KR101730076B1 - Single stranded dna aptamers specifically binding to campylobacter jejuni - Google Patents

Abstract

A single stranded DNA extramammary specifically binding to Campylobacter jejuni and a process for its preparation are disclosed. A method for producing platamer which specifically binds to Campylobacter jejuni comprises a DNA library comprising DNAs having 40 to 60 bases randomly arranged in the center and having a primer region for PCR at both ends, (S1) of mixing Campylobacter jejuni with a binding buffer solution to induce Campylobacter jejuni-DNA conjugate; (S2) of extracting the Campylobacter jejuni-DNA conjugate by centrifuging the mixed solution of the DNA library and Campylobacter jejuni to obtain the Campylobacter jejuni-DNA conjugate. Using a fluorescence activated cell sorter (FACS) Isolating DNA from a Campylobacter jejuni-DNA conjugate (S3); Amplifying the isolated DNA through a polymerase chain reaction (S4); Mixing the amplified DNA with a non-target microorganism in a binding buffer solution to induce a non-target microorganism-DNA complex (S5); And centrifuging the mixed solution of the concentrated DNA and the non-target microorganism to extract DNA not bound to the non-target microorganism (S6).

Description

Technical Field [0001] The present invention relates to a single-stranded DNA plasmid that specifically binds to Campylobacter jejuni, and a method for producing the same. [0002]

The present invention relates to a single-stranded nucleic acid aptamer specifically binding to Campylobacter jejuni and a method for producing the same.

Food poisoning bacteria can cause food poisoning if they are infected with human body through corrupt vegetable, agricultural, marine products, various foodstuffs and food manufacturing process. Therefore, it is possible to detect these food poisoning bacteria more quickly and accurately in terms of improving food safety and hygiene environment There is a strong interest in developing technology. However, efficient rapid detection methods for food poisoning bacteria have so far suffered from the lack of an ideal ligand.

Rapid detection of foodborne pathogens by bioluminescence and reaction products of microbial metabolism results in relative lack of selectivity and thus can only be used as a general indicator for food poisoning bacteria. In addition, highly selective immunological methods and nucleic acid In addition, in the case of enzyme immunoassay and immunofluorescence measurement, there is a problem in the storage and distribution of the substance due to the instability of the antibody used. There is also a problem and the antibody has disadvantages in selectivity and sensitivity due to the cell wall of food poisoning bacteria.

On the other hand, Aptamer is a small molecule oligonucleotide that specifically and selectively binds to a target molecule. As is well known, nucleic acids are linear polyamides in which the nucleotides are linked by covalent bonds, and the nucleotides are composed of small organic compounds such as phosphoric acid, sugar, and purines (adenine or guanine) or pyrimidines (cytosine, thymidine and uracil). By interaction they form a unique steric structure, which is determined by the single strand base sequence.

Generally, nucleic acids such as DNA and RNA have been reported as a storage material for expressing proteins having activity such as cell structure and enzymes. However, since it has been reported that RNA has activity as an enzyme by forming a specific structure in 1982, There are a lot of reports about the structural characteristics and the specific functions accordingly. The nucleic acid is composed of repeats of four bases and maintains a high diversity to form a large number of three-dimensional structures. These three-dimensional structures interact with specific substances to form a complex and stabilize.

Because of these properties, the nucleic acid can act as a ligand for a specific substance containing a protein, and it is possible to select from a library combining single-stranded nucleic acids arranged in various base sequences, The binding force and the specificity can be used to produce aptamer that binds to a specific substance.

A method for screening a nucleic acid that binds to a specific substance is called SELEX (Systematic Evolution of Ligand by Exponential Enrichment). Through this SELEX, a protein capable of binding to a nucleic acid in a natural state, And molecules capable of binding with very high affinity to various biomolecules including those.

In recent years, various attempts have been made to diagnose and treat diseases using such aptamer. In particular, the use of platemer to detect the presence of various pathogens causing diseases can prevent disease in advance.

However, the aptamer generally binds not only to a single target substance but also to other substances having a similar structure, so that there is a problem that the accuracy of diagnosis of a disease or detection of a pathogen is poor.

In particular, Campylobacter jejuni is one of the leading food poisoning bacteria worldwide, along with Salmonella, E. coli O157: H7 and Listeria, and can cause food poisoning by as little as 500 to 800 bacteria, , Children and people with low immunity are known to have a high infection rate, so prevention and diagnosis is needed through accurate detection.

