KR102249189B1 - Vaccine composition for preventing or treating porcine proliferative enteritis and salmonellosis simultaneouly comprising attenuated Salmonella mutant expressing immunogen having improved antigenicity as effective component - Google Patents

Abstract

The present invention relates to a vaccine composition for simultaneously preventing or treating porcine proliferative enteropathy and salmonellosis, comprising an attenuated Salmonella mutant expressing a newly synthesized antigen by collecting the epitope of the autotransporter (LatA) protein of Lawsonia intracellularis, and a chimeric antigen fused with flagellar protein (FliC) to both ends of the peptidoglycan-related lipoprotein (Pal) as an active ingredient.

Description

Vaccine composition for preventing or treating porcine proliferative enteritis and salmonellosis simultaneouly comprising attenuated Salmonella containing as an active ingredient an attenuated Salmonella mutant expressing an antigen with enhanced antigenicity mutant expressing immunogen having improved antigenicity as effective component}

The present invention relates to a vaccine composition for simultaneous prevention or treatment of porcine proliferative ileitis and salmonellosis, comprising as an active ingredient an attenuated Salmonella mutant that expresses an antigen with enhanced antigenicity.

Lawsonia intracellularis is a Gram-negative bacterium, and is an intracellular parasitic bacterium that has been reported as a major strain causing Porcine proliferative enteritis (PPE). In the past, Lawsonia intracellularis was infected only in pigs, and it progresses chronically rather than acute death, so it does not cause mortality, and it shows sluggish growth and chronic diarrhea, slow feed intake, and decreases pig production, such as weight loss. It was the main cause of letting. It has now been found that it also has a substantial effect on birds, including mammals, such as monkeys, rabbits, weasels, foxes, horses, ostrichs and emu. In pigs, transmission is common due to oral infections mainly through feces. In particular, piglets are infected through the sows' nipples contaminated during the lactation process. In addition, infection may occur when contaminated feed or water is consumed due to contaminated feed or drinking water, and infection may also occur through the act of selling the farm floor by mouth, which is one of the habits of pigs. . However, the exact epidemiologic investigation for proliferative ileitis has not been established until now. In addition, as the host area of Lawsonia intracellularis is quite wide, infection through wild birds, wild animals, or farm-raised dogs and cats is also possible, and transmission by equipment or vehicles inside the farm is also possible. It is estimated to be. The age of onset is also wide, and it has the characteristics of onset in pigs of all ages after weaning, so a great deal of effort must be made to eradicate and prevent the disease. There are many cases in which the course is chronic, and there is considerable difficulty in diagnosing the disease, so it is urgent to prepare countermeasures. Compared to the prevalence and severity on farms, there are several reasons why information on porcine proliferative ileitis has only begun to be known recently.The diagnosis of proliferative ileitis is less sensitive and less accurate, and the cause of the disease is Lawsonia intracellular. Lith is difficult to culture in vitro.

The pathogenesis of Lawsonia intracellularis has only been studied recently, and its ecology is still little known. The currently commercialized vaccine is a live attenuated vaccine produced using a non-pathogenic strain obtained by serial passage of the Lawsonia intracellularis strain (Enterisol ^® Ileitis, Boehringer Ingelheim). When the Lawsonia intracellularis strain is serially subcultured, it is estimated that attenuation occurs between 20 and 40 times. However, it is not known exactly which part has been attenuated, and there is a possibility of recovery by contact with wild strains outdoors, so it may be considered insufficient safety. Therefore, porcine proliferative ileitis is mainly controlled by the administration of antibiotics through food or water, but the use of antibiotics in animals is limited due to the recent emergence of antibiotic-resistant bacteria, and a new concept of vaccine is needed to overcome the previous shortcomings. .

Salmonella infection is also an important disease in the pig industry, food industry and public health worldwide. Salmonella Typhimurium (Salmonella Typhimurium) is a pathogen of greater importance in public health and is a causative agent of acute gastroenteritis through contaminated food. Salmonella typhimurium is commonly infected in pigs, which has little to do with mortality and causes enteritis, but even in asymptomatic individuals, the environment is polluted by excreting bacteria in feces for several months after exposure to meat. It is an important cause of human Salmonella infection resulting from contaminated food when transmitted to. According to a recent study, the interaction and balance between intestinal microbes are considered very important to the health of livestock.In animals infected with Salmonella, large changes in the colon's intestinal flora along with inflammation occur, and Salmonella infection is associated with the proliferation of other microbes. It has been proven that pigs that excrete Salmonella have a significant correlation with infection with Lawsonia intracellularis. Therefore, in order to prevent intestinal microbial diseases in pigs, it would be advantageous to defend a variety of important pathogens together. In light of this, in the present invention, it is intended to develop a vaccine that simultaneously prevents infections of Lawsonia intracellularis and Salmonella typhimurium, which has a common point of Gram-negative bacteria with characteristics that proliferate within cells, and the infection location and clinical symptoms are also similar. do.

Live attenuated Salmonella vaccines have been used by expressing heterogeneous antigens or proteins and delivering them to the host's immune system. When inoculated with an attenuated Salmonella strain that secretes a heterologous antigen or protein in the space between cell membranes or on the cell surface, Salmonella bacteria adhere to and proliferate in the intestine and systemic humoral and cellular properties through Peyer's patches It has been demonstrated to cause immunity and mucosal immune responses. Attenuated Salmonella vaccine strains have been developed and used to express specific antigens of various bacteria and viruses such as Escherichia coli and influenza using multi-copy plasmids and deliver them to the host's immune system. It has been improved to increase the residence time in the intestinal tract without causing side effects.

The vaccine developed in the present invention is operated by introducing a recombinant antigen gene derived from Lawsonia intracellularis into an attenuated Salmonella typhimurium strain by removing a specific gene to deliver the Lawsonia antigen to the host. Nutritional requirement by defects in the configuration (auxotrophic) gene, asd (aspartate β-semialdehyde dehydrogenase) an attenuated Salmonella typhimurium live vaccine strain (Δlon, ΔcpxR) rosoni Salmonella typhimurium that has a balanced-lethal host-vector system ah It was selected as a strain to deliver the intracellularis antigen. Salmonella pathogenicity islands (SPIs) contain a number of important virulence factors. lon expresses ATP-dependent Lon protease and inhibits the invasion of Salmonella typhimurium into epithelial cells. However, once Salmonella typhimurium is ingested and reaches the spleen through the intestine, it is a gene that is involved in systemic infection by helping bacteria proliferate. cpxR works in response to changes in the external environment of the cell and is required when various pathogenic bacteria, including Salmonella typhimurium, invade host cells by operating and regulating fimbriae-related genes in various ways. If asd is deficient, it is a selection index when using asd + plasmid as a recombinant vector, as it requires DAP (Diaminopimelic acid) at the time of growth.

