccagcaaggggatgttaaat (SEQ ID NO: 11) 450bp450bp 역방향Reverse ccgcaagcttgatgattacttgtaagta (서열번호 12)ccgcaagcttgatgattacttgtaagta (SEQ ID NO: 12) FedFFedF 정방향Forward ccgcgaattcgcgtctactctacaagta (서열번호 13)ccgcgaattcgcgtctactctacaagta (SEQ ID NO: 13) 846bp846bp 역방향Reverse ccgcaagcttttactgtatctcgaaaacaa (서열번호 14)ccgcaagcttttactgtatctcgaaaacaa (SEQ ID NO: 14) FliCFliC 정방향Forward ccgcgaattcgcacaagtcattaataccaacagc (서열번호 15)ccgcgaattcgcacaagtcattaataccaacagc (SEQ ID NO: 15) 1,689bp1,689bp 역방향Reverse ccgcaagcttttaaccctgcagcagagacagaac (서열번호 16)ccgcaagcttttaaccctgcagcagagacagaac (SEQ ID NO: 16)

증폭된 각 항원 유전자는 시판되는 단백질 발현 플라스미드인 pET28a로 클로닝하여 각각 pET28a-Stx2eB, pET28a-FedA, pET28a-FedF 및 pET28a-FliC로 제조되었고, 각각의 제조된 플라스미드는 E. coli 균주 BL21(DE3)pLysS로 형질전환한 후 각각의 항원 단백질을 발현시키고 정제하였다. 확보된 단백질 항원은 실험동물 및 목적동물에서의 항체 역가(titer) 측정을 위한 ELISA 실험의 항원 및 실험동물에서의 CD4와 CD8 자극물질(stimulator)로 사용하기 위해 -80℃에 보관하며 실험에 사용하였다.Each amplified antigen gene was cloned into pET28a-Stx2eB, pET28a-FedA, pET28a-FedF and pET28a-FliC, respectively, by cloning into pET28a, a commercially available protein expression plasmid. The plasmids prepared were E. coli strain BL21 (DE3) After transformation with pLysS, each antigen protein was expressed and purified. The obtained protein antigen is stored at -80 ° C for use as an antigen of an ELISA test for measuring the titer of an antibody in an experimental animal and a target animal and as a CD4 and CD8 stimulator in an experimental animal. Respectively.

고스트 균주를 제작하기 위하여 위와 동일하게 PCR을 수행하고, 증폭된 4개의 항원 유전자를 pMMP184 플라스미드에 재조합하여 pMMP184-Stx2eB, pMMP184-FedA, pMMP184-FedF 및 pMMP184-FliC를 제조하였고, 이 플라스미드는 약독화 살모넬라 균주(Δlon ΔcpxR Δasd Salmonella Typhimurium, JOL912)에 형질전환시켜 고스트 백신 균주로 준비하였다. pMMP184-Stx2eB, pMMP184-FedA, pMMP184-FedF 및 pMMP184-FliC 플라스미드로 형질전환된 고스트 백신 균주는 각각 JOL1454, JOL1464, JOL1460 및 JOL1485로 명명하였다. 준비된 고스트 백신 균주는 0.2% L-아라비노즈를 투여한 영양배지(nutrient broth)에서 28℃ 온도 조건으로 OD₆₀₀=0.8 까지 배양한 후, 아라비노즈를 제거하기위해 영양배지로 두 번 세척한 후 42℃로 옮겨 48시간동안 배양하며 균주의 용해반응을 유도하였다. 고스트 백신 균주의 용해을 확인하기 위하여 48시간 후 살모넬라 선택배지인 BGA(Brilliant Green Agar)에 고스트 백신 균주 배양액을 100㎕ 씩 접종하여 고스트화 여부를 확인하여 백신 접종을 준비하였다.
PCR was carried out in the same manner as described above to prepare ghost strains and pMMP184-Stx2eB, pMMP184-FedA, pMMP184-FedF and pMMP184-FliC were prepared by recombining the amplified four antigen genes into pMMP184 plasmid, Salmonella typhimurium (Jol912) was transformed into Salmonella strain ( ? Lon? CpxR? Asd) and prepared as a ghost vaccine strain. The ghost vaccine strains transformed with pMMP184-Stx2eB, pMMP184-FedA, pMMP184-FedF and pMMP184-FliC plasmids were named JOL1454, JOL1464, JOL1460 and JOL1485, respectively. The prepared ghost vaccine strain was cultured in a nutrient broth containing 0.2% L-arabinose at a temperature of 28 ° C at OD ₆₀₀ = 0.8, washed twice with nutrient medium to remove arabinose, And incubated for 48 hours to induce the lysis reaction of the strain. To confirm the dissolution of the ghost vaccine strain, 100 μl of ghost vaccine culture broth was inoculated into BAL (Brilliant Green Agar), a salmonella selective medium, after 48 hours to confirm whether or not the ghost vaccine was dissolved.

2. 2. 웨스턴Western 블랏(Western blot)을Western blot 이용한 후보 항원의 백신 세포에서의 발현 여부 확인 Identification of candidate antigens used in vaccine cells

제작된 백신 균주가 해당 Stx2eB, FedA, FedF, FliC 단백질을 세포 외막까지 잘 발현하는지 확인하기 위하여 각 백신 후보균주를 200㎖ LB 액체배지에 하룻밤 배양하여 시료를 준비하였다. 이렇게 준비된 시료는 4,000rpm으로 원심분리한 후 상층액은 새 플라스크로 옮겨주었다. 분리된 상층액은 TCA를 이용하여 분비된 단백질을 분리정제하였고 4,000rpm에서 원심분리하고 남은 펠렛은 SDS-샘플 버퍼와 혼합한 후 15분간 끓인 뒤 사용하였다. SDS-PAGE 후 PVDF 멤브레인으로 옮겨 블락킹 버퍼(3% BSA in PBST)로 3시간 블락킹하였다. 그 후, 항-His tag 항체를 1:5,000으로 희석하여 하룻밤 반응시켰다. 다음날 1:5,000으로 희석된 2차 항체(goat anti-Rabbit IgG HRP-conjugated)로 1시간 반응시킨 후 WEST-one^TM Western Blotting 시스템(IntronBiotechnology, 한국)으로 발색하여 각 항원 단백질의 발현을 확인하였다.
In order to confirm that the prepared vaccine strains express well the Stx2eB, FedA, FedF and FliC proteins to the extracellular membrane, each vaccine candidate strain was cultured overnight in 200 ml LB liquid medium to prepare samples. The prepared sample was centrifuged at 4,000 rpm and the supernatant was transferred to a new flask. The separated supernatants were separated and purified using TCA, centrifuged at 4,000 rpm, and the remaining pellet was mixed with SDS-sample buffer and boiled for 15 minutes before use. After SDS-PAGE, it was transferred to PVDF membrane and blocked for 3 hours with blocking buffer (3% BSA in PBST). Thereafter, the anti-His tag antibody was diluted to 1: 5,000 and allowed to react overnight. The next day, the cells were reacted with a secondary antibody (goat anti-Rabbit IgG HRP-conjugated) diluted 1: 5,000 for 1 hour and developed with WEST-one ^™ Western blotting system (IntronBiotechnology, Korea) to confirm the expression of each antigen protein.

3. 후보 균주의 백신 후보 균주로의 가능성 및 실험동물에서의 면역원성 확인3. Possibility of candidate strains as vaccine candidate strains and immunogenicity in laboratory animals

웨스턴 블랏으로 항원 단백질의 발현이 확인된 백신 균주를 BALB/c 생쥐(암컷, 5주령)에 접종하여 면역유도 반응을 분석하였다. 총 세 번의 실험을 실시하였다. 첫 번째 실험에서는 독소 단백질(Stx2eB)과 섬모 단백질(FedA+FedF)을 발현하는 백신 균주를 각각 투여하여 실험동물에서의 면역원성을 확인하였다(n=30, A: 고스트화 된 JOL1454 균주 1X10⁸, B: 고스트화 된 JOL1460+JOL1464 균주 1X10⁸, C: 음성 대조구). 두 번째 실험에서는 독소 단백질과 섬모 단백질의 혼합 접종시 나타나는 실험동물의 면역원성을 확인하였다(n=30, A: 고스트화 된 JOL1454+JOL1460+JOL1464 균주 1X10⁸, 0주차 1회 접종, B: 고스트화 된 JOL1454+JOL1460+JOL1464 균주 1X10⁸, 0주차 및 2주차 2회 접종, C: 음성 대조구). 세 번째 실험에서는 독소 및 섬모 단백질의 3개의 항원과 함께 면역증강 효과를 보이는 편모 단백질(FliC) 발현 균주까지 더하여 실험동물에 투여하고 그 면역원성을 측정하였다(n=30, A: 고스트화 된 JOL1454+JOL1460+JOL1464+JOL1485 균주 1X10⁸, 0주차 1회 접종, B: 고스트화 된JOL1454+JOL1460+JOL1464+JOL1485 균주 1X10⁸, 0주차 및 2주차 2회 접종, C: 음성 대조구).Immunization induction was analyzed by inoculation of BALB / c mice (female, 5 weeks old) with a vaccine strain in which antigen protein expression was confirmed by Western blotting. A total of three experiments were conducted. In the first experiment, the immunogenicity of the toxin protein (Stx2eB) and the vaccine strain expressing the ciliated protein (FedA + FedF) was individually measured (n = 30, A: ghosted JOL1454 strain 1 × ^{10 8} , B: ghosted JOL1460 + JOL1464 strain 1 × ^{10 8} , C: negative control). The second experiment, the toxin protein and when mixed inoculation of ciliary protein was confirmed the immunogenicity of the animals appears (n = 30, A: Ghost stylized JOL1454 + JOL1460 + JOL1464 strain 1X10 ^8, 0 parking once inoculated, B: Ghost JOL1454 + JOL1460 + JOL1464 strain 1X10 ⁸ , 0 and 2 inoculation twice, C: negative control). In the third experiment, the immunogenicity was measured by adding to the experimental animal the addition of the three antigen of the toxin and the cilioprotein together with the expression of the flagellar protein (FliC) exhibiting the immunity enhancing effect (n = 30, A: ghosted JOL1454 JOL1460 + + + JOL1464 JOL1485 strain 1X10 ^8, 0 parking once inoculated, B: ghost stylized JOL1454 JOL1460 + + + JOL1464 JOL1485 strain 1X10 ^8, 0 parking and parking 2 2 doses, C: negative control).

