KR101743275B1

KR101743275B1 - Single nucleotide polymorphism marker for detecting Haliotis gigantea and method of detecting Haliotis gigantea using the same

Info

Publication number: KR101743275B1
Application number: KR1020150118250A
Authority: KR
Inventors: 이제희; 완창; 이숙경; 산자야 바티제; 겔샨 이마르샤나 고다헤와; 한둔 자야싱게; 샨타쿠마르 툴라시타 윌리엄
Original assignee: 제주대학교 산학협력단
Priority date: 2015-08-21
Filing date: 2015-08-21
Publication date: 2017-06-02
Also published as: KR20170022792A

Abstract

The present invention relates to a kit for detecting a single nucleotide polymorphism (SNP) marker, a gene amplification primer set containing the marker, a kit comprising the primer set, and a primer set using the primer set And more particularly, to a technique for detecting horse overturns in a more rapid and economical manner than conventional techniques through primers for detecting SNP markers.

Description

[0001] The present invention relates to a single nucleotide polymorphism marker for detection of horse abalone,

The present invention relates to a method for detecting a single nucleotide polymorphism (SNP) marker for horse abalone detection, a primer set for amplifying a gene containing the marker, a kit containing the primer set, This invention relates to a method for detecting horse overturning.

Korea's abalone aquaculture production is the second largest in the world after China, and the domestic abalone production, production amount, and export performance are increasing year by year, and favorable environment is provided to supply abundant quality sea tangle and seaweed. In recent years, the potential market value of the aquaculture industry has been widely recognized globally. In the field of abalone farming in Korea, the demand for abalone breeding is rapidly growing in the face of growth and disease tolerance.

In the study of the major countries, the abalone crossbred research team of the United States reported the development of shell traits using interspecific hybridization or crossbreeding of H. rufescens , H. sorenseni and H. corrugata , Dalian No.1, a hybrid of H. discus hannai (Mt. Iwate, Japan) and round abalone ( H. discus discus , Mt. Dalian, China) It is approved by new and different species approval committee, and the Ministry of Agriculture issued a new variety certificate and spread it as a new hybrid variety. In Japan, Cosmo Marine Ranch Co., Ltd. sells hybrid varieties of Jeot Abalone and Horse Abalone, which are faster than abalone and have better ability to adapt to environment and are easier to breed. Australia has also developed a hybrid breeding program of blacklip abalone and greenlip abalone (Jade Tiger Abalone, JTA) in cooperation with GSW (Great Southern Waters Pty Ltd.) and Australian Federation of Science and Industry Research Organization (CSIRO) It is progressing.

In order to collect and manage genetic resources and develop mass production system for seeds, it is required to develop crossbreeds with good traits by securing and characterizing genetic resources of abalones of good traits.

Representative abalones inhabited in Korea are round abalone (abalone, Haliotis discus discus , Haliotis madaka ), horse abalone ( Haliotis gigantea ), northern abalone (abalone, Haliotis discus hannai ), and they are distinguished by the shape and size of the shell, the reproductive cycle, the habitat environment, and the like.

" Haliotis gigantea "is a representative type of abalone belonging to the abalone family, and it is the largest type of abalone, which is 25cm in length. It is mainly found in Korea and Japan, and it is found in the deepest 50m depth of abalone The shell is oval or half-moon-shaped, the shell is thick and hard, and the back is round or swollen, flat or flat. The body layer is particularly developed and occupies most of the shell, the bottom layer is low and small, The spiral veins of the body layer are in the shape of a ridge line of about 25 lines, and the growth arteries are distributed thinly and uniformly, and form several layers depending on the growth. There are many, only four of them in the front. The left slope of the row is rounded, and without strong spiral veins The surface of the shell is reddish brown, and the inner surface of each shell has a strong pearly luster. The inner thread is wide, the width is relatively constant, the outer thread is thick and the thread is slightly curved according to the spiral. It is easy to use because it is thin and low in heat and low in slope on the left side. It is popular because it is rich in taste, it is rich in nutrients and widely used for medicinal purposes.

However, in order to develop stable production of abalone in order to develop abundant and abundant abalone varieties with problems such as aggravation of environment in farms, occurrence of mass mortality due to farming, and degradation of seeds, distinction of the four abalones The development of species specific markers is required.

The present inventors have made efforts to develop a method capable of detecting a horse abalone breed by specifically detecting single polynucleotide polymorphism (SNP) markers. As a result, SNP markers specifically detected in horse overturning were identified and selected. A primer for PCR (PCR) was developed to amplify the gene containing the gene, and the gene containing the SNP marker was amplified , And amplified products were analyzed to detect horse overturns. Thus, the present invention was completed.

Accordingly, it is an object of the present invention to provide a single nucleotide polymorphism marker (SNP) marker that can be usefully used to detect horse abduction.

Yet another object of the present invention is to provide a primer set for amplifying a gene containing the marker.

It is still another object of the present invention to provide a kit for detecting abalone, which comprises the primer set.

It is a further object of the present invention to provide a method for detecting horse overturns using the horse overturn specific marker and / or primer set.

The present invention relates to a kit for detecting a single nucleotide polymorphism marker (SNP) for horse abortion, a primer set for amplifying a gene containing the marker, a kit containing the primer set, Or a method for detecting horse overturn using a primer set.

Hereinafter, the present invention will be described in detail.

As one aspect of the present invention, it relates to single nucleotide polymorphism (SNP) markers for horse abduction detection.

The single nucleotide polymorphism (hereinafter referred to as SNP) marker for horse abortion detection is a gene or a fragment thereof capable of specifically detecting horse overturning, such as round abalone, northern abalone, and abalone and horse abalone, can do,

The single nucleotide polymorphism marker for horse overturning detection comprises:

Among the nucleotide sequences shown in SEQ ID NO: 3, polynucleotides essentially comprising the nucleotide sequence shown in SEQ ID NO: 1 and comprising 376 to 2420 consecutive nucleotides, such as SEQ ID NO: 1, SEQ ID NO: 2, A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;

Among the nucleotide sequences shown in SEQ ID NO: 6, polynucleotides comprising 367 to 1997 consecutive nucleotides which essentially include the nucleotide sequence shown in SEQ ID NO: 4, such as SEQ ID NO: 4, SEQ ID NO: 5, A polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 6;

Among the nucleotide sequences shown in SEQ ID NO: 9, polynucleotides comprising 413 to 1380 consecutive nucleotides which essentially include the nucleotide sequence shown in SEQ ID NO: 7, such as SEQ ID NO: 7, SEQ ID NO: A polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 9;

Among the nucleotide sequences shown in SEQ ID NO: 12, polynucleotides comprising 362 to 777 consecutive nucleotides which essentially include the nucleotide sequence shown in SEQ ID NO: 10, such as SEQ ID NO: 10, SEQ ID NO: A polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 12; And

A polynucleotide having a complementary base sequence of the polynucleotide, and a polynucleotide having a complementary base sequence of the polynucleotide.