On the other hand, Korean Patent Publication No. 2017-0081569 discloses'a vaccine composition for simultaneous prevention or treatment of porcine proliferative ileitis and salmonellosis containing attenuated Salmonella mutant as an active ingredient', and Korean Patent Publication No. 2006-0134054 The issue discloses'Rosonia intracellularis subunit vaccine', but simultaneous prevention of porcine proliferative ileitis and salmonellosis containing an attenuated Salmonella mutant expressing the antigen with enhanced antigenicity of the present invention as an active ingredient or There is no description of the therapeutic vaccine composition.

The present invention was derived from the above requirements, and the present inventors synthesized antigens by collecting epitopes of the autotransporter (LatA) protein of Lawsonia intracellularis, and lipids related to peptidoglycans. After expressing the chimeric antigen in which the flagella protein (FliC) is fused to both ends of the protein (Pal) in each attenuated Salmonella typhimurium strain, the vaccine effect of the Salmonella typhimurium strain expressing the novel antigen was observed in pig ileum. As a result of confirming using a salt mouse model, it was observed that all of the novel antigens of the present invention have a protective effect against the causative agent of porcine ileitis. In particular, in the experimental group treated with the two antigens together, significantly superior to the single-treated experimental group. By confirming that there is a preventive effect, the present invention was completed.

In order to solve the above problems, the present invention is an antigen consisting of the amino acid sequence of SEQ ID NO: 1 derived from the autotransporter protein derived from Lawsonia intracellularis; Or, it provides an attenuated Salmonella mutant comprising an antigen consisting of the amino acid sequence of SEQ ID NO: 2 in which a flagella protein derived from Lawsonia intracellularis and a peptidoglycan-associated lipoprotein are fused. do.

In addition, the present invention provides an attenuated Salmonella mutant mixture comprising the attenuated Salmonella mutant.

In addition, the present invention provides a vaccine composition for simultaneous prevention or treatment of porcine proliferative ileitis and salmonellosis, comprising the attenuated Salmonella mutant strain or the attenuated Salmonella mutant mixture as an active ingredient.

In addition, the present invention provides a feed additive for simultaneous prevention of porcine proliferative ileitis and salmonellosis, comprising the attenuated Salmonella mutant strain or a mixture of attenuated Salmonella mutant strains as an active ingredient.

The novel vaccine candidate antigen according to the present invention has excellent protection against Lawsonia intracellularis, which is the cause of porcine proliferative ileitis, and significantly increases antigen-specific humoral, mucosal and cellular immune responses of immunized animals. Therefore, it is expected to be useful as a vaccine that can prevent and treat porcine proliferative ileitis and salmonellosis at the same time.

1 is a schematic diagram showing the structure of a Lawsonia intracellularis autotransporter protein.
2 is a result of analysis of antigenic determinants with high antigenicity in the Lawsonia autotransporter protein using The ProteomeBinders Epitope Choice Resource (http://bioware.ucd.ie/epic/) program. Five areas indicated by red dashed boxes were used for antigen synthesis.
3 is a schematic diagram showing the interaction of the FliC-PAL-FliC antigen and the TLR5 receptor on the surface of a host cell.
4 is a result of analyzing an antigenic determinant having high antigenicity in PAL protein using The ProteomeBinders Epitope Choice Resource program. The four areas indicated by the red dotted boxes were used for antigen synthesis.
5 is a schematic diagram of an animal experiment for a study on the efficacy of a vaccine candidate.
6 is a schematic diagram of a challenge-infected animal experiment to confirm the efficacy of a vaccine candidate.
7 is a standard calibration curve for quantification of Lawsonia gDNA.
8 is a result of confirming the protein expression level of a vaccine candidate antigen through Western blot. (A) is a vector control, (B) is a FliC-PAL-FliC antigen, and (C) is a LatA protein epitopes focused immunogen antigen.
9 is a result of analysis of sIgA and plasma IgG levels in mucosal tissues after immunization using a Salmonella mutant strain expressing a vaccine candidate antigen through indirect ELISA. **P <0.05, NS: non significant.
10 is a result of analyzing the expression levels of IFN-γ and IL-17 secreted from splenocytes after immunization using a Salmonella mutant strain expressing a vaccine candidate antigen using reverse transcription real-time PCR. **P <0.05, NS: non significant.
11 is a result of analyzing changes in T cell immune response through FACS analysis after immunization using a Salmonella mutant strain expressing a vaccine candidate antigen. ***P <0.05 (significance result compared to non-immunized group).
FIG. 12 is a result of analysis of the level of Lawsonia gDNA found in feces after challenge-infecting an experimental animal immunized with a Salmonella mutant strain expressing a vaccine candidate antigen with a Lawsonia attenuated strain. JOL 1592: Salmonella mutant expressing LatA2, JOL 2127: Salmonella mutant expressing LatA protein epitopes focused immunogen, JOL 2170: Salmonella mutant expressing FliC-PAL-FliC antigen.
13 is a result of confirming the ileum of an experimental animal infected with the Lawsonia attenuated strain and the ileum of an experimental animal immunized with a Salmonella mutant that expresses a vaccine candidate antigen by immunohistochemical staining. The arrow head indicates the location of each bacteria.

In order to achieve the object of the present invention, the present invention is an antigen consisting of the amino acid sequence of SEQ ID NO: 1 derived from the autotransporter protein derived from Lawsonia intracellularis; Or, it provides an attenuated Salmonella mutant comprising an antigen consisting of the amino acid sequence of SEQ ID NO: 2 in which a flagella protein derived from Lawsonia intracellularis and a peptidoglycan-associated lipoprotein are fused. do.

Lawsonia intracellularis autotransporter protein is NCBI's Lawsonia intracellularis PHE/MN1-00 genetic map (https://www.ncbi.nlm.nih.gov/genome/?term=Lawsonia%20intracellularis%20PHE) /MN1-00) was inferred through the identification of the genomic sequence of LI0649 (802639-805194), and the antigen consisting of the amino acid sequence of SEQ ID NO: 1 derived from the autotransporter protein according to the present invention is Lawsonia autotransporter (LatA ) In the protein, the first region consisting of a portion of the 101-200th amino acid sequence including a portion of the passenger domain (LatA1 part in FIG. 2) and a portion of the passenger domain and the 534-851th amino acid including the entire β-domain It is an antigen that is recombined by linking five antigenic determinants predicted to have high antigenicity through a commercialized program at the second site consisting of a sequence portion (LatA2 part in Fig. 2) with glycine.

