KR101702594B1 - Cancer diagnostic kit for cancer diagnostic automation system - Google Patents

Cancer diagnostic kit for cancer diagnostic automation system Download PDF

Info

Publication number
KR101702594B1
KR101702594B1 KR1020160067620A KR20160067620A KR101702594B1 KR 101702594 B1 KR101702594 B1 KR 101702594B1 KR 1020160067620 A KR1020160067620 A KR 1020160067620A KR 20160067620 A KR20160067620 A KR 20160067620A KR 101702594 B1 KR101702594 B1 KR 101702594B1
Authority
KR
South Korea
Prior art keywords
tyrosine
leu
urine
cancer
reagent
Prior art date
Application number
KR1020160067620A
Other languages
Korean (ko)
Inventor
신동진
Original Assignee
(주)큐브바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)큐브바이오 filed Critical (주)큐브바이오
Priority to KR1020160067620A priority Critical patent/KR101702594B1/en
Application granted granted Critical
Publication of KR101702594B1 publication Critical patent/KR101702594B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/26Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/533Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving isomerase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/18Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with another compound as one donor, and incorporation of one atom of oxygen (1.14.18)
    • C12Y114/18001Tyrosinase (1.14.18.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y503/00Intramolecular oxidoreductases (5.3)
    • C12Y503/02Intramolecular oxidoreductases (5.3) interconverting keto- and enol-groups (5.3.2)
    • C12Y503/02001Phenylpyruvate tautomerase (5.3.2.1)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/52Use of compounds or compositions for colorimetric, spectrophotometric or fluorometric investigation, e.g. use of reagent paper and including single- and multilayer analytical elements
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6806Determination of free amino acids
    • G01N33/6812Assays for specific amino acids
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/0099Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor comprising robots or similar manipulators
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/10Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices
    • G01N35/1079Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices with means for piercing stoppers or septums
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N35/00Automatic analysis not limited to methods or materials provided for in any single one of groups G01N1/00 - G01N33/00; Handling materials therefor
    • G01N35/10Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices
    • G01N35/1081Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices characterised by the means for relatively moving the transfer device and the containers in an horizontal plane
    • G01N35/1083Devices for transferring samples or any liquids to, in, or from, the analysis apparatus, e.g. suction devices, injection devices characterised by the means for relatively moving the transfer device and the containers in an horizontal plane with one horizontal degree of freedom

Abstract

The present invention relates to a cancer diagnosing kit for a cancer diagnosis automation system. An individual inspected subject can conveniently confirm the occurrence of cancer and metabolic diseases at home by using a liquid specimen extracted from himself/herself, and the liquid specimen and a reagent which fall from a top side can be easily received and uniformly mixed, so an overall procedure from the extraction of a specimen and the analysis thereof can be easily automated. According to the present invention, the cancer diagnosing kit mixes a liquid specimen transferred through an automated procedure after being extracted from an inspected subject and a reagent for detecting a cancer maker included in the specimen of the inspected subject, and comprises: a mixing casing having an internal space for mixing a specimen of an inspected subject and a reagent; and a funnel-shaped feeding body installed to communicate with the internal space at the top of the mixing casing, and having an entrance which becomes wider toward the top thereof so as to easily receive the liquid specimen and the reagent which fall from the top side thereof.

Description

암 진단 자동화 시스템용 암 진단 키트{CANCER DIAGNOSTIC KIT FOR CANCER DIAGNOSTIC AUTOMATION SYSTEM}[0001] CANCER DIAGNOSTIC KIT FOR CANCER DIAGNOSTIC AUTOMATION SYSTEM [0002]

본 발명은 암 진단 키트에 관한 것으로, 특히 피검수자 개인이 자신에게서 채취된 액상의 검체를 사용하여 가정에서 간편하게 암 및 대사질환의 발생을 확인할 수도 있도록 한 것은 물론, 검체의 채취부터 분석에 이르는 전과정을 자동화하기 용이하도록 상측으로부터 낙하하는 액상의 검체 및 시약을 쉽게 받아들여 균질하게 혼합할 수 있도록 한 암 진단 자동화 시스템용 암 진단 키트에 관한 것이다. The present invention relates to a cancer diagnostic kit, and more particularly, it relates to a cancer diagnostic kit, in which an individual to be inspected can easily identify the occurrence of cancer and metabolic diseases at home using a liquid sample collected from the subject, The present invention relates to a cancer diagnosis kit for a cancer diagnosis automation system which can easily receive and mix homogeneous liquid specimens and reagents dropping from the upper side so as to facilitate the automation.

암 마커는 악성 종양 세포 자체 내에서 생기거나 또는 암에 대한 정상조직의 반응으로 만들어져 혈액, 소변 또는 조직 내에서 비정상적으로 높은 농도를 나타내는 물질이며, 혈액, 소변 또는 조직 내의 암 마커 농도를 통해 암의 진행과 퇴화를 진단, 스크리닝, 추적할 수 있다.Cancer markers are substances that occur in the malignant tumor cells themselves or are caused by reactions of normal tissues against cancer and exhibit abnormally high concentrations in the blood, urine or tissues, and the cancer marker concentration in the blood, urine or tissue You can diagnose, screen, and track progress and degeneration.

일반적으로 암 마커의 농도 측정 또는 검출은 혈액을 통해 이루어지고 있으나, 혈액은 일반인이 스스로 채취하기 어렵다는 문제점이 있었다.In general, the measurement or detection of the concentration of the cancer marker is carried out through the blood, but the blood has a problem that it is difficult for the general person to collect it.

이에 채취하기 어려운 혈액, 조직 등의 생체물질이 아닌 입수가 용이한 소변을 이용하여 소변 내에 존재하는 암 바이오마커 농도를 검출함으로써 암을 진단하는 방법에 대한 개발이 이루어져 왔다.There has been developed a method for diagnosing cancer by detecting the concentration of cancer biomarker present in the urine by using urine which is not easy to obtain and which is not a biomaterial such as blood or tissue.

한편, 일반인과 비교해볼 때 암 환자의 경우 소변 내에 존재하는 티로신(Tyrosine)의 농도가 높아 상기 티로신을 암 바이오마커로서 사용할 수 있음이 알려졌다.On the other hand, it is known that the tyrosine can be used as the cancer biomarker because the concentration of tyrosine present in the urine is high in cancer patients as compared with the general public.

한국 등록특허 제10-0033547호는 암환자의 소변중에 공통적으로 존재하는 방향족 아민(Tyrosine)을 검출하여 암을 진단하는 혼합 시약에 관한 것으로서, 상기 혼합 시약은 수은과 니켈, 질산 및 증류수로 구성된 것으로 기재되어 있다.Korean Patent No. 10-0033547 relates to a mixed reagent for diagnosing cancer by detecting aromatic amine (Tyrosine) commonly present in urine of a cancer patient, wherein the mixed reagent is composed of mercury, nickel, nitric acid and distilled water .

그러나, 상기 혼합 시약은 수은을 포함하고 있어 환경 및 인체에 막대한 영향을 미치기 때문에 현재 사용 금지되어 있다.However, the above-mentioned mixed reagent contains mercury and is currently prohibited because it has a great influence on the environment and human body.

따라서, 채취하기 어려운 생체물질이 아닌 입수가 용이한 소변을 이용함으로써, 소변 내에 존재하는 암 바이오마커 티로신(Tyrosine)의 농도를 친환경적으로 검출하여 암을 진단하기 위한 조성물에 대한 개발이 절실한 실정이다.Therefore, there is an urgent need to develop a composition for diagnosing cancer by eco-friendly detection of the concentration of cancer biomarker tyrosine (Tyrosine) present in the urine by using urine which is not easy to obtain but is not easy to obtain.

또한 한국공개특허공보 제2012-0124320호(2012.11.13)에는 면역크로마토그래피(Immunochromatography)법을 이용하여 소변에서 전체 전립선-특이 항원의 양을 키트 상에서 반 정량적으로 측정할 수 있는 전립선암 진단 키트가 개시되어 있다. 이 등록특허의 전립선암 진단 키트는 전립선 표피에서 높은 수준으로 발현되는 세린 단백질 분해 효소인 전립선-특이항원(Prostate specific antigen;PSA)의 항원, 항체 반응에 따른 발색을 통해 육안으로 전립선 암을 진단할 수 있도록 한 것이다. In Korean Patent Laid-Open Publication No. 2012-0124320 (Nov. 13, 2012), a prostate cancer diagnostic kit capable of semi-quantitatively measuring the amount of whole prostate-specific antigen in the urine using an immunochromatography method Lt; / RTI > This patented prostate cancer diagnostic kit is designed to diagnose prostate cancer visually through the color of antigens and antibody responses of prostate specific antigen (PSA), a serine protease that is expressed at high levels in the prostate epidermis .

그러나 종래기술에 의한 암 진단 키트에 의하면 피검수자가 소변을 직접 채취하고, 적정량의 소변과 시약을 계량한 후 , 이들을 혼합하여 색상 변화를 육안으로 관찰하며, 그에 의해 암 여부를 판단하는 일련의 번거로운 과정이 모두 수작업에 의해 진행되어야 하는 관계로, 그 과정에서 미숙한 처리 및 오염으로 인한 오진단의 문제가 발생할 가능성이 높았으며 인력과 시간이 과도하게 소모되는 경향이 있었다. However, according to the cancer diagnostic kit according to the related art, the urine is collected directly by a subject to be examined, an appropriate amount of urine and a reagent are weighed, and they are mixed to visually observe a color change, Since the process must be carried out by hand, there was a high possibility of misdiagnosis due to premature treatment and contamination, and the labor and time were excessively consumed.

한국공개특허공보 제2012-0124320호(2012.11.13)Korean Patent Publication No. 2012-0124320 (November 13, 2012)

이에 본 발명은 상기와 같은 종래의 제반 문제점을 해소하기 위해 제안된 것으로, 본 발명의 목적은피검수자 개인이 자신에게서 채취된 액상의 검체를 사용하여 가정에서 간편하게 암 및 대사질환의 발생을 확인할 수도 있도록 한 것은 물론, 검체의 채취부터 분석에 이르는 전과정을 자동화하기 용이하도록 상측으로부터 낙하하는 액상의 검체 및 시약을 쉽게 받아들여 균질하게 혼합할 수 있도록 한 암 진단 자동화 시스템용 암 진단 키트를 제공하는데 있다. It is therefore an object of the present invention to provide a method and apparatus for detecting a cancer and a metabolic disease in a home using a liquid specimen collected from the subject, And to provide a cancer diagnosis kit for a cancer diagnosis automation system that can readily accept and mix liquid sample and reagent falling from the upper side so as to easily automate the entire process from sampling to analysis .

상기와 같은 목적을 달성하기 위하여 본 발명의 기술적 사상에 의한 암 진단 자동화 시스템용 암 진단 키트는, 피검수자로부터 채취된 후 자동화 과정을 통해 운반되는 액상의 검체와 상기 피검수자의 검체에 포함된 암 마커의 검출을 위한 시약을 혼합하기 위한 암 진단 키트로서, 피검수자의 검체와 시약이 혼합되는 내부 공간을 구비한 혼합 케이싱과; 상기 혼합 케이싱의 상부에서 그 내부 공간과 연통되도록 설치되고 액상의 내용물인 검체와 시약이 상측으로부터 낙하할 때 받아들이기 용이하도록 상부로 갈수록 넓어지는 입구를 갖는 깔때기 형상의 주입체를 포함하는 것을 그 기술적 구성상의 특징으로 한다. In order to achieve the above object, a cancer diagnosis kit for a cancer diagnosis automation system according to the technical idea of the present invention comprises a liquid specimen collected from a subject to be inspected and then carried through an automated process, A cancer diagnostic kit for mixing a reagent for detecting a marker, comprising: a mixing casing having an inner space in which a specimen of a subject and a reagent are mixed; And a funnel-shaped injecting body provided in the upper part of the mixing casing so as to communicate with the inner space and having an inlet that widens toward the upper part so as to easily receive the specimen as the contents of the liquid phase and the reagent when the reagent drops from above, It is a feature of the configuration.

여기서, 상기 검체는 소변이며, 상기 시약은 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질 1(Tyrp1)을 포함하여, 소변 내에 존재하는 티로신(L-Tyrosine)을 멜라닌으로 전환시키는 티로신 검출용 효소 조성물인 것을 특징으로 할 수 있다. Here, the specimen is urine, and the reagent includes tyrosinase, Dopachrome tautomerase (DCT), and tyrosinase-related protein 1 (Tyrp1) L-tyrosine) into melanin, which is an enzyme composition for detecting tyrosine.

또한, 상기 티로신 검출용 효소 조성물은, L-티로신(L-Tyrosine)을 유멜라닌(Eumelanin)으로 전환시켜, 티로신의 농도가 증가함에 따라 소변 색상이 갈색에서 검정색으로 변색되는 것을 특징으로 할 수 있다. In addition, the enzyme composition for detecting tyrosine may be characterized in that L-tyrosine is converted into Eumelanin and the urine color changes from brown to black as the concentration of tyrosine increases .