위의 모든 실험에서 실험동물로의 백신 균주 투여는 근육내(intramuscular)의 경로로 접종된 것이며, 접종 후 2, 4 및 6 주째에 각 실험동물로부터 혈청(serum)과 분변을 채취하였다. 혈청은 안와후 정맥을 통해 혈액을 채취한 후 4,000xg에서 5분 동안 원심분리하여 상등액(혈청)을 분리한 후 -20℃에 보관하며 실험하였고, 분변의 경우는 무게를 잰 후 아지드화나트륨(sodium azide)이 0.1% 함유된 PBS로 100mg/㎖가 되도록 부유시킨 후 13,200rpm에서 10분간 원심분리한 후 상층액을 분리하여 -20℃에 보관하며 실험에 사용하였다.
In all of the above experiments, vaccine strain administration to experimental animals was inoculated intramuscularly, and serum and feces were collected from each experimental animal at 2, 4, and 6 weeks after inoculation. Serum was collected from the orbital vein and centrifuged at 4,000 × g for 5 minutes. The supernatant (serum) was separated and stored at -20 ° C. The feces were weighed, The suspension was suspended in PBS containing 0.1% sodium azide to a concentration of 100 mg / ml, centrifuged at 13,200 rpm for 10 minutes, and the supernatant was separated and stored at -20 ° C.

4. 면역화된 생쥐의 체액성 면역 반응 측정4. Measurement of humoral immune response in immunized mice

각 항원에 대해 특이한 sIgA 항체와 IgG, IgG1 및 IgG2a 항체를 측정하기 위해 ELISA를 수행하였다. 수행 방법은 접종량을 결정짓기 위한 샘플 웰(well)에는 정제된 항원 단백질을 500ng/웰의 농도로, 표준(standard) 웰에는 goat anti-mouse IgG, IgG1, IgG2a 또는 goat anti-mouse sIgA를 각각 200ng/웰의 농도로 분주한 후 4℃에서 하룻밤동안 코팅하였고, 코팅된 플레이트는 Tween-20이 0.05% 함유된 PBS (PBST)로 3번 세척한 후 블락킹 버퍼(3% skim milk in PBS)로 블락킹한 다음 혈청은 PBST로 1:100 으로 희석하고, 분변은 1:3으로 희석한 다음 100㎕ 씩 웰에 분주한 후, 37℃에서 1시간30분 동안 반응시켰다. 그 후, 혈청 시료의 경우는 HRP-conjugated goat anti-mouse IgG 항체, 분변 시료의 경우는 HRP-conjugated goat anti-mouse IgA 항체를 1:5,000의 배율로 희석하여 각 웰에 100㎕ 씩 분주한 후 37℃에서 1시간 동안 반응시켰다. OPD-기질 반응액을 웰 당 100㎕ 씩 분주하여 발색시킨 후, 3M 황산(H₂SO₄)으로 반응을 정지시키고 492nm에서 OD값을 측정하였다. 각 항원에 대해 특이한 항체의 농도는 표준 단백질 농도에 기초하여 계산하였다.
An ELISA was performed to measure IgG, IgG1 and IgG2a antibodies specific for sIgA antibodies against each antigen. For the method, 200 ng of goat anti-mouse IgG, IgG1, IgG2a or goat anti-mouse sIgA were added to the standard wells at a concentration of 500ng / well of the purified antigen protein in a sample well to determine the inoculation amount, / Well and then coated at 4 ° C overnight. The coated plates were washed 3 times with PBS (PBST) containing 0.05% Tween-20 and blocked with 3% skim milk in PBS After blocking, the serum was diluted 1: 100 with PBST, and the feces was diluted 1: 3. Then, 100 쨉 l was added to each well, followed by reaction at 37 째 C for 1 hour and 30 minutes. After that, HRP-conjugated goat anti-mouse IgG antibody in the case of serum samples and HRP-conjugated goat anti-mouse IgA antibody in the case of fecal samples were diluted at a ratio of 1: 5,000, And reacted at 37 DEG C for 1 hour. The OPD-substrate reaction solution was diluted with 100 쨉 l / well of each well, developed with 3 M sulfuric acid (H ₂ SO ₄ ), and OD was measured at 492 nm. Concentrations of antibodies specific for each antigen were calculated based on standard protein concentrations.

5. 면역화된 생쥐의 세포성 면역 반응 측정5. Measurement of cellular immune response in immunized mice

백신 균주 접종 후 2주차가 된 생쥐를 희생시켜 무균적으로 지라(spleen)를 채취한 후, 조직을 분쇄하고 조직 분쇄물을 세포 스트레이너(stainer)로 걸러 세포만 수집하고 남은 조직은 제거하였다. 원심분리하여 세포를 가라앉힌 뒤 RPMI 배지(모든 RPMI 배지(RPMI 1640 supplemented, Sigma, 미국)는 10% 열-불활성화 소태아혈청(heat-inactivated fetal bovine serum), 100IU/ml 페니실린 및 100㎍/ml 스트렙토마이신이 포함되어 있다)로 부유시키고 세포를 다시 원심분리로 가라앉힌 뒤 적혈구(red blood cell, RBC) 용해 버퍼를 통해 RBC를 제거하였다. 이후 원심분리한 세포 침전물을 멸균 PBS로 세척하고 이와 같은 과정을 두 차례 반복한 뒤 RPMI 배지에 부유된 지라세포(splenocyte)의 수를 측정하여 각 그룹에 해당하는 항원 단백질과 함께 최종 세포수가 1x10이 되도록 24 웰 세포배양 플레이트에 분주하였다. 그 후, 분주한 세포에 항원 단백질로 자극을 준 후 면역 사이토카인 분석을 위해 RT-PCR을 수행하였고, 백신 균주 접종 후 CD4+ 또는 CD8+ T 세포의 증감 유무를 알아보기 위해 유세포분석기(flow cytometry)를 이용하여 FACS(Fluorescence-activated cell sorting)를 실시하였다. 또한 항원 단백질로 분주한 지라세포를 자극한 후에 세포 활성도와 증식 여부를 살펴보기 위해 MTT 분석을 실시하였다.
Spleen was aseptically sacrificed at 2 weeks after the inoculation of the vaccine strain, and the tissue was pulverized. The tissue was pulverized with a cell strainer to collect only the cells, and the remaining tissue was removed. After centrifugation, the cells were resuspended in RPMI medium (RPMI 1640 supplemented, Sigma, USA) supplemented with 10% heat-inactivated fetal bovine serum, 100 IU / ml penicillin and 100 μg / ml streptomycin), the cells were centrifuged again and the RBCs were removed through red blood cell (RBC) lysis buffer. After centrifugation, the cells were washed with sterile PBS, and the number of splenocytes suspended in the RPMI medium was measured twice. The number of final cells was 1 × 10 5 Were dispensed into 24-well cell culture plates as much as possible. Then, RT-PCR was performed for immunocytochemical analysis after stimulation with antigen protein. Flow cytometry was performed to determine the increase or decrease of CD4 + or CD8 + T cells after vaccination with the vaccine strain Fluorescence-activated cell sorting (FACS) was performed. In addition, MTT assay was performed to examine cell activity and proliferation after stimulation of splenocytes with antigen protein.

5-1. 면역 사이토카인 분석을 위한 RT-PCR5-1. RT-PCR for immunocytocin analysis

RNeasy plus mono 키트(Qiagen, 독일)를 사용하여 각 항원으로 반응시킨 지라세포로부터 총 RNA를 추출하였다. 추출된 총 RNA는 NanoDrop을 이용하여 농도를 측정한 뒤 cDNA 역전사 키트(Applied Biosystems, 미국)를 이용하여 cDNA로 합성하고, Quantitect SYBR Green PCR Mastermix(Qiagen)로 인터루킨-4(interleukin-4, IL-4), 인터페론-γ(interferon-γ, IFN-γ), 종양괴사인자-α(tumor necrosis factor α, TNF-α) 및 β-액틴의 mRNA 레벨을 실시간 PCR(Step One plus Real Time PCR system, Applied Biosystems)을 사용하여 분석하였다.
Total RNA was extracted from the zygotic cells reacted with each antigen using RNeasy plus mono kit (Qiagen, Germany). The extracted total RNA was synthesized by cDNA using a cDNA reverse transcription kit (Applied Biosystems, USA) after measuring the concentration using NanoDrop, and quantified by using Quantitect SYBR Green PCR Mastermix (Qiagen) with interleukin- MRNA levels of interferon-γ (interferon-γ, IFN-γ), tumor necrosis factor α and β-actin were measured by real- Applied Biosystems).

5-2. T 세포 분화 확인을 위한 FACS 분석5-2. FACS analysis for confirmation of T cell differentiation

각각 분주되어진 지라세포는 FACS running buffer(Miltenyi Biotec, 독일)로 3회 세척한 후, CD3e-PE, CD4-perCP-Vio700, CD8a-FITC로 각각 형광 라벨링한 후 MACS Quant 유세포분석기(Miltenyi Biotec)를 이용하여 CD4+ 및 CD8+ T 세포군의 분화 정도를 음성 대조구와 비교하였다.
Cells were washed three times with FACS running buffer (Miltenyi Biotec, Germany) and fluorescently labeled with CD3e-PE, CD4-perCP-Vio700, and CD8a-FITC, respectively, and analyzed using a MACS Quant flow cytometer (Miltenyi Biotec) And the degree of differentiation of CD4 + and CD8 + T cell groups was compared with negative control.

