KR101743105B1 - Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof - Google Patents

Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof Download PDF

Info

Publication number
KR101743105B1
KR101743105B1 KR1020150012671A KR20150012671A KR101743105B1 KR 101743105 B1 KR101743105 B1 KR 101743105B1 KR 1020150012671 A KR1020150012671 A KR 1020150012671A KR 20150012671 A KR20150012671 A KR 20150012671A KR 101743105 B1 KR101743105 B1 KR 101743105B1
Authority
KR
South Korea
Prior art keywords
nucleotide sequence
corynebacterium glutamicum
strain
sequence encoding
ala
Prior art date
Application number
KR1020150012671A
Other languages
Korean (ko)
Other versions
KR20160092557A (en
Inventor
이진원
이병훈
이새봄
김현수
Original Assignee
서강대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서강대학교산학협력단 filed Critical 서강대학교산학협력단
Priority to KR1020150012671A priority Critical patent/KR101743105B1/en
Publication of KR20160092557A publication Critical patent/KR20160092557A/en
Application granted granted Critical
Publication of KR101743105B1 publication Critical patent/KR101743105B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12R1/15—
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Abstract

본 발명은 (a) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열; (b) 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열; 또는 (c) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 포함하는 발현벡터로 형질전환된 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주에 관한 것이다. 야생종 코리네박테리움 글루타미컴 균주가 10-케토스테아린 산의 생산이 전혀 이루어지지 않는데 반해, 유전자 조작을 통해 재조합된 본 발명의 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주는 우수한 10-케토스테아린 산 생성능을 가지며, 10-케토스테아린 산을 탄소원으로 사용하지 않아 지속적으로 10-케토스테아린 산을 생산할 수 있다.(A) a nucleotide sequence encoding a hydratase; (b) a nucleotide sequence encoding an alcohol dehydrogenase; Or (c) 10-ketostearic acid transformed with an expression vector comprising a nucleotide sequence encoding a hydratase and a nucleotide sequence encoding an alcohol dehydrogenase, The present invention relates to a Corynebacterium glutamicum strain for production. Whereas the wild type Corynebacterium glutamicum strain does not produce 10-keto stearic acid at all, the Corynebacterium glutamicum strain of the present invention, which has been recombined through genetic engineering, has excellent 10-keto Stearic acid, and can produce 10-keto stearic acid continuously without using 10-keto stearic acid as a carbon source.

Description

10-케토스테아린 산의 생산능이 우수한 코리네박테리움 글루타미컴 균주 및 이의 제조방법{Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof}[0001] The present invention relates to a Corynebacterium glutamicum strain having excellent ability to produce 10-keto stearic acid, and a method for producing the same. [0002] Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof [

본 발명은 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주, 이의 제조방법 및 상기 균주를 이용한 10-케토스테아린 산 생합성 방법에 관한 것이다.The present invention relates to a Corynebacterium glutamicum strain for producing 10-ketostearic acid, a method for producing the same, and a method for biosynthesis of 10-ketoestearic acid using the strain.

코리네박테리움 글루타미컴(Corynebacterium glutamicum)은 그람-양성 토양박테리아로서, 비병원성이며 빠른 균 생장과 주변 환경 적응에 강한 성질로 인해 현재 산업용 균주로 많이 사용되고 있다. 특히 현재 글루타메이트와 라이신 등의 아미노산 생산용 균주로써 산업현장에서 널리 사용 되고 있는 균주이다(도 1). Corynebacterium glutamicum is a Gram-positive soil bacterium, and is currently used as an industrial strain due to its non-pathogenic and rapid bacterial growth and resistance to environmental adaptation. In particular, it is a strain widely used in industrial fields as an amino acid production strain such as glutamate and lysine (Fig. 1).

한편, 미생물을 이용하여 10-하이드록시스테아린 산(10-hydroxystearic acid; 10-HSA) 및 10-케토스테아린 산(10-ketostearic acid; 10-KSA)의 생산 연구가 많이 진행되어왔지만, 산업용 균주인 코리네박테리움 글루타미컴으로 생산하는 연구는 아직 진행되지 않았으며, 일반적인 10-HSA 및 10-KSA 생산 경로는 도 2와 같다.On the other hand, studies on the production of 10-hydroxystearic acid (10-HSA) and 10-ketostearic acid (10-KSA) have been conducted using microorganisms, Studies on the production of Corynebacterium glutamicum have not yet been conducted, and general 10-HSA and 10-KSA production pathways are shown in FIG.

현재 재생 가능한 지방산을 이용한 생물 전환반응에 관한 연구에 가장 널리 알려진 균주는 대장균(Escherichia coli)이다. 하지만, 대장균 같은 경우는 10-KSA를 탄소원으로 사용하기 때문에 10-KSA를 지속적으로 생산하기란 쉽지 않다. Escherichia coli is the most widely known strain for the bioconversion reaction using the renewable fatty acids. However, in the case of Escherichia coli, it is not easy to produce 10-KSA continuously because 10-KSA is used as a carbon source.

그리하여, 본 발명자들은 10-KSA를 탄소원으로 사용하지 않고, 지속적으로 생산 가능하도록, 적응력이 강한 코리네박테리움 글루타미컴(Corynebacterium glutamicum)을 이용하여 10-KSA를 생산하고자 하였다.
Thus, the present inventors tried to produce 10-KSA by using Corynebacterium glutamicum , which has a strong adaptability, so that 10-KSA can be continuously produced without using it as a carbon source.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

대한민국 공개특허공보 제10-2014-0015086호Korean Patent Publication No. 10-2014-0015086

본 발명자들은 우수한 10-케토스테아린 산(10-ketostearic acid) 생산능을 가지며, 유전자 조작을 통해 10-케토스테아린 산 생합성 대사산물을 안정적이고, 효과적으로 생산하는 균주의 개발을 위하여 예의 연구 노력하였고, 그 결과 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia) 유래 OhyA 유전자 및 마이크로코쿠스 루테우스(Micrococcus luteus) 유래 ADH 유전자군으로부터 선택된 1종 이상의 유전자를 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주를 형질전환 시킨 결과, 효과적으로 10-케토스테아린 산 생합성 경로가 과발현되고, 10-케토스테아린 산을 탄소원으로 사용하지 않아 지속적으로 10-케토스테아린 산을 생산 가능함을 확인함으로써, 본 발명을 완성하였다.
The present inventors have made intensive studies for the development of a strain capable of producing 10-keto-stearic acid (10-ketostearic acid) and producing 10-keto-stearic acid biosynthesis metabolites stably and efficiently through gene manipulation, Results One or more genes selected from the OhyA gene derived from Stenotrophomonas maltophilia and the ADH gene group derived from Micrococcus luteus were cultured in the presence of Corynebacterium glutamicum strain As a result of the conversion, it was confirmed that the 10-keto stearic acid biosynthesis pathway was effectively overexpressed and 10-keto stearic acid was not used as a carbon source, and 10-keto stearic acid could be continuously produced.

따라서, 본 발명의 목적은 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주를 제공하는 데 있다.Accordingly, an object of the present invention is to provide a strain of Corynebacterium glutamicum for the production of 10-ketostearic acid.

본 발명의 다른 목적은 상술한 본 발명의 10-케토스테아린 산 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주의 제조방법을 제공하는 데 있다.Another object of the present invention is to provide a method for producing Corynebacterium glutamicum strain for producing 10-keto stearic acid according to the present invention.

본 발명의 또 다른 목적은 상술한 본 발명의 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주를 이용하여 10-케토스테아린 산 생합성 방법을 제공하는 데 있다.
It is still another object of the present invention to provide a method for biosynthesis of 10-keto stearic acid using the above-described Corynebacterium glutamicum strain of the present invention.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 (a) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열; (b) 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열; 또는 (c) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 포함하는 발현벡터로 형질전환된 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주를 제공한다.
According to one aspect of the present invention, the present invention provides a nucleic acid molecule comprising (a) a nucleotide sequence encoding hydratase; (b) a nucleotide sequence encoding an alcohol dehydrogenase; Or (c) 10-ketostearic acid transformed with an expression vector comprising a nucleotide sequence encoding a hydratase and a nucleotide sequence encoding an alcohol dehydrogenase, A strain Corynebacterium glutamicum strain is produced.

본 발명자들은 우수한 10-케토스테아린 산(10-ketostearic acid) 생산능을 가지며, 유전자 조작을 통해 10-케토스테아린 산 생합성 대사산물을 안정적이고, 효과적으로 생산하는 균주의 개발을 위하여 예의 연구 노력하였고, 그 결과 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia) 유래 OhyA 유전자 및 마이크로코쿠스 루테우스(Micrococcus luteus) 유래 ADH 유전자군으로부터 선택된 1종 이상의 유전자를 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주를 형질전환 시킨 결과, 효과적으로 10-케토스테아린 산 생합성 경로가 과발현되고, 10-케토스테아린 산을 탄소원으로 사용하지 않아 지속적으로 10-케토스테아린 산을 생산 가능함을 확인하였다.
The present inventors have made intensive studies for the development of a strain capable of producing 10-keto-stearic acid (10-ketostearic acid) and producing 10-keto-stearic acid biosynthesis metabolites stably and efficiently through gene manipulation, Results One or more genes selected from the OhyA gene derived from Stenotrophomonas maltophilia and the ADH gene group derived from Micrococcus luteus were cultured in the presence of Corynebacterium glutamicum strain As a result of the conversion, it was confirmed that the 10-keto stearic acid biosynthesis pathway was over-expressed effectively and 10-keto stearic acid could be continuously produced without using 10-keto stearic acid as a carbon source.

본 발명의 일 구현예에 따르면, 상기 코리네박테리움 글루타미컴 균주는 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 각각 포함하는 2개의 발현벡터로 공동형질전환된다.According to one embodiment of the present invention, the Corynebacterium glutamicum strain comprises a nucleotide sequence encoding a hydratase and a nucleotide sequence encoding an alcohol dehydrogenase Lt; / RTI > expression vector.

본 발명의 다른 구현예에 따르면, 상기 코리네박테리움 글루타미컴 균주는 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 모두 포함하는 1개의 발현벡터로 공동형질전환된다.According to another embodiment of the present invention, the Corynebacterium glutamicum strain comprises a nucleotide sequence encoding a hydratase and a nucleotide sequence encoding an alcohol dehydrogenase. Lt; / RTI > expression vector.