또한, 상기 티로신 검출용 효소 조성물은, 티로시나아제 40 unit을 1중량비로 하고, 상기 티로시나아제 1 중량비 대비 도파크롬 상호변이효소(DCT)를 0.5 내지 2 중량비 및 티로시나아제-관련 단백질 1(Tyrp1)을 0.5 내지 2 중량비로 포함하고, 최종 농도가 50 내지 100 mM인 인산완충용액(Phosphate buffer) 또는 트리스-염화수소(Tris-HCl) 완충용액, 최종 농도가 0.1% 내지 0.5% Tween 20 및 증류수를 더 포함하고, 최종 반응 pH 7.0 내지 8.5 인 액체로 된 것을 특징으로 할 수 있다. In addition, the enzyme composition for detecting tyrosine comprises 0.5 to 2 parts by weight of DNA chromatin mutant enzyme (DCT) and 1 part by weight of tyrosinase-related protein 1 Tyrp1) in a final concentration of 50 to 100 mM and a final concentration of 0.1 to 0.5% Tween 20 and distilled water (Tyr-HCl) at a final concentration of 0.5 to 2 weight% And a liquid having a final reaction pH of 7.0 to 8.5.

또한, 상기 주입체에는 상단 입구를 통해 공급되는 액상의 내용물이 고여 있는 상태에서 점진적으로 낙하하도록 한 제1유출공을 갖는 상부 고임판과, 상기 상부 고임판의 하측으로 이격 설치되고 상기 제1유출공을 통해 유출된 액상의 내용물이 고여 있는 상태에서 점진적으로 낙하하도록 상기 제1유출공과 대각방향에 형성된 제2유출공을 갖는 하부 고임판이 구비된 것을 특징으로 할 수 있다.In addition, the main body may include an upper grate having a first outlet hole for allowing the liquid contents to be gradually dropped while the contents of the liquid supplied through the upper inlet are gradually accumulated, And a second outlet plate having a second outlet hole formed in a diagonal direction with respect to the first outlet hole so as to gradually drop in a state in which liquid contents flowing out through the hole are accumulated.

또한, 상기 제1유출공과 제2유출공의 하측에는 각각 제1가이드 스크루와 제2가이드 스크루가 더 설치되어 상기 제1유출공과 제2유출공을 통해 유입되는 액상의 내용물이 제1가이드 스크루와 제2가이드 스크루를 타고 나선형으로 흐르면서 더욱 감속되도록 한 것을 특징으로 할 수 있다. In addition, a first guide screw and a second guide screw are further provided below the first outlet hole and the second outlet hole, respectively, so that the contents of the liquid phase introduced through the first outlet hole and the second outlet hole are communicated with the first guide screw The second guide screw can be further reduced in speed while flowing in a spiral manner.

또한, 상기 주입체는 피검수자의 소변을 전담하여 받아들이는 소변 주입체와, 시약을 전담하여 받아들이는 시약 주입체로 구비된 것을 특징으로 할 수 있다. In addition, the injected body may be provided with a urine injected body which receives the urine of the examinee exclusively, and a reagent injected body which receives the reagent exclusively.

또한, 상기 혼합 케이싱의 상면에 설치되어 내부 공간에서 티로신 검출용 효소 조성물의 티로신 반응에 의한 색상 변화를 스캐너가 스캐닝 할 수 있도록 한 제1투명 윈도우와, 상기 혼합 케이싱의 측면에 설치되어 내부 공간에서 티로신 검출용 효소 조성물의 티로신 반응에 의한 색상 변화를 육안으로 관찰할 수 있도록 한 제2투명 윈도우로 구비된 것을 특징으로 할 수 있다. A first transparent window provided on the upper surface of the mixed casing for scanning the color change caused by the tyrosine reaction of the enzyme composition for detecting tyrosine in the inner space, And a second transparent window for visually observing the color change caused by the tyrosine reaction of the enzyme composition for tyrosine detection.

본 발명에 의한 암 진단 자동화 시스템용 암 진단 키트는, 자동화 과정을 통해 피펫이나 캡슐에 수용된 상태로 운반되는 소변 및 시약을 실수 없이 쉽게 받아들여 균질하게 혼합하는데 적합하여 소변 채취부터 분석에 이르는 전과정을 자동화환 암 진단 자동화 시스템을 구현하는데 중추적인 역할을 한다. 이로써 인력과 시간의 소모를 최소화하면서 다량의 암 진단을 실시하는 것이 가능해진다. The cancer diagnosis kit for cancer diagnosis automation system according to the present invention is adapted to easily receive and uniformly mix urine and reagents carried in pipettes or capsules through an automated process without any mistakes so that the entire process from urine collection to analysis It plays a pivotal role in implementing automated garland cancer diagnosis automation systems. This makes it possible to carry out a large amount of cancer diagnosis while minimizing labor and time consumption.

또한, 본 발명에 의한 암 진단 키트는 Further, the cancer diagnosis kit according to the present invention

또한, 본 발명에 의한 암 진단 키트는 암 진단 자동화 시스템을 구현하는 핵심적인 구성요소로 사용될 수 있는 것뿐만 아니라 피검수자 개인이 가정에서 간편하게 암 및 대사질환의 발생을 확인할 수도 있다. In addition, the cancer diagnosis kit according to the present invention can be used as a core component for implementing the cancer diagnosis automation system, and the individual to be inspected can easily confirm the occurrence of cancer and metabolic diseases at home.

또한, 본 발명은 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질 1(Tyrp1)을 포함하여 이루어져, 소변 내에 존재하는 티로신(L-Tyrosine)을 멜라닌으로 전환시키는 티로신 검출용 효소 조성물을 사용함으로써 간편하지만 암 및 대사질환의 여부를 폭 넓게 진단하는 것이 가능하다. The present invention also relates to a method for producing tyrosine (L-Tyrosine), which comprises tyrosinase, Dopachrome tautomerase (DCT) and tyrosinase-related protein 1 (Tyrp1) It is easy to use an enzyme composition for tyrosine detection that converts to melanin, but it is possible to widely diagnose cancer or metabolic diseases.

도 1은 본 발명의 실시예에 의한 암 진단 키트가 적용되는 암 진단 자동화 시스템의 전체 구성도
도 2는 본 발명의 실시예에 의한 암 진단 키트가 적용된 암 진단 자동화 시스템에서 전처리 영역의 구성을 보여주는 평면도
도 3은 본 발명의 실시예에 의한 암 진단 키트가 적용된 암 진단 자동화 시스템에서 운반부의 구성을 보여주는 참조도
도 4는 본 발명의 실시예에 의한 암 진단 키트의 구성을 설명하기 위한 사시도
도 5는 본 발명의 실시예에 의한 암 진단 키트의 구성을 설명하기 위한 측단면도
도 6은 생성된 유멜라닌의 색상을 측정하기 위한 대조 색상표
도 7은 생성된 멜라닌의 색상을 비교한 사진
1 is an overall configuration diagram of a cancer diagnosis automation system to which a cancer diagnosis kit according to an embodiment of the present invention is applied
2 is a plan view showing a configuration of a preprocessing area in a cancer diagnosis automation system to which a cancer diagnosis kit according to an embodiment of the present invention is applied
FIG. 3 is a view showing the configuration of the carrying part in the cancer diagnosis automation system to which the cancer diagnosis kit according to the embodiment of the present invention is applied.
4 is a perspective view for explaining a configuration of a cancer diagnosis kit according to an embodiment of the present invention;
5 is a side sectional view for explaining a configuration of a cancer diagnosis kit according to an embodiment of the present invention;
FIG. 6 is a table showing the relationship between the color of the produced melanin
Figure 7 is a photograph comparing the color of the produced melanin

첨부한 도면을 참조하여 본 발명의 실시예에 의한 암 진단 자동화 시스템용 암 진단 키트에 대하여 상세히 설명한다. 본 발명은 다양한 변경을 가할 수 있고 여러 가지 형태를 가질 수 있는바, 특정 실시예 들을 도면에 예시하고 본문에 상세하게 설명하고자 한다. 그러나 이는 본 발명을 특정한 개시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술범위에 포함되는 모든 변경, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 각 도면을 설명하면서 유사한 참조부호를 유사한 구성요소에 대해 사용하였다. 첨부된 도면에 있어서, 구조물들의 치수는 본 발명의 명확성을 기하기 위하여 실제보다 확대하거나, 개략적인 구성을 이해하기 위하여 실제보다 축소하여 도시한 것이다.A cancer diagnosis kit for a cancer diagnosis automation system according to an embodiment of the present invention will be described in detail with reference to the accompanying drawings. The present invention is capable of various modifications and various forms, and specific embodiments are illustrated in the drawings and described in detail in the text. It is to be understood, however, that the invention is not intended to be limited to the particular forms disclosed, but on the contrary, is intended to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention. Like reference numerals are used for like elements in describing each drawing. In the accompanying drawings, the dimensions of the structures are enlarged to illustrate the present invention, and are actually shown in a smaller scale than the actual dimensions in order to understand the schematic structure.

또한, 제1 및 제2 등의 용어는 다양한 구성요소들을 설명하는데 사용될 수 있지만, 상기 구성요소들은 상기 용어들에 의해 한정되어서는 안 된다. 상기 용어들은 하나의 구성요소를 다른 구성요소로부터 구별하는 목적으로만 사용된다. 예를 들어, 본 발명의 권리 범위를 벗어나지 않으면서 제1 구성요소는 제2 구성요소로 명명될 수 있고, 유사하게 제2 구성요소도 제1 구성요소로 명명될 수 있다. 한편, 다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.Also, the terms first and second, etc. may be used to describe various components, but the components should not be limited by the terms. The terms are used only for the purpose of distinguishing one component from another. For example, without departing from the scope of the present invention, the first component may be referred to as a second component, and similarly, the second component may also be referred to as a first component. On the other hand, unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Terms such as those defined in commonly used dictionaries are to be interpreted as having a meaning consistent with the contextual meaning of the related art and are to be interpreted as either ideal or overly formal in the sense of the present application Do not.

도 1은 본 발명의 실시예에 의한 암 진단 키트가 적용되는 암 진단 자동화 시스템의 전체 구성도이고, 도 2는 본 발명의 실시예에 의한 암 진단 키트가 적용된 암 진단 자동화 시스템에서 전처리 영역의 구성을 보여주는 평면도이며, 도 3은 본 발명의 실시예에 의한 암 진단 키트가 적용된 암 진단 자동화 시스템에서 운반부의 구성을 보여주는 참조도이다.FIG. 1 is an overall configuration diagram of a cancer diagnosis automation system to which a cancer diagnosis kit according to an embodiment of the present invention is applied; FIG. 2 is a block diagram of a configuration of a preprocessing area in a cancer diagnosis automation system to which a cancer diagnosis kit according to an embodiment of the present invention is applied; FIG. 3 is a reference view showing a configuration of a carrier in a cancer diagnosis automation system to which a cancer diagnosis kit according to an embodiment of the present invention is applied.

도시된 바와 같이, 본 발명의 실시예에 의한 암 진단 키트(140a)는, 운반부(110), 소변 채취부(120), 정량 포장부(130), 시약 혼합부(140), 스캐닝부(150), 분석부(160)를 포함하여 이루어져서 소변 채취부터 분석에 이르는 전과정을 자동화할 수 있도록 한 암 진단 자동화 시스템에서 중추적인 역할을 하는 시약 혼합부(140)에 적용되어 피펫이나 캡슐에 수용된 상태로 운반되는 소변 및 시약을 실수 없이 쉽게 받아들인 후 균질하게 혼합함으로써 그 반응을 살필 수 있도록 구성된다.As shown in the figure, the cancer diagnosis kit 140a according to an embodiment of the present invention includes a carrier 110, a urine collection unit 120, a quantitative packaging unit 130, a reagent mixing unit 140, a scanning unit 150, and an analysis unit 160, and is applied to a reagent mixing unit 140, which plays a pivotal role in a cancer diagnosis automation system that can automate the entire process from urine collection to analysis, The urine and the reagent which are carried to the human body can be easily taken without any mistake and then mixed homogeneously.