It is an object of the present invention to provide a single-stranded DNA plasmid that specifically binds to pathogenic bacteria causing food poisoning, particularly Campylobacter jejuni.

It is another object of the present invention to provide a method for producing a single-stranded DNA extramammary specifically binding to Campylobacter jejuni.

According to one embodiment of the present invention, there is provided a single-stranded DNA overtamer having at least one base sequence of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 5, which specifically binds to Campylobacter jejuni.

A method for producing an extramammary specifically binding to Campylobacter jejuni according to an embodiment of the present invention comprises DNA having 40 to 60 bases randomly arranged in the center and having a primer region for PCR at both ends, (S1) of introducing Campylobacter jejuni-DNA complex by mixing Campylobacter jejuni with a DNA library containing the DNA library containing the DNA of the present invention and the binding buffer solution; (S2) of extracting the Campylobacter jejuni-DNA conjugate by centrifuging the mixed solution of the DNA library and Campylobacter jejuni to obtain the Campylobacter jejuni-DNA conjugate. Using FACS (fluorescence activated cell sorter), the Campylobacter jejuni- Isolating DNA from a Campylobacter jejuni-DNA conjugate (S3); Amplifying the isolated DNA through a polymerase chain reaction (S4); Mixing the amplified DNA with a non-target microorganism in a binding buffer solution to induce a non-target microorganism-DNA complex (S5); And centrifuging the mixed solution of the concentrated DNA and the non-target microorganism to extract DNA not bound to the non-target microorganism (S6).

The binding buffer solution may be a phosphate buffer solution.

In addition, the plurality of non-target microorganisms may include at least all of E. coli, E. coli O157: H7, Salmonella, and Staphylococcus aureus.

The method for producing the platemma specifically binding to Campylobacter jejuni according to the above embodiment of the present invention may further comprise the step of concentrating the amplified DNA using a centrifugal filter.

In addition, the concentration of the template to be amplified through the polymerase chain reaction may range from 0.1% to 30%.

A method for producing an abdominal pad specifically binding to Campylobacter jejuni according to another embodiment of the present invention may be modified so as to carry out the step S3 after repeating the steps S1 and S2 more than two times have.

In this case, after performing the step S3, the step S6 may be repeatedly performed at least twice.

Further, after repeating the step S6 at least twice, the steps S1 and S2 may be repeated twice or more and the step S3 may be performed.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings and embodiments. The following specific examples are described for illustrative purposes only, and the scope of the present invention is not limited by the following examples.

According to the present invention, single-stranded DNAs of Sequence Listing 1 to 5, which bind specifically to Campylobacter jejuni without binding to Escherichia coli, Staphylococcus aureus, and the like, which are similar to Campylobacter jejuni, By providing an abdominal thermometer and a manufacturing method thereof, rapid and accurate detection of Campylobacter jejuni is enabled.

FIG. 1 is a diagram showing the concept of SELEX and counter SELEX used in a method of manufacturing a single-stranded DNA extruder according to an embodiment of the present invention.
FIG. 2 is a diagram showing electrophoresis results of single-stranded DNA subjected to PCR.
FIGS. 3 to 7 are diagrams showing secondary structures of a single-stranded DNA stranded DNA candidate sequence having nucleotide sequences of 4, 9, 10, 27 and 35 among the single-stranded DNAs of Table 1, respectively.
FIGS. 8 to 17 are each a combination of a single-stranded DNA plasmid having a nucleotide sequence of 4, 9, 10, 27 and 35 on the sequence listing and a Campylobacter jejuni and a nucleotide sequence of 4, 9, 10, 27 And a single strand DNA strand having a nucleotide sequence of 35 and a mixed food-borne pathogen.
18 is a flowchart illustrating a process of manufacturing a DNA compression device according to an embodiment of the present invention.

1, a method of manufacturing a single-stranded DNA extruder according to an embodiment of the present invention will be described in detail.

Formation of DNA pool

In order to select single-stranded nucleic acids that specifically bind to Campylobacter jejuni, they are composed of DNAs having base sequences in which 60 bases are randomly arranged in the center, with a fixed sequence for primer binding at both ends as shown below DNA library 100 was prepared.

