KR20190053506A - Vaccin compsosition for preventing or treating porcine pathogenic colibacillosis comprising ghost enterotoxigenic Escherichia coli as effective componet - Google Patents

Abstract

The present invention relates to a vaccine composition for preventing or treating colibacillosis in pigs, containing improved ghost enterotoxigenic escherichia coli as an active ingredient. The ghost enterotoxigenic escherichia coli is prepared by treating an enterotoxigenic escherichia coli strain expressing F4 or F18 with GI24 represented by the amino acid sequence of SEQ ID NO: 1.

Description

Technical Field [0001] The present invention relates to a vaccine composition for preventing or treating porcine colicosis, which comprises an improved ghost enteric colitis micro-organism Escherichia coli as an effective ingredient.

The present invention relates to a vaccine composition for preventing or treating porcine colicosis comprising an improved ghost enteric colitis coliform microorganism as an active ingredient.

Enterotoxigenic Escherichia coli (ETEC)] causes diarrhea, especially diarrhea in newborn piglets and weaned pigs, and is one of the most common bacteria and is considered one of the most economically important diseases in the swine industry worldwide. ETEC usually attaches to the surface of intestinal epithelium using Pimbria. The most important Pimbral expression strain related to ETEC is known as F4 + ETEC (K88ac + ETEC among three serotypes) and F18ac + ETEC. These ETEC strains secrete enterotoxins, that is, heat-stable enterotoxins (STa and STb) and heat-labile enterotoxins (LT) after adherence to the intestinal mucus, resulting in severe diarrhea in newborn piglets and piglets. Thus, these Pimbria are known to play an important role in ETEC diarrhea.

In general, most infections in piglets after weaning can be prevented through vaccination at the time of the feeding piglets. However, until now there has been no preventive vaccine for piglets to prevent colicosis in piglets after weaning. It is also known that inactivated dead bacteria vaccine produced by chemical treatment of a typical culture bacteria which has been used for the manufacture of E. coli vaccine may potentially affect the structural immunity of the bacterial surface antigens, This inactivated vaccine is known to induce low-level and short-term immune responses. Thus, traditionally manufactured methods for the production of killed vaccine require multiple inoculations with a strong adjuvant to induce effective protective immunity. However, vaccines prepared by conventional methods have major risks such as an allergic reaction to the chemicals added to the preparation, sarcomas at the vaccination site. On the other hand, ghosted inactivated bacteria maintains the cell surface antigen structure that retains the shape of living cells and bacterial adhesion characteristics intact. In addition, ghosted bacteria have inherent adjuvant properties and are reported to be capable of inducing systemic, mucosal and cellular immune responses.

The use of bacterial ghost cells as a vaccine candidate to develop safe and effective vaccines against infectious diseases is a new and progressive approach. It has been shown that oral or parenteral inoculation of these new ghost vaccine candidate substances in animals can effectively induce humoral and cellular immune responses. In addition, the portion of vaccine production that is an important part of immunogenicity is inactivated chemically and physically, without change, and thus retains the extracellular components that maintain immunogenicity such as bacteria.

Antimicrobial peptides (AMPs) found in most animals and plants play an important role in congenital immune responses and have broad-spectrum activity against these AMPs. These antimicrobial actions cause these AMPs to bind to the bacterial cell membrane and react quickly to create a hole in the cell membrane, causing the cellular component to escape, eventually leading to death. To date, eleven host defense peptides (HDPs) or antimicrobial peptides (AMPs) have been reported in pigs, and porcine myeloid antimicrobial peptide-36 (PMA-36) is known to have the highest positivity. The α-helical domain of the PMA36 N-terminal is known as the active site. This peptide has the ability to penetrate the bacterial membrane through electron-bonding with a peptide having a positive charge and a negative charge with a negative charge of the bacterial cell membrane. In particular, the N-terminal alpha-helix domain of 24 amino acids (GI24) among the 36 amino acids of PMAP-36 also maintains the antimicrobial effect of PMAP-36.

Korean Patent No. 1478202 discloses a multi-purpose ghost salmonella vaccine and an animal immune response flow method using the same. However, a vaccine for preventing or treating porcine colicosis, which comprises the improved ghost enterotoxin Escherichia coli mutant strain of the present invention as an active ingredient, The composition is not described.