본 발명의 실시예에 의한 암 진단 키트(140a)에 대해 설명하기에 앞서 상기 운반부(110)에 대해 간단히 설명하면, 도 3에 도시된 것처럼 상기 운반부(110)는 소변 채취부(120), 정량 포장부(130), 본 발명에 의한 암 진단 키트(140a)를 포함하는 시약 혼합부(140) 간에 피검수자의 소변 및 소변 캡슐(T)을 운반하기 위해 피펫(114)과 픽커(115)를 구비한다. 또한, 상기 피펫(114)과 픽커(115)의 이동을 위하여 가이드레일(112)과, 상기 가이드레일(112)을 따라 이동하며 피펫(114)과 픽커(115)가 수평이동 및 승강 가능하도록 설치된 이동체(113)를 구비한다. 또한, 피펫(114)과 픽커(115)를 이용하여 운반하던 물질 또는 물품을 임시 보관하거나 놓아두기 위한 스테이션(111)도 구비한다. 3, the carrying unit 110 includes a urine collecting unit 120 and a urine collecting unit 120. The urine collecting unit 120, Between the pipette 114 and the picker 115 to transport the urine and urine capsules T of the examinee between the reagent mixing unit 140 including the quantitative packaging unit 130 and the cancer diagnosis kit 140a according to the present invention, . The pipette 114 and the picker 115 may be moved horizontally and vertically while moving along the guide rail 112 and the guide rail 112 for moving the pipette 114 and the picker 115 And a moving body 113. In addition, a station 111 for temporarily storing or releasing a substance or an item carried by the pipette 114 and the picker 115 is also provided.

이하, 본 발명의 실시예에 의한 암 진단 자동화 시스템용 암 진단 키트에 대해 상세히 설명한다. Hereinafter, a cancer diagnosis kit for a cancer diagnosis automation system according to an embodiment of the present invention will be described in detail.

도 4는 본 발명의 실시예에 의한 암 진단 키트의 구성을 설명하기 위한 사시도이며, 도 5는 본 발명의 실시예에 의한 암 진단 키트의 구성을 설명하기 위한 측단면도이다.FIG. 4 is a perspective view illustrating a configuration of a cancer diagnostic kit according to an embodiment of the present invention, and FIG. 5 is a side sectional view illustrating a configuration of a cancer diagnostic kit according to an embodiment of the present invention.

도시된 바와 같이, 본 발명의 실시예에 의한 암 진단 키트는 정량 포장부(130)에서 만들어진 소변 캡슐(T)에 수용된 소변과 시약을 혼합하여 피검수자의 소변에 포함된 암 마커를 검출할 수 있도록 하는 역할을 담당한다. 이를 위해 본 발명의 실시예에 의한 암 진단 키트는 소변 캡슐(T)로 이송된 정량의 소변, 그와 별도로 마련된 시약이 투입된 후 혼합되는 내부 공간을 갖는 혼합 케이싱(141)과, 상기 혼합 케이싱(141)의 상부에서 그 내부 공간과 연통되도록 설치되되 정량의 소변과 시약을 각각 내용물로 하여 받아들이기 용이하도록 상부로 갈수록 넓어지는 입구를 갖는 깔때기 형상으로 형성된 소변 주입체(142)와 시약 주입체(143)를 구비하며, 이들 각 구성요소들에 대해서 보다 상세히 설명한다. As shown in the figure, the cancer diagnosis kit according to the embodiment of the present invention can detect the cancer marker contained in the urine of the examinee by mixing the urine contained in the urine capsule T made in the quantitative packaging unit 130 with the reagent It is the responsibility of the To this end, the cancer diagnosis kit according to an embodiment of the present invention includes a mixing casing 141 having a predetermined amount of urine transferred to the urine capsule T, 141), a funnel-shaped urine injection body (142) and a reagent injection body (142) formed to communicate with the inner space and having an inlet that widens toward the upper portion so as to easily receive a predetermined amount of urine and reagent as contents, 143, and each of these components will be described in more detail.

(단, 여기서 암 마커 검출용 시약은 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질1(Tyrp1)을 포함하여 소변 내에 존재하는 티로신(L-Tyrosine)을 멜라닌으로 전환시키는 티로신 검출용 효소 조성물로서 소변 내에 존재하는 티로신의 농도를 친환경적으로 검출하여 암 및 대사질환의 존재 여부를 진단할 수 있도록 개발된 것으로, L-티로신(L-Tyrosine)을 유멜라닌(Eumelanin)으로 전환시켜 티로신의 농도가 증가함에 따라 소변 색상이 갈색에서 검정색으로 변색되도록 함으로써 소변에 포함된 티로신을 보다 용이하게 검출하도록 한 것이다. 이같은 티로신 검출용 효소 조성물은 티로시나아제 40 unit을 1중량비로 하고, 상기 티로시나아제 1 중량비 대비 도파크롬 상호변이효소(DCT)를 0.5 내지 2 중량비 및 티로시나아제-관련 단백질 1(Tyrp1)을 0.5 내지 2 중량비로 포함하며, 최종 농도가 50 내지 100 mM인 인산완충용액(Phosphate buffer) 또는 트리스-염화수소(Tris-HCl) 완충용액, 최종 농도가 0.1% 내지 0.5% Tween 20 및 증류수를 더 포함하고, 최종 반응 pH 7.0 내지 8.5 인 액체로 되는 것이 바람직하다. 이같은 티로신 검출용 효소 조성물에 대해서는 그 제조방법 등에 대해 차후에 더욱 상세히 설명하기로 한다.) Wherein the reagent for detecting cancer marker comprises tyrosine (L-lysine), which is present in the urine, including tyrosinase, Dopachrome tautomerase (DCT) and tyrosinase-related protein 1 (Tyrp1) Tyrosine) into melanin. It is an enzyme composition for the detection of tyrosine. It is developed to detect the presence or absence of cancer and metabolic diseases by detecting the concentration of tyrosine present in urine environmentally. L-tyrosine The enzyme composition for the detection of tyrosine was found to inhibit tyrosinase 40. The enzyme composition for detecting tyrosinase 40 was found to be more stable than that of tyrosinase 40. [ unit, and 0.5 to 2 parts by weight of a dopachrome mutant enzyme (DCT) relative to 1 part by weight of the tyrosinase, A phosphate buffer or a Tris-HCl buffer solution containing 0.5 to 2 parts by weight of the protein-1 related protein 1 (Tyrp1) at a final concentration of 50 to 100 mM, 0.5% Tween 20, and distilled water, and a final reaction pH of 7.0 to 8.5. The enzyme composition for the detection of tyrosine will be described later in more detail.

상기 혼합 케이싱(141)은 그 내부 공간에서 티로신 검출용 효소 조성물의 티로신 반응에 의하여 생성된 유멜라닌의 색상을 외부에서 파악할 수 있도록 상면과 측면에 각각 제1투명 윈도우(144)와 제2투명 윈도우(145)가 설치된다. 이 중 제1투명 윈도우는 상기 스캐닝부(150)가 생성된 유멜라닌의 색상을 스캐닝할 수 있도록 한 것이며, 제2투명 윈도우(145)는 육안으로 확인할 수 있도록 한 것이다. 육안 확인시에는 대조색상표(146)와 상기 생성된 유멜라닌의 색상을 비교하여 소변 내의 티로신 농도를 확인 할 수 있다. The mixed casing 141 has a first transparent window 144 and a second transparent window 144 on the top and side surfaces, respectively, so as to grasp the color of the eumelanin produced by the tyrosine reaction of the enzyme composition for detecting tyrosine in the inner space, (145). The first transparent window is used to scan the color of the generated eumelanin by the scanning unit 150, and the second transparent window 145 is visible to the naked eye. At the time of visual confirmation, tyrosine concentration in the urine can be confirmed by comparing the color of the produced coloring matter with that of the control color table 146.

또한, 상기 혼합 케이싱(141)은 내부 공간을 구비하고 상부가 개방된 본체부(141a)와, 상기 본체부(141a)의 개방된 상부를 덮는 커버부(141b)의 조합으로 이루어져 상기 커버부(141b)에 의해 본체부(141a)의 상부를 넓게 개방함으로써 한 암 진단에 사용된 소변 및 시약을 쉽게 버릴 수 있다. The mixing casing 141 is composed of a combination of a main body portion 141a having an inner space and an open upper portion and a cover portion 141b covering an opened upper portion of the main body portion 141a, The urine and the reagent used for the diagnosis of cancer can be easily discarded by widely opening the upper portion of the body portion 141a.

이같은 암 진단 키트(140a)의 구성에서 특히 주목할 수 있는 점은 상기 소변 주입체(142)와 시약 주입체(143) 모두 액상의 내용물을 받아들이기 용이하도록 몸체가 상부로 갈수록 넓어지는 깔때기 형상으로 형성되었다는 점이다. 이로써, 작업자가 수작업에 의해, 혹은 자동화된 이동체(113)에 의해 정밀하게 위치 보정을 하지 않아도 혼합 케이싱(141) 내부로 실패 없이 액상의 내용물을 주입할 수 있다는 점에 있다.Particularly noteworthy in the construction of the cancer diagnostic kit 140a is that the urine injector body 142 and the reagent injector body 143 are formed into a funnel shape that widens toward the upper part so as to easily receive the contents of the liquid phase . Thus, the liquid content can be injected into the mixing casing 141 without fail even if the operator does not perform the positional correction by hand or by the automated moving body 113 without fail.

더욱이 시약인 티로신 검출용 효소 조성물에 의해 소변 내에서 생성된 유멜라닌의 색상이 원만하게 발현되기 위해서는 이들이 급격히 혼합되기보다는 서서히 혼합되는 것이 바람직하다. 이에 따라 소변 주입체(142) 및 시약 주입체(143)는 도 5에 도시된 것처럼 각각 상단 입구(142b)를 통해 공급되는 액상의 내용물이 고여 있는 상태에서 점진적으로 낙하하도록 한 제1유출공(142c-1)을 갖는 상부 고임판(142c)과, 상기 상부 고임판(142c)의 하측으로 이격 설치되고 상기 제1유출공(142c-1)을 통해 유출된 액상의 내용물이 고여 있는 상태에서 점진적으로 낙하하도록 상기 제1유출공(142c-1)과 대각방향에 형성된 제2유출공(142d-1)을 갖는 하부 고임판(142d)이 더 형성된 구성을 갖는다. 나아가 상기 제1유출공(142c-1)과 제2유출공(142d-1)의 하측에는 각각 제1가이드 스크루(142e-1)와 제2가이드 스크루(142e-2)가 더 설치된다. 이로써 상기 제1유출공(142c-1)과 제2유출공(142d-1)을 통해 유입되는 액상의 내용물이 제1가이드 스크루(142e-1)와 제2가이드 스크루(142e-2)를 타고 나선형으로 흐르면서 유속은 더욱 감소된 상태가 되어 하단 출구(142a)를 통해 혼합 케이싱(141) 내부로 유입된다. Furthermore, in order for the color of the eumelanin produced in the urine to be expressed smoothly by the enzyme composition for detecting tyrosine, which is a reagent, it is preferable that they are slowly mixed rather than rapidly mixed. The urine injecting body 142 and the reagent injecting body 143 are connected to the first outflow hole 142b and the second outflow hole 142b so as to gradually drop in a state in which the contents of the liquid phase supplied through the upper inlet 142b are accumulated, (142c-1), and a second outlet plate (142c-1) which is spaced apart from the lower side of the upper grate plate (142c) and in which liquid contents flowing out through the first outlet hole And a second outlet plate 142d-1 having a second outlet hole 142d-1 formed in a diagonal direction to the first outlet hole 142c-1 so as to drop into the first outlet hole 142c-1. Further, a first guide screw 142e-1 and a second guide screw 142e-2 are further provided below the first outlet hole 142c-1 and the second outlet hole 142d-1. Thus, the contents of the liquid phase introduced through the first outflow hole 142c-1 and the second outflow hole 142d-1 ride on the first guide screw 142e-1 and the second guide screw 142e-2 The flow velocity is further reduced while flowing in a spiral manner and flows into the mixing casing 141 through the lower outlet 142a.

위와 같은 구성에 있어서 상기 소변 주입체(142)와 시약 주입체(143)의 구성은 대동소이하지만 상기 소변 주입체(142)의 경우 상단 입구 중앙에 소변 캡슐(T)의 하단부를 천공하기 위한 천공침(142f)이 구비되는 정도의 차이만 있다. The urine injecting body 142 and the reagent injecting body 143 are configured in the same manner. However, in the case of the urine injecting body 142, a hole for perforating the lower end of the urine capsule T is formed at the center of the upper inlet, There is only a difference in the degree to which the needles 142f are provided.

계속해서 본 발명의 실시예에 의한 암 진단 키트에 사용될 암 마커 검출용 시약으로 개발된 티로신 검출용 효소 조성물에 대해 설명하기로 한다. An enzyme composition for detecting tyrosine, which has been developed as a reagent for detecting cancer marker to be used in a cancer diagnostic kit according to an embodiment of the present invention, will now be described.

전술된 바와 같이 상기 티로신 검출용 효소 조성물은 소변 내에 존재하는 암 바이오마커 티로신(Tyrosine)의 농도를 검출하기 위한 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질 1(Tyrp1)을 포함하여 이루어진다. As described above, the enzyme composition for detecting tyrosine includes tyrosinase, Dopachrome tautomerase (DCT), and tyrosinase to detect the concentration of the cancer biomarker tyrosine present in the urine. - related protein 1 (Tyrp1).