In addition, the antigen consisting of the amino acid sequence of SEQ ID NO: 2 in which the Lawsonia intracellularis-derived flagella protein and peptidoglycan-associated lipoprotein of the present invention are fused is confirmed in FIG. 3. As can be seen, it is a chimeric protein produced by fusion of a flagella protein to both ends with a peptidoglycan-related lipoprotein in the center.In the amino acid sequence of SEQ ID NO: 2, the 101st to the 176th are peptidoglycan and It is a part of the lipoprotein involved. The 76 amino acid-related peptidoglycan-related lipoprotein portion contains four regions predicted as high antigenic sites through a commercialized program from the sequence of the total peptidoglycan-related lipoprotein (SEQ ID NO: 15). It was recombined.

The scope of the antigen according to the present invention includes a protein having an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 and functional equivalents thereof, respectively. The term "functional equivalent" is at least 60% or more, preferably 80% or more, more preferably 90% or more, with the amino acid sequence represented by SEQ ID NO: 1 or 2 as a result of addition, substitution or deletion of amino acids, Even more preferably, it refers to a protein having a sequence homology of 95% or more and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 1 or SEQ ID NO: 2. "Substantially homogenous physiological activity" means the porcine proliferative ileitis vaccine activity.

The attenuated Salmonella mutant strain of the present invention may be one in which the asd gene is deleted. Preferably, it may be a Salmonella mutant strain in which the lon, cpxR and asd genes are deleted, but is not limited thereto.

In the Salmonella mutant strain according to an embodiment of the present invention, the Salmonella mutant strain (Δlon ΔcpxR Δasd Salmonella Typhimurium , JOL912) in which the lon, cpxR and asd genes are deleted is a DAP (diaminopimellic acid) claimant in which the asd gene is deleted, and is an antigen without antibiotics. In addition to being made to select a recombinant strain, by deleting cpxR , lymphatic tissue penetration is increased to increase immunogenicity, and pathogenicity can be attenuated by deletion of the lon gene. It is known that the strain has no effect on the production of EPS (extracellular polysaccharide), which can act as an antigen, so that it acts as an antigen by itself, has stability, and generates a sufficient humoral mucosal cellular immune response.

The attenuated Salmonella mutant of the present invention is Bla (β-lactamse) signal sequence; An antigen-coding gene consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 linked thereto; And asd gene; may be transformed with a recombinant vector including, but is not limited thereto. In one embodiment of the present invention, the recombinant vector may be pJHL65 (asd+ vector, pBR ori, 6xHis) or pJHL80 (asd+ vector, p15A ori, 6xHis) having a secretion system based on the Bla signal sequence.

Further, in the Salmonella mutants of the present invention, wherein the Salmonella is Salmonella typhimurium (Salmonella typhimurium), Salmonella tie blood (S. typi), Salmonella para tie blood (S. paratyphi), Salmonella Sendai (S. sendai), Salmonella gallinarium (S. gallinarium ) or Salmonella enteritidis (S. enteritidis ) may be, and the like, preferably Salmonella typhimurium, but is not limited thereto.

The present invention also provides an attenuated Salmonella mutant mixture comprising the attenuated Salmonella mutant.

The Salmonella mutant mixture of the present invention is a mixture containing all Salmonella mutant strains in which lon, cpxR and asd genes are deleted, and Salmonella mutant strains expressing an antigen consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 outside the cell or outer membrane. to be. Specifically, the attenuated Salmonella mutant containing an antigen consisting of the amino acid sequence of SEQ ID NO: 1 derived from an autotransporter protein derived from Lawsonia intracellularis; And an attenuated Salmonella mutant comprising an antigen consisting of the amino acid sequence of SEQ ID NO: 2 in which a flagella protein derived from Lawsonia intracellularis and a peptidoglycan-associated lipoprotein are fused. to be.

The present invention also provides a vaccine composition for simultaneous prevention or treatment of porcine proliferative ileitis and salmonellosis, comprising the attenuated Salmonella mutant strain or the attenuated Salmonella mutant mixture as an active ingredient.

Vaccine compositions of the invention Salmonella typhimurium expressing antigen consisting of the amino acid sequence of the origin and the recombinant SEQ ID NO: 1 or SEQ ID NO: 2 from rosoni ah intra-cell-less (Lawsonia intracellularis) in the Salmonella live attenuated by a gene deletion Solarium By including a mixture containing one or more mutant strains as an active ingredient, the vaccine composition may be treated on an animal to simultaneously prevent or treat porcine proliferative ileitis and salmonellosis.

The vaccine composition may be inoculated to humans or mammals, and the mammal may be cattle, deer, goats, goats, dogs, pigs, and the like, and may preferably be inoculated to pigs, but is not limited thereto.

The composition of the present invention may be administered orally or parenterally (for example, intramuscularly, intravenously, subcutaneously, intraperitoneally or topically applied) according to a desired method, preferably oral or subcutaneous administration. , Is not limited thereto. In addition, the dosage of the composition varies according to the weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease of the human or animal.

In the present invention, the term "vaccine" is a biological preparation containing an antigen that gives immunity to a living body, and refers to an immunogen or an antigenic substance that generates immunity to a living body by injection or oral administration to a human or animal to prevent infection. In vivo immunity is largely divided into automatic immunity, in which immunity is automatically obtained in vivo after pathogen infection, and passive immunity, obtained by externally injected vaccines. Automatic immunity has a long period of generation of antibodies related to immunity and is characterized by sustained immunity, whereas passive immunity by a vaccine immediately acts on the treatment of infectious diseases, but has a disadvantage of low persistence.

The vaccine composition is a stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, subviral particle adjuvant, cholera toxin , N,N-dioctadecyl-N',N'-bis(2-hydroxyethyl)-propanediamine, monophosphoryl lipid A, dimethyldioctadecyl-ammonium bromide, and any one selected from the group consisting of a mixture thereof It may further contain the above 2nd auxiliary agent.