5 '- [Fixed Sequence 1] -N60- [Fixed Sequence 2] -3'

The fixed sequence 1 and the fixed sequence 2 are the fixed sites of the DNAs contained in the DNA library 100, and N60 is a base sequence in which 60 A, G, T, and C bases are randomly arranged.

The FW primer used in the PCR can bind to the 5 'terminal fixed sequence 1 of the underlined bases of the above base sequence, and the RE primer of the PCR can fix the 3' terminal end of the underlined bases of the above base sequence Base linkage with SEQ ID NO: 2. In addition, the 5 ' -terminal and 3 ' -terminal fixed sequences each contain a specific nucleotide sequence that the restriction enzyme recognizes. According to one embodiment of the present invention, the 5'-terminal fixed sequence includes GAATCC, which is a recognition sequence of restriction enzyme EcoRI, and the 3'-terminal fixed sequence, GGATCC, which is a recognition sequence of restriction enzyme of BamHI have.

Single stranded DNA in the DNA library 100 was denatured by heat treatment at 95 占 폚 for 10 minutes and -20 占 폚 for 10 minutes before binding with the target microorganism 300 Campylobacter jejuni. Single stranded DNAs 200 having a three-dimensional structure derived from this thermal denaturation constitute a single stranded DNA pool.

1. Screening single-stranded DNA with binding specificity (SELEX)

Single stranded DNAs 200 containing a random sequence are combined with the target microorganism 300 Campylobacter jejuni The mixture is placed in a high-pressure sterilized binding buffer solution (phosphate buffer solution, phosphate buffered saline, pH 7.2) for 15 minutes at 121 ° C, mixed and reacted at room temperature to induce binding. Since this binding buffer solution does not affect the activity of the target microorganism Campylobacter jejuni, Campylobacter jejuni, the target microorganism 300, binds to the single stranded DNAs 200 in an optimal state .

And centrifuged at 10,000 g for 10 minutes to separate the target microorganism-single strand DNA conjugate (310) and unbound single strand DNA (210) in the mixed solution. Centrifugation is the preferred method of isolating the target microorganism-single stranded DNA conjugate (310) in a state that does not affect the living target microorganism as much as possible.

Immediately after centrifugation, the supernatant is removed to remove unbound single stranded DNA (210) that is not bound to the target microorganism. The target microbe-single stranded DNA conjugate 310 is present in the remaining mixed solution. Single stranded DNA of the target microorganism-single strand DNA conjugate (310) becomes the plasmid candidate DNA according to the present invention.

The single-stranded DNA was eluted from the target microorganism by adding the same volume of sterilized distilled water to the mixed solution containing only the microorganism-single stranded DNA conjugate 310, heated at 95 ° C for 10 minutes and heat-treated. The solution was centrifuged at 10,000g for 10 minutes Separate. The eluted plastomer candidate single-stranded DNA (220) floats on the upper layer of the solution after centrifugation, so only the supernatant is extracted to perform PCR amplification.

Since the amount of single strand DNA bound to food poisoning bacteria is very small, the template concentration was varied from 0.1% to 30% in PCR amplification.

At this time, there is a problem that it is difficult to confirm the DNA band even after the PCR amplification because the single strand DNA bound to the target microorganism is very small. To solve this problem, after the PCR amplification, a concentration process can be carried out using a centrifugal filter.

2 is a graph showing the results of DNA electrophoresis analysis before and after centrifugal separation.

C1 and C2 are the results of DNA analysis in the DNA library before the start of SELEX, S1-1 is the single-stranded DNA extracted from the first SELEX, S1-2 is the single-stranded DNA of S1-1 is concentrated 20 times using the centrifugal filter It is the result of one time analysis. S5-1 and S5-2 are the analysis results when the single-stranded DNA extracted from the 5th-order SELEX and the single-stranded DNA of S5-1 were 20-fold concentrated using a centrifugal filter.

As can be seen in FIG. 2, DNA bands become more apparent as the number of SELEXs increases, but become remarkably clear when subjected to a concentration process by a centrifugal filter. The DNA band (S1-2) enriched in the first SELEX is more apparent than the DNA (S5-1) not enriched in the fifth SELEX and the DNA band (S5-2) enriched in the fifth SELEX The band is clearly observed.

Thus, by concentrating DNA using a centrifugal filter in SELEX, the success rate of SELEX can be significantly increased.