상기 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질 1(Tyrp1)을 포함하는 효소 조성물을 이용하여 소변 내에 존재하는 암 바이오마커 티로신(L-Tyrosine)을 멜라닌으로 전환시키고, 상기 멜라닌의 색상을 통해 농도를 측정함으로써 암을 진단할 수 있다.An enzyme composition comprising the above tyrosinase, Dopachrome tautomerase (DCT) and tyrosinase-related protein 1 (Tyrp1) is used to transform cancer biomarker tyrosine (L-Tyrosine ) To melanin and measuring the concentration through the color of the melanin, the cancer can be diagnosed.

상기 티로신 검출용 효소 조성물을 이용하여 L-티로신(L-Tyrosine)을 멜라닌으로 전환하는데 있어서, 상기 멜라닌은 유멜라닌(Eumelanin)인 것을 특징으로 한다.The enzyme composition for detecting tyrosine is used to convert L-tyrosine into melanin, wherein the melanin is eumelanin.

상기 티로신 검출용 효소 조성물은 소변을 이용하여 암을 진단하기 위한 것이므로, 소변의 색상을 고려해볼 때 황갈색을 나타내는 페오멜라닌(Pheomelanin) 또는 갈색을 나타내는 혼합 멜라닌(Mixed melanins)을 통해 농도를 측정하는 경우, 소변의 색상과 비슷하여 농도 측정이 어려울 수 있다. 따라서, 상기 티로신 검출용 효소 조성물은 검정색을 나타내는 유멜라닌을 통해 농도를 측정하는 것이 바람직하다.Since the enzyme composition for detecting tyrosine is used for diagnosing cancer using urine, when the concentration of urine is measured using mixed melanins (Pheomelanin or brown melanin) , It may be difficult to measure the concentration because it is similar to the color of the urine. Therefore, it is preferable that the enzyme composition for detecting tyrosine is measured for its concentration through eumelanin showing black color.

상기 티로신 검출용 효소 조성물은 티로시나아제에 DCT 및 Tyrp1 효소를 추가함으로써, 유멜라닌 생합성 경로를 가속시킬 뿐만 아니라, 생성되는 유멜라닌의 색상을 보다 더 검정색을 띠는 경로로 유도할 수 있다. The enzyme composition for detecting tyrosine not only accelerates the pathway of eumelanin biosynthesis but also induces the color of the resulting eumelanin to a more black path by adding DCT and Tyrp1 enzyme to tyrosinase.

상기 티로신 검출 반응은 최종 농도가 50 내지 100 mM인 인산완충용액(Phosphate buffer) 또는 트리스-염화수소(Tris-HCl) 완충용액 및 최종 농도가 0.1% 내지 0.5%인 Tween 20, pH 7.0 내지 8.5 조건 하에서 측정하는 것이 바람직하다.The tyrosine detection reaction is carried out in a phosphate buffer or Tris-HCl buffer solution at a final concentration of 50 to 100 mM and a pH of 7.0 to 8.5 at a final concentration of 0.1% to 0.5% It is preferable to measure it.

구체적으로는, 사기 티로신 검출용 효소 조성물에 포함되는 인산완충용액은 200mM이고, 효소 조성물 500 ㎕과 소변 샘플 500 ㎕의 총 부피가 1000 ㎕인 경우, 티로신 검출 반응의 인산완충용액 최종 농도는 50mM에서 수행될 수 있다. 단, 이같은 각 성분의 비율을 참조하여 상기 암 진단 키트에 적용할 수 있다. Specifically, when the total amount of the phosphoric acid buffer solution contained in the enzyme composition for detecting scent tyrosine was 200 mM and the total volume of 500 μl of the enzyme composition and 500 μl of the urine sample was 1000 μl, the final concentration of the phosphate buffer solution in the tyrosine detection reaction was 50 mM . However, the present invention can be applied to the cancer diagnostic kit with reference to the ratio of each component.

상기 소변 내에 존재하는 티로신의 농도는 상기 티로신 검출용 효소 조성물과 반응하여 생성되는 유멜라닌의 색상을 통해 측정될 수 있다. 여기서 생성된 유멜라닌에 의한 소변의 색상이 검정색에 가까울 경우, 일정한 소변 양에 티로신의 농도가 높다는 것을 알 수 있다.The concentration of tyrosine present in the urine can be measured through the color of the eumelanin produced by the reaction with the enzyme composition for detecting tyrosine. When the color of the urine produced by the eumelanin produced here is close to black, it can be seen that the concentration of tyrosine in the constant urine amount is high.

상기 티로신 검출용 효소 조성물은 티로시나아제 40 unit을 1 중량비로 하고, 상기 티로시나아제 1 중량비 대비 DCT를 0.5 내지 2 중량비 및 Tyrp1을 0.5 내지 2 중량비로 포함하도록 한다. 이같은 함량을 만족하지 않는 경우, 생성되는 멜라닌의 색상이 황갈색계통 색상이 나타날 수 있어 소변 색과 혼합되므로 티로신의 농도를 측정하기 어려울 수 있다. The enzyme composition for detecting tyrosine comprises 40 units of tyrosinase in a weight ratio of 0.5 to 2 parts by weight of DCT and 0.5 to 2 parts by weight of Tyrp1 to 1 part by weight of the tyrosinase. If this content is not satisfied, it may be difficult to measure the concentration of tyrosine because the color of the melanin to be produced may be yellowish brown and may be mixed with the urine color.

하기 반응식 1을 참조로, L-티로신은 티로시나아제에 의해 산화되어 L-도파(3,4-dihydroxyphenylalanine, DOPA)를 형성하고, 다시 티로시나아제에 의해 산화되어 DOPA 퀴논(Quinone)을 형성하며, 루코도파크롬(Leucodopachrome)을 거쳐 도파크롬(Dopachrome)을 형성한다. Referring to Reaction Scheme 1 below, L-tyrosine is oxidized by tyrosinase to form 3,4-dihydroxyphenylalanine (DOPA), and further oxidized by tyrosinase to form DOPA quinone , And Leucodopachrome to form Dopachrome.

[반응식 1][Reaction Scheme 1]

Figure 112016052582902-pat00001
Figure 112016052582902-pat00001

상기 도파크롬은 멜라닌 전구체로서, DCT에 의해 토토머화(Tautomerization)되어 5,6-디히드록시인돌-2-카르복실산(5,6-Dihydroxyindole-2-carboxylic acid, DHICA)을 형성한다.The dopachrome is a melanin precursor and is tautomerized by DCT to form 5,6-dihydroxyindole-2-carboxylic acid (DHICA).

상기 5,6-디히드록시인돌-2-카르복실산은 Tyrp 1에 의해 산화되어 인돌-5,6-퀴논 카르복실산을 형성하고 상기 인돌-5,6-퀴논 카르복실산은 중합되어 유멜라닌을 형성한다.The 5,6-dihydroxyindole-2-carboxylic acid is oxidized by Tyrp 1 to form indole-5,6-quinonecarboxylic acid and the indole-5,6-quinonecarboxylic acid is polymerized to form uamelanin .

상기 티로시나아제(Tyrosinase)는 미생물 및 식물 및 유기체 조직에서 발견될 수 있는 티로시나아제 수산화효소 및 도파 산화효소 촉매적 활성을 갖는 구리-함유 효소이다. 특히, 상기 티로시나아제는 티로신과 같은 페놀의 산화에 의하여 멜라닌 및 다른 색소의 생성을 촉진한다.The tyrosinase is a tyrosinase hydroxylase and a copper-containing enzyme having catalytic activity of dopa oxidase, which can be found in microorganisms and plant and organism tissues. In particular, the tyrosinase promotes the production of melanin and other pigments by oxidation of phenols such as tyrosine.

상기 도파크롬 상호변이효소(Dopachrome tautomerase, DCT)는 티로시나아제-관련 단백질 2(Tyrp 2)로도 알려져 있으며, 티로시나아제 및 Tyrp 1과 결합하여 멜라닌 세포에서 L-티로신을 멜라닌으로 전환하는데 있어 특성화된 멜라닌세포 특이적 효소이다. 상기 티로시나아제-관련 단백질 1(Tyrp 1)은 티로시나아제를 안정화시키는데 도움을 주는 역할을 한다. The Dopachrome tautomerase (DCT), also known as tyrosinase-related protein 2 (Tyrp 2), binds tyrosinase and Tyrp 1 and is involved in the conversion of L-tyrosine to melanin in melanocytes Specific melanin cell-specific enzyme. The tyrosinase-related protein 1 (Tyrp 1) plays a role in stabilizing tyrosinase.

상기 티로신 검출용 효소 조성물은 상기 도파크롬이 티로시나아제에 의해 5,6-디히드록시인돌(5,6-dihydroxyindole)을 거쳐 인돌-5,6-퀴논(Indole-5,6-quinone)을 형성하여 갈색에 가까운 멜라닌을 형성하는 과정이 아닌(하기 반응식 2 참조), DCT에 의해 토토머화되고 Tyrp 1에 의해 산화되어 검은색에 가까운 멜라닌을 형성하도록 하여 시료인 소변의 색상과 구분되게 함으로써 농도 측정을 효과적으로 수행할 수 있도록 한다. The enzyme composition for detecting tyrosine is prepared by reacting indole-5,6-quinone with 5,6-dihydroxyindole via tyrosinase. (See Reaction Scheme 2 below), which is tautomerized by DCT and oxidized by Tyrp 1 to form melanin close to black to distinguish it from the color of the urine of the sample So that the measurement can be performed effectively.

[반응식 2][Reaction Scheme 2]

Figure 112016052582902-pat00002
Figure 112016052582902-pat00002

생성된 유멜라닌의 색상을 통해 소변 내에 존재하는 티로신의 농도 측정시, 도 6의 대조 색상표와 상기 생성된 유멜라닌의 색상을 비교하여 소변 내의 티로신 농도를 확인 할 수 있다. 이를 통해, 암 및 대사질환의 발생 여부를 진단할 수 있다. When measuring the concentration of tyrosine present in the urine through the color of the produced eumelanin, the concentration of tyrosine in the urine can be confirmed by comparing the color of the produced uromelanin with that of the control color table of FIG. Through this, it is possible to diagnose the occurrence of cancer and metabolic diseases.

한편, 상기 티로신 검출용 효소 조성물은 티로시나아제, DCT 및 Tyrp1을 포함하고, 인산완충용액(Phosphate buffer) 또는 트리스-염화수소(Tris-HCl) 완충용액과 Tween 20 및 증류수를 추가하여 제조할 수 있다. 또한, 상기 티로시나아제, DCt 및 Tyrp1은 전술한 바와 같이, 티로시나아제 40 unit을 1 중량비로 하고, 상기 티로시나아제 1 중량비 대비 DCT를 0.5 내지 2 중량비 및 Tyrp1을 0.5 내지 2 중량비로 포함할 수 있다. Meanwhile, the enzyme composition for detecting tyrosine includes tyrosinase, DCT, and Tyrp1, and may be prepared by adding phosphate buffer or Tris-HCl buffer solution, Tween 20, and distilled water . As described above, tyrosinase, DCt, and Tyrp1 are prepared by adding 40 units of tyrosinase to 1 part by weight of the tyrosinase, 0.5 to 2 parts by weight of DCT and 0.5 to 2 parts by weight of Tyrp1 relative to 1 part by weight of the tyrosinase, .

<제조예 1> 티로신 검출용 효소 조성물 각 구성요소의 제조 PREPARATION EXAMPLE 1 Enzyme composition for tyrosine detection Preparation of each component

티로시나아제 효소는 Sigma사로부터 구매하여 사용하였다. The tyrosinase enzyme was purchased from Sigma.

DCT와 Tyrp1은 아래 단계를 참조로 생쥐 혈액으로부터 유전자를 확보하고 대장균에서 단백질 발현 후 정제하여 실험에 사용하였다. DCT and Tyrp1 were obtained from mouse blood by reference to the following steps and purified after protein expression in E. coli.