In addition, the vaccine composition may include a veterinary acceptable carrier. In the present invention, the term "veterinarily acceptable carrier" includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Carriers, excipients, and diluents that may be included in the vaccine composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

In addition, the compositions for vaccines are oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and nasal formulations such as drips or sprays, and sterile injectable solutions, respectively, according to a conventional method. It can be formulated and used in the form of. In the case of formulation, it can be prepared using diluents or excipients such as generally used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient such as starch, calcium carbonate, and sucrose in the lecithin-like emulsifier. Alternatively, it can be prepared by mixing lactose, gelatin, or the like. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. As liquid preparations for oral administration, suspensions, solvents, emulsions, syrups, etc. can be used. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. can be used. Can be included. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and lyophilized formulations. As the non-aqueous preparation and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used, but are not limited thereto. Penetrants suitable for formulations for intranasal administration are generally known to those of skill in the art. Such suitable formulations are preferably formulated to be sterile, isotonic and buffered for stability and compliance. Formulations for intranasal administration are also formulated to stimulate mucus secretion in several respects to maintain normal ciliary function and are described in Remington's Pharmaceutical Science, 18th Ed., Mack Publishing Co., Easton, PA (1990)). As noted, suitable formulations are preferably isotonic, slightly buffered formulations maintaining a pH of 5.5 to 6.5, most preferably comprising antimicrobial preservatives and suitable drug stabilizers.

The present invention also provides a feed additive for simultaneous prevention of porcine proliferative ileitis and salmonellosis, comprising the attenuated Salmonella mutant strain or the attenuated Salmonella mutant mixture as an active ingredient.

Feed additives of the invention are Salmonella typhimurium expressing antigen consisting rosoni ah intra-cell-less amino acid sequence of the origin and the recombinant SEQ ID NO: 1 or SEQ ID NO: 2 from (Lawsonia intracellularis) in the Salmonella live attenuated by a gene deletion Including a mixture containing one or more mutant strains as an active ingredient, Salmonella mutant strains or mixtures thereof not only protect against Lawsonia intracellularis and Salmonella, but also effectively induce cellular and humoral immune responses in animals, so this is a feed additive. When used as, it can contribute to the simultaneous prevention of porcine proliferative ileitis and salmonellosis and enhancement of immunity in livestock.

The feed additive of the present invention may use a mixture of mutant Salmonella as it is or may additionally add known carriers, stabilizers, etc., such as grains and by-products thereof, allowed for livestock, and citric acid, humic acid, adipic acid, and lactic acid as necessary. , Organic acids such as malic acid, sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate (polyphosphate), and other phosphates, polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, Natural antioxidants such as tannic acid and phytic acid, antibiotics, antibacterial agents, and other additives may be added, and the shape may be in a suitable state such as powder, granules, pellets, suspensions, etc. In the case of supplying the feed additives, livestock It can be supplied alone or mixed with feed.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. New antigen production

1-1. LatA-based multi-epitope recombinant antigen

Lawsonia autotransporter (LatA) protein (Fig. 1), one of the outer membrane proteins of Gram-negative bacteria, is known to play a role in the bacterial adhesion and invasion of target organs or cells of the host and the toxic expression of bacteria. And induces a strong humoral immunity. For antigen synthesis, the LatA protein was used as LatA1 (a portion of the 101-200 amino acid sequence including a portion of the passenger domain) and LatA2 (a portion of the 534-851 amino acid sequence including a portion of the passenger domain and the entire β-domain). It was divided into two parts, and five parts with high antigenicity were selected from LatA1 and LatA2 using The ProteomeBinders Epitope Choice Resource (http://bioware.ucd.ie/epic/) program (Fig. 2), and the glycine linker was used. Using the multi-epitope recombinant antigen was produced. The LatA-derived multi-epitope recombinant antigen was named LatA protein epitopes focused immunogen.

1-2. FliC-PAL chimeric antigen

The FliC antigen is a flagella protein on the cell surface that is responsible for bacterial motility, and the flagella can usually act as pathogen-associated molecular patterns (PAMPs). In addition, as a component of the innate immunity in the host, it interacts with TLR5 (Toll like recepter 5), which is one of the factors that stimulate the activation of the acquired immunity, and NF-κB in macrophages. Contributes to the activation of the acquired immune system through activation of The present inventors used the fliC gene expressing the flagellum protein as an adjuvant and placed it on both sides of the specific target antigen. The specific target antigen is a peptidoglycan-associated lipoprotein (PAL), and an epitope with high antigenicity was selected using the ProteomeBinders Epitope Choice Resource program (Fig. 4), and FliC proteins on both sides. Was placed to prepare a second final antigen in a chimeric form. The chimeric antigen was named FliC-PAL-FliC. FliC binds to the receptor TLR5 and acts as an adjuvant for innate immunity and can stimulate acquired immunity at the same time, and PAL has the ability to interact with many proteins, so it can stably stimulate the host's immune cells.

2. Strains and Plasmids

The bacterial strains and plasmids used in this experiment are listed in Table 1 below. Since pET28α plasmid, a commercially available vector for expression of E. coli protein, has kanamycin resistance, the strain was cultured in the presence of 50 µg/ml kanamycin. The Bl21(DE3)pLysS strain was used to purify the Lawsonia antigen protein. The strain was cultured in the presence of 0.1M IPTG (Isopropyl-β-D-1-thiogalactopyranoside) when inducing overexpression during protein purification. PJHL65 containing the non-antibiotic marker Asd was used as a vector for secreting and delivering the cloned antigenic protein in a Bla signal sequence-based periplasmic secretion method. All strains were cultured at 37°C using LB medium, and stored at -80°C using LB medium containing 20% glycerol.

3. Experimental animals

All experimental animal care and procedures described in this experiment were approved by the Chonbuk National University Animal Ethics Committee (CBNU2015-00085) in accordance with the guidelines of the Korean Committee on Animal Care. A 5-week-old BALB/c female mouse and a 4-week-old C57/BL6 female mouse were purchased and reared at Chonbuk National University's experimental animal farm, followed by a breeding adaptation time for about one week, and then used for the experiment.

4. Construction of plasmid expressing antigenic protein

The candidate antigens for the Lawsonia vaccine are the epitopes focused immunogens of the LatA antigen involved in autotransporter synthesis, and the PAL peptidoglycan antigen that synthesizes flagella-related proteins and the chimeric protein of the FliC cilia antigen as the second final antigen. I did. All genes required for expression of these two antigenic proteins were obtained using gene synthesis (Bioneer, Korea). It was transformed into DH5α in E. coli strains using the synthesized nucleotide sequence. Subsequently, in order to transform BL21(DE3)pLysS, which is used as a protein-expressing strain, it was cloned into pET28α(Novagen), a vector for expression of E. coli proteins. The genes were treated with a designated restriction enzyme and CIP (calf intestine alkaline phosphatase) to prevent self ligation, and confirmed on an agarose gel, and the plasmid was purified. For this, a gel extraction kit (DokDo-Prep Gel Extraction Kit, Elpis) was used. Restriction enzyme treatment and purification of DNA fragments were performed at room temperature for 2 to 4 hours using T4 DNA ligase. The combined reaction solution was transformed into E. coli BL21(DE3)pLysS by a heat shock method, spread evenly on an LB plate medium containing kanamycin, dried, and cultured overnight to select a transformed strain. Plasmids were isolated from the identified E. coli, amplified by PCR, digested with restriction enzymes, and subjected to electrophoresis on an agarose gel for final confirmation (Table 2). The finally identified transformed strain was inoculated in LB liquid medium to which kanamycin was added, and cultured in the presence of 0.1 M IPTG when inducing overexpression during protein purification. Antigens induced by expression in each strain were purified using NTA (Ni-nitrilotriacetic acid) agarose (Qiagen, Valencia, CA), and the finally obtained Lawsonia antigen protein detected specific antibodies for each antigen in mice. It was used for the purpose of doing.