5-3. MTT 분석5-3. MTT analysis

플레이트에 분주되어진 지라세포를 각 항원 단백질 500ng/㎕로 자극시킨 후 72시간동안 37℃에서 관찰하였다. 세포를 현미경으로 관찰한 후 약 20㎕의 MTT 용액을 각 웰에 분주하고 37℃에서 4시간 반응시켜 결정 형성을 관찰하였다. 그 후 배지를 제거하고 결정을 녹이기 위해 DMSO(Dimethyl sulfoxide) 100㎕를 분주하여 결정을 녹여주고 540nm에서 흡광도를 측정한 후, 자극지수(stimulation index)를 하기의 식을 사용하여 계산하였다.Plates were plated on plates and stimulated with 500 ng / 각 of each antigen protein and observed at 37 캜 for 72 hours. After observing the cells with a microscope, about 20 μl of MTT solution was dispensed into each well and reacted at 37 ° C. for 4 hours to observe the formation of crystals. Then, 100 μl of DMSO (dimethyl sulfoxide) was added to dissolve the crystals to dissolve the crystals. The absorbance at 540 nm was measured, and the stimulation index was calculated using the following equation.

자극지수=항원으로 자극된 세포의 540nm 흡광도/음성 대조구의 540nm 흡광도
Irritation index = 540 nm absorbance of antigen stimulated cells / 540 nm absorbance of negative control

6. 실험동물에서의 도전 감염시 백신의 방어력6. Defense of Vaccine in Challenge Infection in Experimental Animals

면역원성 측정을 위해 JOL1454(Stx2eB)+JOL1464(FedA)+JOL1460(FedF) 혼합 백신 또는 JOL1454+JOL1464+JOL1460+JOL1485(FliC) 혼합 백신을 접종하고 6주후 실험동물을 대상으로 전라북도의 한 양돈 농장의 돼지에서 분리한 STEC 야외균주(JOL654)로 도전 감염을 실시하였다. 도전 감염 균주는 PCR을 이용해 Stx2e, F18ab, LT 및 STa 유전자의 존재를 확인하였고 반수치사량(lethal dose 50, LD50)은 실험동물에 야외균주를 1X10⁶ cfu/ml 부터 1X10⁸ cfu/ml 까지 복강내(intraperitoneal) 경로로 접종하고 생존확율을 계산하여 Reed-Muench 방법(Reed, L. et al., 1938, Amer. J. Hyg. 27)을 통하여 2X10⁷ cfu/ml로 결정되었다. 도전 감염후 50 시간동안 설사 및 폐사와 같은 임상 증상을 확인하였다.
For the measurement of immunogenicity, a mixed vaccine of JOL1454 (Stx2eB) + JOL1464 (FedA) + JOL1460 (FedF) or a mixed vaccine of JOL1454 + JOL1464 + JOL1460 + JOL1485 (FliC) A challenge infection was performed with an STEC outdoor strain (JOL654) isolated from pigs. The presence of Stx2e, F18ab, LT, and STa genes was confirmed by PCR in the challenged strain. Lethal dose 50 (LD50) was added to the experimental animals in the abdominal cavity from 1 × ¹⁰ ⁶ cfu / ml to 1 × ^{10 8} cfu / ml (Reed, L. et al., 1938, Amer., J. Hyg ., 27) was used to determine the survival probabilities and the dose was determined to be 2 × 10 ⁷ cfu / ml by intraperitoneal route. Clinical symptoms such as diarrhea and mortality were observed for 50 hours after challenge infection.

실시예 1. 후보 항원 단백질의 백신 균주에서의 발현 분석Example 1 Expression Analysis of Candidate Antigen Proteins in a Vaccine Strain

백신 균주 JOL1454, JOL1464, JOL1460 및 JOL1485는 각각 Stx2eB(9kDa), FedA(18kDa), FedF(32kDa) 및 FliC(62kDa)가 재조합된 고스트 벡터로 형질전환된 약독화 살모넬라 균주이다. 각 항원 단백질은 ompA 신호서열(약 15.3kDa)과 함께 발현이 되어 전체 단백질 크기는 Stx2eB는 24.3kDa, FedA는 33.3kDa, FedF는 47.3kDa 그리고 Flic는 77.3kDa가 되었다. 항원이 포함되지 않은 고스트 벡터를 가지고 있는 약독화 살모넬라 균주(JOL1487)를 음성 대조구(C)로 사용하였다. 각 백신 균주에서 항원 단백질의 발현 여부를 확인하기 위해 수행한 웨스턴 블랏 결과 도 1에서 확인되는 것처럼 모든 백신 균주에서 해당 항원 단백질의 발현이 확인되었다.
The vaccine strains JOL1454, JOL1464, JOL1460 and JOL1485 are attenuated Salmonella strains transformed with a ghost vector in which Stx2eB (9 kDa), FedA (18 kDa), FedF (32 kDa) and FliC (62 kDa) Each antigen protein was expressed with the ompA signal sequence (about 15.3 kDa), and the total protein sizes were 24.3 kDa for Stx2eB, 33.3 kDa for FedA, 47.3 kDa for FedF and 77.3 kDa for Flic. The attenuated Salmonella strain (JOL1487), which has a ghost vector with no antigen, was used as a negative control (C). As shown in FIG. 1, the expression of the corresponding antigen protein was confirmed in all the vaccine strains as a result of western blot performed to confirm the expression of the antigen protein in each vaccine strain.

실시예 2. 체액성 면역 반응 분석 - 개별 백신 투여 후 IgG 및 sIgA 분석Example 2. Humoral Immune Response Analysis - IgG and sIgA analysis after administration of individual vaccine

0주차와 2주차 두 번의 백신 투여 후 6주까지 측정된 혈청 내 IgG 와 sIgA의 역가를 비교하였다. 각 항원 특이적인 IgG의 역가는 Stx2eB, FedA 및 FedF 3개의 항원 모두에서 백신 투여 후 4주째부터 대조구와 비교하여 유의한 증가를 보여 주었다. 6주까지 높은 측정가로 지속되는 본 발명의 백신에 의한 항원 특이적인 IgG는 돼지 부종병의 예방을 위해 필수적인 섬모 관련 항원과 독소 관련 항원에 결합하는 중화항체의 생성가를 보여주었다. 반면에 점막 면역을 유도하는 sIgA(secretory IgA)의 역가는 백신 투여 후 2주차에 유의한 증가를 보여주었으나 부스터(booster) 백신 접종에도 불구하고 오래 지속되지 못하는 경향을 보여주었다(도 2).
Serum IgG and sIgA titers were measured at week 6 and week 2 after two vaccinations. The titers of each antigen-specific IgG showed a significant increase from the 4th week after the vaccination in all of the Stx2eB, FedA and FedF antigens compared to the control. The antigen-specific IgGs of the vaccine of the present invention, which persisted up to 6 weeks, showed the production of neutralizing antibodies that bind to ciliate-associated antigens and toxin-related antigens, which are essential for the prevention of swine swine disease. On the other hand, the reversal of sIgA (secretory IgA), which induces mucosal immunity, showed a significant increase at 2 weeks after the vaccination, but showed a tendency not to last long despite the booster vaccination (Fig. 2).

실시예 3. 체액성 면역 반응 분석 - 개별 백신 투여 후 IgG1과 IgG2a 분석Example 3. Analysis of humoral immune response - Analysis of IgG1 and IgG2a after administration of individual vaccine

항원을 발현하는 고스트 균주를 개별적으로 투여한 실험동물군에서 항원 특이적인 IgG1과 IgG2a를 ELISA를 이용하여 측정하였다. IgG1은 Th2 반응을, IgG2a는 Th1 반응의 효과를 규명하는데 사용되고 있으며, IgG1과 IgG2a의 비율로 Th1 반응과 Th2 반응 중 어느쪽에 더 편향된 반응을 보이는지를 확인할 수 있다. 0주와 2주차에 섬모군 항원 유전자(FedA, FedF)를 발현하는 고스트 백신을 접종한 실험동물군에서는 2주차, 4주차 및 6주차에서 IgG2a와 IgG1의 비율이 0.8-3.2 사이로 측정되었다. 이는 본 발명의 섬모군 항원 고스트 백신에 의해 균형잡힌 Th1 및 Th2 면역 반응이 유도되었음을 보여주는 것이며, 독소 유전자(Stx2eB)를 발현하는 고스트 백신 접종군의 경우 4주차까지는 약간의 Th1 면역 반응이 좀 더 발현되는 경향을 보이나, 6주차에 들어 Th1 및 Th2의 균형잡힌 면역 반응을 보여주었다(도 3). 또한 이 결과는 실시예 2에서 보여준 Th2 면역 반응으로 매개되는 Stx2eB 특이적인 IgG의 4주에서 6주사이에 확연한 증가를 보여주는 결과와 일치하고 있음을 알 수 있었다.
Antigen - specific IgG1 and IgG2a were measured by ELISA in the experimental animals group in which the ghost strains expressing the antigen were individually administered. IgG1 is used to detect the Th2 response, and IgG2a is used to determine the effect of the Th1 response. IgG1 and IgG2a show a more biased response to the Th1 and Th2 responses. The ratio of IgG2a to IgG1 was measured between 0.8-3.2 at the 2nd, 4th and 6th weeks in the experimental animals inoculated with the ghost vaccine expressing the primate antigen gene (FedA, FedF) at 0 and 2 weeks. This indicates that the Th1 and Th2 immune responses balanced by the islet-like group antigen ghost vaccine of the present invention were induced. In the case of the ghost vaccination group expressing the toxin gene (Stx2eB), slight Th1 immunoreactivity was expressed until 4th week , But showed a balanced immune response of Th1 and Th2 at 6 weeks (Fig. 3). This result also coincides with the results showing a marked increase in the amount of Stx2eB-specific IgG mediated by the Th2 immune response shown in Example 2 from 4 to 6 injections.