(i) 생쥐 혈액으로부터 RNA 추출하는 단계(i) RNA extraction from mouse blood

RNA 추출은 상용화된 추출키트를 사용하였으며, RiboEx RNA extraction solution키트 (진올 바이오테크놀로지, 한국)를 사용하였다. 과정은 아래와 같다.RNA extraction was performed using a commercial extraction kit and a RiboEx RNA extraction solution kit (Jinol Biotechnology, Korea) was used. The process is as follows.

a. 생쥐혈액으로부터 생쥐 혈액 300 ㎕와 RiboEx RNA extraction solution (진올 바이오테크놀로지, 한국) 600 ㎕를 넣고 강하게 섞고 5 ~ 10분간 상온 방치하여 세포막을 녹였다. a. 300 μl of mouse blood and 600 μl of RiboEx RNA extraction solution (Jeolol Biotechnology, Korea) were mixed from the mouse blood, mixed strongly and left at room temperature for 5 ~ 10 minutes to dissolve the cell membrane.

b. 클로로포름 200 ㎕를 넣고 강하게 섞고 원심분리기를 이용해 13000 rpm, 4도, 10분간 원심분리하여 상하층으로 분리하였다. b. 200 μl of chloroform was added and mixed vigorously. The mixture was centrifuged at 13,000 rpm, 4 ° C, and 10 minutes using a centrifuge to separate upper and lower layers.

c. 상층만 회수한 후 동일한 양의 컬럼 결합buffer를 넣고 잘 섞은 후 키트에서 제공하는 컬럼에 투입하고 원심분리 (spin down) 하여 RNA 만 컬럼에 결합시켰다.c. After collecting only the upper layer, the same amount of the column-binding buffer was added and mixed well. Then, the solution was added to the column provided in the kit and spin-down to bind only RNA to the column.

d. 컬럼에 키트에서 제공하는 세척버퍼를 투입한 후 원심분리 (spin down) 하여 RNA 이외 물질을 제거하였다. 추가 1분 정도 원심분리하여 잔존하는 세척버퍼를 제거하였다.d. The wash buffer provided in the kit was added to the column, and then the material other than RNA was removed by spin-down. The remaining wash buffer was removed by centrifugation for an additional 1 minute.

e. 컬럼에 결합된 RNA를 회수하는 elution buffer를 투입한 후 5분 후 원심분리 (spin down)하여 최종적으로 RNA를 회수하였다.e. The elution buffer was added to recover the RNA bound to the column, and the RNA was recovered by spinning 5 minutes later.

(ii) 확보한 RNA로부터 cDNA를 제조하는 단계(ii) preparing cDNA from the obtained RNA

1 ㎍ RNA, Reverse transcriptase(역전사효소) 5 unit, oligo dT - 50 pmol, 0.1 M DTT- 2 ㎕, 10x 반응버퍼(reaction buffer)- 2 ㎕, 물- 약 20 ㎕; 위 조성으로 혼합물을 제조하고 PCR 기기에서 45℃에서 10분, 38℃에서 3시간 이상 반응시켰다.  1 μg RNA, 5 units of reverse transcriptase (reverse transcriptase), oligo dT-50 pmol, 0.1 M DTT- 2 μl, 10x reaction buffer - 2 μl, water - about 20 μl; The mixture was prepared in the above composition and reacted at 45 ° C for 10 minutes and at 38 ° C for 3 hours or longer in a PCR instrument.

(iii) cDNA로부터 유전자 (DCT, Tyrp1) 확보 단계(iii) securing the gene (DCT, Tyrp1) from cDNA

a. 위의 단계에서 생성된 cDNA로부터 유전자를 증폭해 내기 위해 아래와 같은 조성으로 혼합물을 제조한 후 아래 조건 하에서 유전자증폭반응(PCR)을 수행하였다.a. In order to amplify the gene from the cDNA generated in the above step, the mixture was prepared with the following composition, and the gene amplification reaction (PCR) was performed under the following conditions.

혼합물 조성: cDNA액 - 2 ㎕, pfu DNA증폭효소- 5 unit, 10mM dNTP- 2 ㎕, 10x 반응버퍼 4 ㎕, 각 2 pmol- 프라이머 쌍, 물- 약 40 ㎕. Mixture composition: 2 μl of cDNA solution, 5 units of pfu DNA amplification enzyme, 2 μl of 10 mM dNTP, 4 μl of 10 × reaction buffer, 2 pmol of each primer pair, and water - about 40 μl.

증폭반응조건: 95℃ 4분- 1회; 95℃ 20초, 60℃ 20초, 72℃ 1분 50초- 35회; 72℃ 10분- 1회; 4℃ 계속.Amplification reaction conditions: 95 ° C 4 min - 1 time; 95 ° C for 20 seconds, 60 ° C for 20 seconds, 72 ° C for 1 minute and 50 seconds - 35 times; 72 占 폚 10 min - 1 time; Continue at 4 ℃.

상기 반응에 사용된 프라이머쌍의 정보는 하기 표 1과 같다.The information of the primer pair used in the above reaction is shown in Table 1 below.

구분division 염기서열Base sequence DCT 증폭용 프라이머
Primer for DCT amplification
순방향 프라이머Forward primer Atgggccttgtgggatggg (서열번호 1)Atgggccttgtgggatggg (SEQ ID NO: 1)
역방향 프라이머Reverse primer taggcttcctccgtgtatctcttgc (서열번호 2)taggcttcctccgtgtatctcttgc (SEQ ID NO: 2) Tyrp1 증폭용 프라이머
Tyrp1 primer for amplification
순방향 프라이머Forward primer Atgaaatcttacaacgtcctccccct (서열번호 3)Atgaaatcttacaacgtcctccccct (SEQ ID NO: 3)
역방향 프라이머Reverse primer cagaccatggagtggttaggattcg (서열번호 4)cagaccatggagtggttaggattcg (SEQ ID NO: 4)

DCT와 Tyrp1 효소는 상기 방법으로 확보된 유전자를 pET28a 벡터에 삽입하여 6x His 가 N-말단에 부착된 융합단백질 형태로 제작하였고, BL21(DE3) 대장균에 형질전환시켜 단백질을 제조하였다. 그 과정은 아래와 같다.The DCT and Tyrp1 enzymes were prepared by inserting the genes obtained by the above method into the pET28a vector and constructing a fusion protein in which 6x His was attached to the N-terminus and transformed into BL21 (DE3) Escherichia coli. The process is as follows.

(i) 형질전환 대장균 배양단계(i) the step of culturing the transformed E. coli

a. pET28a 벡터의 NdeI, XhoI 제한효소 site에 DCT 또는 Tyrp1 유전자를 삽입함으로써 6x His ~단백질을 생산하는 재조합DNA를 완성하였다.a. NdeI of the pET28a vector, and DCT or Tyrp1 gene into the XhoI restriction enzyme site, thereby preparing a recombinant DNA which produces 6x His ~ protein.

b. BL21(DE3)대장균에 heat shock 형질전환법을 이용해 형질전환 대장균을 제조하였다.b. E. coli transformed with BL21 (DE3) was prepared by heat shock transformation.

c. 해당 대장균주를 3 L Luria broth액에서 37℃, 200 rpm 하에서 OD600 ~ 0.7까지 배양 후 0.1M IPTG를 처리하여 단백질생산을 induction하였다.c. The E. coli strain was cultured in 3 L of Luria broth at 37 DEG C and 200 rpm at OD600 ~ 0.7, followed by treatment with 0.1M IPTG to induce protein production.

d. 30℃, 4시간 추가배양 후 원심분리를 통해 대장균을 침전시켰다.d. After further culturing at 30 DEG C for 4 hours, E. coli was precipitated by centrifugation.

(ii) 대장균 파쇄 단계(ii) Escherichia coli disruption step

a. 침전된 대장균을 1x PBS 200 ml을 투입하여 resuspend 시켰다가 원심분리기에서 침전시킴으로써 세척과정을 수행하였다.a. The precipitated E. coli was resuspended in 200 ml of 1x PBS and washed by centrifugation.

b. 침전된 대장균을 40 ml- 0.5 M NaCl, 5mM imidazole, 20 mM Tris-HCl, pH 7.9; 에 투입하였다.b. The precipitated E. coli was suspended in 40 ml of 0.5 M NaCl, 5 mM imidazole, 20 mM Tris-HCl, pH 7.9; Lt; / RTI &gt;

c. 초음파 세포파쇄기에서 대장균을 Energy 38% max, total cell breaking time 4분(2초 sonic treatment/4초 pause) 조건 하에서 파쇄하였다. 대장균 샘플을 담은 병은 세포파쇄과정동안 얼음에 담긴 상태를 유지하였다.c. Escherichia coli was disrupted in an ultrasonic cell disruptor under the condition of Energy 38% max, total cell breaking time 4 min (2 second sonic treatment / 4 sec pause). The bottle containing the E. coli sample remained ice-filled during the cell disruption process.

d. 파쇄된 대장균은 13000 rpm, 30분, 4도 조건에서 원심분리하였다.d. The shredded E. coli was centrifuged at 13,000 rpm, 30 minutes, and 4 degrees.

e. 상등액만 깨끗한 conical tube에 모아두었다.e. Only the supernatant was collected in a clean conical tube.

(iii) Ni-NTA Agarose resin을 이용한 his tag-융합단백질 정제(iii) Purification of his tag-fusion protein using Ni-NTA agarose resin

a. 위의 단계에서 얻어진 수용성 단백질액을 Ni-NTA Agarose resin 과 혼합하고 30분간 4℃ 조건하에서 흔들어 주면서 his tag-융합단백질과 Ni-NTA Agarose resin이 서로 결합하도록 유도하였다.a. The water-soluble protein solution obtained in the above step was mixed with Ni-NTA agarose resin and shaken for 30 minutes at 4 ° C to induce binding of the his tag-fusion protein to the Ni-NTA agarose resin.

b. 단백질액, resin 혼합액을 컬럼에 투입하고 컬럼 코크를 열어 액체를 뽑아내었다.b. The protein solution and the resin mixture were put into the column, and the column cock was opened to extract the liquid.

c. Washing buffer (0.5 M NaCl, 60mM imidazole, 20 mM Tris-HCl, pH 7.9) 400 ml을 통과시켜 불순물과 융합단백질 이외의 단백질을 제거하였다.c. 400 ml of washing buffer (0.5 M NaCl, 60 mM imidazole, 20 mM Tris-HCl, pH 7.9) was passed through to remove proteins other than impurities and fusion proteins.

d. Elution buffer (0.25 M NaCl, 500mM imidazole, 20 mM Tris-HCl, pH 7.9) 3 ml을 투입하고 10분간 방치한 후 코크를 열어 단백질을 회수하였다.d. 3 ml of elution buffer (0.25 M NaCl, 500 mM imidazole, 20 mM Tris-HCl, pH 7.9) was added and allowed to stand for 10 minutes.

e. d 과정을 2회 반복하였다.e. d process was repeated twice.

(iii) FPLC-size exclusion법을 이용한 단백질 정제(iii) Protein purification using FPLC-size exclusion method

a. 회수된 단백질을 superdex S200 (GE healthcare) 컬럼이 장착된 FPLC에 투입하고 단백질을 크기에 따라 분리하였다. a. The recovered proteins were loaded onto FPLC equipped with a superdex S200 (GE healthcare) column and the proteins were separated by size.

b. 얻어진 fraction샘플들 가운데 his tag 융합단백질에 해당하는 fraction을 polyacrylamide gel electrophoresis 법으로 확인하고 최종적으로 원하는 his tag 융합단백질을 확보하였다.b. Among the obtained fraction samples, fractions corresponding to his tag fusion proteins were identified by polyacrylamide gel electrophoresis and finally the desired his tag fusion protein was obtained.

c. Abs 280값을 측정하고 얻어진 값으로부터 단백질 농도를 환산하여 하기 표 2에 기재하였다.c. Abs 280 values were measured, and protein concentrations were converted from the obtained values, and they are shown in Table 2 below.

구분division 단백질 농도(OD280nm)Protein concentration (OD 280 nm) 1 mg DCT/ml1 mg DCT / ml 1.651.65 1 mg Tyrp1/ml1 mg Tyrp1 / ml 1.421.42

<효소 조성물의 제조>&Lt; Preparation of enzyme composition >

하기 표 3을 참조로, 활성이 1000 unit/ml인 티로시나아제 효소 40 ㎕에 상기 제조예 1에서 제조된 활성이 1000 unit/ml인 DCT 40㎕ 및 활성이 1000 unit/ml인 Tyrp1 40 ㎕, 200mM Tris buffer pH 8을 250 ㎕, 10% Tween 20 25 ㎕, 증류수(Distilled water) 105 ㎕를 넣어 효소 조성물(Stock solution)을 제조하였다.40 μl of DCT with activity of 1000 unit / ml and 40 μl of Tyrp1 with activity of 1000 unit / ml prepared in Preparation Example 1 were added to 40 μl of tyrosinase enzyme having activity of 1000 unit / ml, 250 μl of 200 mM Tris buffer pH 8, 25 μl of 10% Tween 20, and 105 μl of distilled water were added to prepare an enzyme composition (stock solution).

Stock solutionStock solution Volumn(500 ㎕)Volumn (500 [mu] L) 200 mM Tris buffer pH8200 mM Tris buffer pH8 250 ㎕250 μl 10% Tween 2010% Tween 20 25 ㎕25 μl Tyrosinase(>=1000 unit/ml)Tyrosinase (> = 1000 unit / ml) 40 ㎕40 μl DCT(>=1000 unit/ml)DCT (> = 1000 unit / ml) 40 ㎕40 μl TYRP1(>=1000 unit/ml)TYRP1 (> = 1000 unit / ml) 40 ㎕40 μl D.WD.W 105 ㎕105 μl

<소변 시료 채취> <Urine sample collection>

정상인과 암환자의 소변 채취는 동일하며 다음과 같이 수행하였다.Urine collection from normal and cancer patients was the same and was performed as follows.