DISCLOSURE OF THE INVENTION The present invention was conceived to solve the problems as described above. The present inventors produced an improved ghost gastroenterologic E. coli by inducing ghosting of F4 + ETEC strain and F18 + ETEC strain using GI24, The present inventors have completed the present invention by confirming that a vaccine containing a small E. coli strain effectively prevents diarrhea in weaned piglets.

In order to achieve the above object of the present invention, the present invention provides an improved ghost extract, which is obtained by treating G424 expressed by the amino acid sequence of SEQ ID NO: 1 in a small intestine small intestine E. coli expressing F4 or a small intestine small intestine E. coli expressing F18 And to provide a colonoscopic small E. coli.

According to a preferred embodiment of the present invention, the enterohepatocyte E. coli expressing F4 may be HJL593.

According to a preferred embodiment of the present invention, the enterovirus small E. coli monkey expressing F18 may be HJL565.

The present invention provides, in order to accomplish another object, a method for producing an improved ghost enterotoxin-small E. coli comprising the following steps.

(a) inoculating a Listeria monocytogenes Escherichia coli expressing F4 or a Escherichia coli Escherichia coli strain expressing F18 in an LB liquid medium and culturing at 35 to 37 ° C; And

(c) reacting GI24 expressed by the amino acid sequence of SEQ ID NO: 1 with the cultured enterotoxin small E. coli at 35 to 37 DEG C for 1 hour to 24 hours.

According to a preferred embodiment of the present invention, the enterohepatocyte E. coli expressing F4 may be HJL593.

According to a preferred embodiment of the present invention, the enterovirus small E. coli monkey expressing F18 may be HJL565.

In order to accomplish another object of the present invention, there is provided an improved ghost gastroenterologic Escherichia coli described above; A culture thereof, and a mixture thereof. The present invention also provides a vaccine composition for preventing or treating porcine colicosis.

According to a preferred embodiment of the present invention, the vaccine composition may be characterized by inoculating sows or piglets.

In order to accomplish another object of the present invention, there is provided a gastrointestinal tract small intestine; And a feed additive for preventing porcine colicosis of pigs, which comprises at least one selected from the group consisting of a culture thereof and a mixture thereof.

As a result of conducting the challenge infection with the small intestine poison small outbreak strain after inoculating the muscle of the improved ghost intestinal tract small intestine E. coli according to the present invention, diarrhea and mortality were not observed in the piglet inoculated with the strain of the present invention. Therefore, the ghost intestinal venom micro-coli of the present invention has an effect of being able to prevent E. coli diarrhea after the muscle inoculation of the weaning pig.

Brief Description of the Drawings Figure 1 is a group electron micrograph of (A) GI24 peptide untreated group and (B) GI24 peptide treatment of intestinal tubular small intestine E. coli according to the present invention.
FIG. 2 shows the results of serum antibody titers for each antigen of the present invention (Group A: control group, group B: vaccine group containing Gastrointestinal tract coliform Escherichia coli).

Hereinafter, the present invention will be described in more detail.

DISCLOSURE OF THE INVENTION The object of the present invention is to solve the above problems of the present invention by providing a method of treating GI24 expressed by the amino acid sequence of SEQ ID NO: 1 in a small intestine toxin E. coli expressing F4 or a small intestine E. coli expressing F18 To provide an improved ghost enteric enterocyte E. coli.

According to a preferred embodiment of the present invention, the enterohepatocyte E. coli expressing F4 may be HJL593.

According to a preferred embodiment of the present invention, the enterovirus small E. coli monkey expressing F18 may be HJL565.

The present invention provides, in order to accomplish another object, a method for producing an improved ghost enterotoxin-small E. coli comprising the following steps.

(a) inoculating a Listeria monocytogenes Escherichia coli expressing F4 or a Escherichia coli Escherichia coli strain expressing F18 in an LB liquid medium and culturing at 35 to 37 ° C; And

(c) reacting GI24 expressed by the amino acid sequence of SEQ ID NO: 1 with the cultured enterotoxin small E. coli at 35 to 37 DEG C for 1 hour to 24 hours.

According to a preferred embodiment of the present invention, the enterohepatocyte E. coli expressing F4 may be HJL593.