본 명세서에서,“하이드라테이즈(hydratase)”는 올레산(oleic acid)으로부터 10-하이드록시스테아린 산(10-hydroxystearic acid)을 생산하는 효소로서, OhyA 유전자가 이를 코딩하는 유전자이다.In the present specification, "hydratase" is an enzyme that produces 10-hydroxystearic acid from oleic acid, and is a gene in which OhyA gene encodes it.

본 발명의 발현벡터에서 발현되는 상기 하이드라테이즈는 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia)로부터 유래한 것을 사용하는 것이 바람직하다. 더욱 바람직하게는 서열목록 제1서열로 표시되는 하이드라테이즈를 발현하도록 할 수 있으며, 상기 하이드라테이즈를 코딩하는 뉴클레오티드 서열은 바람직하게는 서열목록 제2서열로 표시될 수 있다.The hydratase expressed in the expression vector of the present invention is preferably derived from Stenotrophomonas maltophilia . More preferably the hydratase expressed in the first sequence of SEQ ID NO: 1, and the hydratase-encoding nucleotide sequence can be preferably represented by SEQ ID NO: 2.

본 명세서에서,“알코올 디하이드로게네이즈(alcohol dehydrogenase)”는 10-하이드록시스테아린 산(10-hydroxystearic acid)으로부터 10-케토스테아린 산(10-ketostearic acid)을 생산 하는 효소로서, ADH 유전자가 이를 코딩하는 유전자이다.In this specification, an enzyme which produces an "alcohol-dihydro-to tyrosinase (alcohol dehydrogenase)" is 10-keto-stearin acid (10-ketostearic acid) from the 10-hydroxy stearin acid (10-hydroxystearic acid), the ADH gene it Coding genes.

본 발명의 발현벡터에서 발현되는 상기 알코올 디하이드로게네이즈는 마이크로코쿠스 루테우스(Micrococcus luteus)로부터 유래한 것을 사용하는 것이 바람직하다. 보다 바람직하게는 서열목록 제3서열로 표시되는 알코올 디하이드로게네이즈를 발현하도록 할 수 있으며, 상기 알코올 디하이드로게네이즈를 코딩하는 뉴클레오티드 서열은 바람직하게는 서열목록 제4서열로 표시될 수 있다.The alcohol dehydrogenase expressed in the expression vector of the present invention is preferably derived from Micrococcus luteus . More preferably the alcohol dihydrogenase represented by SEQ ID NO: 3, and the nucleotide sequence encoding the alcohol dehydrogenase may preferably be represented by SEQ ID NO: 4.

본 발명에서 이용되는 뉴클레오티드 서열은 상기 언급된 서열 이외에 상기 뉴클레오티드 서열에 대하여 실질적인 동일성을 나타내는 뉴클레오티드 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 본 발명의 뉴클레오티드 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 80%의 상동성, 보다 바람직하게는 최소 90%의 상동성, 가장 바람직하게는 최소 95%의 상동성을 나타내는 뉴클레오티드 서열을 의미한다. 서열비교를 위한 얼라인먼트 방법은 당업계에 공지되어 있다. 얼라인먼트에 대한 다양한 방법 및 알고리즘은 Smith and Waterman, Adv. Appl. Math. 2:482(1981); Needleman and Wunsch, J. Mol. Bio. 48:443(1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31(1988); Higgins and Sharp, Gene 73:237-44(1988); Higgins and Sharp, CABIOS 5:151-3(1989); Corpet et al., Nuc. Acids Res. 16:10881-90(1988); Huang et al., Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al., Meth. Mol. Biol. 24:307-31(1994)에 개시되어 있다. NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10(1990))은 NBCI (National Center for Biological Information) 등에서 접근 가능하며, 인터넷 상에서 blastp, blasm, blastx, tblastn and tblastx와 같은 서열 분석 프로그램과 연동되어 이용할 수 있다. BLSAT는 http://www.ncbi.nlm.nih.gov/BLAST/에서 접속 가능하다. 이 프로그램을 이용한 서열 상동성 비교 방법은 http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html에서 확인할 수 있다.The nucleotide sequence used in the present invention is interpreted to include a nucleotide sequence that exhibits substantial identity to the nucleotide sequence in addition to the above-mentioned sequence. The above substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and analyzing the aligned sequence using algorithms commonly used in the art to obtain a minimum of 80% Homology, more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are well known in the art. Various methods and algorithms for alignment are described by Smith and Waterman, Adv. Appl. Math. 2: 482 (1981) ; Needleman and Wunsch, J. Mol. Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988); Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc. Acids Res. 16: 10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8: 155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 (1994). The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215: 403-10 (1990)) is accessible from National Center for Biological Information (NBCI) It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLSAT is available at http://www.ncbi.nlm.nih.gov/BLAST/. A method for comparing sequence homology using this program can be found at http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html.

상기 유전자들은 발현벡터 내부에 도입되어 코리네박테리움 글루타미컴(Corynebacterium glutamicum)에서 발현되게 된다. 본 명세서에 있어서, 용어 “발현벡터”는 발현벡터의 전사에 제공되는 추가단편에 작동가능하게 연결된 관심의 폴리펩티드를 암호화하는 단편으로 구성되는 선형 또는 원형의 DNA 분자이다. 그와 같은 추가단편은 프로모터 및 종료암호 서열을 포함한다. 발현벡터는 하나 이상의 복제 개시점, 하나 이상의 선택마커, 폴리아데닐화 신호 등을 또한 포함한다. 발현벡터는 일반적으로 플라스미드 또는 바이러스 DNA로부터 유도되거나, 또는 둘 다의 요소를 함유한다.These genes are introduced into the expression vector and expressed in Corynebacterium glutamicum . As used herein, the term " expression vector " is a linear or circular DNA molecule consisting of a fragment encoding a polypeptide of interest operably linked to an additional fragment provided in the transcription of the expression vector. Such additional fragments include promoter and termination coding sequences. The expression vector also includes at least one replication origin, at least one selection marker, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or contain both elements.

본 발명의 벡터 시스템은 당업계에 공지된 다양한 방법을 통해 구축될 수 있으며, 이에 대한 구체적인 방법은 Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press(2001)에 개시되어 있으며, 이 문헌은 본 명세서에 참조로서 삽입된다. The vector system of the present invention can be constructed through various methods known in the art, and specific methods for this are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001) This document is incorporated herein by reference.

본 발명의 상기 유전자를 인코딩하는 핵산 분자는 원핵세포에서 작동하는 프로모터에 작동적으로 연결(operatively linked)된다. 본 명세서에서, 용어 “작동적으로 결합된”은 핵산 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다. The nucleic acid molecule encoding the gene of the present invention is operatively linked to a promoter that operates in prokaryotic cells. As used herein, the term " operably linked " means a functional linkage between a nucleic acid expression control sequence (e.g., an array of promoter, signal sequence, or transcription factor binding site) and another nucleic acid sequence, The regulatory sequence will regulate transcription and / or translation of the other nucleic acid sequences.

본 발명의 벡터는 전형적으로 발현을 위한 벡터로서 구축될 수 있다. 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예컨대, tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pLλ프로모터, pRλ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로머터, trp 프로모터 및 T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다.The vector of the present invention can typically be constructed as a vector for expression. When the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (such as a tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL 貫 promoter, pR 貫 promoter, rac5 Promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter), a ribosome binding site for initiation of detoxification, and a transcription / translation termination sequence.

한편, 본 발명에 이용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드(예: pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pET28a, pGEX 시리즈, pET 시리즈, pUC18K, pEKEx2 및 pCES-L10 등), 파지(예: λgt4λB, λ-Charon, λΔz1 및 M13 등) 또는 바이러스(예: SV40 등)를 조작하여 제작될 수 있으나, 바람직하게는 10-케토스테아린 산 생합성에 이용될 코리네박테리움 글루타미컴(Corynebacterium glutamicum)을 위한 특정 유전자를 미생물 생체 내로 운반하여 외부로부터 삽입된 유전자의 발현을 효과적으로 조절할 수 있도록 상기 발현벡터는 도 3의 유전자 지도를 갖는 pCES-L10이고, 상기 뉴클레오티드 서열은 pCES-L10의 MCS(multiple cloning site)에 삽입된다.The vectors that can be used in the present invention include plasmids such as pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, (such as pET28a, pGEX series, pET series, pUC18K, pEKEx2 and pCES-L10), phage (such as λgt4λB, λ-Charon, λΔz1 and M13) Preferably, the expression vector is used for the expression of Corynebacterium glutamicum to be used for biosynthesis of 10-keto-stearic acid, so that the expression of the gene inserted from the outside can be effectively controlled by carrying a specific gene for the microorganism in vivo 3, and the nucleotide sequence is inserted into the MCS (multiple cloning site) of pCES-L10.

한편, 본 발명의 벡터는 선택표지로서, 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함하며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및 테트라사이클린에 대한 내성 유전자가 있다. On the other hand, the vector of the present invention includes, as a selection marker, an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamicin, carbinicillin, chloramphenicol, streptomycin, kanamycin, And resistance genes for tetracycline.

본 발명의 발현 벡터는 프로모터서열, 발현 대상 유전자(구조 유전자)의 뉴클레오티드 서열 및 터미네이터 서열을 포함하며, 상기 서열들이 5'-3' 순서대로 연결되는 것이 바람직하다. 본 발명에서는 OhyA 및/또는 ADH 의 유전자 서열이 5'-3' 순서대로 연결되어 제공되었다.The expression vector of the present invention includes a promoter sequence, a nucleotide sequence of a gene to be expressed (structural gene), and a terminator sequence, and the sequences are preferably linked in the 5'-3 'sequence. In the present invention, OhyA and / or ADH Gene sequences were provided in the 5'-3 'sequence.

본 발명의 발현벡터에는 상기 유전자들이 효소의 과발현 기능을 포함하여 최소한의 길이를 가지도록 RBS(ribosomal bindingsite) 및 효소발현에 꼭 필요한 부분을 포함하는 염기서열만을 서열로 정하여 삽입시키는 것이 숙주세포의 대사부담(metabolic burden)을 줄이는 측면에서 바람직하다. In the expression vector of the present invention, it is preferable that only the nucleotide sequence containing the RBS (ribosomal bindingsite) and the portion essential for the expression of the enzyme is inserted into the sequence so that the genes have the minimum length including the overexpression function of the enzyme, It is preferable in terms of reducing the metabolic burden.