Single-stranded DNA was obtained by selectively amplifying only the single-stranded DNA bound in the primary SELEX and then selectively binding the target microorganism with the same procedure five times.

2. Excitation of excimer candidate single-stranded DNA binding to non-target microorganisms (counter-SELEX)

After the end of the 5th SELEX, a primary counter-SELEX (counter-SELEX) was performed to exclude single-stranded DNA binding to non-target microorganisms.

In one embodiment of the present invention, counter-SELEX was performed on the mixed bacteria consisting of E. coli, E. coli O157: H7, Salmonella and Staphylococcus aureus under the same conditions as those of SELEX.

Namely, the plasmid candidate single-stranded DNAs 220 are mixed with the non-target microorganism mixture 400 and the binding buffer solution to induce the binding, and the non-target microorganism-single-stranded DNA complex 410 and the micro- After isolating the binding single stranded DNA 230 and PCR-amplifying only the unbound single stranded DNA 230, the non-target microorganism Escherichia coli O157: H7 (SEQ ID NO: , Single-stranded DNA that does not bind to Salmonella and Staphylococcus aureus can be obtained.

3. Verification of binding specificity of Campylobacter jejuni for Campylobacter

The nucleotide sequences of single-stranded DNA identified to bind specifically to Campylobacter jejuni via SELEX-counter SELEX are shown in Table 1 below.

Abtamer Base sequence One GCGTGCAGCAGCCTTTTGTGTCGCGGTCGTTAGTGCTGTGGTGCG 2 ACGTGCAGCAGGGGATGTGTCGCGGTAGGTAGTGCTGTGGTGCG 3 GCGTGCGGAGCGGGCTGGGTAGGGGTCGGGGGCGGTGGGGCGCG 4 GCGTGCAGCAGGGGCAGGGTCGCGGTCGGTAGTGCTGTGGTGCG 5 GCGTGCAGCAGGGGCAGGGTCGCGGTCGGTAGTGCTGTGGTGCG 6 GCGTGTAGGTGTCGTCCGGTGGCTGTGGGGCTGGGTGTTGCGCG 7 ACGGGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGTG 8 ACGTGGCGGTCGGTTGCGGCGGCTCAGGGGAGGTGTGCGGCGCG 9 GCGTGCAGCAGGGGCTGTGTAGCGGTCGGTAGTGCTGTGGTGCG 10 CACGCAGCCAGCACCCACGCACACCGAAAATGTTGGCCTCACGCACGC 11 GCGGGCGTGGGAGGCAATGCCTTGCTTGTAGGCTTCCCCTGTGCGCG 12 Gt; 13 GCGTGCAGCAGGTGCTGTGTCGTGGTCGGTAGTGCTGTGGTGCG 14 GCGTGCAGCAGGGGCTGTGTCGCGGTAGGTAGTGCTGTGGTGCG 15 GCGTGCAGCAGGGGCTGTGTCGCGGTCGTTAGTGCTGTGGTGCG 16 GCGTGCAGCGGGCTGGTATGTGACATCGATGCTGCTGCGGGGCG 17 GCGTGTAGGTGTCGTCCGGTGGCTGTGGGGCTGGGTGTTGCGCG 18 GCGGGCAGCCGCCTTTTGAGTCGCGGTCGGTAGTGCTGTGGTGCG 19 GCGTGCGGAGGGATAATGGGGCGTTGGGGATGTGGTGCTGCGTG 20 GCGTGTCGGTGTAGTCCGGTGGCTGTGGGGCTGGGTGTTGCGCG 21 GCGTGCAGCAGCCCTTTAGACGCGGTCGGTAGTGCTGTGGTGCG 22 GCGTGCGGAGCGGGCAGGGGAGGGCTGGAGGTCGGCGGGGCGCG 23 TCGTGCAGAAGGGGCTGTGTCGCGGTCGGTAGTGCTGTGGTGCG 24 GCGTGCAGCAGGGGCTGTGTCGCAGTCGGTAGTGCTGTGGTGCG 25 ACGTGCAGCGGGCTGGTATGTGACATCGATGCTGCTGCGGGGCG 26 GCGTGCAGAAGGGGCTGTGTCGAGGTCGGTAGTGCTGTGGTGCG 27 GCGTGCAGCAGGGGCTGTGTCGCGTTCGGTAGTGCTGTGGTGCG 28 GCGTGCGGAGCGGGGATGGGAGGGCTGTGGGTCGGCGGGGCGTG 29 GCGTGTCGGTGTCGTACGGTGGCTGTGGGGCTGGGTGTTGCGCG 30 GCGTGGCGGTCGGTTGCGGCGGCTCAGGGGATGTGTGCGGCGCG 31 GCGTGCAGCGGGGGCTGTGTCGCGGTCGGTAGTGCTGTGGTGCG 32 GCGTGTCGGTGTCGTCCGGTGGCTGTGGGTCTGGGTGTTGCGCG 33 GCGTGCAGCAGGGTCTGTGTCGCGGTCGGTAGTGCTGTGGTGCG 34 ACTCACTATAGGGCGGTGGCGGGTTGTACGAGGTTCGTTTTGAGGTCAGTGGCGCGT 35 GCGTGCCGGAGGAGACGGGTGGCGGTGGGGCTGGGTGTGGCGCG 36 GCGTGCAGCAGGGGATGTGTCGCGGTCGGTAGTGCTGTGGTGCG 37 ACGTGAAGCCGGCCAGGGTTGCTTCCCGGTCCACTTCTTGCCGG 38 GCGTGCAGGAGGCGCTGGGTGGCGGTGGGGATGGGTGTGGCGCG 39 GCGTGTCGGTGGCGTCCGGTGGCTGTGGGGCTGGGTGTTGCGCG 40 GCGTGCCGGAGGAGACGGGTGGCGGTGGGGCTGGGTGTGGCGCG