According to a preferred embodiment of the present invention, the enterovirus small E. coli monkey expressing F18 may be HJL565.

In order to achieve still another object of the present invention, there is provided an improved ghost enteric capsule small coliform; A culture thereof, and a mixture thereof. The present invention also provides a vaccine composition for preventing or treating porcine colicosis.

According to a preferred embodiment of the present invention, the vaccine composition may be characterized by inoculating sows or piglets. But is not limited thereto.

The composition of the present invention may be administered orally or parenterally (for example, intramuscularly, intravenously, subcutaneously, intraperitoneally or topically), preferably by oral or parenteral But are not limited thereto. The dosage of the composition varies depending on the weight, age, sex, health condition, diet, administration time, administration method, excretion rate, severity of disease and the like. The dosage of the ghost vaccine composition is preferably about 2 × 10 8 to 2 × 10 11 cells, preferably about 2 × 10 9 to 2 × 10 10 cells per sow.

The term " vaccine " in the present invention refers to a biological agent containing an antigen that immunizes a living body. The term " vaccine " refers to an immunogenic or antigenic substance that causes immunization to a living body by injection or oral administration to a human or animal for the prevention of infection. In vivo immunity is largely divided into autoimmunity, which is obtained automatically in vivo after infection with pathogenic bacteria, and passive immunization, which is obtained by externally injected vaccine. While autoimmunity has a long period of immune-related antibody production and is characterized by persistent immunity, passive immunization by vaccine acts immediately for the treatment of infectious diseases but has a disadvantage that its persistence is poor.

The vaccine composition may contain one or more of a stabilizer, an emulsifier, aluminum hydroxide, an aluminum phosphate, a pH adjuster, a surfactant, a liposome, an iscom adjuvant, a synthetic glycopeptide, an extender, a carboxy polymethylene, a subviral particle adjuvant, , N, N-dioctadecyl-N ', N'-bis (2-hydroxyethyl) -propanediamine, monophosphoryl lipid A, dimethyl dioctadecyl- ammonium bromide, The second auxiliary agent may be further contained.

In addition, the vaccine composition may comprise a veterinarily acceptable carrier. The term " veterinarily acceptable carrier " as used herein includes any and all solvents, dispersion media, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, Examples of the carrier, excipient and diluent which can be contained in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, each of the above-mentioned compositions for the vaccine may be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, and nasal formulations such as drips or sprays, And the like. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, Or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. As the liquid preparation for oral administration, suspensions, solutions, emulsions, syrups and the like may be used. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and freeze-drying agents. Examples of the suspending agent include propylene glycol, polyethyleneglycol, vegetable oil such as olive oil, injectable ester such as ethylolate, and the like, but the present invention is not limited thereto. Penetrants suitable for formulation for intranasal administration are generally known to those skilled in the art. Such suitable formulations are preferably formulated to be sterile, emollient and buffered for stability and compliance. Formulations for intranasal administration are also prepared to stimulate mucus secretion in several ways to maintain normal ciliary action and are described in Remington's Pharmaceutical Science, 18th Ed., Mack Publishing Co., Easton, PA (1990) As noted, suitable formulations are preferably isotonic, slightly buffered formulations that maintain a pH of 5.5 to 6.5, and most preferably comprise an antimicrobial preservative and a suitable drug stabilizing agent.

In order to achieve a further object of the present invention, there is provided an improved ghost gastroenterologic Escherichia coli mutant strain described above; And a feed additive for preventing porcine colicosis of pigs, which comprises at least one selected from the group consisting of a culture thereof and a mixture thereof.

The feed additive of the present invention may be prepared by using the intestinal toxin-small E. coli mutant strain or a mixture thereof intact, or additionally, a known carrier such as cereal grains and by-products acceptable for livestock, a stabilizer, etc., (Such as polyphosphoric acid, catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, etc.) such as organic acids such as adipic acid, lactic acid and malic acid, sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate Natural antioxidants such as extracts, chitosan, tannic acid, and phytic acid, antibiotics, antimicrobial agents, and other additives may be added, and the shape thereof may be a proper state such as powder, granule, pellet, suspension, , It can be supplied to livestock alone or mixed with feed.