상기 유전자가 포함된 발현벡터는 이후 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 내부로 도입되는데, 본 발명의 벡터를 대장균 내로 운반하는 방법은 CaCl2 방법(Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), 하나한 방법(Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); 및 Hanahan, D., J. Mol. Biol., 166:557-580(1983)) 및 전기 천공 방법(Dower, W.J. et al., Nucleic. Acids Res., 16:6127-6145(1988)) 등에 의해 실시될 수 있으나, 형질전환체의 안정적 제조와 효율을 높이기 위해서는 전기 충격에 의한 형질전환 방법을 사용하는 것이 바람직하다.
The expression vector containing the gene is then introduced into Corynebacterium glutamicum . The method of carrying the vector of the present invention into Escherichia coli is a CaCl 2 method (Cohen, SN et al., Proc. Natl. Acac. Sci., USA, 9: 2110-2114 (1973), and Hanahan, A. et al., Proc. (Dower, WJ et al., Nucleic Acids Res., 16: 6127-6145 (1988)), and the like, However, it is preferable to use an electric shock transformation method in order to stably manufacture and improve the efficiency of the transformant.

본 발명의 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주의 제조방법을 제공한다: (a) (ⅰ) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열; (ⅱ) 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열; 또는 (ⅲ) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 포함하는 발현벡터에 삽입시키는 단계; 및 (b) 상기 뉴클레오티드 서열이 삽입된 발현벡터로 코리네박테리움 글루타미컴 균주를 형질전환시키는 단계.According to another aspect of the present invention, there is provided a method for producing a Corynebacterium glutamicum strain for the production of 10-ketostearic acid comprising the steps of: (a ) (I) a nucleotide sequence encoding a hydratase; (Ii) a nucleotide sequence encoding an alcohol dehydrogenase; Or (iii) into an expression vector comprising a nucleotide sequence encoding a hydratase and a nucleotide sequence encoding an alcohol dehydrogenase; And (b) transforming the Corynebacterium glutamicum strain with the expression vector into which the nucleotide sequence is inserted.

본 발명의 10-케토스테아린 산 생산용 형질전환 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주의 제조방법은 상술한 본 발명의 코리네박테리움 글루타미컴 균주를 제조하는 것이므로 상술한 내용과 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.The method for producing the transformed Corynebacterium glutamicum strain for producing 10-keto stearic acid according to the present invention is to produce the Corynebacterium glutamicum strain of the present invention described above, The contents are omitted in order to avoid the excessive complexity of the present specification.

본 발명의 또 다른 구현예에 따르면, 상기 코리네박테리움 글루타미컴 균주를 발현시키는 단계 (b)는 전기충격 방법으로 수행된다.
According to another embodiment of the present invention, step (b) of expressing the Corynebacterium glutamicum strain is carried out by an electric shock method.

본 발명의 또 다른 양태에 따르면, 본 발명은 다음 단계를 포함하는 10-케토스테아린 산(10-ketostearic acid) 생합성 방법을 제공한다: (a) 상술한 본 발명의 코리네박테리움 글루타미컴 균주를 배양하여 10-케토스테아린 산을 생합성하는 단계; 및 (b) 상기 단계 (a)의 생합성된 10-케토스테아린 산을 수득하는 단계.According to another aspect of the present invention, the present invention provides a 10-ketostearic acid biosynthetic method comprising the steps of: (a) isolating the Corynebacterium glutamicum strain of the present invention Culturing 10-keto stearic acid to biosynthesize 10-keto stearic acid; And (b) obtaining biosynthetic 10-keto stearic acid of step (a).

상기 형질전환 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주 내에서 생합성된 10-케토스테아린 산을 분리하는 단계는 당업계에 공지된 통상의 분리 또는 정제 방법에 따라 실시될 수 있다(참조: B. Aurousseau et al., Journal of the American Oil Chemists' Society, 57(3):1558-9331( 1980); Frank C. Magne et al., Journal of the American Oil Chemists' Society, 34(3):127-129(1957)).The step of isolating the biosynthesized 10-keto stearic acid in the transformed Corynebacterium glutamicum strain can be carried out according to a conventional separation or purification method known in the art (see B Aurousseau et al., Journal of the American Oil Chemists Society , 57 (3): 1558-9331 (1980); Frank C. Magne et al., Journal of the American Oil Chemists Society , 34 (3): 127 -129 (1957)).

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(ⅰ) 본 발명은 (a) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열; (b) 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열; 또는 (c) 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 포함하는 발현벡터로 형질전환된 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주를 제공한다.(I) the present invention provides a kit comprising: (a) a nucleotide sequence encoding hydratase; (b) a nucleotide sequence encoding an alcohol dehydrogenase; Or (c) 10-ketostearic acid transformed with an expression vector comprising a nucleotide sequence encoding a hydratase and a nucleotide sequence encoding an alcohol dehydrogenase, A strain Corynebacterium glutamicum strain is produced.

(ⅱ) 야생종 코리네박테리움 글루타미컴 균주가 10-케토스테아린 산의 생산이 전혀 이루어지지 않는데 반해, 유전자 조작을 통해 재조합된 본 발명의 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주는 우수한 10-케토스테아린 산 생성능을 가지며, 10-케토스테아린 산을 탄소원으로 사용하지 않아 지속적으로 10-케토스테아린 산을 생산할 수 있다.(Ii) the wild-type Corynebacterium glutamicum strain does not produce 10-keto-stearic acid at all, whereas the recombinant Corynebacterium glutamicum strain of the present invention, 10-keto stearic acid, 10-keto stearic acid is not used as a carbon source, and 10-keto stearic acid can be continuously produced.

(ⅲ) 또한, 본 발명의 코리네박테리움 글루타미컴 균주는 10-케토스테아린 산 대사경로에 필수적인 유전자를 과발현 시키는 과정을 통해 10-케토스테아린 산의 생산량이 증가하였다.(Iii) In addition, the production of 10-keto stearic acid was increased by overexpressing the gene essential for the 10-keto stearic acid metabolic pathway of the Corynebacterium glutamicum strain of the present invention.

도 1은 코리네박테리움 글루타미컴(Corynebacterium glutamicum)을 보여주는 사진이다.
도 2는 10-케토스테아린 산(10-ketostearic acid)의 생산경로를 보여준다.
도 3은 발현벡터인 pCES-L10을 보여주는 도식화이다.
도 4는 야생종 코리네박테리움 글루타미컴 ACTC13032 및 본 발명의 일 실시예에 따른 재조합 균주인 코리네박테리움 글루타미컴 ATCC13032-pCESL10::OhyA::ADH 의 GC/MS 분석 결과를 보여준다.
도 5는 본 발명의 일 실시예에 따른 재조합 균주인 코리네박테리움 글루타미컴 ATCC13032-pCESL10::OhyA::ADH 의 GC/MS 분석 결과를 보여준다.Figure 1 is a photograph showing Corynebacterium glutamicum .
Figure 2 shows the production route of 10-ketostearic acid.
Figure 3 is a schematic showing the expression vector pCES-L10.
4 shows GC / MS analysis results of the wild type Corynebacterium glutamicum ACTC13032 and the recombinant strain Corynebacterium glutamicum ATCC13032-pCESL10 :: OhyA :: ADH according to one embodiment of the present invention.
FIG. 5 shows GC / MS analysis results of a recombinant strain Corynebacterium glutamicum ATCC13032-pCESL10 :: OhyA :: ADH according to an embodiment of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예Example

코리네박테리움 글루타미컴(Corynebacterium glutamicum)의 경우, 지방산으로부터 10-케토스테아린 산(10-ketostearic acid; 10-KSA)을 생산하는데 필요한 효소들인 하이드라테이즈(hydratase)를 코딩하는 OhyA 유전자와 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 ADH 유전자를 가지고 있지 않다.In the case of Corynebacterium glutamicum , the OhyA gene encoding hydratase, an enzyme necessary for producing 10-ketostearic acid (10-KSA) from fatty acids, and an alcohol It does not have an ADH gene that codes for alcohol dehydrogenase.

따라서, 코리네박테리움 글루타미컴이 가지고 있지 않은 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia) 유래 OhyA 및 마이크로코쿠스 루테우스(Micrococcus luteus) NCTC2665 유래 ADH 유전자를 발현 벡터(expression vector)인 pCES-L10를 이용하여 삽입하여 재조합 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주 (Corynebacterium glutamicum ATCC13032::pCES-L10::OhyA::ADH)를 제작하였다.
Therefore, the ADH gene derived from OhyA and Micrococcus luteus NCTC2665 derived from Stenotrophomonas maltophilia , which is not possessed by Corynebacterium glutamicum, is transformed into the expression vector pCES- L10 to prepare a recombinant Corynebacterium glutamicum strain ( Corynebacterium glutamicum ATCC13032 :: pCES-L10 :: OhyA :: ADH ).

실시예 1: 중합효소 연쇄 반응(Polymerase Chain Reaction; PCR)을 이용한 Example 1: PCR using Polymerase Chain Reaction (PCR) OhyAOhyA 및  And ADHADH 유전자 증폭 Gene amplification

유전자gene 생산 효소Production enzyme OhyAOhyA HydrataseHydratase ADHADH Alcohol dehydrogenaseAlcohol dehydrogenase

상기 표 1의 OhyA 유전자를 증폭하기 위한 프라이머는 Foward - GGATCCATGTACTACAGCAGTGGCAATTACG Tm=61.61(31mer)(서열목록 제5서열) 및 Reverse CATATGTCAGTCCTCCTGCACCAG Tm=58.35(24mer)(서열목록 제6서열)를 이용하였고, 제한효소는 BamHI 및 NdeI을 이용하였다. The primers used for amplifying the OhyA gene in Table 1 were Foward -GGATCCATGTACTACAGCAGTGGCAATTACG Tm = 61.61 (31mer) (Sequence Listing 5) and Reverse CATATGTCAGTCCTCCTGCACCAG Tm = 58.35 (24mer) (Sequence Listing 6) Bam HI and Nde I were used.

상기 표 1의 ADH 유전자를 증폭하기 위한 프라이머는 Foward - GGAATCAAAGTTAAATGTCCGAGTTCACCCGTTTC Tm=65.33(35mer)(서열목록 제7서열) 및 Reverse - AATTTTGAAGTTAATCAGCCGAGCGGGGTGTC Tm=65.37(32mer)(서열목록 제8서열)를 이용하였으며, 제한효소는 HpaI을 이용하였다.The primers for amplifying the ADH gene in Table 1 were Foward-GGAATCAAAGTTAAATGTCCGAGTTCACCCGTTTCTm = 65.33 (35mer) (SEQ ID NO: 7) and Reverse-AATTTTGAAGTTAATCAGCCGAGCGGGGTGTCTm = 65.37 (32mer) (SEQ ID No. 8) The enzyme was Hpa I.