To confirm the binding specificity of Campylobacter jejuni to 40 kinds of single strand DNA having the nucleotide sequence shown in Table 1, binding strength and selectivity were firstly confirmed using a fluorescence detector. More specifically, FAM was bound to the 5'-end of 40 nucleotide sequences obtained through SELEX-cloning and sequencing, and then 1.0 nmol of plamer candidate and 108 cfu of food poisoning bacteria were combined with SELEX And the binding specificity was determined by analyzing the fluorescence intensity.

According to the result of this binding specificity test, it was found that single-stranded DNA having the nucleotide sequences of 4, 9, 10, 27 and 35 among the single-stranded DNAs shown in Table 1 was highly specific for Campylobacter jejuni .

The secondary structure of these five single-stranded DNA extramameric candidate groups is as shown in Figs.

4. Flow cytometry and target cell separation

The binding specificity of the five single stranded DNA extramammers identified by Campylobacter jejuni was confirmed by using a flow cytometer.

Concretely, Campylobacter jejuni and mixed food poisoning bacteria (E. coli, E. coli O157: H7, Salmonella and Staphylococcus aureus) were subjected to the same conditions And fluorescence intensity was determined by flow cytometry.

FIGS. 8 to 17 are each a combination of a single-stranded DNA plasmid having a nucleotide sequence of 4, 9, 10, 27 and 35 on the sequence listing and a Campylobacter jejuni, and 4, 9, 10, 27 And a single strand DNA strand having a nucleotide sequence of 35 and a mixed food-borne pathogen.

8 to 17, the fluorescence intensities of the five candidates of Abtamer were higher than those of the mixed food poisoning bacteria when they were reacted with Campylobacter jejuni. Especially, in the case of Abtamer 9, the binding specificity with Campylobacter jejuni poisoning bacteria was very high Respectively.

4. Preparation of single-stranded DNA plasmers by repeated SELEX, counter-SELEX and FACS separation

In the above description, SELEX, counter SELEX and flow cytometry were performed to describe a method of producing an umbilical cord specifically binding to Campylobacter jejuni. However, in the case of a target microorganism, namely Campylobacter jejuni, According to another embodiment of the present invention, there is provided a method for producing a single-stranded DNA extramamer which is repeatedly carried out using a cell separation process using SELEX, counter-SELEX, and FACS .

The method of producing the platemer according to the present invention can be configured to perform flow cytometry analysis using a fluorescence activated cell sorter (FACS) and target cell separation for the production of an electrometer having improved selectivity.