실시예 4. 체액성 면역 반응 분석 - 혼합 백신 투여 후 IgG 및 sIgA 분석Example 4. Humoral immune response assay - IgG and sIgA analysis after mixed vaccine administration

3개의 항원(Stx2eB, FedA 및 FedF)을 발현하는 고스트 백신에 FliC를 발현하는 고스트 백신을 혼합하여 0주차에 1회 접종한 경우와 0주차, 2주차에 두 번 접종한 경우의 항원 특이 항체 생성을 비교하였다. 그 결과, 혼합 백신을 2회 투여한 경우 개별 백신 투여와 비슷하게 항원 특이적인 IgG의 역가가 6주차까지 증가함을 관찰할 수 있었다(도 4A 및 4C). 하지만 혼합 백신을 1회 투여한 실험동물군에서 FedF 특이 IgG의 경우 6주차에 감소 경향이 나타났고 이는 충분한 면역지속 효과를 위해 부스터 접종이 필요함을 시사하였다. sIgA의 측정가에서는 실시예 2에서 관찰한 고스트 백신의 개별 투여 실험동물군에서 관찰된 sIgA의 양상과는 다르게 혼합백신 2회 접종 실험동물군에서는 항체의 역가가 6주차까지 유의하게 증가(P<0.05)함을 관찰하였다(도 4B 및 4D). 상기의 결과를 통해 본 발명의 혼합 백신을 투여하면 일차적인 방어 체계 역할로 담당하는 점막 면역의 활성화를 유도시켜, 백신 투여에 의해 유도되는 중화 항체와 더불어 돼지에서 부종병 감염시 체계적인 방어체계를 형성할 수 있음을 시사하였다.
A ghost vaccine expressing three antigens (Stx2eB, FedA, and FedF) was mixed with a ghost vaccine expressing FliC, and an antigen-specific antibody was generated when the vaccine was inoculated once at week 0 and twice at week 0 and week 2 Were compared. As a result, it was observed that when the mixed vaccine was administered twice, the activity of the antigen-specific IgG was increased to 6 weeks, similar to the administration of the individual vaccine (FIGS. 4A and 4C). However, FedF - specific IgG showed a decreasing tendency at 6th week in the experimental animal group administered once with mixed vaccine, suggesting that booster vaccination is necessary for sufficient immunosuppressive effect. Unlike sIgA observed in the individual experimental group of ghost vaccine observed in Example 2, the antibody value of sIgA was significantly increased (p <0.05 ) (Fig. 4B and 4D). The above results indicate that administration of the combined vaccine of the present invention induces activation of mucosal immunity, which serves as a primary defense system, to form a systematic defense system for swine infections in pigs, together with neutralizing antibodies induced by vaccine administration It is possible to do.

실시예 5. 면역 사이토카인 분석Example 5. Immunocytocin analysis

JOL1454(Stx2eB)를 단독으로, 그리고 JOL1464(FedA)와 JOL1460(FedF)를 합쳐서 각각 투여한 생쥐에서 분리한 지라세포를 각 항원 단백질로 자극하여 IL-4, INF-γ 그리고 TNF-α를 RT-PCR을 이용하여 측정하였다. 그 결과, Th2 반응을 매개하여 체액성 면역 반응을 유도하는 IL-4는 모든 개별 항원을 발현하는 고스트 백신을 투여한 실험동물군에서 약 3.0-6.0배가 넘게 발현되었고, 특히 FedF 백신을 투여한 실험동물 그룹에서는 대조구 그룹과 비교하여 약 6.3배의 높은 발현양을 보여주었다(도 5A). 또한 동일 그룹에서 Th1 반응을 매개하여 세포매개성 면역 반응을 유도하는 CD8+ T 세포의 이펙터(effector) 역할을 하는 INF-γ와 TNF-α는 전 그룹에서 대조구와 비교하여 약 1.0-4.5배 증가한 결과를 보여주었다. 이는 각각의 항원을 발현하는 고스트 백신 균주를 개별적으로 투여하여도 일정 수준 이상의 면역반응을 매개하는 사이토카인의 분비를 유도함을 보여주며, 사균 고스트 백신이 다른 약독화 생균 균주와 비교하여도 충분한 보호효과를 나타낸다는 것을 보여주었다. 또한, 3개 혼합 백신과 면역증강제를 포함한 4개 혼합 백신 투여 후, 사이토카인 측정 시, 위 개별항원 발현 고스트 백신 투여 후의 사이토카인 발현량과 비슷한 INF-γ와 TNF-α와 IL-4의 증가량이 관찰되었다. 상기의 결과를 통해 본 발명의 백신이 실험동물의 전반적인 면역체계를 자극시켜 체액성 및 세포성 면역을 유도할 수 있는 충분한 능력을 가지고 있음을 확인하였다.
IFN-γ and TNF-α were stimulated with each antigen protein in RT-immunized mice, which were isolated from mice treated with JOL1454 (Stx2eB) alone and with JOL1464 (FedA) and JOL1460 (FedF) PCR. As a result, IL-4, which induces a humoral immune response mediated by the Th2 response, was expressed in an amount of about 3.0-6.0 times that of the ghost vaccine in which all individual antigens were expressed. In particular, In the animal group, the expression level was about 6.3 times higher than that in the control group (Fig. 5A). In addition, INF-γ and TNF-α, which act as effectors of CD8 + T cells that mediate the Th1 response and induce a cell-mediated immune response in the same group, increased about 1.0-4.5 times compared with the control in all groups Respectively. This indicates that even when the ghost vaccine strains expressing the respective antigens are separately administered, the secretion of cytokines mediating a certain level of the immune response is induced, and even when the dead ghost vaccine is compared with other attenuated strains, . In addition, the increase in the amount of INF-γ, TNF-α and IL-4, which is similar to the amount of cytokine released after the administration of the above-mentioned individual antigen-expressing ghost vaccine, in the case of cytokine measurement after administration of the four combination vaccines including three combined vaccines and immunostimulants Respectively. From the above results, it was confirmed that the vaccine of the present invention has sufficient ability to induce humoral and cellular immunity by stimulating the overall immune system of an experimental animal.

실시예 6. 백신 투여에 따른 T 세포 분화 정도 분석Example 6. Analysis of T cell differentiation according to vaccine administration

JOL1454(Stx2eB) 단독 투여군, JOL1464(FedA)+JOL1460(FedF) 혼합 투여군, JOL1454+JOL1464+JOL1460 혼합 투여군 및 JOL1454+JOL1464+JOL1460+JOL1485(FliC) 혼합 투여군으로 그룹을 나누어 백신을 실험동물에 투여한 10일 후, 각 실험동물로부터 지라세포를 분리하고 T 세포 집단의 증가를 보기위하여, 전체 T 세포에서 발현하는 CD3와 Th1, Th2, Th17 그룹으로 분화되는 CD4+ T 세포의 증가량을 대조구와 비교하여 FACS 분석하였다. 모든 그룹에서 20% 이상의 T 세포(CD3+) 증가량이 관찰되었고 그중 CD4+ T 세포 집단도 모든 그룹에서 20% 이상 증가되었음을 확인하였다(도 6). 이를 통해 본 발명의 백신이 T 세포 집단의 증가 뿐만 아니라 체액성 및 세포 매개성 면역 반응을 유도하는 CD3+CD4+ T 세포 집단의 증가도 유도함을 알 수 있었다.
The vaccine was administered to experimental animals in groups of JOL1454 (Stx2eB) alone, JOL1464 (FedA) + JOL1460 (FedF) mixed administration group, JOL1454 + JOL1464 + JOL1460 mixed administration group and JOL1454 + JOL1464 + JOL1460 + JOL1485 (FliC) After 10 days, the growth of CD4 + T cells differentiated into CD3 and Th1, Th2, and Th17 groups expressed in all T cells was compared with that of the control, in order to separate splenocytes from each experimental animal and to show increase in T cell population. FACS Respectively. More than 20% increase in T cells (CD3 +) was observed in all groups, and CD4 + T cell population was increased by more than 20% in all groups (FIG. 6). This indicates that the vaccine of the present invention induces not only an increase in the T cell population but also an increase in the CD3 + CD4 + T cell population which induces humoral and cell mediated immune responses.

실시예 7. MTT 분석Example 7. MTT assay

JOL1454(Stx2eB) 단독 투여, JOL1464(FedA)+JOL1460(FedF) 혼합 투여 또는 JOL1454+JOL1464+JOL1460+JOL1485(FliC) 혼합 투여 실험동물군에서 분리한 지라세포를 각각의 항원 단백질로 자극하여 분화시킨 세포를, 대조구 실험동물군에서 분리하여 같은 항원 단백질로 자극시켜 분화시킨 세포와의 MTT 분석을 통해 세포 생존율을 비교하였다. 백신을 투여한 세 실험동물군 모두에서 대조구와 비교하여 1.8-4배 이상 높은 세포 생존율을 보여주었다(도 7). 이는 백신을 투여한 실험동물군의 T 세포가 항원 단백질로 자극 시 증식하였다는 것을 의미하며, 본 발명의 백신이 T 세포 증식에 의한 면역 반응 유도 효과가 있음을 보여주는 것이다.
A mixture of JOL1454 (Stx2eB) alone, JOL1464 (FedA) + JOL1460 (FedF) mixture or JOL1454 + JOL1464 + JOL1460 + JOL1485 (FliC) Were isolated from the control experimental animal group, and cell viability was compared by MTT assay with cells differentiated by stimulation with the same antigen protein. The cell survival rate was 1.8-4 times higher than that of the control group in all of the experimental animals to which the vaccine was administered (FIG. 7). This means that the T cells of the experimental animal group to which the vaccine was administered proliferated upon stimulation with the antigen protein, showing that the vaccine of the present invention has an immune response inducing effect by T cell proliferation.