아침 기상 후 첫 소변을 채취함에 있어 요도로부터 흘러나오는 처음 소변은 채취하지 않으며, 중간 소변에서 샘플을 30 ml 채취하였다.The first urine from the urethra was not collected during the first urine collection after the morning wake, and 30 ml of the sample was collected from the urine.

<실험예 1> 소변 내에 존재하는 티로신 농도의 측정 1Experimental Example 1 Measurement of tyrosine concentration in urine 1

일정량 내에 존재하는 티로신의 농도를 측정하기 위해 채취된 정상인과 암환자의 소변 각각 500 ㎕ 동일한 양을 티로신 검출용 효소 조성물과 반응시켰다(각각 총 1000 ㎕). 그런 다음, 생성된 각 유멜라닌에 의한 소변의 색상을 도 6의 대조 색상표와 비교하고 하기 표 4에 기재하였다.In order to measure the concentration of tyrosine present in a certain amount, the same amount of 500 μl of each of the urine collected from the normal and cancer patients was reacted with the enzyme composition for detecting tyrosine (total 1000 μl each). Then, the color of the urine produced by each of the produced eumelanins is compared with the control color table of FIG. 6, and is shown in Table 4 below.

유멜라닌에 의한 소변의 색상Color of urine by eumelanin 정상인의 소변Urine of a normal person 황색~황갈색Yellow to tan 암환자의 소변Urine of cancer patient 검정색black

상기 표 4에서 보듯이, 정상인의 소변이 상기 티로신 검출용 효소 조성물과 반응하여 생성된 유멜라닌에 의한 소변 색상은 황색에서 황갈색인 반면, 암환자의 소변이 효소 조성물과 반응하여 생성된 유멜라닌에 의한 소변의 색상은 검정색으로 나타났음을 확인하였다.As shown in Table 4, the urine color produced by the reaction of the normal urine with the enzyme composition for detecting tyrosine was yellow to yellowish brown, while the urine of the cancer patient was reacted with the enzyme composition to produce uromelanin The color of the urine was confirmed to be black.

이를 통해, 암환자의 소변 내에 티로신이 다량으로 존재함을 알 수 있었다.This shows that tyrosine is present in large amounts in urine of cancer patients.

<실험예 2> 소변 내에 존재하는 티로신 농도의 측정 2<Experimental Example 2> Measurement of tyrosine concentration in urine 2

티로시나아제만을 포함하는 기존의 효소 조성물에 비해, 티로시나아제에 DCT 및 Tyrp1을 추가로 포함한 효소 조성물을 사용한 경우, 생성된 유멜라닌에 의한 소변의 색상이 더욱 검정색으로 나타날 수 있음을 알아보기 위해, 아래와 같이 실험을 수행하였다.Compared to the conventional enzyme compositions containing tyrosinase alone, the use of an enzyme composition which additionally contains DCT and Tyrp1 in tyrosinase can be used to show that the color of the urine produced by the produced uromelanin may become more black , The following experiment was carried out.

상기 실험예 1에서와 같은 방식으로 채취된 정상인의 소변 500 ㎕을 티로시나아제 40 unit, DCT 20 unit 및 Tyrp1 20 unit을 포함하는 상기 티로신 검출용 효소 조성물과 혼합한 혼합물 (A), 암환자의 소변 500 ㎕을 티로시나아제 40 unit만을 포함하는 기존의 효소 조성물과 혼합한 혼합물 (B), 및 암환자의 소변 500 ㎕을 티로시나아제 40 unit, DCT 20 unit 및 Tyrp1 20 unit을 포함하는 상기 티로신 검출용 효소 조성물과 혼합한 혼합물 (C)를 37℃에서 30분 동안 각각 반응시켰다.500 μl of normal human urine collected in the same manner as in Experimental Example 1 was mixed with the enzyme composition for detecting tyrosine comprising 40 units of tyrosinase, 20 units of DCT and 20 units of Tyrp1 (A) (B) in which 500 μl of urine was mixed with a conventional enzyme composition containing only 40 units of tyrosinase, and 500 μl of urine of a cancer patient were mixed with 40 μl of tyrosinase, 20 units of DCT and 20 units of Tyrp1 (C) mixed with the enzyme composition for detection were reacted at 37 DEG C for 30 minutes, respectively.

도 7을 참조하면, 티로신 검출용 효소 조성물과 정상인의 소변을 반응시킨 혼합물 (A)는 황색을 나타내는데 비해, 암환자의 소변을 반응시킨 혼합물 (B) 및 (C)는 더욱 짙은 황갈색 또는 검은색을 나타내는 것을 확인하였다.7, the mixture (A) in which the enzyme composition for tyrosine detection and reacted with urine of a normal person exhibits yellow color, while the mixture (B) and (C) in which the urine of the cancer patient is reacted shows a darker tan or black .

특히, 암환자의 소변 검출 결과, DCT 및 Tyrp 1을 더 포함한 혼합물 (C)의 색상이 티로시나아제만을 포함한 혼합물 (B)에 비해 더욱 검은색을 나타내는 것을 확인하였다.Especially, as a result of the urine detection of the cancer patient, it was confirmed that the color of the mixture (C) containing DCT and Tyrp 1 is more black than the mixture (B) containing only tyrosinase.

따라서, 티로신 검출용 효소 조성물이 티로시나아제에 DCT 및 Tyrp1 효소를 추가함으로써, 유멜라닌 생합성 경로를 가속시킬 뿐만 아니라, 생성되는 유멜라닌의 색상을 보다 더 검정색을 띠는 경로로 유도할 수 있음을 확인하였다.Thus, the addition of DCT and Tyrp1 enzymes to tyrosinease in the enzyme composition for tyrosine detection not only accelerates the pathway of eumelanin biosynthesis, but also leads to a more black-colored pathway of the color of the resulting eumelanin Respectively.

이와 같이 본 발명의 실시예에 의한 암 진단 키트에 사용하기 위해 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질 1(Tyrp1)을 포함하는 형태로 개발한 효소 조성물은 보다 정확하고 편리하게 암 및 대사질환의 발생을 확인할 수 있도록 해준다. As described above, in a form including tyrosinase, Dopachrome tautomerase (DCT) and tyrosinase-related protein 1 (Tyrp1) for use in the cancer diagnosis kit according to the embodiment of the present invention The developed enzyme composition enables more accurate and convenient identification of the occurrence of cancer and metabolic diseases.

이상에서 본 발명의 바람직한 실시예를 설명하였으나, 본 발명은 다양한 변화와 변경 및 균등물을 사용할 수 있다. 본 발명은 상기 실시예를 적절히 변형하여 동일하게 응용할 수 있음이 명확하다. 따라서 상기 기재 내용은 하기 특허청구범위의 한계에 의해 정해지는 본 발명의 범위를 한정하는 것이 아니다. While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. It is clear that the present invention can be suitably modified and applied in the same manner. Therefore, the above description does not limit the scope of the present invention, which is defined by the limitations of the following claims.

110 : 운반부 111 : 스테이션
112 : 가이드레일 113 : 이동체
114 : 피펫 115 : 픽커
120 : 소변 채취부 130 : 정량 포장부
140 : 시약 혼합부 140a : 암 진단 키트
141 : 혼합 케이싱 141a : 본체부
141b : 커버부 142 : 소변 주입체
143 : 시약 주입체 144 : 제1투명 윈도우
145 : 제2투명 윈도우 150 : 스캐닝부
160 : 분석부 T : 소변 캡슐
110: carrying part 111: station
112: guide rail 113: moving body
114: pipette 115: picker
120: urine collection unit 130: quantitative packaging unit
140: Reagent mixing section 140a: Cancer diagnosis kit
141: Mixed casing 141a:
141b: cover part 142:
143: Reagent injection body 144: 1st transparent window
145: second transparent window 150: scanning section
160: Analysis section T: Urine capsule