Examples of the markers for horse abduction detection include polynucleotides comprising a nucleotide sequence of one of the nucleotide sequences shown in SEQ ID NOS: 1 to 12 or a polynucleotide comprising the complementary nucleotide sequence of SEQ ID NOS: 1, 4 and 7 , And 7 are shown in Table 1 below. The SNP positions are shown in bold and the primer regions are underlined.

SEQ ID NO: denomination
(Reference
sequence) Sequence listing (5'-3 ') size
(nucleotide) Number of SNPs Allele
Round-King-Horse One HaliotisDiscus03811 GTTCCCTGAGTTTCACACCACCATACT GAAAAGTTCCCGCGATTACCGTTGTAATCTTAATGGTCTAGACCGCGTGTCCCTATGACAACAATACAACAATCTTAAAATGACGCCAAGCCTTAGCTCAGATTTTGATAACTTTGTTCCAGTTTGAGAATCTTTGCTCCACAAATGATATGGATCCCATAAAAG C ATGGTGGACAAATATTTTTAAAATTATTTCAATGCAAAAAGTCATTGTGGATTATT T AATAATGTATGTACAAATATAGAAAATACCCCAAAAGAGACCATCTGGCCCCCCAAAAAGATACAGAAGGGATACAAAACATGTTAAAAACATATAT CTAACGACAATATCACGACGAGAACCCAC 376 2 (193) ATC

(250) CAT 4 HaliotisDiscus08959 ACTGCCCTGTTGTACTGGTGATG TCATAATAAGTCATAATCAGAAAAGGCAGTGCAAAAAGCACCACCAATGGTACTGAACGTTACATAGTCACCTGAGCTGAAGACCTGTCCCAGTAAACAGGACCCCAGTGCTCCAACTGTTGTCGGAATATG C TCATGTATAAAGATTCGGAGATTAATAGTGGGAGCA C GTTGAACATTTATGAGAAATTAACAATGGCAGCAGTCTGGACATTTATAGGAGATTTACAGTTGGAGCAGTCTGGACATTTGTGGGAAATTAACAGTGGGAGAAGTCTGGACATTTATGGGAGATTAACAGTGGGAGCATTCTGAACAT TCATAGGTGATCAAGGGTGTGTGGT 367 2 (156) GAC

(193) GTC 7 HaliotisDiscus10277 CCCAGACGGTGTACTCTTTGGACATT TATCATCACATCAAGTTTTCAGNAAAAAATGAAATGAAACAAAGTATTATTTTGGGTCTTAGAAATATTATTTTACCTTATCCTGACATATACTCATTGCTTGCCTCATCTCTTTCCGAAAAGGTAGTGGAAACGCCAGTGCTGTGTCTCGTGTGGCTGAGGGGTGCGTAGGGTGAAATATTTTTCTGTTCTTGGGACACAGTACAGGAGTTTCCATTAGCTTTT C GGAATGAGATGAGATAAGCACTTTGTATGAGTCAGGATAAATGTAAATTATGTTTTTACCCTAAAAAATATATTTTCTGATCTTGAAGCAAAATTTGAAAGTAATCAAAGGTTTTTTGATTCATGGTAGTTAT TTGTTGAAGAGGGAGTGATGTGACAACA 413 One (252) T-G-C 10 HaliotisDiscus04686 GGCACCTATCTACGCCAACCATTCT CCAGTAGGATCACAAAGCGATCTCTATGGTGCAGAATATCAAACTGATGCGGAGACGGCGCCTCTTCATAAACTGTATCAAGATGATATCCCGTGTGTGGTGTGTCGCAGTCGTCACAGGAGGAGTGCTGTCATGGTCCCTGCCAGGAATGAGTGCTTCCCTGAGTGGCACCTGGAATACAAGGGGTACCTCTTTGGGGGT G CCACTGAAGCAGATACTGGTCATACTGATTATGTCTGTGTTGATGGCGATGCAGAAGCTGTCGCGGGGGGTAAGGCAAACACAAACGGCCATCTCTTGTACCTGGTCGACTC TAAATGCGGTGCCTTACCTTGCC 362 One (227) A-T-G

Specifically, in the nucleotide sequence set forth in SEQ ID NO: 1, the species-detected SNP base of the abalone is the 193rd and / or 250th base. The 193rd base in the nucleotide sequence of SEQ ID NO: 1 is (A / T / C), and A, T or C base in round abalone, northern abalone and king abalone, and C base type in horse abalone. The 250th base in the nucleotide sequence of SEQ ID NO: 1 is (A / C / T), and A or C in round abalone, northern abalone and king abalone, and T base type in horse abalone.

In the nucleotide sequence shown in SEQ ID NO: 4, the species detection SNP base of rollover is the 156th base and / or the 193rd base. The 156th base in the nucleotide sequence of SEQ ID NO: 4 is (A / G / C), and A or G in round abalone, northern abalone and king abalone, and C base type in horse abalone. In the nucleotide sequence of SEQ ID NO: 4, the 193rd base is represented by (G / T / C) and is G or T in round abalone, northern abalone and king abalone, and C in horse abalone.

In the nucleotide sequence shown in SEQ ID NO: 7, the SNP base of the abortion-detected SNP is the 252nd nucleotide. (C / T / G) in the nucleotide sequence of SEQ ID NO: 7, G or T in round abalone, northern abalone and king abalone, and C in horse abalone.

In the nucleotide sequence shown in SEQ ID NO: 10, the SNP base of the abortion-detected SNP is the 227th base. In the nucleotide sequence of SEQ ID NO: 10, the detection base is represented by (A / T / G) in the 227th base and is A or T in round abalone, northern abalone and king abalone and G in horse abalone.

In the present invention, six SNP markers can be used for horse abduction detection based on the fact that there is a high probability that a specific base exists depending on the abalone variety at each SNP mutation position in the abalone locus. It was confirmed that the specific base type was specifically associated with the horse overturning variety.

In one embodiment of the present invention, the present invention relates to a primer set that specifically amplifies a gene comprising a single nucleotide polymorphic marker that can be usefully used to detect horse abortion.

Specifically, the primer set includes:

A first primer consisting of a base sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 19; And

A second primer consisting of a base sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20;

And a primer set for a polymerase chain reaction (PCR).