실시예 8. 준치사량(sublethal dose)으로 도전 감염 시 백신 효과 분석Example 8. Analysis of Vaccine Effect on Challenge Infection with Sublethal Dose

임상 증상은 충분히 유발하지만 사망을 초래하지 않는 준치사량으로 도전 감염시 실험동물군의 변화를 관찰하였다. 1X10⁶ CFU/ml의 준치사량으로 실험동물을 도전 감염한 후 10일 동안 임상증상과 체중 변화를 관찰하였다. 그 결과, 모든 그룹에서 도전 감염후 3일 동안 움직임의 감소, 식욕 감퇴, 설사, 털 빠짐 증상이 관찰 되었다. 하지만 FedA와 FedF를 발현시키는 고스트 백신 균주를 0주와 2주차에 두 번 접종한 후 4주차에 도전 감염을 한 그룹군과, Stx2eB를 발현하는 고스트 백신 균주를 같은 방식으로 접종한 그룹군에서는 도전 감염 3일후에 감소되던 체중이 약 99%까지 다시 회복되었고(도 8), 움직임과 식욕이 증가하였으며 털 빠짐도 감소하였다. 대조적으로 대조구 그룹군은 도전 감염후 9일후까지도 움직임은 증가하였으나 식욕은 여전히 감소추세에 있었고 약 95%의 몸무게 회복율을 보였다. 이는 본 발명의 백신 접종이 사망을 이르게 하는 치사량이 아닌 임상 증상을 발현하는 정도인 준치사량에서 충분한 면역력과 방어능력을 보임을 알수 있었다.
Changes in experimental animals were observed when challenged with sub - lethal doses that caused sufficient clinical symptoms but did not cause death. Clinical symptoms and weight changes were observed for 10 days after challenging the experimental animals with sub-lethal dose of 1 × 10 ⁶ CFU / ml. As a result, all groups showed decreased motion, loss of appetite, diarrhea, and hair loss after 3 days of challenge. However, in the group inoculated with the group of challenge infections at 4th week and the group of ghost vaccine expressing Stx2eB in the same manner after the inoculation of the ghost vaccine strain expressing FedA and FedF twice at week 0 and 2, The decreased body weight after 3 days of infection was restored to about 99% (Fig. 8), and the movement and appetite increased, and hair loss decreased. In contrast, the control group showed increased motility even after 9 days of challenge, but appetite was still decreasing and showed a recovery rate of about 95%. It was found that the vaccination of the present invention showed sufficient immunity and defense ability in the sub-lethal dose, which is the degree of clinical symptoms rather than the lethal dose leading to death.

실시예 9. 반수치사량(lethal dose 50)으로 도전 감염 시 백신 효과Example 9. Vaccine effect on conductive infection with lethal dose 50

JOL1454(Stx2eB)+JOL1464(FedA)+JOL1460(FedF) 혼합 백신 및 JOL1454+JOL1464+JOL1460+JOL1485(FliC) 혼합 백신 접종 6주후 실험동물에 STEC 야외균주(JOL654)의 반수치사량으로 도전 감염 시킨 후 실험 동물의 생존율을 확인하였다.After 6 weeks of mixed vaccination with JOL1454 (Stx2eB) + JOL1464 (FedA) + JOL1460 (FedF) mixed vaccine and JOL1454 + JOL1464 + JOL1460 + JOL1485 (FliC), the experiment animals were challenged with half of the STEC outdoor strain (JOL654) The survival rate of the animals was confirmed.

그 결과, 3개 항원 혼합 백신 투여 실험에서는 반수치사량으로 도전 감염 시대조구 실험동물군은 60%의 생존율을, 항원을 발현하는 고스트 백신 균주 3개를 1X10⁸ cfu/ml로 한 번 투여한 실험동물군은 91.7%의 생존율을, 그리고 고스트 백신 균주 3개를 0주차와 2주차에 두 번 투여한 실험동물군에서는 92.3%의 생존율을 보여주었다(도 9A).As a result, the survival rate of 60% in the experimental animal group of the challenge stage and 3 x ^{10 8} cfu / ml of the ghost vaccine strain expressing the antigen were administered once in a half lethal dose, The survival rate of the group was 91.7%, and the survival rate of the ghost vaccine strain was 92.3% in the experimental animals administered twice at 0 and 2 weeks (FIG. 9A).

또한, 3개 항원 및 FliC 항원의 혼합 백신 투여 실험에서는 반수치사량으로 도전 감염 시 대조구 실험동물군은 53.3%(7/15)의 생존률을 보여주었다. FliC 항원과 다른 3개의 항원을 발현하는 고스트 백신 균주를 1X10⁸ cfu/ml로 한 번 투여한 실험동물군은 86.6%(13/15)의 생존율을 보여주었고, 0주차와 2주차에 두 번 투여한 실험동물군은 100%(15/15)의 생존율을 나타냈다(도 9B). 이는 실험동물의 야외균주 감염 시 본 발명의 고스트 백신 균주의 보호 효과를 확실하게 보여주는 것이었다.In addition, in the mixed vaccine administration experiment of three antigens and FliC antigens, the survival rate of the control experimental animal group was 53.3% (7/15) at the half-life lethal dose. The survival rate was 86.6% (13/15) in the experimental group treated with 1 × ^{10 8} cfu / ml of the ghost vaccine strain expressing the FliC antigen and the other three antigens. One experimental animal group had a survival rate of 100% (15/15) (FIG. 9B). This clearly shows the protective effect of the ghost vaccine strain of the present invention in the case of an outdoor strain of an experimental animal.

또한, 상기 3개 항원 및 FliC 항원의 혼합 백신 투여 실험에서 도전 감염 4주 후 생존한 실험동물을 대상으로 각 3마리씩 희생시켜 소장을 샘플링하여 무게를 잰후 1:5의 비율로 PBS로 균질화시키고 EMB(Eosin methylene blue) 고체 배지에 배양하여 도전 감염 균주를 회복시켰다. 그 결과, 대조구 그룹은 약 2,000 cfu/ml의 도전 감염 균주가 회복된 반면, 백신을 한 번 접종한 그룹과 두 번 접종한 그룹은 각각 평균적으로 약 350 cfu/ml 및 20 cfu/ml의 도전 감염 균주가 회복된 것을 관찰하였다(도 10). 이는 본 발명의 백신 접종이 도전 감염 균주 제거(clearance)에 유의적으로 작용한다는 것을 의미하였다.In addition, in the mixed vaccine administration of the three antigens and FliC antigens, three animals were sacrificed after 4 weeks of challenge infection, and the small intestine was sampled, weighed, and homogenized with PBS at a ratio of 1: 5, (Eosin methylene blue) solid medium to recover the challenged strain. As a result, the control group recovered about 2,000 cfu / ml of the challenge-infected strain while the vaccine-once and twice-inoculated groups achieved an average of about 350 cfu / ml and 20 cfu / ml challenge infections, respectively The strain was observed to recover (Fig. 10). This meant that the vaccination of the present invention was significant for the challenge of clearance of challenge infectious strains.