상기 프라이머(primer)를 사용하여 증폭한 결과, OhyA는 1770 bp, ADH는 933 bp의 크기로 증폭되었다. 각각의 중합효소 연쇄 반응은 통상적인 반응조건(10 mM Tris-HCl(pH 9.0), 50 mM KCI, 0.1% Triton X-100, 2 mM MgSO4, Taq DNA 중합효소(DaKaRa)) 아래에서 ADH 유전자 경우는 95℃/5분(denaturation), 65℃/1분(annealing), 72℃/1분(extension)로 1회 수행한 후, 95℃/20초(denaturation), 65℃/30초(annealing), 72℃/1분 20초(extension)로 27회 반복 수행하였다. 마지막 단계로 안정적인 신장(extension)을 위해 95℃/1분(denaturation), 65℃/1분(annealing), 72℃/10분(extension) 반응하였고, OhyA 유전자 경우는 5℃/5분(denaturation), 60℃/1분(annealing), 72℃/1분(extension)로 1회 수행한 후, 95℃/20초(denaturation), 60℃/30초(annealing), 72℃/1분 20초(extension)로 27회 반복 수행하였다. 마지막 단계로 안정적인 신장(extension)을 위해 95℃/1분(denaturation), 60℃/1분(annealing), 72℃/10분(extension) 반응하였다.
As a result of amplification using the above primer, OhyA was amplified to 1770 bp and ADH to 933 bp. Each of the polymerase chain reaction is ADH gene under conventional reaction conditions (10 mM Tris-HCl (pH 9.0), 50 mM KCI, 0.1% Triton X-100, 2 mM MgSO 4, Taq DNA polymerase (DaKaRa)) , Denaturation at 95 ° C for 20 seconds, denaturation at 65 ° C for 30 seconds (denaturation at 95 ° C for 5 minutes, annealing at 65 ° C for 1 minute, extension at 72 ° C for 1 minute) annealing at 72 ° C for 1 minute and 20 seconds (extension). The final step was denaturation at 95 ° C / 1 min, annealing at 65 ° C for 1 min and extension at 72 ° C for 10 min for stable extension. The OhyA gene was denatured at 5 ° C / 5 min Annealing at 60 ° C for 1 min and 72 ° C for 1 min followed by denaturation at 95 ° C for 20 sec and annealing at 60 ° C for 30 sec and 72 ° C for 1 min. And repeated 27 times with an extension. The final step was denaturation at 95 ° C for 1 minute, annealing at 60 ° C for 1 minute and extension at 72 ° C for 10 minutes for stable extension.

실시예 2: 재조합 플라스미드의 제조 Example 2: Preparation of recombinant plasmid

상기 실시예 1의 중합효소 연쇄 반응 후 증폭된 DNA는 0.8% 아가로즈 젤 상에서 확인 후 정제하여 발현 벡터(expression vector)인 pCES-L10(도 3)의 다중삽입부위(multicloning site) 클로닝에 이용하였다. 조합 플라스미드인 pCESL10::OhyA::ADH를 위의 제한효소들과 37℃ 항온수조(water bath)에서 약 1시간 30분 반응하였다. 각각의 DNA 절편들을 절단한 뒤 발현 벡터(expression vector)인 pCES-L10(도 3)의 다중삽입부위(multicloning site)에 T4 라이게이즈(Dakara) 및 SLIC(sequence and ligation independent cloning) 클로닝을 기법을 이용하여 재조합 플라스미드를 완성하였다. 각 단계마다 삽입된 유전자의 삽입여부를 확인하기 위해 대장균(E. coli DH5a competent cell, RBS)에 형질 전환 시킨 후 재조합 플라스미드를 추출하여 이를 다시 원래 삽입부위의 제한효소로 처리하여 잘린 DNA 조작의 크기를 0.8% 아가로즈 젤 상에서 전기영동하여 비교하는 방법을 사용하였다.
The DNA amplified after the polymerase chain reaction in Example 1 was confirmed on 0.8% agarose gel and purified and used for cloning of multicloning site of pCES-L10 (FIG. 3) as an expression vector . The combination plasmid pCESL10 :: OhyA :: ADH The above restriction enzymes were reacted in a 37 ° C water bath for about 1 hour and 30 minutes. After cutting each DNA fragment, T4 ligase (Dakara) and sequence and ligation independent cloning (SLIC) cloning were performed on the multicloning site of the expression vector pCES-L10 (FIG. 3) To complete a recombinant plasmid. In each step, E. coli DH5a competent cell (RBS) was transformed with E. coli , and the recombinant plasmid was extracted and treated with the restriction enzyme of the original insertion site to determine the size Were electrophoresed on 0.8% agarose gel and compared.

실시예 3 : 이종 코리네박테리움 글루타미컴 형질전환체 제조Example 3: Preparation of heterologous Corynebacterium glutamicum transformants

통상적으로 클로닝용으로 많이 쓰이는 균주의 경우 CaCl2 버퍼를 사용한 컴피턴트 세포를 만든 후 열 충격(42℃) 방법에 의해 플라스미드를 숙주세포내로 넣지만, 본 발명에서는 형질전환체의 안정적 제조와 효율을 높이기 위해 전기천공법 (electroporation)에 의한 형질전환방법을 사용하였다. 상기 전기 충격에 의한 형질전환방법을 위해 16시간동안 전 배양 된 500 uL(0.1 %)의 야생종 코리네박테리움 글루타미컴(Corynebacterium glutamicum ATCC13032) 배양액을 41.5 mL의 BHI(5 g/L beef heart, 12.5 g/L calf brains, 2.5 g/L disodium hydrogen phosphate, 2 g/L D(+)-glucose, 10 g/L peptone, 5 g/L sodium chloride)에 100 mg/mL의 이소니코틴산(isonicotinic acid) 2 mL, 200 mg/mL의 글라이신 6.25 mL, 20%(v/v) 트윈 80 0.25 mL를 첨가한 배지에 접종하여 배양액의 흡광도(absorbance)가 600 nm 파장에서 0.6에 이르렀을 때, 배양액 전체에 해당하는 50 mL의 배양액을 원심 분리(12000 rpm, 10분)하여 상등액과 세포를 분리하였다. 모아진 세포는 10% 글리세롤 50 mL로 3회 세척해준 후, 다시 원심분리(12000 rpm, 1분)하여 상등액과 세포로 나누어 주었다. 세포는 10% 글리세롤 0.25 mL로 현탁하였다. 현탁 된 세포 50 uL에 재조합 플라스미드 1.5 uL를 첨가시켜주었다. 상기 플라스미드가 들어있는 분주된 51.5 uL의 액체는 전기천공법(electroporation)용 큐벳(BIO-RAD, Gene pulser cuvette)에 담아 BIO-RAD, Gene pulser Xcell로 전기 충격(2500v, 25uF, 200Ω)을 가하였다. 미리 준비해둔 1 mL BHI(5 g/L beef heart, 12.5 g/L calf brains, 2.5 g/L disodium hydrogen phosphate, 2 g/L D(+)-glucose, 10 g/L peptone, 5 g/L sodium chloride)를 첨가한 뒤 1시간 동안 200 rpm, 30℃에서 진탕 배양하였다. 배양된 형질전환체는 카나마이신(50 ug/mL)이 첨가된 BHI 아가(5 g/L beef heart, 12.5 g/L calf brains, 2.5 g/L disodium hydrogen phosphate, 2 g/L D(+)-glucose, 10 g/L peptone, 5 g/L sodium chloride, agar 20 g/L)에서 단일 균체가 생성될 때까지 30℃에서 배양하였다. 이를 통해 재조합 플라스미드를 코리네박테리움 글루타미컴(Corynebacterium glutamicum ATCC13032) 균주에 형질 전환한 코리네박테리움 글루타미컴 ATCC13032::OhyA::ADH 재조합 균주를 개발하였다.
In the case of a strain commonly used for cloning, a competent cell using a CaCl 2 buffer is prepared, and the plasmid is introduced into the host cell by heat shock (42 ° C). In the present invention, however, stable production and efficiency of the transformant Transformation by electroporation was used to increase the expression level. For the transfection by electroporation, 500 uL (0.1%) of Corynebacterium glutamicum ATCC13032 culture pre-cultured for 16 hours was added to 41.5 mL of BHI (5 g / L beef heart, (100 mg / mL) of isonicotinic acid was added to each well of a 12.5 g / L calf brains, 2.5 g / L disodium hydrogen phosphate, 2 g / When the absorbance of the culture solution reached 0.6 at a wavelength of 600 nm, the cells were inoculated into the culture medium in the presence of 2 mL of the culture solution, 6.25 mL of glycine at 200 mg / mL and 0.25 mL of 20% (v / v) The supernatant and cells were separated by centrifugation (12000 rpm, 10 minutes) of the corresponding 50 mL culture. The collected cells were washed three times with 50 mL of 10% glycerol, and then centrifuged again (12,000 rpm, 1 minute) to separate supernatant and cells. Cells were suspended in 0.25 mL of 10% glycerol. To 50 uL of the suspended cells, 1.5 uL of the recombinant plasmid was added. 51.5 μL of the liquid containing the plasmid was placed in a cuvette for electroporation (BIO-RAD, Gene pulser cuvette), and electric shock (2500 v, 25 uF, 200 Ω) was applied to BIO-RAD and Gene pulser Xcell Respectively. Lipofectamine, 10 g / L peptone, 5 g / L sodium bicarbonate (BHI), 5 g / L calf brains, 2.5 g / L disodium hydrogen phosphate, chloride) was added and incubated for 1 hour at 200 rpm and 30 ° C with shaking. The cultured transformants were BHI agar (5 g / L beef heart, 12.5 g / L calf brains, 2.5 g / L disodium hydrogen phosphate, 2 g / LD (+) - glucose) supplemented with kanamycin , 10 g / L peptone, 5 g / L sodium chloride, 20 g / L agar) at 30 ° C until single cells were produced. Thus, a recombinant strain of Corynebacterium glutamicum ATCC13032 :: OhyA :: ADH , which transformed a recombinant plasmid into a strain of Corynebacterium glutamicum ATCC13032, was developed.