The principle of operation of FACS is to push out the suspension of fluorescently labeled cells with compressed air and to flow out from the center of the nozzle. This nozzle has a special structure, so that the seed liquid always flows out as if it surrounds the flow of cell suspension, and the cells are protected by this seed solution and flow out. When an ultrasonic nozzle vibrator applies more than about 40,000 vibrations per second to the nozzle, the water current, including the cells flowing out of the nozzle due to vibration, is changed to about 40,000 drops per second. On the other hand, the laser beam narrowly clamped by the condenser lens is irradiated to the water stream immediately before the water droplet is formed, and is reflected on the passing cell. The scattered light and fluorescence generated by the scattering of the laser beam are converted into electrical signals from the receiving tube and sent to the computer. There, various interpretations are carried out according to each purpose. If there is a cell that meets the conditions set at this time, the droplet containing the cell is charged, and then, when passing through the electric field of the polarizing plate, it is separated to the right or left by the filling. And uncooled drops drop right down. Charging is done in both + and -, so it is possible to select two kinds of cells at the same time. It is also possible to operate all of the series of separation processes aseptically and at a low temperature.

In addition to scattered light and fluorescence intensity, fluorescence color tones and fluorescence polarized light can be selected and combined. These information interpreted by the computer can be displayed on the display, and the selection area can be determined from these displays.

The FACS interpretation covers a wide range of applications such as DNA, RNA, lymphocytes, leukocytes, antigens, immunoglobulins, enzymes, viruses, chemicals, and chromosomes, and covers life sciences such as immunology and oncology.

Using such FACS, flow cytometry analysis and target cell separation can be performed simultaneously to produce an electrometer with improved selectivity.

This embodiment of the present invention will be described with reference to FIG.

First, SELEX is repeated three times to extract a single-stranded DNA candidate group specifically binding to Campylobacter jejuni (S1).

Flow cytometry and target cell separation are performed using FACS for the first-stranded single-stranded DNA candidate (S2).

Counter SELEX is performed three times for isolated single strand DNA candidates, and single strand DNA not bound to non-target microorganisms is extracted (S3).

The single-stranded DNA extracted from S3 is subjected to S1-S3 processes, ie, cell separation using SELEX, FACS, and counter-SELEX (S4, S5, S6).

The single-stranded DNA extracted from the secondary counter-SELEX of S6 is subjected to SELEX four times and single-stranded DNA bound to the target microorganism, Campylobacter jejuni, is extracted (S7).

The single-stranded DNA-Campylobacter Jeju-Ni complex extracted from S7 is separated using FACS (S8).

As described above, the SELEX-1 FACS cell separation-3 counter-SELEX procedures were repeated, and 4 SELEX-FAC flow cytometry analyzes were performed on the single-stranded DNA obtained from the final counter SELEX, So that it can be obtained efficiently.

In the above description, the process consisting of three SELEX-1 FACS flow cytometry analyzes and cell separation-three counter SELEXs is repeated twice. However, the number of SELEX and counter SELEX treatments may be different (for example, 4 Conclusion SELEX- - One FACS flow cytometry analysis and cell separation - Two counter SELEX, or four SELEX - one FACS flow cytometry analyzes and cell separation - Four counter SELEX), the number of repetitions of the process can be three or more .

100: DNA library 200: modified single stranded DNA
300: Target microorganism 400: Non-target microorganism

<110> Republic of Korea (Management: Rural Development Administraion) <120> SINGLE STRANDED DNA APTAMERS SPECIFICALLY BINDING TO          CAMPYLOBACTER JEJUNI <130> RDK-14P023 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> aptamer specifically binding to Campylobacter jejuni <400> 1 gcgtgcagca ggggcagggt cgcggtcggt agtgctgtgg tgcg 44 <210> 2 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> aptamer specifically binding to Campylobacter jejuni <400> 2 gcgtgcagca ggggctgtgt agcggtcggt agtgctgtgg tgcg 44 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> aptamer specifically binding to Campylobacter jejuni <400> 3 cacgcagcca gcacccacgc acaccgaaaa tgttggcctc acgcacgc 48 <210> 4 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> aptamer specifically binding to Campylobacter jejuni <400> 4 gcgtgcagca ggggctgtgt cgcgttcggt agtgctgtgg tgcg 44 <210> 5 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> aptamer specifically binding to Campylobacter jejuni <400> 5 gcgtgcagca ggggcagggt cgcggtcggt agtgctgtgg tgcg 44

Claims (9)

A single-stranded DNA plasmid having the nucleotide sequence of SEQ ID NO: 4 which specifically binds to Campylobacter jejuni.
delete delete delete delete delete delete delete delete

Images