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Vaccine composition for preventing or treating porcine edema disease comprising ghost Salmonella mutant expressing Enterotoxigenic Escherichia coli antigen as effective component <130> PN15407 <160> 16 <170> KopatentIn 2.0 <210> 1 <211> 86 <212> PRT <213> Escherichia coli <400> 1 Lys Lys Met Phe Ile Ala Val Leu Phe Ala Leu Val Ser Val Asn Ala 1 5 10 15 Met Ala Ala Asp Cys Ala Lys Gly Lys Ile Glu Phe Ser Lys Tyr Asn 20 25 30 Glu Asp Asn Thr Phe Thr Val Lys Val Ser Gly Arg Glu Tyr Trp Thr 35 40 45 Asn Arg Trp Asn Leu Gln Pro Leu Leu Gln Ser Ala Gln Leu Thr Gly 50 55 60 Met Thr Val Thr Ile Ile Ser Asn Thr Cys Ser Ser Gly Ser Gly Phe 65 70 75 80 Ala Gln Val Lys Phe Asn 85 <210> 2 <211> 149 <212> PRT <213> Escherichia coli <400> 2 Gln Gln Gly Asp Val Lys Phe Phe Gly Asn Val Ser Ala Thr Thr Cys 1 5 10 15 Asn Leu Thr Pro Gln Ile Ser Gly Thr Val Gly Asp Thr Ile Gln Leu 20 25 30 Gly Thr Val Ala Pro Ser Gly Ala Gly Arg Glu Ile Pro Phe Ala Leu 35 40 45 Lys Ala Ser Ser Asn Val Gly Gly Cys Ala Ser Leu Ser Thr Lys Thr 50 55 60 Ala Asp Ile Thr Trp Ser Gly Gln Leu Thr Glu Lys Gly Phe Ala Asn 65 70 75 80 Gln Gly Gly Val Ala Asn Asp Ser Tyr Val Ala Leu Lys Thr Val Asn 85 90 95 Gly Lys Thr Gln Gly Gln Glu Val Lys Ala Ser Asn Ser Thr Val Ser 100 105 110 Phe Asp Ala Ser Lys Ala Thr Thr Asp Gly Phe Lys Phe Thr Ala Gln 115 120 125 Leu Lys Gly Gly Gln Thr Pro Gly Asp Phe Gln Gly Ala Ala Ala Tyr 130 135 140 Ala Val Thr Tyr Lys 145 <210> 3 <211> 281 <212> PRT <213> Escherichia coli <400> 3 Ala Ser Thr Leu Gln Val Asp Lys Ser Val Ser Tyr Asp Trp Ile Asn 1 5 10 15 Ser Ser Ala Ser Ser Ala Gln Val Thr Gly Thr Leu Leu Gly Thr Gly 20 25 30 Lys Thr Asn Thr Thr Gln Met Pro Ala Leu Tyr Thr Trp Gln His Lys 35 40 45 Ile Tyr Asn Val Asn Phe Ile Pro Ser Ser Ser Gly Thr Leu Thr Cys 50 55 60 Gln Ala Gly Thr Ile Leu Val Trp Lys Gly Gly Arg Glu Thr Gln Tyr 65 70 75 80 Ala Leu Glu Cys Arg Val Ser Ile His His Ser Ser Gly Ser Ile Asn 85 90 95 Glu Ser Gln Trp Gly Gln Gln Ser Gln Val Gly Phe Gly Thr Ala Cys 100 105 110 Gly Thr Lys Lys Cys Arg Phe Thr Gly Phe Glu Ile Ser Leu Arg Ile 115 120 125 Pro Pro Asn Ala Gln Thr Tyr Pro Leu Ser Ser Gly Asp Leu Lys Gly 130 135 140 Ser Phe Ser Leu Thr Asn Lys Glu Val Asn Trp Ser Ala Ser Ile Tyr 145 150 155 160 Val Pro Ala Ile Ala Lys Ser Tyr Arg Leu Asp Thr Ser Ile Thr Leu 165 170 175 Pro Asp Thr Val Asn Leu Lys Gln Asn Gln Ala Thr Pro Val Tyr Tyr 180 185 190 Thr Phe Ser Ala Pro Ser Val Ser Asn Thr Ile Thr Gly Ile Pro Asn 195 200 205 Gln Asn Asp Met Pro Ser Ser Asn Val Lys Leu Thr Ile Gly Pro Ile 210 215 220 Gln Ser Lys Thr Thr Ala Leu Tyr Val Gln Pro Asp Ala Thr Gly Ser 225 230 235 240 Trp Tyr Asp Leu Ser Lys Ser Ile Thr Met Thr Val Val Lys Ser Ser 245 250 255 Met Leu Asn Phe Lys Gly Ile Asn Ala Lys Pro Gly Asn Val Thr Leu 260 265 270 Ser Val Pro Ile Val Phe Glu Ile Gln 275 280 <210> 4 <211> 562 <212> PRT <213> Escherichia coli <400> 4 Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Ile Thr Gln Asn Asn 1 5 10 15 Ile Asn Lys Asn Gln Ser Ala Leu Ser Ser Ser Ile Glu Arg Leu Ser 20 25 30 Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln Ala 35 40 45 Ile Ala Asn Arg Phe Thr Ser Asn Ile Lys Gly Leu Thr Gln Ala Ala 50 55 60 Arg Asn Ala Asn Asp Gly Ile Ser Val Ala Gln Thr Thr Glu Gly Ala 65 70 75 80 Leu Ser Glu Ile Asn Asn Asn Leu Gln Arg Val Arg Glu Leu Thr Val 85 90 95 Gln Ala Thr Thr Gly Thr Asn Ser Gln Ser Asp Leu Asp Ser Ile Gln 100 105 110 Asp Glu Ile Lys Ser Arg Leu Asp Glu Ile Asp Arg Val Ser Gly Gln 115 120 125 Thr Gln Phe Asn Gly Val Asn Val Leu Ala Lys Asp Gly Ser Met Lys 130 135 140 Ile Gln Val Gly Ala Asn Asp Gly Gln Thr Ile Thr Ile Asp Leu Lys 145 150 155 160 Lys Ile Asp Ser Ser Thr Leu Asn Leu Thr Gly Phe Asn Val Asn Gly 165 170 175 Ser Gly Ser Val Ala Asn Thr Ala Ala Thr Lys Ala Asp Leu Thr Ala 180 185 190 Ala Gln Leu Ser Ala Pro Gly Ala Ala Asp Ala Asn Gly Thr Val Thr 195 200 205 Tyr Thr Val Ser Ala Gly Tyr Lys Glu Ser Thr Ala Ala Asp Val Ile 210 215 220 Ala Ser Ile Lys Asp Gly Ser Ala Pro Thr Ser Ala Ile Thr Ala Thr 225 230 235 240 Ile Asn Asn Gly Phe Gly Asp Ser Ser Ala Leu Thr Ser Asn Asp Tyr 245 250 255 Thr Tyr Asp Pro Ala Lys Gly Asp Phe Thr Tyr Asp Val Ala Ser Ser 260 265 270 Ala Asn Asn Thr Ala Ala Gln Val Gln Ser Phe Leu Thr Pro Lys Ala 275 280 285 Gly Asp Thr Ala Asn Leu Lys Val Thr Val Gly Thr Thr Ser Val Asp 290 295 300 Val Val Leu Ala Ser Asp Gly Lys Ile Thr Ala Lys Asp Gly Ser Ala 305 310 315 320 Leu Tyr Ile Asp Ser Thr Gly Asn Leu Thr Gln Asn Ser Ala Gly Leu 325 330 335 Thr Ser Ala Lys Leu Ala Thr Leu Thr Gly Leu Gln Gly Ser Gly Val 340 345 350 Ala Ser Thr Ile Thr Thr Glu Asp Gly Thr Asn Ile Asp Ile Ala Ala 355 360 365 Asn Gly Asn Ile Gly Leu Thr Gly Val Arg Ile Ser Ala Asp Ser Leu 370 375 380 Gln Ser Ala Thr Lys Ser Thr Gly Phe Thr Val Gly Thr Gly Ala Thr 385 390 395 400 Gly Leu Thr Val Gly Thr Asp Gly Lys Val Thr Ile Gly Gly Thr Thr 405 410 415 Ala Gln Ser Tyr Thr Ser Lys Asp Gly Ser Leu Thr Thr Asp Asn Thr 420 425 430 Thr Lys Leu Tyr Leu Gln Lys Asp Gly Ser Val Thr Asn Gly Ser Gly 435 440 445 Lys Ala Val Tyr Val Glu Ala Asp Gly Asp Phe Thr Thr Asp Ala Ala 450 455 460 Thr Lys Ala Ala Thr Thr Thr Asp Pro Leu Lys Ala Leu Asp Glu Ala 465 470 475 480 Ile Ser Gln Ile Asp Lys Phe Arg Ser Ser Leu Gly Ala Ile Gln Asn 485 490 495 Arg Leu Asp Ser Ala Val Thr Asn Leu Asn Asn Thr Thr Thr Asn Leu 500 505 510 Ser Glu Ala Gln Ser Arg Ile Gln Asp Ala Asp Tyr Ala Thr Glu Val 515 520 525 Ser Asn Met Ser Lys Ala Gln Ile Ile Gln Gln Ala Gly Asn Ser Val 530 535 540 Leu Ala Lys Ala Asn Gln Val Pro Gln Gln Val Leu Ser Leu Leu Gln 545 550 555 560 Gly Pro <210> 5 <211> 261 <212> DNA <213> Escherichia coli <400> 5 aagaagatgt ttatagcggt tttatttgca ttggtttctg ttaatgcaat ggcggcggat 60 tgtgctaaag gtaaaattga gttttccaag tataatgagg ataatacctt tactgtgaag 120 gtgtcaggaa gagaatactg gacgaacaga tggaatttgc agccattgtt acaaagtgct 180 cagctgacag ggatgactgt aacaatcata tctaatacct gcagttcagg ctcaggcttt 240 gcccaggtga agtttaactg a 261 <210> 6 <211> 450 <212> DNA <213> Escherichia coli <400> 6 cagcaagggg atgttaaatt ctttggtaac gtatcagcaa ctacctgtaa tttgacacca 60 caaataagtg gcactgtagg agataccatt cagcttggta ctgttgcacc aagcggagct 120 ggtcgtgaaa ttccttttgc actgaaggct tcttcaaatg ttggcggttg tgcttccttg 180 tccactaaaa cagctgatat aacttggagc gggcagttaa ccgaaaaagg ttttgctaat 240 caaggggggg tggcaaatga ttcatatgtc gctctgaaaa ccgtgaacgg taaaacacag 300 gggcaggagg ttaaggcgtc gaatagcact gtaagtttcg atgcatcaaa agcaactacg 360 gatggtttca aatttactgc tcaactgaaa ggtggtcaaa ccccgggtga cttccagggg 420 gcagcggctt acgcggttac ttacaagtaa 450 <210> 7 <211> 846 <212> DNA <213> Escherichia coli <400> 7 gcgtctactc tacaagtaga caagtctgtt tcatacgact ggatcaattc tagtgcgagt 60 agtgctcaag tcacaggaac acttcttggc acagggaaga caaacactac ccaaatgcca 120 gctctgtata cgtggcagca taaaatctac aatgttaatt tcattcctag ttcatcagga 180 actttgacat gccaggctgg aactattttg gtatggaaag gtgggcgcga aacccaatat 240 gcgctcgagt gtcgtgtgag cattcaccat agttctggct ccattaatga atctcagtgg 300 gggcaacagt cacaagtagg attcggtaca gcatgtggaa ctaaaaaatg tcgatttact 360 ggttttgaga tctctttacg tattcctcct aatgctcaga catatcccct ttcttccggt 420 gatctaaaag gaagtttttc cttaaccaac aaggaggtca actggtctgc ttcaatctat 480 gttcctgcga ttgcaaaatc ttatagacta gacacgtcaa