<110> CubeBio <120> Enzyme Compositions for Detecting Cancer Biomarker Tyrosine <130> DP18030 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 1 atgggccttg tgggatggg 19 <210> 2 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 2 ctaggcttcc tccgtgtatc tcttgc 26 <210> 3 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 3 atgaaatctt acaacgtcct ccccct 26 <210> 4 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 4 tcagaccatg gagtggttag gattcg 26 <210> 5 <211> 556 <212> PRT <213> Agaricus bisporus <400> 5 Met Ser Leu Ile Ala Thr Val Gly Pro Thr Gly Gly Val Lys Asn Arg 1 5 10 15 Leu Asn Ile Val Asp Phe Val Lys Asn Glu Lys Phe Phe Thr Leu Tyr 20 25 30 Val Arg Ser Leu Glu Leu Leu Gln Ala Lys Glu Gln His Asp Tyr Ser 35 40 45 Ser Phe Phe Gln Leu Ala Gly Ile His Gly Leu Pro Phe Thr Glu Trp 50 55 60 Ala Lys Glu Arg Pro Ser Met Asn Leu Tyr Lys Ala Gly Tyr Cys Thr 65 70 75 80 His Gly Gln Val Leu Phe Pro Thr Trp His Arg Thr Tyr Leu Ser Val 85 90 95 Phe Glu Gln Ile Leu Gln Gly Ala Ala Ile Glu Val Ala Asn Lys Phe 100 105 110 Thr Ser Asn Gln Thr Asp Trp Ile Gln Ala Ala Gln Asp Leu Arg Gln 115 120 125 Pro Tyr Trp Asp Trp Gly Phe Glu Leu Met Pro Pro Asp Glu Val Ile 130 135 140 Lys Asn Glu Glu Val Asn Ile Thr Asn Tyr Asp Gly Lys Lys Ile Ser 145 150 155 160 Val Lys Asn Pro Ile Leu Arg Tyr His Phe His Pro Ile Asp Pro Ser 165 170 175 Phe Lys Pro Tyr Gly Asp Phe Ala Thr Trp Arg Thr Thr Val Arg Asn 180 185 190 Pro Asp Arg Asn Arg Arg Glu Asp Ile Pro Gly Leu Ile Lys Lys Met 195 200 205 Arg Leu Glu Glu Gly Gln Ile Arg Glu Lys Thr Tyr Asn Met Leu Lys 210 215 220 Phe Asn Asp Ala Trp Glu Arg Phe Ser Asn His Gly Ile Ser Asp Asp 225 230 235 240 Gln His Ala Asn Ser Leu Glu Ser Val His Asp Asp Ile His Val Met 245 250 255 Val Gly Tyr Gly Lys Ile Glu Gly His Met Asp His Pro Phe Phe Ala 260 265 270 Ala Phe Asp Pro Ile Phe Trp Leu His His Thr Asn Val Asp Arg Leu 275 280 285 Leu Ser Leu Trp Lys Ala Ile Asn Pro Asp Val Trp Val Thr Ser Gly 290 295 300 Arg Asn Arg Asp Gly Thr Met Gly Ile Ala Pro Asn Ala Gln Ile Asn 305 310 315 320 Asp Glu Thr Pro Leu Glu Pro Phe Tyr Gln Ser Glu Asp Lys Val Trp 325 330 335 Thr Ser Ala Ser Leu Ala Asp Thr Ala Arg Leu Gly Tyr Ser Tyr Pro 340 345 350 Asp Phe Asp Lys Leu Val Gly Gly Thr Lys Glu Leu Ile Arg Asp Ala 355 360 365 Ile Asp Asp Leu Ile Asp Glu Arg Tyr Gly Ser Lys Pro Ser Ser Gly 370 375 380 Ala Arg Asn Thr Ala Phe Asp Leu Leu Ala Asp Phe Lys Gly Ile Thr 385 390 395 400 Lys Glu His Lys Glu Asp Leu Lys Met Tyr Asp Trp Thr Ile His Val 405 410 415 Ala Phe Lys Lys Phe Glu Leu Lys Glu Ser Phe Ser Leu Leu Phe Tyr 420 425 430 Phe Ala Ser Asp Gly Gly Asp Tyr Asp Gln Glu Asn Cys Phe Val Gly 435 440 445 Ser Ile Asn Ala Phe Arg Gly Thr Thr Pro Glu Thr Cys Ala Asn Cys 450 455 460 Gln Asp Asn Glu Asn Leu Ile Gln Glu Gly Phe Ile His Leu Asn His 465 470 475 480 Tyr Leu Ala Arg Asp Leu Glu Ser Phe Glu Pro Gln Asp Val His Lys 485 490 495 Phe Leu Lys Glu Lys Gly Leu Ser Tyr Lys Leu Tyr Ser Arg Glu Asp 500 505 510 Lys Ser Leu Thr Ser Leu Ser Val Lys Ile Glu Gly Arg Pro Leu His 515 520 525 Leu Pro Pro Gly Glu His Arg Pro Lys Tyr Asp His Thr Gln Asp Arg 530 535 540 Val Val Phe Asp Asp Val Ala Val His Val Ile Asn 545 550 555 <210> 6 <211> 517 <212> PRT <213> Mus musculus <400> 6 Met Gly Leu Val Gly Trp Gly Leu Leu Leu Gly Cys Leu Gly Cys Gly 1 5 10 15 Ile Leu Leu Arg Ala Arg Ala Gln Phe Pro Arg Val Cys Met Thr Leu 20 25 30 Asp Gly Val Leu Asn Lys Glu Cys Cys Pro Pro Leu Gly Pro Glu Ala 35 40 45 Thr Asn Ile Cys Gly Phe Leu Glu Gly Arg Gly Gln Cys Ala Glu Val 50 55 60 Gln Thr Asp Thr Arg Pro Trp Ser Gly Pro Tyr Ile Leu Arg Asn Gln 65 70 75 80 Asp Asp Arg Glu Gln Trp Pro Arg Lys Phe Phe Asn Arg Thr Cys Lys 85 90 95 Cys Thr Gly Asn Phe Ala Gly Tyr Asn Cys Gly Gly Cys Lys Phe Gly 100 105 110 Trp Thr Gly Pro Asp Cys Asn Arg Lys Lys Pro Ala Ile Leu Arg Arg 115 120 125 Asn Ile His Ser Leu Thr Ala Gln Glu Arg Glu Gln Phe Leu Gly Ala 130 135 140 Leu Asp Leu Ala Lys Lys Ser Ile His Pro Asp Tyr Val Ile Thr Thr 145 150 155 160 Gln His Trp Leu Gly Leu Leu Gly Pro Asn Gly Thr Gln Pro Gln Ile 165 170 175 Ala Asn Cys Ser Val Tyr Asp Phe Phe Val Trp Leu His Tyr Tyr Ser 180 185 190 Val Arg Asp Thr Leu Leu Gly Pro Gly Arg Pro Tyr Lys Ala Ile Asp 195 200 205 Phe Ser His Gln Gly Pro Ala Phe Val Thr Trp His Arg Tyr His Leu 210 215 220 Leu Trp Leu Glu Arg Glu Leu Gln Arg Leu Thr Gly Asn Glu Ser Phe 225 230 235 240 Ala Leu Pro Tyr Trp Asn Phe Ala Thr Gly Lys Asn Glu Cys Asp Val 245 250 255 Cys Thr Asp Glu Leu Leu Gly Ala Ala Arg Gln Asp Asp Pro Thr Leu 260 265 270 Ile Ser Arg Asn Ser Arg Phe Ser Thr Trp Glu Ile Val Cys Asp Ser 275 280 285 Leu Asp Asp Tyr Asn Arg Arg Val Thr Leu Cys Asn Gly Thr Tyr Glu 290 295 300 Gly Leu Leu Arg Arg Asn Lys Val Gly Arg Asn Asn Glu Lys Leu Pro 305 310 315 320 Thr Leu Lys Asn Val Gln Asp Cys Leu Ser Leu Gln Lys Phe Asp Ser 325 330 335 Pro Pro Phe Phe Gln Asn Ser Thr Phe Ser Phe Arg Asn Ala Leu Glu 340 345 350 Gly Phe Asp Lys Ala Asp Gly Thr Leu Asp Ser Gln Val Met Asn Leu 355 360 365 His Asn Leu Ala His Ser Phe Leu Asn Gly Thr Asn Ala Leu Pro His 370 375 380 Ser Ala Ala Asn Asp Pro Val Phe Val Val Leu His Ser Phe Thr Asp 385 390 395 400 Ala Ile Phe Asp Glu Trp Leu Lys Arg Asn Asn Pro Ser Thr Asp Ala 405 410 415 Trp Pro Gln Glu Leu Ala Pro Ile Gly His Asn Arg Met Tyr Asn Met 420 425 430 Val Pro Phe Phe Pro Pro Val Thr Asn Glu Glu Leu Phe Leu Thr Ala 435 440 445 Glu Gln Leu Gly Tyr Asn Tyr Ala Val Asp Leu Ser Glu Glu Glu Ala 450 455 460 Pro Val Trp Ser Thr Thr Leu Ser Val Val Ile Gly Ile Leu Gly Ala 465 470 475 480 Phe Val Leu Leu Leu Gly Leu Leu Ala Phe Leu Gln Tyr Arg Arg Leu 485 490 495 Arg Lys Gly Tyr Ala Pro Leu Met Glu Thr Gly Leu Ser Ser Lys Arg 500 505 510 Tyr Thr Glu Glu Ala 515 <210> 7 <211> 537 <212> PRT <213> Mus musculus <400> 7 Met Lys Ser Tyr Asn Val Leu Pro Leu Ala Tyr Ile Ser Leu Phe Leu 1 5 10 15 Met Leu Phe Tyr Gln Val Trp Ala Gln Phe Pro Arg Glu Cys Ala Asn 20 25 30 Ile Glu Ala Leu Arg Arg Gly Val Cys Cys Pro Asp Leu Leu Pro Ser 35 40 45 Ser Gly Pro Gly Thr Asp Pro Cys Gly Ser Ser Ser Gly Arg Gly Arg 50 55 60 Cys Val Ala Val Ile Ala Asp Ser Arg Pro His Ser Arg His Tyr Pro 65 70 75 80 His Asp Gly Lys Asp Asp Arg Glu Ala Trp Pro Leu Arg Phe Phe Asn 85 90 95 Arg Thr Cys Gln Cys Asn Asp Asn Phe Ser Gly His Asn Cys Gly Thr 100 105 110 Cys Arg Pro Gly Trp Arg Gly Ala Ala Cys Asn Gln Lys Ile Leu Thr 115 120 125 Val Arg Arg Asn Leu Leu Asp Leu Ser Pro Glu Glu Lys Ser His Phe 130 135 140 Val Arg Ala Leu Asp Met Ala Lys Arg Thr Thr His Pro Gln Phe Val 145 150 155 160 Ile Ala Thr Arg Arg Leu Glu Asp Ile Leu Gly Pro Asp Gly Asn Thr 165 170 175 Pro Gln Phe Glu Asn Ile Ser Val Tyr Asn Tyr Phe Val Trp Thr His 180 185 190 Tyr Tyr Ser Val Lys Lys Thr Phe Leu Gly Thr Gly Gln Glu Ser Phe 195 200 205 Gly Asp Val Asp Phe Ser His Glu Gly Pro Ala Phe Leu Thr Trp His 210 215 220 Arg Tyr His Leu Leu Gln Leu Glu Arg Asp Met Gln Glu Met Leu Gln 225 230 235 240 Glu Pro Ser Phe Ser Leu Pro Tyr Trp Asn Phe Ala Thr Gly Lys Asn 245 250 255 Val Cys Asp Val Cys Thr Asp Asp Leu Met Gly Ser Arg Ser Asn Phe 260 265 270 Asp Ser Thr Leu Ile Ser Pro Asn Ser Val Phe Ser Gln Trp Arg Val 275 280 285 Val Cys Glu Ser Leu Glu Glu Tyr Asp Thr Leu Gly Thr Leu Cys Asn 290 295 300 Ser Thr Glu Gly Gly Pro Ile Arg Arg Asn Pro Ala Gly Asn Val Gly 305 310 315 320 Arg Pro Ala Val Gln Arg Leu Pro Glu Pro Gln Asp Val Thr Gln Cys 325 330 335 Leu Glu Val Arg Val Phe Asp Thr Pro Pro Phe Tyr Ser Asn Ser Thr 340 345 350 Asp Ser Phe Arg Asn Thr Val Glu Gly Tyr Ser Ala Pro Thr Gly Lys 355 360 365 Tyr Asp Pro Ala Val Arg Ser Leu His Asn Leu Ala His Leu Phe Leu 370 375 380 Asn Gly Thr Gly Gly Gln Thr His Leu Ser Pro Asn Asp Pro Ile Phe 385 390 395 400 Val Leu Leu His Thr Phe Thr Asp Ala Val Phe Asp Glu Trp Leu Arg 405 410 415 Arg Tyr Asn Ala Asp Ile Ser Thr Phe Pro Leu Glu Asn Ala Pro Ile 420 425 430 Gly His Asn Arg Gln Tyr Asn Met Val Pro Phe Trp Pro Pro Val Thr 435 440 445 Asn Thr Glu Met Phe Val Thr Ala Pro Asp Asn Leu Gly Tyr Ala Tyr 450 455 460 Glu Val Gln Trp Pro Gly Gln Glu Phe Thr Val Ser Glu Ile Ile Thr 465 470 475 480 Ile Ala Val Val Ala Ala Leu Leu Leu Val Ala Ala Ile Phe Gly Val 485 490 495 Ala Ser Cys Leu Ile Arg Ser Arg Ser Thr Lys Asn Glu Ala Asn Gln 500 505 510 Pro Leu Leu Thr Asp His Tyr Gln Arg Tyr Ala Glu Asp Tyr Glu Glu 515 520 525 Leu Pro Asn Pro Asn His Ser Met Val 530 535 <110> CubeBio <120> Enzyme Compositions for Detecting Cancer Biomarker Tyrosine <130> DP18030 <160> 7 <170> KoPatentin 3.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 1 atgggccttg tgggatggg 19 <210> 2 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 2 ctaggcttcc tccgtgtatc tcttgc 26 <210> 3 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 3 atgaaatctt acaacgtcct ccccct 26 <210> 4 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> primer <400> 4 tcagaccatg gagtggttag gattcg 26 <210> 5 <211> 556 <212> PRT <213> Agaricus bisporus <400> 5 Met Ser Leu Ile Ala Thr Val Gly Pro Thr Gly Gly Val Lys Asn Arg   1 5 10 15 Leu Asn Ile Val Asp Phe Val Lys Asn Glu Lys Phe Phe Thr Leu Tyr              20 25 30 Val Arg Ser Leu Glu Leu Leu Gln Ala Lys Glu Gln His Asp Tyr Ser          35 40 45 Ser Phe Phe Gln Leu Ala Gly Ile His Gly Leu Pro Phe Thr Glu Trp      50 55 60 Ala Lys Glu Arg Pro Ser Met Asn Leu Tyr Lys Ala Gly Tyr Cys Thr  65 70 75 80 His Gly Gln Val Leu Phe Pro Thr Trp His Arg Thr Tyr Leu Ser Val                  85 90 95 Phe Glu Gln Ile Leu Gln Gly Ala Ala Ile Glu Val Ala Asn Lys Phe             100 105 110 Thr Ser Asn Gln Thr Asp Trp Ile Gln Ala Ala Gln Asp Leu Arg Gln         115 120 125 Pro Tyr Trp Asp Trp Gly Phe Glu Leu Met Pro Pro Asp Glu Val Ile     130 135 140 Lys Asn Glu Glu Val Asn Ile Thr Asn Tyr Asp Gly Lys Lys Ile Ser 145 150 155 160 Val Lys Asn Pro Ile Leu Arg Tyr His Phe His Pro Ile Asp Pro Ser                 165 170 175 Phe Lys Pro Tyr Gly Asp Phe Ala Thr Trp Arg Thr Thr Val Arg Asn             180 185 190 Pro Asp Arg Asn Arg Arg Glu Asp Ile Pro Gly Leu Ile Lys Lys Met         195 200 205 Arg Leu Glu Glu Gly Gln Ile Arg Glu Lys Thr Tyr Asn Met Leu Lys     210 215 220 Phe Asn Asp Ala Trp Glu Arg Phe Ser Asn His Gly Ile Ser Asp Asp 225 230 235 240 Gln His Ala Asn Ser Leu Glu Ser Val His Asp Asp Ile His Val Met                 245 250 255 Val Gly Tyr Gly Lys Ile Glu Gly His Met Asp His Pro Phe Phe Ala             260 265 270 Ala Phe Asp Pro Ile Phe Trp Leu His His Thr Asn Val Asp Arg Leu         275 280 285 Leu Ser Leu Trp Lys Ala Ile Asn Pro Asp Val Trp Val Thr Ser Gly     290 295 300 Arg Asn Arg Asp Gly Thr Met Gly Ile Ala Pro Asn Ala Gln Ile Asn 305 310 315 320 Asp Glu Thr Pro Leu Glu Pro Phe Tyr Gln Ser Glu Asp Lys Val Trp                 325 330 335 Thr Ser Ala Ser Leu Ala Asp Thr Ala Arg Leu Gly Tyr Ser Tyr Pro             340 345 350 Asp Phe Asp Lys Leu Val Gly Gly Thr Lys Glu Leu Ile Arg Asp Ala         355 360 365 Ile Asp Asp Leu Ile Asp Glu Arg Tyr Gly Ser Lys Pro Ser Ser Gly     370 375 380 Ala Arg Asn Thr Ala Phe Asp Leu Leu Ala Asp Phe Lys Gly Ile Thr 385 390 395 400 Lys Glu His Lys Glu Asp Leu Lys Met Tyr Asp Trp Thr Ile His Val                 405 410 415 Ala Phe Lys Lys Phe Glu Leu Lys Glu Ser Phe Ser Leu Leu Phe Tyr             420 425 430 Phe Ala Ser Asp Gly Gly Asp Tyr Asp Gln Glu Asn Cys Phe Val Gly         435 440 445 Ser Ile Asn Ala Phe Arg Gly Thr Thr Pro Glu Thr Cys Ala Asn Cys     450 455 460 Gln Asp Asn Glu Asn Leu Ile Gln Glu Gly Phe Ile His Leu Asn His 465 470 475 480 Tyr Leu Ala Arg Asp Leu Glu Ser Phe Glu Pro Gln Asp Val His Lys                 485 490 495 Phe Leu Lys Glu Lys Gly Leu Ser Tyr Lys Leu Tyr Ser Arg Glu Asp             500 505 510 Lys Ser Leu Thr Ser Leu Ser Val Lys Ile Glu Gly Arg Pro Leu His         515 520 525 Leu Pro Pro Gly Glu His Arg Pro Lys Tyr Asp His Thr Gln Asp Arg     530 535 540 Val Val Phe Asp Asp Val Ala Val His Val Ile Asn 545 550 555 <210> 6 <211> 517 <212> PRT <213> Mus musculus <400> 6 Met Gly Leu Val Gly Trp Gly Leu Leu Leu Gly Cys Leu Gly Cys Gly   1 5 10 15 Ile Leu Leu Arg Ala Arg Ala Gln Phe Pro Arg Val Cys Met Thr Leu              20 25 30 Asp Gly Val Leu Asn Lys Glu Cys Cys Pro Pro Leu Gly Pro Glu Ala          35 40 45 Thr Asn Ile Cys Gly Phe Leu Glu Gly Arg Gly Gln Cys Ala Glu Val      50 55 60 Gln Thr Asp Thr Arg Pro Trp Ser Gly Pro Tyr Ile Leu Arg Asn Gln  65 70 75 80 Asp Asp Arg Glu Gln Trp Pro Arg Lys Phe Phe Asn Arg Thr Cys Lys                  85 90 95 Cys Thr Gly Asn Phe Ala Gly Tyr Asn Cys Gly Gly Cys Lys Phe Gly             100 105 110 Trp Thr Gly Pro Asp Cys Asn Arg Lys Lys Pro Ala Ile Leu Arg Arg         115 120 125 Asn Ile His Ser Leu Thr Ala Gln Glu Arg Glu Gln Phe Leu Gly Ala     130 135 140 Leu Asp Leu Ala Lys Lys Ser Ile His Pro Asp Tyr Val Ile Thr Thr 145 150 155 160 Gln His Trp Leu Gly Leu Leu Gly Pro Asn Gly Thr Gln Pro Gln Ile                 165 170 175 Ala Asn Cys Ser Val Tyr Asp Phe Phe Val Trp Leu His Tyr Tyr Ser             180 185 190 Val Arg Asp Thr Leu Leu Gly Pro Gly Arg Pro Tyr Lys Ala Ile Asp         195 200 205 Phe Ser His Gln Gly Pro Ala Phe Val Thr Trp His Arg Tyr His Leu     210 215 220 Leu Trp Leu Glu Arg Glu Leu Gln Arg Leu Thr Gly Asn Glu Ser Phe 225 230 235 240 Ala Leu Pro Tyr Trp Asn Phe Ala Thr Gly Lys Asn Glu Cys Asp Val                 245 250 255 Cys Thr Asp Glu Leu Leu Gly Ala Ala Arg Gln Asp Asp Pro Thr Leu             260 265 270 Ile Ser Arg Asn Ser Arg Phe Ser Thr Trp Glu Ile Val Cys Asp Ser         275 280 285 Leu Asp Asp Tyr Asn Arg Arg Val Thr Leu Cys Asn Gly Thr Tyr Glu     290 295 300 Gly Leu Leu Arg Arg Asn Lys Val Gly Arg Asn Asn Glu Lys Leu Pro 305 310 315 320 Thr Leu Lys Asn Val Gln Asp Cys Leu Ser Leu Gln Lys Phe Asp Ser                 325 330 335 Pro Pro Phe Phe Gln Asn Ser Thr Phe Ser Phe Arg Asn Ala Leu Glu             340 345 350 Gly Phe Asp Lys Ala Asp Gly Thr Leu Asp Ser Gln Val Met Asn Leu         355 360 365 His Asn Leu Ala His Ser Phe Leu Asn Gly Thr Asn Ala Leu Pro His     370 375 380 Ser Ala Asn Asp Pro Val Phe Val Val Leu His Ser Phe Thr Asp 385 390 395 400 Ala Ile Phe Asp Glu Trp Leu Lys Arg Asn Asn Pro Ser Thr Asp Ala                 405 410 415 Trp Pro Gln Glu Leu Ala Pro Ile Gly His Asn Arg Met Tyr Asn Met             420 425 430 Val Pro Phe Pro Pro Val Thr Asn Glu Glu Leu Phe Leu Thr Ala         435 440 445 Glu Gln Leu Gly Tyr Asn Tyr Ala Val Asp Leu Ser Glu Glu Glu Ala     450 455 460 Pro Val Trp Ser Thr Thr Leu Ser Val Val Ile Gly Ile Leu Gly Ala 465 470 475 480 Phe Val Leu Leu Leu Gly Leu Leu Ala Phe Leu Gln Tyr Arg Arg Leu                 485 490 495 Arg Lys Gly Tyr Ala Pro Leu Met Glu Thr Gly Leu Ser Ser Lys Arg             500 505 510 Tyr Thr Glu Glu Ala         515 <210> 7 <211> 537 <212> PRT <213> Mus musculus <400> 7 Met Lys Ser Tyr Asn Val Leu Pro Leu Ala Tyr Ile Ser Leu Phe Leu   1 5 10 15 Met Leu Phe Tyr Gln Val Trp Ala Gln Phe Pro Arg Glu Cys Ala Asn              20 25 30 Ile Glu Ala Leu Arg Arg Gly Val Cys Cys Pro Asp Leu Leu Pro Ser          35 40 45 Ser Gly Pro Gly Thr Asp Pro Cys Gly Ser Ser Ser Gly Arg Gly Arg      50 55 60 Cys Val Ala Val Ile Ala Asp Ser Arg Pro His Ser Arg His Tyr Pro  65 70 75 80 His Asp Gly Lys Asp Asp Arg Glu Ala Trp Pro Leu Arg Phe Phe Asn                  85 90 95 Arg Thr Cys Gln Cys Asn Asp Asn Phe Ser Gly His Asn Cys Gly Thr             100 105 110 Cys Arg Pro Gly Trp Arg Gly Ala Ala Cys Asn Gln Lys Ile Leu Thr         115 120 125 Val Arg Arg Asn Leu Leu Asp Leu Ser Pro Glu Glu Lys Ser His Phe     130 135 140 Val Arg Ala Leu Asp Met Ala Lys Arg Thr Thr His Pro Gln Phe Val 145 150 155 160 Ile Ala Thr Arg Arg Leu Glu Asp Ile Leu Gly Pro Asp Gly Asn Thr                 165 170 175 Pro Gln Phe Glu Asn Ile Ser Val Tyr Asn Tyr Phe Val Trp Thr His             180 185 190 Tyr Tyr Ser Val Lys Lys Thr Phe Leu Gly Thr Gly Gln Glu Ser Phe         195 200 205 Gly Asp Val Asp Phe Ser His Glu Gly Pro Ala Phe Leu Thr Trp His     210 215 220 Arg Tyr His Leu Leu Gln Leu Glu Arg Asp Met Gln Glu Met Leu Gln 225 230 235 240 Glu Pro Ser Phe Ser Leu Pro Tyr Trp Asn Phe Ala Thr Gly Lys Asn                 245 250 255 Val Cys Asp Val Cys Thr Asp Asp Leu Met Gly Ser Arg Ser Asn Phe             260 265 270 Asp Ser Thr Leu Ile Ser Pro Asn Ser Val Phe Ser Gln Trp Arg Val         275 280 285 Val Cys Glu Ser Leu Glu Glu Tyr Asp Thr Leu Gly Thr Leu Cys Asn     290 295 300 Ser Thr Glu Gly Gly Pro Ile Arg Arg Asn Pro Ala Gly Asn Val Gly 305 310 315 320 Arg Pro Ala Val Gln Arg Leu Pro Glu Pro Gln Asp Val Thr Gln Cys                 325 330 335 Leu Glu Val Arg Phe Asp Thr Pro Pro Phe Tyr Ser Asn Ser Thr             340 345 350 Asp Ser Phe Arg Asn Thr Val Glu Gly Tyr Ser Ala Pro Thr Gly Lys         355 360 365 Tyr Asp Pro Ala Val Arg Ser Leu His Asn Leu Ala His Leu Phe Leu     370 375 380 Asn Gly Thr Gly Gly Gln Thr His Leu Ser Pro Asn Asp Pro Ile Phe 385 390 395 400 Val Leu Leu His Thr Phe Thr Asp Ala Val Phe Asp Glu Trp Leu Arg                 405 410 415 Arg Tyr Asn Ala Asp Ile Ser Thr Phe Pro Leu Glu Asn Ala Pro Ile             420 425 430 Gly His Asn Arg Gln Tyr Asn Met Val Pro Phe Trp Pro Pro Val Thr         435 440 445 Asn Thr Glu Met Phe Val Thr Ala Pro Asp Asn Leu Gly Tyr Ala Tyr     450 455 460 Glu Val Gln Trp Pro Gly Gln Glu Phe Thr Val Ser Glu Ile Ile Thr 465 470 475 480 Ile Ala Val Ala Ala Leu Leu Ala Val Ala Ile Phe Gly Val                 485 490 495 Ala Ser Cys Leu Ile Arg Ser Ser Ser Thr Lys Asn Glu Ala Asn Gln             500 505 510 Pro Leu Leu Thr Asp His Tyr Gln Arg Tyr Ala Glu Asp Tyr Glu Glu         515 520 525 Leu Pro Asn Pro Asn His Ser Met Val     530 535