Materials and methods

1. Bacterial strains, plasmids and growth conditions

All bacterial strains used in this study are described in Table 1. F4 + (HJL593) and F18 + (HJL565) ETEC strains were used as strain for vaccine preparation and challenge infection. In order to identify and isolate F4 + ETEC and F18 + ETEC bacteria used in the present invention, a previously published article was referred (Kim et al. 2010). Reasons for diarrhea In order to collect feces from pigs, feces were collected from the rectum using a commercial swab set and transported to the laboratory in a refrigerated state. The transferred swabs were directly plated on eosin methylene blue agar (Difco, Sparks, Maryland, USA) and cultured at 37 ° C for 24 hours. Colonies that typically have large, dark blue-green metallic shine are selected. The selected colonies were inoculated into the blood culture medium and cultured at 37 ° C for 16 hours to confirm whether the cells were hemolyzed again. PCR was performed using F4 or F18 selective primers (listed in Table 2) in both the hemolytic and non-hemolytic colonies of beta hemolytic, to determine the Pimbral form of each E. coli. As a result of the PCR, it was confirmed once again that the strain having hemolytic activity among F4 + ETEC or F18 + ETEC was confirmed to be Escherichia coli using API32 kit and it was determined as a strain to be used in the final experiment (Kim JH, Hur J, Lee JH. Isolation of Escherichia coli E. coli DH5α and E. coli strain BL21 (DE3) produced K88ac and FedA antigen production, respectively, in E. coli BL21 (DE3) Over-expression host strains. All strains were cultured in LB broth and LB agar. The pQE31 and pET28a plasmids were also used to overexpress the K88ac and FedA antigens, respectively.

The strains and plasmids used in the study Strain / Plasmid Description Source Strains E. coli HJL593 Wild type F4ac (K88ac) ⁺ LT ^+, Sta ⁺ ETEC isolate from pig Lab stock HJL565 Wild type F18 ⁺ Sta ⁺ ETEC isolate from pig Lab stock DH5a 1, hsdR17 (SEQ ID NO: 1), dA (lacZ) 2, dA (rAF-lacZ), U169, phoA, glnV44, w80, D Promega BL21 (DE3) F ^- , ompT, hsdSB (r ^- _B , m ^- _B ), dcm, Promega HJL667 DH5a K88ac in pQE31 This study HJL669 BL21 (DE3) fedA in pET28a This study Plasmids   pQE31 IPTG-inducible expression vector; Am ^r QIAGEN pET28a IPTG-inducible expression vector; Km ^r Novagen

2. Manufacture of GI24

     GI24 (SEQ ID NO: 1: GRFRRLRKKTRKRLKKIGKVLKWI-NH2) was prepared using prptron (Daejeon, Korea).

3. Structure of F4 + and F18 + ETEC vaccine candidates

One colony of F4 + ETEC or F18 + ETEC strains was selected and inoculated into 200 ml of LB liquid medium, respectively, and cultured at 37 ° C until the absorbance reached 0.3. The GI24 peptide was added to the culture medium to a concentration of 40 μg / ml, and each ETEC strain was reacted at 37 ° C for 16 hours until lysis was induced. After the reaction, 100 μl of each reaction solution was inoculated into LB agar medium and broth, respectively, and incubated at 37 ° C for 5 days to confirm the lysis of the reaction solution with or without colony formation. The lysis reaction solution was concentrated by centrifugation at 4000 × g for 30 minutes, washed three times with sterile PBS, resuspended at a final concentration of 1 × 10 ⁹ cells / ml, and stored at -20 ° C. .

4. Transmission electron microscopy (TEM) of F4 + and F18 + ETEC vaccine candidates

Preparation of bacterial samples before and after treatment with GI24 peptide for each ETEC bacterium was prepared in the same manner as for the preparation of F4 + ETEC and F18 + ETEC ghost vaccines. The TEM was photographed according to the method described in Lv et al (Lv et al.2014). As shown in Figure 1, F4 + ETEC and F18 + ETEC strains not treated with GI24 peptide showed intact cell membranes and intact cell filled spontaneous cell contents (FIG. 1A). On the other hand, each ETEC strain ghosted by the GI24 peptide was observed to have an empty cytoplasmic space with a perforated cell membrane as shown in Figure 1B