taacactacc agataccgtg 540 aatttaaaac aaaaccaagc tacgcctgtt tattatacat tttcagcacc tagcgtttca 600 aatactatta cagggatccc caaccaaaat gatatgcctt catctaatgt caaacttacc 660 atagggccga tccaatccaa aacaactgct ctttatgtgc agcccgatgc aacaggctcg 720 tggtatgatt tgtctaagag cataacaatg acagtagtaa aatccagtat gctcaacttc 780 aaaggaatta acgcaaaacc aggcaatgtt acattgtcgg tgcccattgt tttcgagata 840 cagtaa 846 <210> 8 <211> 1689 <212> DNA <213> Escherichia coli <400> 8 gcacaagtca ttaataccaa cagcctctcg ctgatcactc aaaataatat caacaagaac 60 cagtctgcgc tgtcgagttc tatcgagcgt ctgtcttctg gcttgcgtat taacagcgcg 120 aaggatgacg ccgcaggtca ggcgattgct aaccgtttta cttctaacat taaaggcctg 180 actcaggctg cacgtaacgc caacgacggt atttctgttg cacagaccac tgaaggcgcg 240 ctgtccgaaa tcaacaacaa cttacagcgt gtgcgtgaac tgaccgttca ggcaaccacc 300 ggtaccaact cccagtctga cctggactct atccaggacg aaattaaatc ccgtctggac 360 gaaattgatc gcgtatccgg tcagacccag ttcaacggcg tgaacgtgct ggcaaaagac 420 ggttccatga aaattcaggt tggcgcgaac gatggccaga ccatcactat cgacctgaag 480 aagattgact cttctacctt gaacctgaca ggttttaacg ttaacggttc tggttctgtg 540 gcgaatactg cagcaactaa agctgattta accgctgctc aactctctgc accgggtgca 600 gcagacgcaa atggtacagt tacttatact gtcagtgctg gttataaaga atccactgct 660 gcagatgtta ttgctagcat caaagacggc agtgctccga cttctgcaat tactgcaacc 720 attaataatg gcttcggtga ttccagtgcg ctgacttcca atgactatac ttatgaccca 780 gcaaaaggcg acttcactta cgacgtagct tcaagcgcca ataatactgc tgcccaggtt 840 cagtctttcc tgacgccgaa agcaggtgat accgcaaatc tgaaagtaac cgttggtacg 900 acatcggttg atgtcgttct ggccagtgat ggtaagatta cagcaaaaga tggttctgca 960 ttatatatcg acagtacagg taacctgact cagaacagtg ctggcttgac ctctgctaaa 1020 ctggctactc tgactggcct tcagggctct ggtgttgctt caaccatcac tactgaagat 1080 ggcactaata ttgatattgc tgctaacggt aatattggtc tgaccggtgt tcgtatcagt 1140 gctgattctc tgcagtcagc gactaaatct acgggcttta ctgttggtac tggcgctaca 1200 ggtctgaccg taggtactga tggtaaagtg actatcggcg ggactactgc tcagtcctac 1260 accagcaaag atggttccct gactactgat aacaccacta aactgtatct gcagaaagat 1320 ggctctgtaa ccaacggttc aggtaaagcg gtctatgtag aagcggatgg tgatttcact 1380 accgacgctg caaccaaagc cgcaaccacc accgatccgc tgaaagccct ggatgaggca 1440 atcagccaga tcgataagtt ccgttcatcc ctgggtgcta tccagaaccg tctggattcc 1500 gcggtcacca acctgaacaa caccactacc aacctgtctg aagcgcagtc ccgtattcag 1560 gacgccgact atgcgaccga agtgtccaac atgtcgaaag cgcagatcat tcagcaggcc 1620 ggtaactccg tgctggcaaa agccaaccag gtaccgcaac aggttctgtc tctgctgcag 1680 ggtccataa 1689 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccgccaattc aagaagatgt ttatggcg 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ccgcaagctt gtcattatta aactgcac 28 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccgcgaattc cagcaagggg atgttaaat 29 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccgcaagctt gatgattact tgtaagta 28 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ccgcgaattc gcgtctactc tacaagta 28 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ccgcaagctt ttactgtatc tcgaaaacaa 30 <210> 15 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ccgcgaattc gcacaagtca ttaataccaa cagc 34 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccgcaagctt ttaaccctgc agcagagaca gaac 34 <110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Vaccine composition for preventing or treating porcine edema disease comprising ghost Salmonella mutant expressing Enterotoxigenic Escherichia coli antigen as effective component <130> PN15407 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 86 <212> PRT <213> Escherichia coli <400> 1 Lys Lys Met Phe Ile Ala Val Leu Phe Ala Leu Val Ser Val Asn Ala 1 5 10 15 Met Ala Ala Asp Cys Ala Lys Gly Lys Ile Glu Phe Ser Lys Tyr Asn 20 25 30 Glu Asp Asn Thr Phe Thr Val Lys Val Ser Gly Arg Glu Tyr Trp Thr 35 40 45 Asn Arg Trp Asn Leu Gln Pro Leu Leu Gln Ser Ala Gln Leu Thr Gly 50 55 60 Met Thr Val Thr Ile Ile Ser Asn Thr Cys Ser Ser Gly Ser Gly Phe 65 70 75 80 Ala Gln Val Lys Phe Asn 85 <210> 2 <211> 149 <212> PRT <213> Escherichia coli <400> 2 Gln Gln Gly Asp Val Lys Phe Phe Gly Asn Val Ser Ala Thr Thr Cys 1 5 10 15 Asn Leu Thr Pro Gln Ile Ser Gly Thr Val Gly Asp Thr Ile Gln Leu 20 25 30 Gly Thr Val Ala Pro Ser Gly Ala Gly Arg Glu Ile Pro Phe Ala Leu 35 40 45 Lys Ala Ser Ser Asn Val Gly Gly Cys Ala Ser Leu Ser Thr Lys Thr 50 55 60 Ala Asp Ile Thr Trp Ser Gly Gln Leu Thr Glu Lys Gly Phe Ala Asn 65 70 75 80 Gln Gly Gly Val Ala Asn Asp Ser Tyr Val Ala Leu Lys Thr Val Asn 85 90 95 Gly Lys Thr Gln Gly Gln Glu Val Lys Ala Ser Asn Ser Thr Val Ser 100 105 110 Phe Asp Ala Ser Lys Ala Thr Thr Asp Gly Phe Lys Phe Thr Ala Gln 115 120 125 Leu Lys Gly Gly Gly Gly Thr Gly Asp Gly Gly Aly Ala Ala Tyr 130 135 140 Ala Val Thr Tyr Lys 145 <210> 3 <211> 281 <212> PRT <213> Escherichia coli <400> 3 Ala Ser Thr Leu Gln Val Asp Lys Ser Val Ser Tyr Asp Trp Ile Asn 1 5 10 15 Ser Ser Ala Ser Ser Ala Gln Val Thr Gly Thr Leu Leu Gly Thr Gly 20 25 30 Lys Thr Asn Thr Thr Gln Met Pro Ala Leu Tyr Thr Trp Gln His Lys 35 40 45 Ile Tyr Asn Val Asn Phe Ile Pro Ser Ser Ser Gly Thr Leu Thr Cys 50 55 60 Gln Ala Gly Thr Ile Leu Val Trp Lys Gly Gly Arg Glu Thr Gln Tyr 65 70 75 80 Ala Leu Glu Cys Arg Val Ser Ile His His Ser Ser Gly Ser Ile Asn 85 90 95 Glu Ser Gln Trp Gly Gln Gln Ser Gln Val Gly Phe Gly Thr Ala Cys 100 105 110 Gly Thr Lys Lys Cys Arg Phe Thr Gly Phe Glu Ile Ser Leu Arg Ile 115 120 125 Pro Pro Asn Ala Gln Thr Tyr Pro Leu Ser Ser Gly Asp Leu Lys Gly 130 135 140 Ser Phe Ser Leu Thr Asn Lys Glu Val Asn Trp Ser Ala Ser Ile Tyr 145 150 155 160 Val Pro Ala Ile Ala Lys Ser Tyr Arg Leu Asp Thr Ser Ile Thr Leu 165 170 175 Pro Asp Thr Val Asn Leu Lys Gln Asn Gln Ala Thr Pro Val Tyr Tyr 180 185 190 Thr Phe Ser Ala Pro Ser Val Ser Asn Thr Ile Thr Gly Ile Pro Asn 195 200 205 Gln Asn Asp Met Pro Ser Ser Asn Val Lys Leu Thr Ile Gly Pro Ile 210 215 220 Gln Ser Lys Thr Thr Ala Leu Tyr Val Gln Pro Asp Ala Thr Gly Ser 225 230 235 240 Trp Tyr Asp Leu Ser Lys Ser Ile Thr Met Thr Val Val Ser Ser 245 250 255 Met Leu Asn Phe Lys Gly Ile Asn Ala Lys Pro Gly Asn Val Thr Leu 260 265 270 Ser Val Pro Ile Val Phe Glu Ile Gln 275 280 <210> 4 <211> 562 <212> PRT <213> Escherichia coli <400> 4 Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Ile Thr Gln Asn Asn 1 5 10 15 Ile Asn Lys Asn Gln Ser Ala Leu Ser Ser Ser Ile Glu Arg Leu Ser 20 25 30 Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln Ala 35 40 45 Ile Ala Asn Arg Phe Thr Ser Asn Ile Lys Gly Leu Thr Gln Ala Ala 50 55 60 Arg Asn Ala Asn Asp Gly Ile Ser Val Ala Gln Thr Thr Glu Gly Ala 65 70 75 80 Leu Ser Glu Ile Asn Asn Asn Leu Gln Arg Val Val Glu Leu Thr Val 85 90 95 Gln Ala Thr Thr Gly Thr Asn Ser Gln Ser Asp Leu Asp Ser Ile Gln 100 105 110 Asp Glu Ile Lys Ser Arg Leu Asp Glu Ile Asp Arg Val Ser Gly Gln 115 120 125 Thr Gln Phe Asn Gly Val Asn Val Leu Ala Lys Asp Gly Ser Met Lys 130 135 140 Ile Gln Val Gly Ala Asn Asp Gly Gln Thr Ile Thr Ile Asp Leu Lys 145 150 155 160 Lys Ile Asp Ser Ser Thr Leu Asn Leu Thr Gly Phe Asn Val Asn Gly 165 170 175 Ser Gly Ser Val Ala Asn Thr Ala Ala Thr Lys Ala Asp Leu Thr Ala 180 185 190 Ala Gln Leu Ser Ala Pro Gly Ala Ala Asp Ala Asn Gly Thr Val Thr 195 200 205 Tyr Thr Val Ser Ala Gly Tyr Lys Glu Ser Thr Ala Ala Asp Val Ile 210 215 220 Ala Ser Ile Lys Asp Gly Ser Ala Pro Thr Ser Ala Ile Thr Ala Thr 225 