Primers used for antigen identification PCR in the present invention primer DNA sequence (5'→3') Amplification size LatA protein epitopes focused immunogen F: ATGGTTCGGTTTTTTGCTCA (SEQ ID NO: 3) 456 bp R: CCCCGGAAAGTAGACGT (SEQ ID NO: 4) flagellin-peptidoglycan associated protein (FliC-PAL) chimera expressed gene F: GTCTTTGGTCATTAACAACAAC (SEQ ID NO: 5) 816 bp R: GAGTTGGCTTGCCATCTTTG (SEQ ID NO: 6)

5. Vaccine strain production

The prepared candidate antigen was cloned into a pJHL65 expression vector containing the non-antibiotic marker Asd, and JOL912 ( Δlon ΔcpxR Δasd Salmonella Typhimurium ) was mixed with 0.1 μg of the purified plasmid, and then put into a cuvette and used with Bio-Rad MicroPulser (Bio-Rad, USA). Electroporation was applied and recovered, and incubated at 28° C. for 1 hour and 30 minutes in 1 ml of LB medium without DAP. In order to select the transformed strain, it was spread evenly on LB agar containing DAP and then cultured overnight and then formed colonies were selected. A number of colonies were selected, digested with a restriction enzyme corresponding to each antigen, and confirmed by electrophoresis and PCR performed on an agarose gel, and then used.

6. Western blot

Samples were prepared by culturing each vaccine candidate strain in 200 ml LB medium overnight to confirm whether the produced vaccine strain expressed the epitopes focused immunogens of the LatA antigen and the FliC-PAL-FliC chimeric protein. The prepared sample was centrifuged at 4,000 rpm, and the supernatant was transferred to a new flask. The separated supernatant was separated and purified using TCA (tricholoroacetic acid) to find proteins secreted from the clear supernatant obtained by passing through a 0.22 µm filter and reacted overnight at 4°C. After centrifugation, the remaining pellet was washed with acetone and resuspended with PBS. The solution thus obtained was mixed with the SDS-sample buffer in a 1:1 ratio, and then boiled for 15 minutes before use. After SDS-PAGE, it was transferred to a PVDF membrane and reacted with a blocking buffer (3% BSA in PBST) for 3 hours. His-tag antibody was diluted 1:5,000 and reacted at 4° C. overnight. After 1 hour reaction with each 1:5,000 diluted secondary antibody (goat anti-Mouse IgG HRP) prepared on the following day, the color was developed and the size of each antigen was checked to confirm the expression.

7. Vaccination and challenge infection research

In the vaccination study, 5-week-old BALB/c female mice were purchased and reared at Chonbuk National University's experimental animal farm, followed by a breeding adaptation period for about one week, and then used for experiments. Mice were divided into 5 groups, and were given an oral vaccination and a subcutaneous vaccination. The control group was inoculated with 100 µl of PBS, and of the experimental group, the oral inoculation group was inoculated with JOL2127 and JOL2170 at 1×10 ⁸ CFU/100µl per group, the subcutaneous inoculation group was inoculated with JOL2127 and JOL2170 at 1×10 ⁷ CFU/100µl (Fig. 5).

In the challenge infection study, 4-week-old C57/BL6 female mice were purchased and used for the experiment after passing through the same breeding adaptation period. Mice were divided into 5 groups and were orally vaccinated. The control group was inoculated with PBS 100 ㎕, the experimental group were inoculated JOL2127, JOL2170, it was inoculated per the JOL1592 a ^{1 × 10 8 CFU / 100㎕,} JOL2127, by mixing ^{JOL2170 1 × 10 8 CFU / 100㎕} . Two weeks later, the attenuated strains of Lawsonia ^{were inoculated with a dose of 10 5.9} tissue culture infective dose (TCID ₅₀ ) and challenged infection. Fecal samples collected at regular intervals were stored at -20°C and used, and intestinal samples were fixed in 10% formaldehyde for two days, and paraffin sections were made and used in the experiment (FIG. 6).

8. Temporary specimen collection

Before inoculation (week 0) and at 2, 4, and 6 weeks after inoculation, a vaginal wash solution was drawn for sIgA measurement, and blood was collected for IgG measurement. In the case of vaginal washing solution, the vaginal washing solution was collected using PBS, stored at -20°C, and used in the experiment. Serum was collected through vein after orbit and centrifuged at 4,000×g for 5 minutes to separate the supernatant serum, and then stored at -20°C and used in the experiment.

9. ELISA (Enzyme-Linked ImmunoSorbent Assay)

ELISA was performed to measure the immunized sIgA and IgG antibodies. The protein of each specific antigen expressed in E. coli was used as a coating antigen. After dispensing a protein of a specific antigen at a concentration of 500 ng/well, it was coated overnight at 4°C. The coated plate was washed 3 times with PBST containing 0.05% Tween 20, followed by blocking with Blocking buffer (3% skim milk, PBS), then diluted 1:100 serum and PBS, and 1:2 vaginal washing solution. After diluting with and dispensing 100 µl into wells, the mixture was reacted at 37°C for 1 hour. Dilute HRP-conjugated Goat anti-mouse IgG for serum and HRP-conjugated Goat anti-mouse IgA for vaginal wash at a ratio of 1:5,000, and dispense 100 µl into each well for 1 hour at 37°C. Reacted for a while. 100 µl of the OPD-substrate reaction solution was dispensed per well, color development _{, stopped with 3M sulfuric acid (H 2} SO ₄ ), and an OD ₆₀₀ value was measured at 492 nm. The concentration of each antigen-specific antibody was determined based on the standard protein concentration.