For example, the primer set includes a primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and the nucleotide sequence of SEQ ID NO: 14; A primer pair consisting of the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 16; A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 18; And a primer pair consisting of the nucleotide sequence of SEQ ID NO: 19 and the nucleotide sequence of SEQ ID NO: 20; and a pair of at least one primer selected from the group consisting of:

The nucleotide sequences of SEQ ID NOS: 13 to 20 are shown in Table 2 below.

order
number denomination Sequences (5 '-> 3') Tm
(° C) Product size
(bp) 13 HaliotisDiscus03811-F GTTCCCTGAGTTTCACACCACCATACT 60 376 14 HaliotisDiscus03811-R GTGGGTTCTCGTCGTGATATTGTCGTTAG 60 15 HaliotisDiscus08959-F ACTGCCCTGTTGTACTGGTGATGT 60 367 16 HaliotisDiscus08959-R ACCACACACCCTTGATCACCTATGA 60 17 HaliotisDiscus10277-F CCCAGACGGTGTACTCTTTGGACATT 60 413 18 HaliotisDiscus10277-R TGTTGTCACATCACTCCCTCTTCAACAA 60 19 HaliotisDiscus04686-F GGCACCTATCTACGCCAACCATTCT 60 362 20 HaliotisDiscus04686-R GGCAAGGTAAGGCACCGCATTTA 60

The primer set for the polymerase chain reaction of the present invention is a primer set that amplifies a gene containing a single base polymorphism marker that specifically appears in horse abduction.

In another aspect of the present invention, the present invention provides a kit for detecting abortion comprising the primer set. The kit may include a buffer solution, DNA polymerase, dNTP, and distilled water, which may be used without limitation, such as solutions, enzymes and the like commonly used in the art.

For example, the kit may be a restriction fragment length polymorphism (PCR) kit, an allele-specific PCR kit, a real-time PCR kit, a DNA chip kit or a Southern blotting kit. In addition to the primers, the kit may further comprise a DNA polymerase, a DNA staining reagent or a suitable carrier.

In another aspect of the present invention, the present invention provides a method for detecting horse overturn using the primer set.

Specifically, the method comprises: performing a polymerase chain reaction (PCR) with a primer set; And analyzing the product of the polymerase chain reaction.

The step of performing the PCR may be a conventional PCR, preferably a conventional PCR or a real-time PCR, And more preferably a real-time polymerase chain reaction. The conventional polymerase chain reaction may be performed by amplifying a specific DNA, and then performing a step of confirming amplification of the specific DNA, And the step of confirming amplification of the specific DNA may be performed by a method of confirming the size of the DNA product amplified through electrophoresis etc. The real time PCR is preferably performed using SYBR Green I May be a real-time polymerase chain reaction.

The polymerase chain reaction can be carried out using a conventional polymerase chain reaction device. The polymerase chain reaction device is preferably a real time polymerase chain reaction device, a thermal block polymerase chain reaction Block PCR) and a device for micro-PCR (Micro PCR), and more preferably a device for real-time polymerase chain reaction.

The extraction of the template DNA, that is, the sample DNA, can be performed by a conventional DNA extraction method. The DNA extraction method is preferably an alkaline extraction method, a hot water extraction method, a column extraction method, or a phenol / Chloroform extraction method, and more preferably, an Alkaline extraction method.

The step of analyzing the amplification product may include analyzing the base sequence of the PCR product to confirm the presence of a single nucleotide polymorphism marker (SNP) marker.

As used herein, the term "primer" refers to a single strand of oligonucleotides that is hybridized under suitable conditions (presence of four different nucleoside triphosphates and polymerases such as DNA or RNA polymerases) Quot; means acting as a starting point at which to initiate directed DNA synthesis. The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

As used herein, the term "nucleotide" is a deoxyribonucleotide or ribonucleotide present in single or double stranded form, and includes analogs of natural nucleotides unless otherwise specifically indicated (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

As used herein, the term "ortholog" refers to a gene derived from a common ancestral gene and found in a different species as a result of species differentiation. A gene found in a different species is considered an ortholog if its nucleotide sequence and / or its coded protein sequence share significant identity as defined elsewhere herein. The function of the ortholog is often highly conserved among species. Accordingly, it is suitable for use in detecting the horse overturning of the present invention from other species of rollover.

The present invention relates to a kit for detecting a single nucleotide polymorphism (SNP) marker, a gene amplification primer set containing the marker, a kit comprising the primer set, and a primer set using the primer set The present invention relates to a method of detecting a horse overturn by performing a polymerase chain reaction and detecting a horse overturn using a primer set for detecting SNP markers according to the present invention in a faster and more economical manner than the existing technology.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flowchart showing a method for developing SNP markers in an embodiment of the present invention. FIG.
2 is a flowchart illustrating a method of performing a SNP comparison according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Selection of SNP markers by ortholog analysis

A transcriptome database of round abalone, king abalone, and horse abalone was constructed. Next, we compared the offsets of the royal overturning and the horse overturning on the basis of the rounded abductor. At this time, the number of transcripts of round abalone was 37,852, compared with 62,769 and 62,314, respectively. The tBLASTx program compared the ovoles of round abalone, king abalone, and horse abalone, and the number of transcripts compared was 11,506. The results are shown in Table 3 below.

division Round abalone Horse abalone King Abalone Input transcripts 37,852 62,769 62,314 Ortholog group transcripts
(1e-4) 11,506 11,506 11,506 Ratio
(%) 30.4 18.3 18.5 Specific transcripts
(1e-2) 577 2,708 3,056 Ratio
(%) 1.5 1.3 4.9 Etc 25,769 48,555 47,752

Next, the SNPs were analyzed by the CLCAssemblyCell program based on 37,852 transposons, which were 37,860,919 bp in round abalone total. Table 4 shows the assembly results with the mapping parameter indenty of 95% or more and HSP coverage of 90% or more.

Species Horse abalone King Abalone Mapping parameter Identity 80% 90% 95% 80% 90% 95% HSP coverage 50% 80% 90% 50% 80% 90% Mapped reads No. 36,770,297 33,389,813 30,612,802 39,302,46 35,248,856 30,864,732 -79.70% -72.40% -66.40% -78.80% -70.60% -61.90% Genome coverage All 35,565,783 35,117,279 34,362,838 34,963,697 34,365,814 33,103,404 -93.90% -92.80% -90.80% -92.40% -90.80% -87.40% > 3 reads 34,460,163 33,780,786 32,702,869 33,654,326 32,803,855 31,093,720 -91.00% -89.20% -86.40% -88.90% -86.60% -82.10% Average depth 241.9 225.6 208.7 256.3 236.8 209.5

As can be seen in Table 4, the number of mapped reads was 30,612,802 in the case of horse overturning and 30,864,732 in the case of king overturning.

Then, SNP calling was performed with the CLCAssemblyCell program, and the results are shown in Table 5 below. The calling parameter was set to min ratio 0.2, min allele change value 3, and min depth 5.

Library Horse abalone King Abalone Variations No. 423,884 571,985 SNP type Substitution No.
(%) 374,144 Homo 205,197 512, 743 Homo 404, 245 -59.1 -70.7 -88.3 Hetero 124,947 -89.6 Hetero 108, 498 -29.5 -19 Insertion No. 18,445 24,959 (%) -4.4 -4.4 Deletion No. 30,295 34,283 (%) -7.2 -6

As shown in Table 5, 423,884 SNPs were obtained in the horse abalone and 571,985 SNPs in the royal abalone. These SNPs were divided into Substitution type, Insertion type and Deletion type. Substitutional SNPs were divided into homo and heterozygous forms, with 205,197 homozygous forms of horse abalone and 404,245 homozygous forms of king abalone. Among the SNP callings, homo - abortion and homo - abortion homozygous SNP were selected and compared with round abortion.