5. Vaccination and Disease Collection

Large Yorkshire mammal piglets were used in this study, and all piglets were moved to a barn equipped with a heat lamp. Commercial diets containing no antibiotics or growth promoters were also fed. A total of 20 piglets were divided into two groups. All groups of piglets were vaccinated with intramuscular injection (once every 2 weeks, 2 times every 4 weeks). Group A pigs were inoculated with 2 ml of sterile PBS as a control. Group B pigs were inoculated with 2 × 10 ⁹ ghost cells in a total volume of 1 × 10 ⁹ ghost cells mixed with 2 × PBS and F4 + ETEC and F18 + ETEC, respectively. Blood was collected at 0 WPPI (before post-immunization), 2 WPPI (pre-vaccination) and 4 WPPI (before challenge). All specimens were stored at minus 70 ° C until use. The animal tests reported in this experiment were approved by the Animal Care Committee of Chonbuk National University, which was accredited by the Korean Council on Animal Care.

6. ELISA for evaluation of immune response

After inoculation with F4 + ETEC and F18 + ETEC ghost vaccines, recombinant K88ac and FedA proteins were purified from HJL667 and HJL669 according to the manufacturer's recommended method for antibody titration measurements. To determine the optical density (OD) for ETEC fimbrial antigen-specific IgG in each serum, pig IgG (Bethyl Lab Inc. Montgomery, TX, USA) ELISA quantitation kit was used according to manufacturer's instructions. Serum was diluted 1: 400 for serum titers. The antibody titers of each zygote serum IgG to recombinant K88ac and FedA antigens in vaccinated piglets are shown in Fig. Serum IgG titers against K88ac and FedA were significantly increased in the inoculated group compared to the control group (P ≤ 0.05).

7. Challenging infection

The challenge infectious strains JHL593 and HJL565 were prepared according to the method described previously (Hur and Lee 2011; and 2013). All piglets challenged orally at 6 weeks of age with a 2 ml mixture (1 × 10 ⁹ CFU / ml each of F4 + ETEC and F18 + ETEC). Diarrhea and mortality of all piglets were monitored for 14 days post challenge challenge. When diarrhea was observed after challenge infection, the isolating isolates of the challenge infectious strains from the swab of piglets were identified and PCR was performed with each of the Pimbria-specific primers described in Table 2 of the isolated strains. If PCR included one of the genes of at least one ETEC Pimbria challenged, it was considered to be diarrhea due to challenge infection. All weaned pigs were orally challenged at 6 weeks of age. Among the 10 goat piglets belonging to Group B, only one did not have diarrhea. In contrast, diarrhea was observed in 7 out of 10 piglets (70%) in Group A.

The primers used for identification of the challenge infectious strains after challenge infection Adhesin Sequence Size Primer coordinates Accession number F4 GCTGCATCTGCTGCATCTGGTAGTG (SEQ ID NO: 2)
CCACTGAGTGCTGGTAGTTACAGCC (SEQ ID NO: 3 792 31-54 M29374 798-822 F18 GTGAAAAGACTAGTGTTTATTTC (SEQ ID NO: 4)
CTTGTAAGTAACCGCGTAAGC (SEQ ID NO: 5) 510 160-182 M61713 649-669