10. Splenocyte Proliferation Assay

After the 6th week of inoculation, the mice were sacrificed, the spleen was collected aseptically, pulverized, and the cells in the tissue were taken out and the remaining tissue was removed with a cell stainer. After the cells were settled by centrifugation, RPMI-1640 (Sigma) was suspended in RPMI containing 10% heat-inactivated fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 μg/ml streptomycin, and the cells were centrifuged again. After settling by separation, the cells were suspended through a red blood cell (RBC) lysis buffer to remove red blood cells. Subsequently, the centrifuged cell precipitate was washed with sterile PBS, followed by two more times, and then the number of splenocytes suspended in RPMI was measured so that the final number of cells along with the antigens corresponding to each group was 1x10 ⁷ respectively. It was dispensed on a well culture plate and cultured for 48 hours.

11. qPCR quantification

For quantitative analysis of immunomodulatory cytokines, total RNA was extracted from splenocytes reacted with each antigen using an RNeasy plus mono kit (Qiagen) after 72 hours of culture. The extracted total RNA was synthesized into cDNA using a cDNA reverse transcription kit (High capacity cDNA REverse transcription kit) after checking the appropriate concentration value with NanoDrop and stored frozen. Using the primers in Table 3, IL-17 and IFN-γ Genes were measured through Real-Time PCR (Step One plus Real Time PCR system, Applied Biosystems). The mRNA expression of the gene was relatively quantified based on the expression of the internal control β-actin. The ^{cycle threshold (Ct) was analyzed using DataAssist TM} (ThermoScientific Inc), and the fold change of cytokines was calculated as the log2 average value of 2ΔΔCt of the stimulated sample divided by the log2 average value of 2ΔΔCt of the unstimulated sample.

Primers used for qPCR of the present invention antigen primer DNA sequence (5'→3') IFN-γ Forward direction TCAAGTGGCATAGATGTGGAAGAA (SEQ ID NO: 7) Reverse TGGCTCTGCAGGATTTTCATG (SEQ ID NO: 8) IL-17 Forward direction ACCGCAATGAAGACCCTGAT (SEQ ID NO: 9) Reverse TCCCTCCGCATTGACACA (SEQ ID NO: 10)

12. FACS analysis

After inoculation, a mouse 6 weeks old was sacrificed, the spleen was collected aseptically, pulverized, and the cells in the tissue were taken out and the remaining tissue was removed with a cell stainer. After centrifugation at 470xg for 3 minutes, the pellet was suspended with RPMI, and then the cells were suspended through RBC Lysis buffer to remove RBC. Afterwards, the centrifuged cell precipitate was washed with sterile PBS, followed by two more times, and then the number of splenocytes suspended in RPMI was measured, so that the number of final cells along with the antigens corresponding to each group was 1x10 ⁶ in 96 wells. It was dispensed on the culture plate. For fluorescence activated cell sorting (FACS) analysis, fluorescence staining was performed by reacting anti-mouse CD3e-PE and anti-mouse CD4-perCP-vio700 in a dark room at 4° C. for 20 minutes. After the stained cells were washed three times with FACS buffer and analyzed using a 200㎕ MACSQuant ^® analyzer (miltenyi Biotec Inc.).

13. Study and diagnosis of efficacy of vaccine candidates using experimental animals

There are a number of ways to investigate the infection status, such as symptoms, post-mortem biopsy, bacterial isolation and identification, PCR, and serological methods. Among them, the method for isolation and identification has high specificity, but it is very difficult to identify intracellular parasitic bacteria from feces, and it is difficult to separate them from chronic carrier animals where infected animals intermittently excrete bacteria or infect the lymph nodes latent. have. PCR has good sensitivity and specificity, but there are disadvantages that false positives may occur due to the possibility of mixing feces of several individuals when using feces, or false results may occur such as negative results due to fecal components acting as inhibitors. In order to compensate for these shortcomings, the degree of infection was investigated by the nested Real Time PCR method in the present invention. The above method can compensate for disadvantages such as false positives in feces that may come out of the test, and is more effective in confirming the infection status due to its high sensitivity and specificity. In addition, using immunohistochemistry (IHC) using the infectious intestine, the degree of infection was directly confirmed in the lesion, and it was confirmed that the Salmonella delivery vaccine and Lawsonia were infected in the same lesion and thus had a vaccine effect.

13-1. Nested Real Time PCR

A fecal sample obtained from a mouse was used to confirm the degree of infection with Lawsonia intracellularis bacteria present in the feces. For the collection of feces, more than 0.5 g of mouse feces were collected in a sterilized 1.5 ml tube, and the collected feces were stored at -20°C to prevent degeneration from high temperatures, and used with minimal exposure to the outside. In order to purify genomic DNA (gDNA) from the collected feces, 0.5 g of the resulting feces was suspended in 250 μl of lysis buffer (0.05 M Tris-Cl, 0.5% SDS, pH 8.0) and reacted at room temperature for 10 minutes. After mixing in (Phenol-Chloroform Isoamyl Alcohol Method), centrifugation was performed at 13,000×g for 15 minutes. The supernatant obtained through centrifugation was mixed with 200 µl of isopropanol, reacted at -20°C for 1 hour, and then centrifuged again (13,000×g, 15 minutes) to remove the supernatant, and the pellet was dried at 37°C and 20 It was mixed in µl TE buffer (Tris; 10 mM, EDTA; 1 mM, pH0.8) and used in the experiment. Using the thus obtained fecal sample, a diagnostic method was established to confirm the PCR amplification product for Lawsonia intracellularis bacteria present in the feces. First, two sets of primers were prepared by analyzing with NCBI Blast based on NCBI (GenBank:AM180252.1:c1143127-1141712 Lawsonia intracellularis PHE/MN1-00) to perform this diagnostic technique (Table 4). In the nested Real Time PCR of the present invention, first, using genomic DNA extracted from a fecal sample as a template DNA, amplify a target size with an outer primer, dilute it by 1/10, and then again Real Time PCR (Real Time PCR). Time PCR, TOYOBO SYBR 2X PCR premix) was used as a template DNA and amplified with an inner primer. Through the difference between the Ct value and the melting curve peak obtained through this, the presence or absence of observation in the control group and the vaccination group was investigated. Bacterial gDNA measurement was calculated by a standard curve by measuring the Ct value of Lawsonia gDNA amplified by Real-Time PCR (FIG. 7).