As a result of SNP comparison, 1,329 SNP markers were selected as candidates, and 1,248 specific transcripts including SNP were selected. Among these, 1,176 transcripts with one SNP, 64 transcripts with two transcripts, seven transcripts with three transcripts, and one transcript with four transcripts were identified, and the results are shown in Table 6 below .

Number of SNPs per transcript Number of transfers 4 One 3 7 2 64 One 1,176 Total 1,248

Subsequently, the nucleotide sequences predicted to be applicable as SNP markers capable of distinguishing round abalone, king abalone, and horse abalone were selected. Specifically, 19 nucleotide sequences with a depth of 5 or more and a rate of 100% were selected from 1,248 specific transcripts, and one nucleotide sequence with a rate of 95% and a depth of 5 or more was selected. The selected nucleotide sequences are shown in Table 7 below, H. discus discus in Table 8, H. gigantean in Table 8, and H. madaka in Table 9.

Reference seq. Length
(bp) position allele count depth Rate
(%) HaliotisDiscus02013 2,342 1,736 A 7 7 100.0 HaliotisDiscus02891 3,290 2,237 A 10 10 100.0 HaliotisDiscus03811 2,420 861 C 8 8 100.0 HaliotisDiscus03811 2,420 804 A 10 10 100.0 HaliotisDiscus05725 1,234 997 A 14 14 100.0 HaliotisDiscus06858 2,231 1,990 G 16 16 100.0 HaliotisDiscus08959 1,997 334 G 12 12 100.0 HaliotisDiscus08959 1,997 371 G 10 10 100.0 HaliotisDiscus09356 766 189 G 7 7 100.0 HaliotisDiscus10277 1,380 1,049 T 15 15 100.0 HaliotisDiscus10347 2,831 1,072 G 6 6 100.0 HaliotisDiscus12227 960 446 C 5 5 100.0 HaliotisDiscus12797 594 455 C 6 6 100.0 HaliotisDiscus13384 1,422 899 G 8 8 100.0 HaliotisDiscus14164 1,646 1,016 A 11 11 100.0 HaliotisDiscus27269 2,786 1,473 A 8 8 100.0 HaliotisDiscus29114 1,411 936 T 9 9 100.0 HaliotisDiscus29191 662 421 A 12 12 100.0 HaliotisDiscus29748 792 122 A 6 6 100.0 HaliotisDiscus04686 777 571 A 31 32 96.9

Reference seq. Length
(bp) position allele count depth Rate
(%) HaliotisDiscus02013 2,342 1,736 G 222 222 100.0 HaliotisDiscus02891 3,290 2,237 G 52 52 100.0 HaliotisDiscus03811 2,420 861 A 85 85 100.0 HaliotisDiscus03811 2,420 804 T 128 128 100.0 HaliotisDiscus05725 1,234 997 G 64 64 100.0 HaliotisDiscus06858 2,231 1,990 C 36 36 100.0 HaliotisDiscus08959 1,997 334 A 97 97 100.0 HaliotisDiscus08959 1,997 371 T 38 38 100.0 HaliotisDiscus09356 766 189 A 150 150 100.0 HaliotisDiscus10277 1,380 1,049 G 271 271 100.0 HaliotisDiscus10347 2,831 1,072 A 205 205 100.0 HaliotisDiscus12227 960 446 T 146 146 100.0 HaliotisDiscus12797 594 455 A 89 89 100.0 HaliotisDiscus13384 1,422 899 T 190 190 100.0 HaliotisDiscus14164 1,646 1,016 G 294 294 100.0 HaliotisDiscus27269 2,786 1,473 C 63 63 100.0 HaliotisDiscus29114 1,411 936 G 168 168 100.0 HaliotisDiscus29191 662 421 T 258 258 100.0 HaliotisDiscus29748 792 122 G 64 64 100.0 HaliotisDiscus04686 777 571 T 32 32 100.0

Reference seq. Length
(bp) position allele count depth Rate
(%) HaliotisDiscus02013 2,342 1,736 T 213 213 100.0 HaliotisDiscus02891 3,290 2,237 T 44 44 100.0 HaliotisDiscus03811 2,420 861 T 214 214 100.0 HaliotisDiscus03811 2,420 804 C 219 219 100.0 HaliotisDiscus05725 1,234 997 T 156 156 100.0 HaliotisDiscus06858 2,231 1,990 T 79 79 100.0 HaliotisDiscus08959 1,997 334 C 89 89 100.0 HaliotisDiscus08959 1,997 371 C 64 64 100.0 HaliotisDiscus09356 766 189 T 62 62 100.0 HaliotisDiscus10277 1,380 1,049 C 166 166 100.0 HaliotisDiscus10347 2,831 1,072 T 158 158 100.0 HaliotisDiscus12227 960 446 A 100 100 100.0 HaliotisDiscus12797 594 455 T 62 62 100.0 HaliotisDiscus13384 1,422 899 C 209 209 100.0 HaliotisDiscus14164 1,646 1,016 C 236 236 100.0 HaliotisDiscus27269 2,786 1,473 G 99 99 100.0 HaliotisDiscus29114 1,411 936 C 218 218 100.0 HaliotisDiscus29191 662 421 C 158 158 100.0 HaliotisDiscus29748 792 122 T 34 34 100.0 HaliotisDiscus04686 777 571 G 119 120 99.2

Then, among the above 20 nucleotide sequences, the four nucleotide sequences shown in Table 10 below were finally selected. The SNPs in each nucleotide sequence are shown in bold type, and the underlined portions in each nucleotide sequence indicate the forward primer (front) and the reverse primer (rear), respectively.

Example 2. Preparation of primer

A gene specific primer was designed to amplify the SNP-containing sequence of the selected overturned gene through the selection of the SNP marker of Example 1. The nucleotide sequences of the primers are shown in Table 11.

The optimal annealing temperature (Tm) for multiplex PCR for this primer combination is all at 60 ° C. By designing the base sequence of the primer so that the deviation of the optimum annealing temperature between each primer is minimized, not only the easiness of the chain polymerization reaction but also the accuracy of the reaction result is maximized.

Example 3. PCR Performing and Analysis

A total of 39 genomic DNAs (gDNA) were collected except for one horse abalone, which was collected with the help of the YangSuSan Research Institute, Jeju Island, with 10 round abalones, 10 abalones, 10 abalones and 10 abalones And used as a template strand for PCR.