실험예 1: 전세포 생물전환(Whole cell bioconversion)Experimental Example 1: Whole cell bioconversion

① C. glutamicum ACTC13032::pCES-L10::OhyA::ADH 균주가 올레산(oleic acid)으로부터 10-KSA의 생산 가능성을 확인하기 위해 플라스크 배양 및 생물전환 반응을 진행하였다. 100 ml 플라스크 배양 및 25 ml 생물전환 조건 그리고, 배지 조성은 다음 표 2와 같으며, 플라스크 배양(flask fermentation) 실험은 500 ml 삼각 플라스크를 이용해 100 ml 부피로 진행하였고, 생물전환 실험은 250 ml 배플(baffle) 삼각 플라스크를 이용해 25 ml 부피로 진행하였다.① C. glutamicum ACTC13032 :: pCES-L10 :: OhyA :: The ADH strain was cultured in flasks and bioconverted to confirm the possibility of production of 10-KSA from oleic acid. Flask fermentation experiments were carried out in a volume of 100 ml using a 500 ml Erlenmeyer flask and the biotransformation experiments were carried out in a 250 ml baffle lt; RTI ID = 0.0 > ml < / RTI > using a baffled Erlenmeyer flask.

Figure 112015008731931-pat00001
Figure 112015008731931-pat00001

12시간의 배양하여 정체 성장기(stationary growth phase)까지 세포를 키운 후에 Tris-HCl(pH 7.5) 버퍼로 풀어준 후에 기질인 올레산(oleic acid) 2.5 g/l 넣어서 생물 전환 반응을 진행하였다. 실험 결과, 도 4에서 알 수 있듯이, 최대 전환수율 78.4%, 최대 생산성 2.0 g/l/h의 10-케토스테아린 산이 생산되었다. 또한, 1시간 이후에 10-케토스테아린 산이 감소하지 않고 그대로 유지되는 점에 있어서 C. glutamicum ACTC13032 ::pCES-L10::OhyA::ADH가 10-케토스테아린 산을 생산하는 균주로서 산업적 가능성이 있다고 판단된다. 한편, 대조군인 야생형의 경우 10-케토스테아린 산 생산이 전혀 이루어지지 않았다.
Cells were grown to stationary growth phase for 12 hrs. Cells were grown in Tris-HCl (pH 7.5) buffer, and then 2.5 g / l of oleic acid, a substrate, was added. As shown in FIG. 4, 10-keto stearic acid having a maximum conversion yield of 78.4% and a maximum productivity of 2.0 g / l / h was produced. In addition, it has industrial potential as a strain producing 10-keto stearic acid in that C. glutamicum ACTC13032 :: pCES-L10 :: OhyA :: ADH is maintained as 10-keto stearic acid does not decrease after 1 hour . On the other hand, the control group, wild type, did not produce 10-keto stearic acid at all.

② 최종적으로 산업적으로 쓰이기 위해서는 올레산(oleic acid) 보다 경제력 있는 올리브오일을 기질로 하여 C. glutamicum ACTC13032 ::pCES-L10::OhyA::ADH 균주로 생물 전환 반응을 진행하였다. 올리브 오일은 올리브나무 열매에 들어있는 30-70%의 기름을 추출해 만들어지며 주성분은 불포화지방산인 올레산(oleic acid)으로, 전체 함량은 65-85% 정도다. ② Finally, in order to be used industrially, the biotransformation reaction was carried out with C. glutamicum ACTC13032 :: pCES-L10 :: OhyA :: ADH strain with olive oil which is more economical than oleic acid as a substrate. Olive oil is made by extracting 30-70% of the oil contained in the olive tree fruit. Its main ingredient is oleic acid, which is an unsaturated fatty acid, and its total content is about 65-85%.