The digestive tract is the main space for digestion and nutrition absorption. In addition, intestinal blood plays an important role in preventing bacterial antigens and toxins from infecting the host. The intestinal status of the new money can be changed by several factors. Among such factors, suckling pigs and juveniles are particularly sensitive to many bacterial infections. The reason for this is the separation from the sows, the coexistence with other groups of pigeons that are similar in size to those of the same breed, and the stresses that are sensitive to many bacteria due to changes in feed and environment, not familiar mammals. Mucosal immunity is more important in defense against ETEC colibacillosis than systemic immunity. Some industrial sow vaccines for the prevention of ETEC colibacillosis for the piglet piglets have been marketed, but the vaccine for the sow pigs has not been sold yet. However, recently, studies on the development of vaccines against edema diseases, which are mainly caused by pathogenic Escherichia coli, have been conducted in weaned piglets, or have only reached the final stage of sales. However, the formalin - inactivated vaccine to prevent colibacillosis in newborn piglets may alter the physicochemical and structural properties of bacterial surface antigens, and formalin - inactivated ETEC vaccines may not be effective in preventing colibacillosis in newborn piglets. Therefore, it is necessary to develop new vaccines that do not alter the structural and physicochemical properties of bacteria. The ETEC ghost vaccine, induced by the GI24 peptide, retains native surface structures with high immunogenicity to the cell, making holes in the bacterial cell membrane to release intracellular cytoplasmic substances out of the cell Eventually inactivate. Therefore, GI24-induced ghost vaccine candidates can be used as more advanced vaccine candidates in pigs. Therefore, in this study, GI24 peptides were induced to ghost by F4 + ETEC and F18 + ETEC causing diarrhea in weaned piglets. After immunization of these ETEC ghost vaccine candidates with the piglets, To see if the defense against. As a result, a significant increase in the serum IgG of K88ac and FedA antigens was observed in the mixed inoculation group of F4 + ETEC and F18 + ETEC ghost vaccine. These results suggest that the IM vaccination of the new ETEC vaccine candidate has a protective immune response It can be effectively induced. To observe the efficacy of vaccine candidates, all piglets challenged with wild-type ETEC strains. Diarrhea was observed in 70% after challenge infection in piglets of control group A. However, diarrhea was not observed in almost all of the piglets in the vaccinated group, suggesting that intramuscular injection of ghost vaccine candidates to the feed piglets may be effective in defending against ETEC colibacillosis in piglets after the induction. , It was confirmed that inoculating the ETEC ghost vaccine into the rabbit pigs effectively induces the systemic immune response. In addition, no clinical symptoms were observed after challenging with wild-type virulent ETEC strains after muscle inoculation in the piglets, whereas 70% of the control group's piglets had diarrhea. Therefore, based on these results, we suggest that inoculation of mammalian piglets with our new vaccine candidate may be effective in defending ETEC colibacillosis after induction.

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Vaccin compsosition for preventing or treating porcine pathogenic          colibacillosis comprising ghost enterotoxigenic Escherichia coli          as effective componet <130> 1063237 <160> 5 <170> KoPatentin 3.0 <210> 1 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> protein of GI24 <400> 1 Gly Arg Phe Arg Arg Leu Arg Lys Lys Thr Arg Lys Arg Leu Lys Lys   1 5 10 15 Ile Gly Lys Val Leu Lys Trp Ile              20 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer of F4 <400> 2 gctgcatctg ctgcatctgg tagtg 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of F4 <400> 3 ccactgagtg ctggtagtta cagcc 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> foward primer of F18 <400> 4 gtgaaaagac tagtgtttat ttc 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of F18 <400> 5 cttgtaagta accgcgtaag c 21

Claims (9)

An improved gut gastroentericum Escherichia coli treated with GI24 expressed by the amino acid sequence of SEQ ID NO: 1 in enteric-coated small intestine E. coli expressing F4 or intestinal toxin-resistant E. coli expressing F18. The improved colostomy gland colostrum as claimed in claim 1, wherein the enteric capsule small E. coli expressing F4 is HJL593. The improved colostrum ghost enteric colitis according to claim 1, wherein said F18-expressing small intestine colonic colony is HJL565. (a) inoculating a Listeria monocytogenes Escherichia coli expressing F4 or a Escherichia coli Escherichia coli strain expressing F18 in an LB liquid medium and culturing at 35 to 37 ° C; And
(c) reacting GI24 expressed by the amino acid sequence of SEQ ID NO: 1 with the cultured enterotoxin small E. coli at 35 to 37 DEG C for 1 hour to 24 hours;
&Lt; / RTI &gt; wherein the method comprises the steps of: 5. The method of claim 4, wherein the intestinal venom microcolleum expressing F4 is HJL593. 3. The method of claim 1, wherein the enteric-coated small coliform bacterium expressing F18 is HJL565. The improved ghost enteric enterocyte coli of claim 1; A culture thereof, and a mixture thereof, as an active ingredient. The present invention also provides a vaccine composition for preventing or treating porcine colicosis. 8. The vaccine composition according to claim 7, wherein said vaccine composition is inoculated into sows or piglets. The improved ghost enteric enterocyte coli of claim 1; A culture thereof and a mixture thereof, as an active ingredient. The present invention also provides a feed additive for preventing porcine colicosis from swine.

Images