Concretely, 3 μl of gDNA, 5 μl of 10 × reaction buffer, 5 μl of dNTPs (each 2.5 mM), 2 μl of forward primer, 2 μl of reverse primer, 0.2 μl of Ex-taq polymerase and 32.58 μl of reaction water were mixed, After 5 minutes of reaction, the sequences were amplified for 35 seconds at 94 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds. Finally, the PCR product was stabilized at 72 ° C for 7 minutes to complete the PCR. &Lt; / RTI > The above 39 PCR products were analyzed by asking for a base at SNP position in Macrogen (Korea), and the results are shown in Table 12 below.

SNP marker Sequencing results % SNP marker Species Allele One 2 3 4 5 6 7 8 9 10 One HaliotisDiscus03811
1 ^st loci Round abalone A C T T C A A A C C A 40 Northern abalone - C A C / A A C T A A A C - King Abalone T C C T T T A C T T C 50 Horse abalone C C C C C C C C C C 100 HaliotisDiscus03811
2 ^nd loci Round abalone C A C A A C C C A A C 50 Northern abalone - A C A / C C A A C C C A - King Abalone A A A A A C A A A A A 90 Horse abalone T T T T T T T T T T 100 2 HaliotisDiscus08959
1 ^st loci Round abalone G G G G A / G G G G G A G 80 Northern abalone - G G G G G A G G G G - King Abalone A A A / G A A / G A A G G G A 50 Horse abalone C C C C C C C C C C 100 HaliotisDiscus08959
2 ^nd loci Round abalone G G G G / T G G T T G G G 70 Northern abalone - G G G G G T G G G G - King Abalone T T T / G T T / G T T G G G G 40 Horse abalone C C C C C C C C C C 100 3 HaliotisDiscus04686 Round abalone A A A T A A T T A T A 60 Northern abalone - A T A T T T T T T T - King Abalone T T T T T T T T T T T 100 Horse abalone G G G G G G G G G G 100 4 HaliotisDiscus04686 Round abalone A A A T A A T T A T A 60 Northern abalone - A T A T T T T T T T - King Abalone T T T T T T T T T T T 100 Horse abalone G G G G G G G G G G 100

The nucleotide sequence was analyzed by sequencing using forward primer in the nucleotide sequence analysis and compared with the SNP allele of each abalone species in the SNP candidate sequence analysis result obtained from the abalone database, We checked to see if a total of 10 (9 horses) were representative of species alleles.

As can be seen from the results shown in Table 10, it was confirmed that all six SNPs were conserved in horse overturning (100%), but not in all other abortions.