배지배양 조성 및 생물 전환 조건은 위와 동일하며, 기질만 올리브 오일을 라파아제(lipase) 처리만 하여 생물 전환 반응을 진행하였다. 실험 결과, 도 5에서 볼 수 있듯이, 6시간에 1.3 g/l 10-KSA가 생산되었으며, 최대 전환 수율 65%, 최대 생산성 0.7 g/l/h로써, 이 균주가 10-KSA 생산을 위한 균주로서 산업적 가능성이 있음을 다시 확인 할 수 있었다.
The medium culture conditions and bioconversion conditions were the same as above. Only the substrate was subjected to biotransformation by lipase treatment of olive oil. As shown in FIG. 5, 1.3 g / l 10-KSA was produced at 6 hours, and the maximum conversion yield was 65% and the maximum productivity was 0.7 g / l / h. It is possible to confirm that there is an industrial possibility.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Sogang University <120> Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof <130> PN150013 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 589 <212> PRT <213> Hydratase from Stenotrophomonas maltophilia <400> 1 Met Tyr Tyr Ser Ser Gly Asn Tyr Glu Ala Phe Ala Arg Pro Arg Lys 1 5 10 15 Pro Ala Gly Val Asp Gly Lys Arg Ala Trp Phe Val Gly Ser Gly Leu 20 25 30 Ala Ser Leu Ala Gly Ala Ala Phe Leu Val Arg Asp Gly His Met Ala 35 40 45 Gly Glu Cys Ile Thr Ile Leu Glu Gln Gln Gln Ile Pro Gly Gly Ala 50 55 60 Leu Asp Gly Leu Lys Val Pro Glu Lys Gly Phe Val Ile Arg Gly Gly 65 70 75 80 Arg Glu Met Glu Asp His Phe Glu Cys Leu Trp Asp Leu Phe Arg Ser 85 90 95 Ile Pro Ser Leu Glu Ile Glu Asp Ala Ser Val Leu Asp Glu Phe Tyr 100 105 110 Trp Leu Asn Lys Asp Asp Pro Asn Tyr Ser Leu Gln Arg Ala Thr Ile 115 120 125 Asn Arg Gly Glu Asp Ala His Thr Asp Gly Leu Phe Thr Leu Thr Glu 130 135 140 Gln Ala Gln Arg Asp Ile Val Ala Leu Phe Leu Ala Thr Arg Gln Glu 145 150 155 160 Met Glu Asn Lys Arg Ile Asn Glu Val Leu Gly Arg Asp Phe Leu Asp 165 170 175 Ser Asn Phe Trp Leu Tyr Trp Arg Thr Met Phe Ala Phe Glu Glu Trp 180 185 190 His Ser Ala Leu Glu Met Lys Leu Tyr Leu His Arg Phe Ile His His 195 200 205 Ile Gly Gly Leu Pro Asp Phe Ser Ala Leu Lys Phe Thr Lys Tyr Asn 210 215 220 Gln Tyr Glu Ser Leu Val Leu Pro Leu Val Lys Trp Leu Gln Asp Gln 225 230 235 240 Gly Val Val Phe Gln Tyr Gly Thr Glu Val Thr Asp Val Asp Phe Asp 245 250 255 Leu Gln Pro Asp Arg Lys Gln Ala Thr Arg Ile His Trp Met His Asp 260 265 270 Gly Val Ala Gly Gly Val Glu Leu Gly Ala Asp Asp Leu Leu Phe Met 275 280 285 Thr Ile Gly Ser Leu Thr Glu Asn Ser Asp Asn Gly Asp His His Thr 290 295 300 Ala Ala Arg Leu Asn Glu Gly Pro Ala Pro Ala Trp Asp Leu Trp Arg 305 310 315 320 Arg Ile Ala Ala Lys Asp Asp Ala Phe Gly Arg Pro Asp Val Phe Gly 325 330 335 Ala His Ile Pro Glu Thr Lys Trp Glu Ser Ala Thr Val Thr Thr Leu 340 345 350 Asp Ala Arg Ile Pro Ala Tyr Ile Gln Lys Ile Ala Lys Arg Asp Pro 355 360 365 Phe Ser Gly Lys Val Val Thr Gly Gly Ile Val Ser Val Arg Asp Ser 370 375 380 Arg Trp Leu Met Ser Trp Thr Val Asn Arg Gln Pro His Phe Lys Asn 385 390 395 400 Gln Pro Lys Asp Gln Ile Val Val Trp Val Tyr Ser Leu Phe Val Asp 405 410 415 Thr Pro Gly Asp Tyr Val Lys Lys Pro Met Gln Asp Cys Thr Gly Glu 420 425 430 Glu Ile Thr Arg Glu Trp Leu Tyr His Leu Gly Val Pro Val Glu Glu 435 440 445 Ile Asp Glu Leu Ala Ala Thr Gly Ala Lys Thr Val Pro Val Met Met 450 455 460 Pro Tyr Ile Thr Ala Phe Phe Met Pro Arg Gln Ala Gly Asp Arg Pro 465 470 475 480 Asp Val Val Pro Glu Gly Ala Val Asn Phe Ala Phe Ile Gly Gln Phe 485 490 495 Ala Glu Ser Lys Gln Arg Asp Cys Ile Phe Thr Thr Glu Tyr Ser Val 500 505 510 Arg Thr Pro Met Glu Ala Val Tyr Thr Leu Leu Gly Ile Glu Arg Gly 515 520 525 Val Pro Glu Val Phe Asn Ser Thr Tyr Asp Val Arg Ser Leu Leu Ala 530 535 540 Ala Thr Gly Arg Leu Arg Asp Gly Lys Glu Leu Asp Ile Pro Gly Pro 545 550 555 560 Ala Phe Leu Arg Asn Leu Leu Met Asn Lys Leu Asp Lys Thr Gln Ile 565 570 575 Gly Gly Leu Leu Arg Glu Phe Lys Leu Val Gln Glu Asp 580 585 <210> 2 <211> 1770 <212> DNA <213> OhyA sequence coding Hydratase from Stenotrophomonas maltophilia <400> 2 atgtactaca gcagtggcaa ttacgaagcc ttcgcgcgcc cgcgcaagcc cgccggtgtg 60 gatggcaagc gtgcatggtt cgtcggttcg ggcctggcct cgttggccgg tgccgcgttc 120 ctggtgcgcg acggccacat ggccggtgag tgcatcacca tccttgagca gcagcagatt 180 ccgggcggcg cgctggacgg cctgaaagtg ccggaaaagg gtttcgtgat ccgtggtggc 240 cgcgagatgg aagatcattt cgagtgcctg tgggacctgt tccgctcgat accgtcgctg 300 gagatcgaag atgccagcgt gctggacgag ttctactggt tgaacaagga cgacccgaac 360 tattcgctgc agcgcgccac catcaatcgc ggcgaggatg cacacaccga tggcctgttc 420 acgctgaccg agcaggcaca gagggacatc gtcgcgctgt tcctggccac ccgtcaggag 480 atggagaaca agcgcatcaa cgaagtactg ggccgtgatt tcctggacag caacttctgg 540 ctgtactggc gaaccatgtt cgcgttcgaa gagtggcatt cggcgctgga gatgaagctg 600 tacctgcatc gcttcatcca ccatatcggc ggcctgccgg atttctcggc gctgaagttc 660 acgaagtaca accagtacga atcgctggtg ctgccgctgg tgaagtggtt gcaggaccag 720 ggcgtggtgt tccagtacgg taccgaggtg accgacgtcg actttgatct gcagccggac 780 cgcaagcagg ccacgcgcat ccattggatg catgacggtg tagccggtgg cgtggaactc 840 ggcgcggatg atctgctgtt catgaccatc ggttcgctga ccgagaactc ggataatggc 900 gaccaccaca ctgcggcacg cctgaacgaa ggcccggcgc ctgcctggga cctgtggcgc 960 cgcattgccg cgaaggatga cgcgttcggg cgtccggatg tgttcggcgc gcacattcca 1020 gaaaccaagt gggaatcggc aacggtgacc acgctggatg cgcgcattcc ggcctacatc 1080 cagaagatcg ccaagcgcga tcccttcagc ggcaaagtgg tgaccggcgg catcgtcagc 1140 gtgcgcgact cgcgctggct gatgagctgg acggtgaatc gccagccaca tttcaagaac 1200 cagcccaagg accagatcgt ggtctgggtg tattcgttgt tcgtggatac gcccggcgac 1260 tacgtgaaga agccgatgca ggactgcacc ggcgaggaga tcacgcgcga atggctgtat 1320 cacctgggcg tgccggtgga agagatcgat gagctggccg cgaccggcgc gaagacagtg 1380 ccggtgatga tgccgtacat cacggcgttc ttcatgccac gccaggcagg tgaccgcccg 1440 gacgtggtgc cggaaggtgc ggtgaacttc gctttcatcg gccagttcgc cgaatcgaag 1500 cagcgcgact gcatcttcac caccgagtac tcggtgcgca cgccgatgga ggcggtgtac 1560 accttgctgg ggatcgagcg tggcgtgccg gaggtgttca attccacgta tgacgtgcgc 1620 tcgctgctgg ccgcgaccgg gcgcctgcgt gatggcaagg aactggacat tcccgggcca 1680 gcgttcctgc gcaacctgct gatgaacaag ctggacaaga cccagatcgg tggtctgctg 1740 cgcgagttca agctggtgca ggaggactga 1770 <210> 3 <211> 310 <212> PRT <213> Alcohol dehydrogenase from Micrococcus luteus NCTC2665 <400> 3 Met Ser Glu Phe Thr Arg Phe Glu Gln Val Ala Val Leu Gly Thr Gly 1 5 10 15 Val Leu Gly Ser Gln Ile Ile Met Gln Ala Ala Tyr His Gly Lys Lys 20 25 30 Val Met Ala Tyr Asp Ala Val Pro Ala Ala Leu Glu Gly Ile Glu Arg 35 40 45 Arg Trp Ala Trp Ile Arg Gln Gly Tyr Glu Ala Asp Leu Gly Glu Gly 50 55 60 Tyr Asp Pro Gln Arg Phe Asp Glu Ala Ile Ala Arg Ile Thr Pro Thr 65 70 75 80 Ser Asp Leu Gly Glu Ala Leu Ala Asp Ala Asp Ile Val Ile Glu Ala 85 90 95 Val Pro Glu Asn Leu Glu Leu Lys Arg Lys Val Trp Ala Gln Val Gly 100 105 110 Glu Leu Ala Pro Ala Thr Thr Leu Phe Ala Thr Asn Thr Ser Ser Leu 115 120 125 Leu Pro Ser Asp Phe Ala Asp Ala Ser Gly His Pro Glu Arg Phe Leu 130 135 140 Ala Leu His Tyr Ala Asn Arg Ile Trp Ala Gln Asn Thr Ala Glu Val 145 150 155 160 Met Gly Thr Ala Ala Thr Ser Pro Glu Ala Val Ala Gly Ala Leu Gln 165 170 175 Phe Ala Glu Glu Thr Gly Met Val Pro Val His Val Arg Lys Glu Ile 180 185 190 Pro Gly Tyr Phe Leu Asn Ser Leu Leu Ile Pro Trp Leu Gln Ala Gly 195 200 205 Ser Lys Leu Tyr Met His Gly Val Gly Asn Pro Ala Asp Ile Asp Arg 210 215 220 Thr Trp Arg Val Ala Thr Gly Asn Glu Arg Gly Pro Phe Gln Thr Tyr 225 230 235 240 Asp Ile Val Gly Phe His Val Ala Ala Asn Val Ser Arg Asn Thr Gly 245 250 255 Val Asp Trp Gln Leu Gly Phe Ala Glu Leu Leu Glu Lys Ser Ile Ala 260 265 270 Glu Gly His Ser Gly Val Ala Asp Gly Gln Gly Phe Tyr Arg Tyr Gly 275 280 285 Pro Asp Gly Glu Asn Leu Gly Pro Val Glu Asp Trp Asn Leu Gly Asp 290 295 300 Lys Asp Thr Pro Leu Gly 305 310 <210> 4 <211> 933 <212> DNA <213> ADH sequence coding Alcohol dehydrogenase from Micrococcus luteus NCTC2665 <400> 4 atgtccgagt tcacccgttt cgagcaggtc gccgtgctgg gcaccggcgt gctgggttcg 60 cagatcatca tgcaggcggc gtaccacggc aagaaggtga tggcctacga cgccgtcccc 120 gccgccctcg aggggatcga gcgccgctgg gcgtggatcc gccaaggcta cgaagcagac 180 ctcggggagg gctacgaccc gcagcgcttc gacgaggcca tcgcccgcat cacgccgacc 240 tccgacctcg gcgaggccct ggcggatgcg gacatcgtga tcgaggccgt cccggagaac 300 ctggagctca agcgcaaggt gtgggcccag gtgggcgagc tcgcccccgc cacgaccctg 360 ttcgccacga acacctcctc cctgctgccc tcggacttcg ccgacgccag cggccatccg 420 gagcgcttcc tggccctgca ctacgccaac cgcatctggg cgcagaacac cgccgaggtc 480 atgggcaccg ccgccacctc gccggaggcc gtcgcgggag ccctgcagtt cgccgaggag 540 accggcatgg tccccgtgca cgtgcgcaag gagatcccgg gctacttcct caactccctg 600 ctcatcccgt ggctgcaggc cggctccaag ctgtacatgc acggagtggg caacccggcg 660 gacatcgacc gcacctggcg cgtggccacc ggcaacgagc gcggcccgtt ccagacctac 720 gacatcgtgg gcttccacgt ggccgccaac gtctcccgca acacgggcgt cgactggcag 780 ctcggcttcg ctgagctgct cgagaagagc atcgccgagg gccacagcgg cgtggctgac 840 ggccagggct tctaccgcta cgggccggac ggggagaacc tcggcccggt ggaggactgg 900 aacctgggcg acaaggacac cccgctcggc tga 933 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying OhyA gene <400> 5 ggatccatgt actacagcag tggcaattac g 31 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying OhyA gene <400> 6 catatgtcag tcctcctgca ccag 24 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying ADH gene <400> 7 ggaatcaaag ttaaatgtcc gagttcaccc gtttc 35 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying ADH gene <400> 8 aattttgaag ttaatcagcc gagcggggtg tc 32 <110> Sogang University <120> Corynebacterium glutamicum Strains Having Excellent Production          Potential of 10-ketostearic acid and Method for Preparing Thereof <130> PN150013 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 589 <212> PRT <213> Hydratase from Stenotrophomonas maltophilia <400> 1 Met Tyr Tyr Ser Ser Gly Asn Tyr Glu Ala Phe Ala Arg Pro Arg Lys   1 5 10 15 Pro Ala Gly Val Asp Gly Lys Arg Ala Trp Phe Val Gly Ser Gly Leu              20 25 30 Ala Ser Leu Ala Gly Ala Ala Phe Leu Val Arg Asp Gly His Met Ala          35 40 45 Gly Glu Cys Ile Thr Ile Leu Glu Gln Gln Gln Ile Pro Gly Gly Ala      50 55 60 Leu Asp Gly Leu Lys Val Pro Glu Lys Gly Phe Val Ile Arg Gly Gly  65 70 75 80 Arg Glu Met Glu Asp His Phe Glu Cys Leu Trp Asp Leu Phe Arg Ser                  85 90 95 Ile Pro Ser Leu Glu Ile Glu Asp Ala Ser Val Leu Asp Glu Phe Tyr             100 105 110 Trp Leu Asn Lys Asp Asp Pro Asn Tyr Ser Leu Gln Arg Ala Thr Ile         115 120 125 Asn Arg Gly Glu Asp Ala His Thr Asp Gly Leu Phe Thr Leu Thr Glu     130 135 140 Gln Ala Gln Arg Asp Ile Val Ala Leu Phe Leu Ala Thr Arg Gln Glu 145 150 155 160 Met Glu Asn Lys Arg Ile Asn Glu Val Leu Gly Arg Asp Phe Leu Asp                 165 170 175 Ser Asn Phe Trp Leu Tyr Trp Arg Thr Met Phe Ala Phe Glu Glu Trp             180 185 190 His Ser Ala Leu Glu Met Lys Leu Tyr Leu His Arg Phe Ile His His         195 200 205 Ile Gly Gly Leu Pro Asp Phe Ser Ala Leu Lys Phe Thr Lys Tyr Asn     210 215 220 Gln Tyr Glu Ser Leu Val Leu Pro Leu Val Lys Trp Leu Gln Asp Gln 225 230 235 240 Gly Val Val Phe Gln Tyr Gly Thr Glu Val Thr Asp Val Asp Phe Asp                 245 250 255 Leu Gln Pro Asp Arg Lys Gln Ala Thr Arg Ile His Trp Met His Asp             260 265 270 Gly Val Ala Gly Gly Val Glu Leu Gly Ala Asp Asp Leu Leu Phe Met         275 280 285 Thr Ile Gly Ser Leu Thr Glu Asn Ser Asp Asn Gly Asp His His Thr     290 295 300 Ala Ala Arg Leu Asn Glu Gly Pro Ala Pro Ala Trp Asp Leu Trp Arg 305 310 315 320 Arg Ile Ala Lys Asp Asp Ala Phe Gly Arg Pro Asp Val Phe Gly                 325 330 335 Ala His Ile Pro Glu Thr Lys Trp Glu Ser Ala Thr Val Thr Thr Leu             340 345 350 Asp Ala Arg Ile Pro Ala Tyr Ile Gln Lys Ile Ala Lys Arg Asp Pro         355 360 365 Phe Ser Gly Lys Val Val Thr Gly Gly Ile Val Ser Val Arg Asp Ser     370 375 380 Arg Trp Leu Met Ser Trp Thr Val Asn Arg Gln Pro His Phe Lys Asn 385 390 395 400 Gln Pro Lys Asp Gln Ile Val Val Trp Val Tyr Ser Leu Phe Val Asp                 405 410 415 Thr Pro Gly Asp Tyr Val Lys Lys Pro Met Gln Asp Cys Thr Gly Glu             420 425 430 Glu Ile Thr Arg Glu Trp Leu Tyr His Leu Gly Val Pro Val Glu Glu         435 440 445 Ile Asp Glu Leu Ala Ala Thr Gly Ala Lys Thr Val     450 455 460 Pro Tyr Ile Thr Ala Phe Phe Met Pro Arg Gln Ala Gly Asp Arg Pro 465 470 475 480 Asp Val Val Pro Glu Gly Ala Val Asn Phe Ala Phe Ile Gly Gln Phe                 485 490 495 Ala Glu Ser Lys Gln Arg Asp Cys Ile Phe Thr Thr Glu Tyr Ser Val             500 505 510 Arg Thr Pro Met Glu Ala Val Tyr Thr Leu Leu Gly Ile Glu Arg Gly         515 520 525 Val Pro Glu Val Phe Asn Ser Thr Tyr Asp Val Arg Ser Leu Leu Ala     530 535 540 Ala Thr Gly Arg Leu Arg Asp Gly Lys Glu Leu Asp Ile Pro Gly Pro 545 550 555 560 Ala Phe Leu Arg Asn Leu Leu Met Asn Lys Leu Asp Lys Thr Gln Ile                 565 570 575 Gly Gly Leu Leu Arg Glu Phe Lys Leu Val Gln Glu Asp             580 585 <210> 2 <211> 1770 <212> DNA <213> OhyA sequence coding Hydratase from Stenotrophomonas maltophilia <400> 2 atgtactaca gcagtggcaa ttacgaagcc ttcgcgcgcc cgcgcaagcc cgccggtgtg 60 gatggcaagc gtgcatggtt cgtcggttcg ggcctggcct cgttggccgg tgccgcgttc 120 ctggtgcgcg acggccacat ggccggtgag tgcatcacca tccttgagca gcagcagatt 180 ccgggcggcg cgctggacgg cctgaaagtg ccggaaaagg gtttcgtgat ccgtggtggc 240 cgcgagatgg aagatcattt cgagtgcctg tgggacctgt tccgctcgat accgtcgctg 300 gagatcgaag atgccagcgt gctggacgag ttctactggt tgaacaagga cgacccgaac 360 tattcgctgc agcgcgccac catcaatcgc ggcgaggatg cacacaccga tggcctgttc 420 acgctgaccg agcaggcaca gagggacatc gtcgcgctgt tcctggccac ccgtcaggag 480 atggagaaca agcgcatcaa cgaagtactg ggccgtgatt tcctggacag caacttctgg 540 ctgtactggc gaaccatgtt cgcgttcgaa gagtggcatt cggcgctgga gatgaagctg 600 tacctgcatc gcttcatcca ccatatcggc ggcctgccgg atttctcggc gctgaagttc 660 acgaagtaca accagtacga atcgctggtg ctgccgctgg tgaagtggtt gcaggaccag 720 ggcgtggtgt tccagtacgg taccgaggtg accgacgtcg actttgatct gcagccggac 780 cgcaagcagg ccacgcgcat ccattggatg catgacggtg tagccggtgg cgtggaactc 840 ggcgcggatg atctgctgtt catgaccatc ggttcgctga ccgagaactc ggataatggc 900 gaccaccaca ctgcggcacg cctgaacgaa ggcccggcgc ctgcctggga cctgtggcgc 960 cgcattgccg cgaaggatga cgcgttcggg cgtccggatg tgttcggcgc gcacattcca 1020 gaaaccaagt gggaatcggc aacggtgacc acgctggatg cgcgcattcc ggcctacatc 1080 cgaagatcg ccaagcgcga tcccttcagc ggcaaagtgg tgaccggcgg catcgtcagc 1140 gtgcgcgact cgcgctggct gatgagctgg acggtgaatc gccagccaca tttcaagaac 1200 cagcccaagg accagatcgt ggtctgggtg tattcgttgt tcgtggatac gcccggcgac 1260 tacgtgaaga agccgatgca ggactgcacc ggcgaggaga tcacgcgcga atggctgtat 1320 cacctgggcg tgccggtgga agagatcgat gagctggccg cgaccggcgc gaagacagtg 1380 ccggtgatga tgccgtacat cacggcgttc ttcatgccac gccaggcagg tgaccgcccg 1440 gcgtggtgc cggaaggtgc ggtgaacttc gctttcatcg gccagttcgc cgaatcgaag 1500 cagcgcgact gcatcttcac caccgagtac tcggtgcgca cgccgatgga ggcggtgtac 1560 accttgctgg ggatcgagcg tggcgtgccg gaggtgttca attccacgta tgacgtgcgc 1620 tcgctgctgg ccgcgaccgg gcgcctgcgt gatggcaagg aactggacat tcccgggcca 1680 gcgttcctgc gcaacctgct gatgaacaag ctggacaaga cccagatcgg tggtctgctg 1740 cgcgagttca agctggtgca ggaggactga 1770 <210> 3 <211> 310 <212> PRT <213> Alcohol dehydrogenase from Micrococcus luteus NCTC 2666 <400> 3 Met Ser Glu Phe Thr Arg Phe Glu Gln Val Ala Val Leu Gly Thr Gly   1 5 10 15 Val Leu Gly Ser Gly Ile Met Gln Ala Ala Tyr His Gly Lys Lys              20 25 30 Val Met Ala Tyr Asp Ala Val Ala Ala Leu Glu Gly Ile Glu Arg          35 40 45 Arg Trp Ala Trp Ile Arg Gln Gly Tyr Glu Ala Asp Leu Gly Glu Gly      50 55 60 Tyr Asp Pro Gln Arg Phe Asp Glu Ala Ile Ala Arg Ile Thr Pro Thr  65 70 75 80 Ser Asp Leu Gly Glu Ala Leu Ala Asp Ala Asp Ile Val Ile Glu Ala                  85 90 95 Val Pro Glu Asn Leu Glu Leu Lys Arg Lys Val Trp Ala Gln Val Gly             100 105 110 Glu Leu Ala Pro Ala Thr Thr Leu Phe Ala Thr Asn Thr Ser Seru         115 120 125 Leu Pro Ser Asp Phe Ala Asp Ala Ser Gly His Pro Glu Arg Phe Leu     130 135 140 Ala Leu His Tyr Ala Asn Arg Ile Trp Ala Gln Asn Thr Ala Glu Val 145 150 155 160 Met Gly Thr Ala Ala Thr Ser Pro Glu Ala Val Ala Gly Ala Leu Gln                 165 170 175 Phe Ala Glu Glu Thr Gly Met Val Val Val Val Arg Lys Glu Ile             180 185 190 Pro Gly Tyr Phe Leu Asn Ser Leu Leu Ile Pro Trp Leu Gln Ala Gly         195 200 205 Ser Lys Leu Tyr Met His Gly Val Gly Asn Pro Ala Asp Ile Asp Arg     210 215 220 Thr Trp Arg Val Ala Thr Gly Asn Glu Arg Gly Pro Phe Gln Thr Tyr 225 230 235 240 Asp Ile Val Gly Phe His Val Ala Asp Val Ser Ser Asn Thr Gly                 245 250 255 Val Asp Trp Gln Leu Gly Phe Ala Glu Leu Leu Glu Lys Ser Ile Ala             260 265 270 Glu Gly His Ser Gly Val Ala Asp Gly Gln Gly Phe Tyr Arg Tyr Gly         275 280 285 Pro Asp Gly Glu Asn Leu Gly Pro Val Glu Asp Trp Asn Leu Gly Asp     290 295 300 Lys Asp Thr Pro Leu Gly 305 310 <210> 4 <211> 933 <212> DNA <213> ADH sequence coding Alcohol dehydrogenase from Micrococcus luteus NCTC2665 <400> 4 atgtccgagt tcacccgttt cgagcaggtc gccgtgctgg gcaccggcgt gctgggttcg 60 cagatcatca tgcaggcggc gtaccacggc aagaaggtga tggcctacga cgccgtcccc 120 gccgccctcg aggggatcga gcgccgctgg gcgtggatcc gccaaggcta cgaagcagac 180 ctcggggagg gctacgaccc gcagcgcttc gacgaggcca tcgcccgcat cacgccgacc 240 tccgacctcg gcgaggccct ggcggatgcg gacatcgtga tcgaggccgt cccggagaac 300 ctggagctca agcgcaaggt gtgggcccag gtgggcgagc tcgcccccgc cacgaccctg 360 ttcgccacga acacctcctc cctgctgccc tcggacttcg ccgacgccag cggccatccg 420 gagcgcttcc tggccctgca ctacgccaac cgcatctggg cgcagaacac cgccgaggtc 480 atgggcaccg ccgccacctc gccggaggcc gtcgcgggag ccctgcagtt cgccgaggag 540 accggcatgg tccccgtgca cgtgcgcaag gagatcccgg gctacttcct caactccctg 600 ctcatcccgt ggctgcaggc cggctccaag ctgtacatgc acggagtggg caacccggcg 660 gacatcgacc gcacctggcg cgtggccacc ggcaacgagc gcggcccgtt ccagacctac 720 gacatcgtgg gcttccacgt ggccgccaac gtctcccgca acacgggcgt cgactggcag 780 ctcggcttcg ctgagctgct cgagaagagc atcgccgagg gccacagcgg cgtggctgac 840 ggccagggct tctaccgcta cgggccggac ggggagaacc tcggcccggt ggaggactgg 900 aacctgggcg acaaggacac cccgctcggc tga 933 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying OhyA gene <400> 5 ggatccatgt actacagcag tggcaattac g 31 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying OhyA gene <400> 6 catatgtcag tcctcctgca ccag 24 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying ADH gene <400> 7 ggaatcaaag ttaaatgtcc gagttcaccc gtttc 35 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying ADH gene <400> 8 aattttgaag ttaatcagcc gagcggggtg tc 32