Nested Real Time PCR primer used in the present invention primer DNA sequence (5'→3') Amplification size LI outer forward direction ACACTCCGTGCTGTTGAAAC (SEQ ID NO: 11) 310 bp LI outer reverse ATTGGTATTCTCCTTTCTCATGT (SEQ ID NO: 12) LI inner forward direction GCAAACAATAAACTTGGTCTTC (SEQ ID NO: 13) 201 bp LI inner reverse TTCTCCTTTCTCATGTCCCAT (SEQ ID NO: 14)

13-2. Immunohistochemistry (IHC)

Using tissue samples obtained from mice, the degree of infection of the vaccine using the Lawsonia intracellularis bacteria and Salmonella delivery system in the intestine was confirmed. The collected tissue was fixed in 10% formaldehyde solution for 2 days. The fixed specimen was subjected to paraffin embedding (dehydration-transparent-penetration-embedding-cutting-cutting) to make a block. Paraffin sections were made on micro slide glass. After that, the paraffin section is first soaked in xylene twice for an average of 5 minutes to remove paraffin. Then, it is sequentially immersed in ethanol from 100% to 75% to supply moisture to the tissue, and then washed with distilled water. To restore antigenicity, it is treated in 10mM citrate buffer (citric acid: sodium citrate=9:41, pH 6.0) at 100℃ for 30 minutes. After the citrate buffer treatment is finished, cool it at room temperature and wash in distilled water for 5 minutes. After that, the slices are dried and hydrogen peroxide is treated for 15 minutes. The above section was washed twice for 5 minutes with distilled water, and 5% bovine serum albumin (BSA) was treated with a blocking agent for 1 hour to prevent non-specific antigen-antibody reaction. Remove the solution from the section, dilute the primary antibody (Rabbit serum antibody) 1:200 without washing, and react at 4°C overnight. The primary antibody was washed twice with PBS for 5 minutes, and the secondary antibody (Goat Anti-Rabbit IgG) was reacted at room temperature for 1 hour. The secondary antibody was washed twice with PBS for 5 minutes, exposed to DAB coloring agent for 10 minutes, counter-stained with methylene green for 3 minutes, and washed with running water. After removing moisture from the section, it was sealed, dried at room temperature for about a day, and the tissue condition and staining condition were checked under a microscope.

Example 1. Confirmation of protein expression of vaccine candidate antigen

Western blot was performed to confirm the presence or absence of protein expression of the antigen in each vaccine candidate strain. JOL912 was used as a control, and each antigen was used as an experimental group. The size of epitopes focused immunogens of LatA antigen was 28 KDa, and the FliC-PAL-FliC chimeric antigen showed a size of 40 KDa (FIG. 8).

Example 2. Measurement of humoral immune response in vaccinated mice by ELISA

To evaluate immunogenicity for each antigen, antibody titers of IgG and sIgA in immunized mice were measured by ELISA. Compared with the control group administered with PBS, significant levels of IgG were found in both the oral and subcutaneous vaccination groups until 4-6 weeks of infection. The increase in sIgA secretion began to decrease gradually after reaching its peak at week 2 in the case of oral vaccination (FIG. 9). Through this, it was found that plasma IgG and mucosal tissue sIgA were effectively stimulated by the ileitis vaccine strain utilizing the attenuated Salmonella expression and delivery system.

Example 3. Analysis of cytokine expression level through real-time reverse transcription PCR

In order to evaluate the expression level of cytokines that regulate cellular immune responses, mRNA expression of IFN-γ and IL-17 was confirmed through RT-PCR. The amount of RT-PCR product was normalized to the β-actin value used as an internal standard. The expression of IFN-γ and IL-17 in the vaccinated mice was significantly increased compared to the control group (FIG. 10). In particular, the increase in mRNA expression of IL-17 is important because it works with IL-22 to induce the expression of the anti-microbial peptides β-defensin-2 and -3. In addition, IL-22 can protect the host from bacterial infections in the lung and large intestine. The increase in the mRNA expression of IFN-γ suggests that when Lawsonia antigen is expressed, it can stimulate cellular immune responses in host cells.

Example 4. Evaluation of T cell immune response through FACS analysis

T cells have memory capacity in the immune system and not only help antibody generation by providing information about antigens to B cells, but also play a major role in the immune activity of cells, the differentiation of T lymphocytes was confirmed through FACS analysis. The immune response of T cells was evaluated in splenocytes isolated from mice 6 weeks after inoculation. As a result, there was a significant increase in the expression of CD4+ and CD8+ T cells (Fig. 11). Through this, it can be seen that the expression of IL-17 increased as the T helper cell-mediated immune response increased, and the activity of CD4+ T cells was induced. In addition, as a strong immune response to intracellular pathogens appeared according to vaccine immunization, the activity of CD8+ T cells increased, suggesting that it is associated with an increase in the mRNA of IFN-γ. Therefore, it is proved that the vaccine candidate using the attenuated Salmonella expression and delivery system induced a cellular immune response.

Example 5. Investigation of the amount of Lawsonia bacterium in mouse feces through Nested Real Time PCR

In the results of this experiment, it was confirmed that Lawsonia intracellularis gDNA significantly decreased in the experimental group inoculated with two vaccine strains. In the stool samples collected from the vaccination group, after 6 days, compared to the control group, the decrease was noticeable, and after 9 days, the lowest bacterial gDNA was shown in the group inoculated with the two vaccine strains (FIG. 12ⓑ). In addition, the experimental animals immunized with each individual vaccine strain showed the lowest value in the experimental group of epitopes focused immunogens of LatA antigen (FIG. 12ⓐ). The above results suggest that the most significant effective defense against Lawsonia infection can occur when the two vaccine strains are mixed orally, and the epitopes focused immunogens of LatA antigens provide strong immunity-inducing ability among the two antigens. It means there is a possibility to do it.

Example 6. Confirmation of infection location of ileitis group and Salmonella delivery vaccine by immunohistochemistry (Immunohistochemistry, IHC)

Both Lawsonia and Salmonella are infected through the intestine. In addition, as endocellular live bacteria have similar infection sites and proliferation sites, they may induce infection with each other, and there are similarities in the mechanisms of living organisms to defend each pathogen. One of the main characteristics of Lawsonia infection is the reduction of mucin-producing goblet cells. Mucins are an important barrier to invading pathogens in the intestine, and due to reduced mucin production, Salmonella can easily access the lining of the colon and promote infection. Based on this, in order to confirm the degree of infection in the intestinal tract, the ileal tissues of mice inoculated with Salmonella delivery vaccine and Lawsonia attenuated strain were confirmed by immunohistochemical staining. As a result, it was found that the infected Salmonella delivery vaccine and Lawsonia bacteria were infected in the same location in the experimental group (FIG. 13). This suggests that the ileitis antigen expressed to the same site can be delivered through the Salmonella delivery strain, thereby causing an immune response at the same site.