<110> Jeju National University Industry-Academic Cooperation Foundation <120> Single nucleotide polymorphism marker for detecting Haliotis gigantea and method of detecting Haliotis gigantea using the same <130> DPP20151834 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 376 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus03811_1 <400> 1 gttccctgag tttcacacca ccatactgaa aagttcccgc gattaccgtt gtaatcttaa 60 tggtctagac cgcgtgtccc tatgacaaca atacaacaat cttaaaatga cgccaagcct 120 tagctcagat tttgataact ttgttccagt ttgagaatct ttgctccaca aatgatatgg 180 atcccataaa agcatggtgg acaaatattt ttaaaattat ttcaatgcaa aaagtcattg 240 tggattattt aataatgtat gtacaaatat agaaaatacc ccaaaagaga ccatctggcc 300 ccccaaaaag atacagaagg gatacaaaac atgttaaaaa catatatcta acgacaatat 360 cacgacgaga acccac 376 <210> 2 <211> 658 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus03811_2 <400> 2 ctgcattgtt acattcatgg agattgtcca aattttatta ttttaaaaga gaaattattat 60 tttaagatac ttatgtttta cattgtttct aaaataacca aacatatggt tccctgagtt 120 tcacaccacc atactgaaaa gttcccgcga ttaccgttgt aatcttaatg gtctagaccg 180 cgtgtcccta tgacaacaat acaacaatct taaaatgacg ccaagcctta gctcagattt 240 tgataacttt gttccagttt gagaatcttt gctccacaaa tgatatggat cccataaaag 300 catggtggac aaatattttt aaaattattt caatgcaaaa agtcattgtg gattatttaa 360 taatgtatgt acaaatatag aaaatacccc aaaagagacc atctggcccc ccaaaaagat 420 acagaaggga tacaaaacat gttaaaaaca tatatctaac gacaatatca cgacgagaac 480 ccaccaaata atacatatta tgcatgtata atgtattcta ttggtttttg agattatcaa 540 gtctgaaaac ccaggcccac tggcaaggca tacgattaaa tggaattgct ggaatcatga 600 ctgtcattcc tgatgtggcg ccagctttga aatcaaagta tcctgggtat cctagcaa 658 <210> 3 <211> 2420 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus03811_3 <400> 3 ttcctttaat ccatgggttt atttcatact ggcaagaatt atgtcataca aatgcatctt 60 cccaaaaata agtctctgga atgatatggt gaggatgttc ttgtttacac tgctttccaa 120 caagtatatt gatgatatag tagcatcaac tttacatgac aggaaagtcc aaactgatgc 180 agccgtatgt gtgttcaccc ttcttgtggg gtgtctactg aagtaccagt aatcgggtag 240 aacctgagtt catccccacg accagtaatc gggtagaacc tgagttcatc cccacaacag 300 cacgggatgg aagaattgca gcacacaatt ggccctgcct gcttcctgga atgttataca ttatgggaat 420 atctgactga atagttcata tctaaatgat atttctatac atcacatgaa attttaaccc 480 cttgaattta aagtgacata agtctgcatt gttacattca tggagattgt ccaaatttta 540 ttattttaaa agagaaatat tattttaaga tacttatgtt ttacattgtt tctaaaataa 600 ccaaacatat ggttccctga gtttcacacc accatactga aaagttcccg cgattaccgt 660 tgtaatctta atggtctaga ccgcgtgtcc ctatgacaac aatacaacaa tcttaaaatg 720 acgccaagcc ttagctcaga ttttgataac tttgttccag tttgagaatc tttgctccac 780 aaatgatatg gatcccataa aagcatggtg gacaaatatt tttaaaatta tttcaatgca 840 aaaagtcatt gtggattatt taataatgta tgtacaaata tagaaaatac cccaaaagag 900 accatctggc cccccaaaaa gatacagaag ggatacaaaa catgttaaaa acatatatct 960 aacgacaata tcacgacgag aacccaccaa ataatacata ttatgcatgt ataatgtatt 1020 ctattggttt ttgagattat caagtctgaa aacccaggcc cactggcaag gcatacgatt 1080 aaatggaatt gctggaatca tgactgtcat tcctgatgtg gcgccagctt tgaaatcaaa 1140 gtatcctggg tatcctagca acgtcactgt ggtggcggga cccggctgtg gagcagctag 1200 ctccagcata tctccccgag gccagctgag agtgatggcg tacacggaaa taccagttga 1260 agacttcttg gacgtgtacc agacatcagg tgccgctgtg tcattctggg tagtccaggg 1320 tcgtgtctca tagatggcgt cgccattaac cttcagccat tgtcccatct gacgcagcct 1380 ctcagcaaat atcgggttga tcatgccgct agaggtgggg ccagcattca gcaggaagtt 1440 gccaccgcag ctgacaactt ggacaagctg agtaataagt gcatgagctg tgttgaagtc 1500 accaatcttg gcgttgcgcc ggaaagccca tgcgtacttg tctatcgttg ttgcatcctc 1560 gaatttgtgc ttctgtacca cacctggatt gtacttgtca tggcaggtgt agtatcctcc 1620 gtgtttacac atgcattcat ctccccagcg atcgttggtc accacagtgt ccttgatggg 1680 gctgtcgtta tacagccagg ccaggaagtg tgtggagttc cagtaggacg atggggccag 1740 ccaggacccg tcagaccata tgagatctgg cttgtactga ttcactaact catacaactc 1800 aggcatggtc ttgaacttaa caaagtcttg ggtcttgaat ttgttcttct gatcctggag 1860 ccataacggg ttgacaaact cgaacagtga gtggtaaata ccaaacctga ggattgactt 1920 cttccgtata gagttggcca ggtcacccac taagtccctg cgagggccaa catccataga 1980 attccagttg aaggagtgtt ttgtattcca gttgcagaat ccttcatggt gctttgatgt 2040 aagcacaaca tatcttgccc ccgaagcgtt gaatatctcc gcccattcgt cggggttgta 2100 gt; tctcataaac tccacaacgt ccgttctgtt ttctcgccaa tactcctgaa accaagcacc 2220 tgcgaagctt ggaacagaga acacccccca gtgaagaaag atgccaaact tggcctcgtc 2280 gtaccaggcc gggaggggcc tctggtccag tgactcccat gttgggtcgt agcgggcacc 2340 tgccgctagt gtcacagtca acaacgtgca caacaacagt ccagccatgt tgtacgatct 2400 cgtatctatt gatgttcccc 2420 <210> 4 <211> 367 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus08959_1 <400> 4 actgccctgt tgtactggtg atgtcataat aagtcataat cagaaaaggc agtgcaaaaa 60 gcaccaccaa tggtactgaa cgttacatag tcacctgagc tgaagacctg tcccagtaaa 120 caggacccca gtgctccaac tgttgtcgga atatgctcat gtataaagat tcggagatta 180 atagtgggag cacgttgaac atttatgaga aattaacaat ggcagcagtc tggacattta 240 taggagattt acagttggag cagtctggac atttgtggga aattaacagt gggagaagtc 300 tggacattta tgggagatta acagtgggag cattctgaac attcataggt gatcaagggt 360 gtgtggt 367 <210> 5 <211> 638 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus08959_2 <400> 5 tatggacata tatacacaaa gatatacatc aaagggtctt aagccaacta tgcacaaggc 60 tatcagtaaa cagcagttaa atttgtgtga tttgaagact cagactcaag tccagctgac 120 caataattga acaaccctcc aacaaactgc cctgttgtac tggtgatgtc ataataagtc 180 ataatcagaa aaggcagtgc aaaaagcacc accaatggta ctgaacgtta catagtcacc 240 tgagctgaag acctgtccca gtaaacagga ccccagtgct ccaactgttg tcggaatatg 300 ctcatgtata aagattcgga gattaatagt gggagcacgt tgaacattta tgagaaatta 360 acaatggcag cagtctggac atttatagga gatttacagt tggagcagtc tggacatttg 420 tgggaaatta acagtgggag aagtctggac atttatggga gattaacagt gggagcattc 480 tgaacattca taggtgatca agggtgtgtg gtattaccca tacaccagta tattgtggtg 540 caaatcttca gcaatacgta ttgcgatacg tttgtatatg tagcaatata ttagggcaaa 600 cataaataag tatatttatg tgttcctaat ggatatgg 638 <210> 6 <211> 1997 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus08959_3 <400> 6 tttttacttt atccaaatgg atttatttga acatatggac atatatacac aaagatatac 60 atcaaagggt cttaagccaa ctatgcacaa ggctatcagt aaacagcagt taaatttgtg 120 tgatttgaag actcagactc aagtccagct gaccaataat tgaacaaccc tccaacaaac 180 tgccctgttg tactggtgat gtcataataa gtcataatca gaaaaggcag tgcaaaaagc 240 accaccaatg gtactgaacg ttacatagtc acctgagctg aagacctgtc ccagtaaaca 300 ggaccccagt gctccaactg ttgtcggaat atgctcatgt ataaagattc ggagattaat 360 agtgggagca cgttgaacat ttatgagaaa ttaacaatgg cagcagtctg gacatttata 420 ggagatttac agttggagca gtctggacat ttgtgggaaa ttaacagtgg gagaagtctg 480 gacatttatg ggagattaac agtgggagca ttctgaacat tcataggtga tcaagggtgt 540 gtggtattac ccatacacca gtatattgtg gtgcaaatct tcagcaatac gtattgcgat 600 acgtttgtat atgtagcaat atattagggc aaacataaat aagtatattt atgtgttcct 660 aatggatatg gagatgggaa atagtatctt tctgatacaa cttgcctgtg actatctttt 720 ttatcaatta gcgtgcacac atcgcgtcta tcaagctctt cacagcgata gcctgttcgc 780 ggagctccct agagtacatg catataactg actgatggta tttgacatta cagggtttaa 840 ctctgattaa ctcaaggaaa tgtaaattgg taacatattg caatacaggt taaagtatgg 900 caatatattg caatacaaaa tccaggtcaa tacacagccc tagtgattaa cagtgggagc 960 actctgaaca ttccttagaa cagggaaccc ttgagaatgt ctgcgagaat tcatattttg 1020 taacatttct ggatttaatt ggtcacaaaa tgtacactat cgcatctcct tgcctttcta 1080 caaagatgtc tacaaaaata