Claims (10)

서열목록 제1서열의 아미노산 서열로 이루어진 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 서열목록 제3서열의 아미노산 서열로 이루어진 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 포함하는 발현벡터로 형질전환된 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주.
An expression comprising a nucleotide sequence encoding a hydratase consisting of the amino acid sequence of SEQ ID NO: 1 and a nucleotide sequence encoding an alcohol dehydrogenase consisting of the amino acid sequence of SEQ ID NO: 3 Corynebacterium glutamicum strain for the production of 10-ketostearic acid transformed with a vector.
제 1 항에 있어서, 상기 코리네박테리움 글루타미컴 균주는 서열목록 제1서열의 아미노산 서열로 이루어진 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 서열목록 제3서열의 아미노산 서열로 이루어진 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 각각 포함하는 2개의 발현벡터로 공동형질전환된 것을 특징으로 하는 코리네박테리움 글루타미컴 균주.
The method of claim 1, wherein the Corynebacterium glutamicum strain comprises a nucleotide sequence encoding a hydratase comprising the amino acid sequence of SEQ ID NO: 1 and an alcohol sequence comprising the amino acid sequence of SEQ ID NO: Wherein the vector is cotransformed with two expression vectors each containing a nucleotide sequence encoding an alcohol dehydrogenase.
제 1 항에 있어서, 상기 코리네박테리움 글루타미컴 균주는 서열목록 제1서열의 아미노산 서열로 이루어진 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 서열목록 제3서열의 아미노산 서열로 이루어진 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 모두 포함하는 1개의 발현벡터로 형질전환된 것을 특징으로 하는 코리네박테리움 글루타미컴 균주.
The method of claim 1, wherein the Corynebacterium glutamicum strain comprises a nucleotide sequence encoding a hydratase comprising the amino acid sequence of SEQ ID NO: 1 and an alcohol sequence comprising the amino acid sequence of SEQ ID NO: Wherein the strain is transformed with an expression vector containing all of the nucleotide sequences encoding an alcohol dehydrogenase.
제 1 항에 있어서, 상기 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열은 스테노트로포모나스 말토필리아(Stenotrophomonas maltophilia)로부터 유래하고, 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열은 마이크로코쿠스 루테우스(Micrococcus luteus)로부터 유래한 것을 특징으로 하는 코리네박테리움 글루타미컴 균주.
2. The method according to claim 1, wherein the nucleotide sequence encoding the hydratase is derived from Stenotrophomonas maltophilia , and the nucleotide sequence encoding alcohol dehydrogenase is derived from micro- A strain of Corynebacterium glutamicum characterized by originating from Micrococcus luteus .
삭제delete 제 1 항에 있어서, 상기 하이드라테이즈를 코딩하는 뉴클레오티드 서열은 서열목록 제 2 서열의 뉴클레오티드 서열로 이루어지고, 상기 알코올 디하이드로게네이즈를 코딩하는 뉴클레오티드 서열은 서열목록 제 4 서열의 뉴클레오티드 서열로 이루어진 것을 특징으로 하는 코리네박테리움 글루타미컴 균주.
The method of claim 1, wherein the nucleotide sequence encoding hydratase is a nucleotide sequence of SEQ ID NO: 2, and the nucleotide sequence encoding the alcohol dehydrogenase is a nucleotide sequence of SEQ ID NO: 4 Wherein the strain is a strain of Corynebacterium glutamicum.
제 1 항에 있어서, 상기 발현벡터는 도 3의 유전자 지도를 갖는 pCES-L10이고, 상기 뉴클레오티드 서열은 pCES-L10의 MCS(multiple cloning site)에 삽입되는 것을 특징으로 하는 코리네박테리움 글루타미컴 균주.
2. The coryneform bacterium according to claim 1, wherein the expression vector is pCES-L10 having the gene map shown in Fig. 3, and the nucleotide sequence is inserted into MCS (multiple cloning site) of pCES-L10. Strain.
다음 단계를 포함하는 10-케토스테아린 산(10-ketostearic acid) 생산용 코리네박테리움 글루타미컴(Corynebacterium glutamicum) 균주의 제조방법:
(a) 서열목록 제1서열의 아미노산 서열로 이루어진 하이드라테이즈(hydratase)를 코딩하는 뉴클레오티드 서열과 서열목록 제3서열의 아미노산 서열로 이루어진 알코올 디하이드로게네이즈(alcohol dehydrogenase)를 코딩하는 뉴클레오티드 서열을 발현벡터에 삽입시키는 단계; 및
(b) 상기 뉴클레오티드 서열이 삽입된 발현벡터로 코리네박테리움 글루타미컴 균주를 형질전환시키는 단계.
A method for producing Corynebacterium glutamicum strain for producing 10-ketostearic acid comprising the steps of:
(a) a nucleotide sequence encoding a hydratase consisting of the amino acid sequence of SEQ ID NO: 1, and a nucleotide sequence encoding an alcohol dehydrogenase consisting of the amino acid sequence of SEQ ID NO: 3 Into an expression vector; And
(b) transforming the Corynebacterium glutamicum strain with the expression vector into which the nucleotide sequence is inserted.
제 8 항에 있어서, 상기 코리네박테리움 글루타미컴 균주를 형질전환시키는 단계 (b)는 전기천공 방법으로 수행되는 것을 특징으로 하는 방법.
9. The method according to claim 8, wherein the step (b) of transforming the Corynebacterium glutamicum strain is carried out by an electroporation method.
다음 단계를 포함하는 10-케토스테아린 산(10-ketostearic acid) 생합성 방법:
(a) 제 1 항 내지 제 4 항, 제 6 항 및 제 7 항 중 어느 한 항의 코리네박테리움 글루타미컴 균주를 배양하여 10-케토스테아린 산을 생합성하는 단계; 및
(b) 상기 단계 (a)의 생합성된 10-케토스테아린 산을 수득하는 단계.10. A method of biosynthesis of 10-ketostearic acid comprising the steps of:
(a) culturing a Corynebacterium glutamicum strain according to any one of claims 1 to 4, 6, 7, or 8 to biosynthesize 10-keto stearic acid; And
(b) obtaining biosynthetic 10-keto stearic acid of step (a).
KR1020150012671A 2015-01-27 2015-01-27 Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof KR101743105B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150012671A KR101743105B1 (en) 2015-01-27 2015-01-27 Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150012671A KR101743105B1 (en) 2015-01-27 2015-01-27 Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof

Publications (2)

Publication Number Publication Date
KR20160092557A KR20160092557A (en) 2016-08-05
KR101743105B1 true KR101743105B1 (en) 2017-06-08

Family

ID=56711039

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150012671A KR101743105B1 (en) 2015-01-27 2015-01-27 Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof

Country Status (1)

Country Link
KR (1) KR101743105B1 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102023618B1 (en) 2012-07-27 2019-09-20 삼성전자주식회사 Mutant microorganism having improved production ability of 1,4-BDO and method for preparing 1,4-BDO using the same

Also Published As

Publication number Publication date
KR20160092557A (en) 2016-08-05

Similar Documents

Publication Publication Date Title
JP6469874B2 (en) New promoters and their uses
US7785837B2 (en) Production of 3-hydroxypropionic acid using beta-alanine/pyruvate aminotransferase
KR101749429B1 (en) Oleate Hydratase Gene, Expression Vector Containing the Gene, and Transformant Transformed by the Vector
US7524666B2 (en) Reductase gene and use thereof
US20060234336A1 (en) Methylotrophic bacterium for the production of recombinant proteins and other products
KR101298988B1 (en) Heterologous Klebsiella pneumoniae strains for producing 2,3-butanediol and manufacturing method
AU753879B2 (en) Industrial method for producing heterologous proteins in E.coli and strains useful for said method
KR101743105B1 (en) Corynebacterium glutamicum Strains Having Excellent Production Potential of 10-ketostearic acid and Method for Preparing Thereof
JP2009142289A (en) Biosynthesis method enabling the preparation of cobalamins
US20130045515A1 (en) Heterogeneous e. coli for improving fatty acid content using fatty acid biosynthesis and preparation method thereof
KR101743104B1 (en) Corynebacterium glutamicum Strains Having Excellent Production Potential of 12-ketooleic acid and Method for Preparing Thereof
JP2001069979A (en) Production of l-glutamic acid by fermentation
KR20160048292A (en) Avirulent and Psychrophilic Corynebacterium glutamicum Strains Having Excellent Production Potential of 2,3-Butanediol and Method for Preparing Thereof
KR101755767B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR101408304B1 (en) Method for Preparing 2,3-butanediol from Commercial carbon source by Transformed Klebsiella pneumoniae
EP1231266A1 (en) Arabidopsis-origin gdp-4-keto-6-deoxy-d-mannose-3,5-epimerase-4-reductase gene
KR101522689B1 (en) Method for Preparing Phosphoenolypruvate carboxylase of Photobacterium profundum SS9 using Escherichia coli system
US8735110B2 (en) Pseudomonas aeruginosa strain developed for improving fatty acid content, and method of manufacturing the same
WO2020262107A1 (en) Production method of (r)-reticulin
KR101917480B1 (en) Corynebacteria producing L-lysine and a method of producing L-lysine using the same
US20030157636A1 (en) Methylotrophic bacterium for the production of recombinant proteins and other products
KR20220126610A (en) Mutant of Corynebacterium glutamicum with enhanced L-lysine productivity and method for preparing L-lysine using the same
KR100707989B1 (en) Method conversion of chorismate to isochorismate using Isochorismate synthase gene of Synechocystis sp. PCC6803
KR20140010474A (en) Method for preparing fatty acid using transformed e.coli introducing trans-2-enoyl-coa reductase
CN117460829A (en) Modified alpha-isopropyl malate synthase

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20200304

Year of fee payment: 4