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Vaccine composition for preventing or treating porcine proliferative enteritis and salmonellosis simultaneouly comprising attenuated Salmonella mutant expressing immunogen having improved antigenicity as effective component <130> PN19453 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 150 <212> PRT <213> Artificial Sequence <220> <223> LatA protein epitopes focused immunogen <400> 1 Met Val Arg Phe Phe Ala Gln Gln Gln Pro Asn Glu Asp Gln Leu Val 1 5 10 15 Gly Gly Asp Ile Asn Ile Asn Leu Glu Asn Val Thr Thr Pro Glu Phe 20 25 30 Tyr Gly Leu Tyr Gly Pro Leu Thr Val Asn Leu Ser His Ser Pro Glu 35 40 45 Ile Leu Gly Lys Ile Ile Thr Gln Pro Ile Pro Ile Ala Asp Val Phe 50 55 60 Gly Thr Ser Lys Leu Phe Val Glu His Asn Thr Lys Gly Leu Ile Trp 65 70 75 80 Val Ser Gly Gln Phe Ala Thr Asn Arg Thr Lys Thr Lys Cys Thr Gly 85 90 95 Phe Asp Glu Thr Tyr Asn Trp Lys Glu Asn Val Pro Thr Glu Ala Ile 100 105 110 Glu Ala Ser Val Asp Trp Ile Lys Gly Ile Ser Gly Asp Phe Ala Ala 115 120 125 Lys Ser Glu Val Leu Asn Met Lys Phe Lys Asp Lys Asn Asp Thr Ser 130 135 140 Thr Phe Arg Gly Lys Leu 145 150 <210> 2 <211> 267 <212> PRT <213> Artificial Sequence <220> <223> FliC-PAL-FliC <400> 2 Met Ser Leu Val Ile Asn Asn Asn Met Met Ala Ala Asn Ala Ala Arg 1 5 10 15 Asn Leu Asn Glu Ser Tyr Ser Arg Leu Ser Gln Ser Thr Arg Arg Leu 20 25 30 Ser Ser Gly Leu Arg Val Gly Thr Ala Ala Asp Asp Ser Ala Gly Leu 35 40 45 Ala Ile Arg Glu Leu Met Arg Ala Asp Ile Lys Thr Phe Gln Gln Gly 50 55 60 Ala Arg Asn Ala Asn Asp Ala Ile Ser Leu Val Gln Val Ala Asp Gly 65 70 75 80 Ala Leu Gly Val Ile Asp Glu Lys Leu Ile Arg Met Lys Glu Leu Ala 85 90 95 Glu Gln Ala Ala Ile Arg Val Arg Ile Glu Gly Asn Cys Asp Ala Arg 100 105 110 Gly Thr Gln Glu Tyr Asn Leu Ala Leu Gly Glu Arg Arg Ala Arg Ala 115 120 125 Ala Tyr Glu Tyr Leu Val Met Leu Gly Val Asn Pro Ser Gln Leu Glu 130 135 140 Ile Ile Ser Phe Gly Lys Glu Arg Pro Ala Val Glu Gly Thr Gly Pro 145 150 155 160 Ala Val Trp Ala Lys Asn Arg Arg Asp Asp Phe Arg Ile Ile Ala Lys 165 170 175 Gln Ala Ala Leu Asp Ala Ile Asn Asp Ala Ile Val Ser Lys Asp Asn 180 185 190 Ile Arg Ala Ser Leu Gly Thr Leu Gln Asn Arg Leu Glu Ala Thr Ile 195 200 205 Thr Asn Leu Asn Thr Gln Ala Glu Asn Leu Gln Ala Ala Glu Ser Arg 210 215 220 Ile Ser Asp Ile Asp Val Ser Thr Glu Met Thr Glu Phe Val Arg Asn 225 230 235 240 Gln Ile Leu Thr Gln Ser Gly Val Ala Met Leu Ser Gln Ala Asn Ser 245 250 255 Leu Pro Lys Met Ala Ser Gln Leu Ile Ser Gly 260 265 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 atggttcggt tttttgctca 20 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ccccggaaag tagacgt 17 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gtctttggtc attaacaaca ac 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gagttggctt gccatctttg 20 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tcaagtggca tagatgtgga agaa 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tggctctgca ggattttcat g 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 accgcaatga agaccctgat 20 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tccctccgca ttgacaca 18 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 acactccgtg ctgttgaaac 20 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 attggtattc tcctttctca tgt 23 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gcaaacaata aacttggtct tc 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ttctcctttc tcatgtccca t 21 <210> 15 <211> 162 <212> PRT <213> Lawsonia intracellularis <400> 15 Met Glu Val Phe Arg Arg Tyr Gly Ile Val Leu Val Leu Leu Val Val 15 19 24 29 Leu Ser Ala Gly Phe Gly Cys Cys Lys Lys Ser Val Asp Val Glu Gln 34 39 44 Ser Leu Ala Thr Glu Cys Ile Ala Pro Ala Pro Ala Ile Asn Ala Ala 49 54 59 Ala Glu Thr Ile Thr Asp Gly Ile Ile Tyr Phe Asp Phe Asp Lys Tyr 64 69 74 Asp Ile Lys Pro Glu Tyr Arg Asp Met Leu Gln Lys Lys Ala Glu Leu 79 84 89 94 Leu Lys Glu Tyr Pro Cys Ile Arg Val Arg Ile Glu Gly Asn Cys Asp 99 104 109 Ala Arg Gly Thr Gln Glu Tyr Asn Leu Ala Leu Gly Glu Arg Arg Ala 114 119 124 Arg Ala Ala Tyr Glu Tyr Leu Val Met Leu Gly Val Asn Pro Ser Gln 129 134 139 Leu Glu Ile Ile Ser Phe Gly Lys Glu Arg Pro Ala Val Glu Gly Thr 144 149 154 Gly Pro Ala Val Trp Ala Lys Asn Arg Arg Asp Asp Phe Arg Ile Ile 159 164 169 174 Ala Lys

Claims (7)

delete delete delete An attenuated Salmonella mutant comprising an antigen consisting of the amino acid sequence of SEQ ID NO: 1 derived from an autotransporter protein derived from Lawsonia intracellularis; And an attenuated Salmonella mutant comprising an antigen consisting of the amino acid sequence of SEQ ID NO: 2 in which a flagella protein derived from Lawsonia intracellularis and a peptidoglycan-associated lipoprotein are fused. . A vaccine composition for the simultaneous prevention or treatment of porcine proliferative ileitis and salmonellosis, comprising a mixture of the attenuated Salmonella mutant strain of claim 4 as an active ingredient. [6] The vaccine composition of claim 5, wherein the vaccine composition is for oral or subcutaneous administration. A feed additive for simultaneous prevention of porcine proliferative ileitis and salmonellosis, comprising a mixture of the attenuated Salmonella mutant strain of claim 4 as an active ingredient.

Images