attccatgtc agaaaataat aactgtactc tgtcctgaca 1140 ccgtttaaat ggacttgcca ttcacacccc ctgccacttc acagtccagg agcagccacc 1200 aacaccttcg tccctgtaca gcttgttcac ttctatcaca tctggtgtaa taatttcaac 1260 acattctgca caaagaatgt tgatagaggt cgagtccaca aataagttag acactgtgtg 1320 ctggaggcat gtgtttccac cgtcatgagg cagtggtgac tcggtcgagg atgtggcggt 1380 agacgtccac gtggtcctgg aaggtcttct ccaggtacag gtggcgctgc tctagggaca 1440 tgcaactaag cgtctgggac aactcctcgg gctgcagagc tttctccaac ttcttgaagt 1500 cacgcccatt cttctggaag ggtgcattga gtcgcctctt gatgtccagc ctgtactgtc 1560 tgtacatctc cgtgttactt gggtcagtgg ctcggagtcg cagcatctcg tacactcgcc 1620 gtgtctgacg ccgagatagt ttgagtttct tctgcgcctc aatcaccatg tcctctgaga 1680 atcccagata caacctgtct ggctcaaaac tggtcagctc catgcagttc ttaacatcaa 1740 caaagtcacg caatctctga aagttctcag aggggtcttc aactgttata tccagcacgt 1800 tggagcttga gtagcagctg ttgtagaagg tttggagaag ctgagcacca tgaccttgtt 1860 tctggaacgg cggcaggatc aacacttggc tgattctggg acgaatcttt tctggataag 1920 cataatattt atacactgtc atgtacccga caatagcata catagggttc ccattggatt 1980 tgtatttctc gaataga 1997 <210> 7 <211> 413 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus10277_1 <400> 7 cccagacggt gtactctttg gacatttatc atcacatcaa gttttcagna aaaaatgaaa 60 tgaaacaaag tattattttg ggtcttagaa atattatttt accttatcct gacatatact 120 cattgcttgc ctcatctctt tccgaaaagg tagtggaaac gccagtgctg tgtctcgtgt 180 ggctgagggg tgcgtagggt gaaatatttt tctgttcttg ggacacagta caggagtttc 240 cattagcttt tcggaatgag atgagataag cactttgtat gagtcaggat aaatgtaaat 300 tatgttttta ccctaaaaaa tatattttct gatcttgaag caaaatttga aagtaatcaa 360 aggttttttg attcatggta gttatttgtt gaagagggag tgatgtgaca aca 413 <210> 8 <211> 601 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus10277_2 <400> 8 ctttagttgt gttgttattt tttgtgttgt agtattttca gatgttctcc ccagacggtg 60 tactctttgg acatttatca tcacatcaag ttttcagnaa aaaatgaaat gaaacaaagt 120 attattttgg gtcttagaaa tattatttta ccttatcctg acatatactc attgcttgcc 180 tcatctcttt ccgaaaaggt agtggaaacg ccagtgctgt gtctcgtgtg gctgaggggt 240 gcgtagggtg aaatattttt ctgttcttgg gacacagtac aggagtttcc attagctttt 300 cggaatgaga tgagataagc actttgtatg agtcaggata aatgtaaatt atgtttttac 360 cctaaaaaat atattttctg atcttgaagc aaaatttgaa agtaatcaaa ggttttttga 420 ttcatggtag ttatttgttg aagagggagt gatgtgacaa cattctttct agtaagaaaa 480 tataatgttg aatttttata ttcagttttg aactctttag tgttcatctt tgttatgtaa 540 ccattgtaac tatgtattgg tgcaatatgt ctgtcttttg tttgttgtct atttacattg 600 t 601 <210> 9 <211> 1380 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus10277_3 <400> 9 gggctcattt gtgacttctg tgagttatca aaggccctgt tattagttga ctaatgagag 60 acttgcgttg ctgctccacc acaaaccctg tgaagtgttg atgagaatat ctttagcgaa 120 aagcacaaca aatatgctga tggtaacaaa ttaagggaac aaagaaaagt ggaggaaaat 180 acggcttact gtcattacat ttgaaattgc gcttacaaat tcaacacatc agtatcaaat 240 gatgagatgt gtttgtgtgc gttgttacca gctcgtattt ggtagacaac tcatgataac 300 attattttac tgtgtctaaa actaagtatt tccttattca tgtccatcag tatacattaa 360 gagagagatt ttaacaggta caaggtctgt gcatggtggc caggtttctt tccacaacct 420 ggggcctgtt tcacaaagcg attgtaacgc tacgactgtt gttagtctgt gttaaactat 480 aggagatatg atagtcgaag cgctagtgtc actttgtgaa acgaggccca gttctttcga 540 actgctgtga gcatctgtgt aagtatggaa gttacaatat gttctagtcc aacgatcact 600 ttgtgcaagt gaatcctaat cacagaacta gtttgtgttg aagcagggga gttattgcag 660 ttgttgtgca agctctaaga ctttagcact gactttgtca aagagcaaag cttgctctgt 720 gaaagtggat tgtggttatt tactgaagct ttagttgtgt tgttattttt tgtgttgtag 780 tattttcaga tgttctcccc agacggtgta ctctttggac atttatcatc acatcaagtt 840 ttcagnaaaa aatgaaatga aacaaagtat tattttgggt cttagaaata ttattttacc 900 ttatcctgac atatactcat tgcttgcctc atctctttcc gaaaaggtag tggaaacgcc 960 agtgctgtgt ctcgtgtggc tgaggggtgc gtagggtgaa atatttttct gttcttggga 1020 cacaktacag gagtttccat tagcttttcg gaatgagatg agataagcac tttgtatgag 1080 tcaggataaa tgtaaattat gtttttaccc taaaaaatat attttctgat cttgaagcaa 1140 aatttgaaag taatcaaagg ttttttgatt catggtagtt atttgttgaa gagggagtga 1200 tgtgacaaca ttctttctag taagaaaata taatgttgaa tttttatatt cagttttgaa 1260 ctctttagtg ttcatctttg ttatgtaacc attgtaacta tgtattggtg caatatgtct 1320 gtcttttgtt tgttgtctat ttacattgtc atgatgaata aaattaatgt aatgaaacat 1380 1380 <210> 10 <211> 362 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus04686_1 <400> 10 ggcacctatc tacgccaacc attctccagt aggatcacaa agcgatctct atggtgcaga 60 atatcaaact gatgcggaga cggcgcctct tcataaactg tatcaagatg atatcccgtg 120 tgtggtgtgt cgcagtcgtc acaggaggag tgctgtcatg gtccctgcca ggaatgagtg 180 cttccctgag tggcacctgg aatacaaggg gtacctcttt gggggtgcca ctgaagcaga 240 tactggtcat actgattatg tctgtgttga tggcgatgca gaagctgtcg cggggggtaa 300 ggcaaacaca aacggccatc tcttgtacct ggtcgactct aaatgcggtg ccttaccttg 360 cc 362 <210> 11 <211> 507 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus04686_2 <400> 11 atgtataaag gttatgcagg agggagccat taccaggcca cgggaggacc aggaacaact 60 ctgtgcctcc ctgaggcacc tatctacgcc aaccattctc cagtaggatc acaaagcgat 120 ctctatggtg cagaatatca aactgatgcg gagacggcgc ctcttcataa actgtatcaa 180 gatgatatcc cgtgtgtggt gtgtcgcagt cgtcacagga ggagtgctgt catggtccct 240 gccaggaatg agtgcttccc tgagtggcac ctggaataca aggggtacct ctttgggggt 300 gccactgaag cagatactgg tcatactgat tatgtctgtg ttgatggcga tgcagaagct 360 gtcgcggggg gtaaggcaaa cacaaacggc catctcttgt acctggtcga ctctaaatgc 420 ggtgccttac cttgcccacc atatgttgaa ggctgggaga tgacatgcgc tctttgcaca 480 aaataaaatc atgtcacctg caaaaaa 507 <210> 12 <211> 777 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus04686_3 <400> 12 ggttgtattc agtccacaac catgacgtta acgctgcatg ctaccatcat cgtcctggcg 60 gcagggatgg tcaaagctga tatctacaat ccgtacacac acccgtccac caaccggagg 120 ttcttgcatg agctgaagtc gctgctgagg ctctatctgg gagagaaggt tctgccacca 180 gaaactttca ctcaacatgg aagcgacctg gaaggaggag ctgtgttcac tcggtggggg 240 aggacaacat gtccgtcagg aaatgatgtc atgtataaag gttatgcagg agggagccat 300 taccaggcca cgggaggacc aggaacaact ctgtgcctcc ctgaggcacc tatctacgcc 360 aaccattctc cagtaggatc acaaagcgat ctctatggtg cagaatatca aactgatgcg 420 gagacggcgc ctcttcataa actgtatcaa gatgatatcc cgtgtgtggt gtgtcgcagt 480 cgtcacagga ggagtgctgt catggtccct gccaggaatg agtgcttccc tgagtggcac 540 ctggaataca aggggtacct ctttgggggt gccactgaag cagatactgg tcatactgat 600 tatgtctgtg ttgatggcga tgcagaagct gtcgcggggg gtaaggcaaa cacaaacggc 660 catctcttgt acctggtcga ctctaaatgc ggtgccttac cttgcccacc atatgttgaa 720 ggctgggaga tgacatgcgc tctttgcaca aaataaaatc atgtcacctg caaaaaa 777 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus03811-F <400> 13 gttccctgag tttcacacca ccatact 27 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus03811-R <400> 14 gtgggttctc gtcgtgatat tgtcgttag 29 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus08959-F <400> 15 actgccctgt tgtactggtg atgt 24 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus08959-R <400> 16 accacacacc cttgatcacc tatga 25 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus10277-F <400> 17 cccagacggt gtactctttg gacatt 26 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus10277-R <400> 18 tgttgtcaca tcactccctc ttcaacaa 28 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus04686-F <400> 19 ggcacctatc tacgccaacc attct 25 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HaliotisDiscus04686-R <400> 20 ggcaaggtaa ggcaccgcat tta 23