230 235 240 Ile Asn Asn Gly Phe Gly Asp Ser Ser Ala Leu Thr Ser Asn Asp Tyr 245 250 255 Thr Tyr Asp Pro Ala Lys Gly Asp Phe Thr Tyr Asp Val Ala Ser Ser 260 265 270 Ala Asn Asn Thr Ala Gln Val Gln Ser Phe Leu Thr Pro Lys Ala 275 280 285 Gly Asp Thr Ala Asn Leu Lys Val Thr Val Gly Thr Thr Ser Val Asp 290 295 300 Val Val Leu Ala Ser Asp Gly Lys Ile Thr Ala Lys Asp Gly Ser Ala 305 310 315 320 Leu Tyr Ile Asp Ser Thr Gly Asn Leu Thr Gln Asn Ser Ala Gly Leu 325 330 335 Thr Ser Ala Lys Leu Ala Thr Leu Thr Gly Leu Gln Gly Ser Gly Val 340 345 350 Ala Ser Thr Ile Thr Thr Glu Asp Gly Thr Asn Ile Asp Ile Ala Ala 355 360 365 Asn Gly Asn Ile Gly Leu Thr Gly Val Ile Ser Ala Asp Ser Leu 370 375 380 Gln Ser Ala Thr Lys Ser Thr Gly Phe Thr Val Gly Thr Gly Ala Thr 385 390 395 400 Gly Leu Thr Val Gly Thr Asp Gly Lys Val Thr Ile Gly Gly Thr Thr 405 410 415 Ala Gln Ser Tyr Thr Ser Lys Asp Gly Ser Leu Thr Thr Asp Asn Thr 420 425 430 Thr Lys Leu Tyr Leu Gln Lys Asp Gly Ser Val Thr Asn Gly Ser Gly 435 440 445 Lys Ala Val Tyr Val Glu Ala Asp Gly Asp Phe Thr Thr Asp Ala Ala 450 455 460 Thr Lys Ala Ala Thr Thr Thr Asp Pro Leu Lys Ala Leu Asp Glu Ala 465 470 475 480 Ile Ser Gln Ile Asp Lys Phe Arg Ser Ser Leu Gly Ala Ile Gln Asn 485 490 495 Arg Leu Asp Ser Ala Val Thr Asn Leu Asn Asn Thr Thr Thr Asn Leu 500 505 510 Ser Glu Ala Gln Ser Arg Ile Gln Asp Ala Asp Tyr Ala Thr Glu Val 515 520 525 Ser Asn Met Ser Lys Ala Gln Ile Ile Gln Gln Ala Gly Asn Ser Val 530 535 540 Leu Ala Lys Ala Asn Gln Val Pro Gln Gln Val Leu Ser Leu Leu Gln 545 550 555 560 Gly Pro <210> 5 <211> 261 <212> DNA <213> Escherichia coli <400> 5 aagaagatgt ttatagcggt tttatttgca ttggtttctg ttaatgcaat ggcggcggat 60 tgtgctaaag gtaaaattga gttttccaag tataatgagg ataatacctt tactgtgaag 120 gtgtcaggaa gagaatactg gacgaacaga tggaatttgc agccattgtt acaaagtgct 180 cagctgacag ggatgactgt aacaatcata tctaatacct gcagttcagg ctcaggcttt 240 gcccaggtga agtttaactg a 261 <210> 6 <211> 450 <212> DNA <213> Escherichia coli <400> 6 cagcaagggg atgttaaatt ctttggtaac gtatcagcaa ctacctgtaa tttgacacca 60 caaataagtg gcactgtagg agataccatt cagcttggta ctgttgcacc aagcggagct 120 ggtcgtgaaa ttccttttgc actgaaggct tcttcaaatg ttggcggttg tgcttccttg 180 tccactaaaa cagctgatat aacttggagc gggcagttaa ccgaaaaagg ttttgctaat 240 caaggggggg tggcaaatga ttcatatgtc gctctgaaaa ccgtgaacgg taaaacacag 300 gggcaggagg ttaaggcgtc gaatagcact gtaagtttcg atgcatcaaa agcaactacg 360 gatggtttca aatttactgc tcaactgaaa ggtggtcaaa ccccgggtga cttccagggg 420 gcagcggctt acgcggttac ttacaagtaa 450 <210> 7 <211> 846 <212> DNA <213> Escherichia coli <400> 7 gcgtctactc tacaagtaga caagtctgtt tcatacgact ggatcaattc tagtgcgagt 60 agtgctcaag tcacaggaac acttcttggc acagggaaga caaacactac ccaaatgcca 120 gctctgtata cgtggcagca taaaatctac aatgttaatt tcattcctag ttcatcagga 180 actttgacat gccaggctgg aactattttg gtatggaaag gtgggcgcga aacccaatat 240 gcgctcgagt gtcgtgtgag cattcaccat agttctggct ccattaatga atctcagtgg 300 gggcaacagt cacaagtagg attcggtaca gcatgtggaa ctaaaaaatg tcgatttact 360 ggttttgaga tctctttacg tattcctcct aatgctcaga catatcccct ttcttccggt 420 gatctaaaag gaagtttttc cttaaccaac aaggaggtca actggtctgc ttcaatctat 480 gttcctgcga ttgcaaaatc ttatagacta gacacgtcaa taacactacc agataccgtg 540 aattaaaac aaaaccaagc tacgcctgtt tattatacat tttcagcacc tagcgtttca 600 aatactatta cagggatccc caaccaaaat gatatgcctt catctaatgt caaacttacc 660 atagggccga tccaatccaa aacaactgct ctttatgtgc agcccgatgc aacaggctcg 720 tggtatgatt tgtctaagag cataacaatg acagtagtaa aatccagtat gctcaacttc 780 aaaggaatta acgcaaaacc aggcaatgtt acattgtcgg tgcccattgt tttcgagata 840 cagtaa 846 <210> 8 <211> 1689 <212> DNA <213> Escherichia coli <400> 8 gcacaagtca ttaataccaa cagcctctcg ctgatcactc aaaataatat caacaagaac 60 cagtctgcgc tgtcgagttc tatcgagcgt ctgtcttctg gcttgcgtat taacagcgcg 120 aaggatgacg ccgcaggtca ggcgattgct aaccgtttta cttctaacat taaaggcctg 180 actcaggctg cacgtaacgc caacgacggt atttctgttg cacagaccac tgaaggcgcg 240 ctgtccgaaa tcaacaacaa cttacagcgt gtgcgtgaac tgaccgttca ggcaaccacc 300 ggtaccaact cccagtctga cctggactct atccaggacg aaattaaatc ccgtctggac 360 gaaattgatc gcgtatccgg tcagacccag ttcaacggcg tgaacgtgct ggcaaaagac 420 ggttccatga aaattcaggt tggcgcgaac gatggccaga ccatcactat cgacctgaag 480 aagattgact cttctacctt gaacctgaca ggttttaacg ttaacggttc tggttctgtg 540 gcgaatactg cagcaactaa agctgattta accgctgctc aactctctgc accgggtgca 600 gcagacgcaa atggtacagt tacttatact gtcagtgctg gttataaaga atccactgct 660 gcagatgtta ttgctagcat caaagacggc agtgctccga cttctgcaat tactgcaacc 720 attaataatg gcttcggtga ttccagtgcg ctgacttcca atgactatac ttatgaccca 780 gcaaaaggcg acttcactta cgacgtagct tcaagcgcca ataatactgc tgcccaggtt 840 cagtctttcc tgacgccgaa agcaggtgat accgcaaatc tgaaagtaac cgttggtacg 900 acatcggttg atgtcgttct ggccagtgat ggtaagatta cagcaaaaga tggttctgca 960 ttatatatcg acagtacagg taacctgact cagaacagtg ctggcttgac ctctgctaaa 1020 ctggctactc tgactggcct tcagggctct ggtgttgctt caaccatcac tactgaagat 1080 ggcactaata ttgatattgc tgctaacggt aatattggtc tgaccggtgt tcgtatcagt 1140 gctgattctc tgcagtcagc gactaaatct acgggcttta ctgttggtac tggcgctaca 1200 ggtctgaccg taggtactga tggtaaagtg actatcggcg ggactactgc tcagtcctac 1260 accagcaaag atggttccct gactactgat aacaccacta aactgtatct gcagaaagat 1320 ggctctgtaa ccaacggttc aggtaaagcg gtctatgtag aagcggatgg tgatttcact 1380 accgacgctg caaccaaagc cgcaaccacc accgatccgc tgaaagccct ggatgaggca 1440 atcagccaga tcgataagtt ccgttcatcc ctgggtgcta tccagaaccg tctggattcc 1500 gcggtcacca acctgaacaa caccactacc aacctgtctg aagcgcagtc ccgtattcag 1560 gcgccgact atgcgaccga agtgtccaac atgtcgaaag cgcagatcat tcagcaggcc 1620 ggtaactccg tgctggcaaa agccaaccag gtaccgcaac aggttctgtc tctgctgcag 1680 ggtccataa 1689 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccgccaattc aagaagatgt ttatggcg 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ccgcaagctt gtcattatta aactgcac 28 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccgcgaattc cagcaagggg atgttaaat 29 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccgcaagctt gatgattact tgtaagta 28 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ccgcgaattc gcgtctactc tacaagta 28 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ccgcaagctt ttactgtatc tcgaaaacaa 30 <210> 15 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ccgcgaattc gcacaagtca ttaataccaa cagc 34 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccgcaagctt ttaaccctgc agcagagaca gaac 34

Claims

delete

in the lon, cpxR and asd attenuated Salmonella strain the gene is deleted asd (aspartate β-semialdehyde dehydrogenase) gene, PR promoter / cI28 repressor (repressor) cell lysis (E-lysis) operably linked to a gene, pBR origin of replication a Ghost induction gene comprising any one gene selected from the group consisting of Stx2eB, FedA and FedF antigen coding genes derived from Enterotoxigenic Escherichia coli linked to the ompA signal sequence and the ompA signal sequence, A mutant strain of Ghost Salmonella that expresses Stx2eB, FedA or FedF, respectively, as the active ingredient, and further comprising a ghost Salmonella mutant expressing the FliC antigen derived from the enterotoxin E. coli. A vaccine composition for the prevention or treatment of edema.

delete

6. The vaccine composition according to claim 5, wherein the vaccine composition is inoculated into piglets.

delete