Claims

Among the nucleotide sequences shown in SEQ ID NO: 6, polynucleotides comprising 367 to 1997 consecutive nucleotides essentially comprising the nucleotide sequence shown in SEQ ID NO: 4, and
And a polynucleotide complementary to the polynucleotide, wherein the markers comprise at least one polynucleotide selected from the group consisting of complementary polynucleotides of the polynucleotides.

The method according to claim 1,
Wherein the markers for horse abduction detection are one or more polynucleotides selected from the group consisting of the nucleotide sequences shown in SEQ ID NOS: 4 to 6 and complementary base sequences thereof.

The method according to claim 1,
Among the nucleotide sequences shown in SEQ ID NO: 3, polynucleotides essentially comprising the nucleotide sequence shown in SEQ ID NO: 1 and comprising 376 to 2420 consecutive nucleotides,
Among the nucleotide sequences shown in SEQ ID NO: 9, polynucleotides comprising 413 to 1380 consecutive nucleotides, which essentially include the nucleotide sequence shown in SEQ ID NO: 7,
Among the nucleotide sequences shown in SEQ ID NO: 12, polynucleotides comprising 362 to 777 consecutive nucleotides essentially comprising the nucleotide sequence shown in SEQ ID NO: 10, and
Wherein the polynucleotide further comprises at least one polynucleotide selected from the group consisting of complementary polynucleotides of the polynucleotides.

The method of claim 3,
Wherein the additional marker for detecting rollover is one or more polynucleotides selected from the group consisting of the nucleotide sequence shown in SEQ ID NO: 1 to 3 or 7 to 12 and the complementary base sequence thereof.

A primer set for a polymerase chain reaction comprising a pair of primers consisting of a base sequence of SEQ ID NO: 15 and a base sequence of SEQ ID NO:

6. The method according to claim 5,
A primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and the nucleotide sequence of SEQ ID NO: 14;
A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 18; And
A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 19 and the nucleotide sequence of SEQ ID NO: 20;
&Lt; / RTI > further comprising at least one primer pair selected from the group consisting of: < RTI ID = 0.0 >

6. The marker for detecting horse abalone according to claim 5, wherein the primer set is for genetic amplification including a marker for detecting horse abalone, wherein the marker for detecting horse abalone is selected from the group consisting of the nucleotide sequence shown in SEQ ID NO: 6 and the nucleotide sequence shown in SEQ ID NO: &Lt; / RTI > or a contiguous polynucleotide of said polynucleotide.

8. A kit for detecting abalone, comprising a primer set according to any one of claims 5 to 7.

9. The kit of claim 8, wherein the kit comprises a buffer solution, a DNA polymerase, and dNTPs.

A primer set according to claim 5
Obtaining a PCR product by performing a polymerase chain reaction (PCR); And
Analyzing the PCR product;
Wherein said method comprises the steps of:

[Claim 11] The method according to claim 10, wherein the polymerase chain reaction amplifies a marker for detecting horse abalone, wherein the marker for detecting horse abalone comprises a base sequence represented by SEQ ID NO: 6, A polynucleotide comprising from 367 to 1997 consecutive nucleotides, and a polynucleotide selected from the group consisting of complementary polynucleotides of said polynucleotides.

12. The detection method according to claim 11, wherein the marker for detecting horse abduction is at least one polynucleotide selected from the group consisting of a nucleotide sequence shown in SEQ ID NO: 4 to 6 and a complementary base sequence thereof.

12. The method of claim 11,
The primer set includes a primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and the nucleotide sequence of SEQ ID NO: 14, the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 18 and the nucleotide sequence and sequence of SEQ ID NO: Wherein the primer pair comprises at least one primer pair selected from the group consisting of primers consisting of the nucleotide sequence of SEQ ID NO:
The marker for detecting horse overturning
Among the nucleotide sequences shown in SEQ ID NO: 3, polynucleotides essentially comprising the nucleotide sequence shown in SEQ ID NO: 1 and comprising 376 to 2420 consecutive nucleotides,
Among the nucleotide sequences shown in SEQ ID NO: 9, polynucleotides comprising 413 to 1380 consecutive nucleotides, which essentially include the nucleotide sequence shown in SEQ ID NO: 7,
Among the nucleotide sequences shown in SEQ ID NO: 12, polynucleotides comprising 362 to 777 consecutive nucleotides essentially comprising the nucleotide sequence shown in SEQ ID NO: 10, and
Wherein the polynucleotide further comprises at least one polynucleotide selected from the group consisting of complementary polynucleotides of the polynucleotides.

14. The detection method according to claim 13, wherein the marker for detecting horse overturning is at least one polynucleotide selected from the group consisting of a nucleotide sequence shown in SEQ ID NO: 1 to 3 or 7 to 12 and a complementary base sequence thereof. .