Claims (9)

피검수자로부터 채취된 후 자동화 과정을 통해 운반되는 액상의 검체와 상기 피검수자의 검체에 포함된 암 마커의 검출을 위한 시약을 혼합하기 위한 암 진단 키트로서,
피검수자의 검체와 시약이 혼합되는 내부 공간을 구비한 혼합 케이싱과; 상기 혼합 케이싱의 상부에서 그 내부 공간과 연통되도록 설치되고 액상의 내용물인 검체와 시약이 상측으로부터 낙하할 때 받아들이기 용이하도록 상부로 갈수록 넓어지는 입구를 갖는 깔때기 형상의 주입체를 포함하며,
상기 검체는 소변이고, 상기 시약은 티로시나아제(Tyrosinase), 도파크롬 상호변이효소(Dopachrome tautomerase, DCT) 및 티로시나아제-관련 단백질 1(Tyrp1)을 포함하여, 소변 내에 존재하는 티로신(L-Tyrosine)을 멜라닌으로 전환시키는 티로신 검출용 효소 조성물인 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
1. A cancer diagnostic kit for mixing a reagent for detecting a liquid specimen collected from a subject and then carried through an automated process and a cancer marker contained in a specimen of the subject subject,
A mixed casing having an internal space in which a specimen of a subject and a reagent are mixed; And a funnel-shaped injecting body provided at the upper part of the mixing casing so as to communicate with the inner space and having an inlet which widens toward the upper part so as to easily receive the specimen as the content of the liquid phase and the reagent when the reagent falls from above,
Wherein the sample is urine and the reagent comprises a tyrosine (L-lysine) residue in the urine, including tyrosinase, Dopachrome tautomerase (DCT) and tyrosinase- Wherein the enzyme composition is a tyrosine detection enzyme composition which converts tyrosine into melanin.
삭제delete 제1항에 있어서,
상기 티로신 검출용 효소 조성물은, L-티로신(L-Tyrosine)을 유멜라닌(Eumelanin)으로 전환시켜, 티로신의 농도가 증가함에 따라 소변 색상이 갈색에서 검정색으로 변색되는 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
The method according to claim 1,
The enzyme composition for detecting tyrosine is characterized in that L-tyrosine is converted into Eumelanin and the color of urine is changed from brown to black as the concentration of tyrosine is increased. Cancer diagnosis kit.
제3항에 있어서,
상기 티로신 검출용 효소 조성물은, 티로시나아제 40 unit을 1중량비로 하고, 상기 티로시나아제 1 중량비 대비 도파크롬 상호변이효소(DCT)를 0.5 내지 2 중량비 및 티로시나아제-관련 단백질 1(Tyrp1)을 0.5 내지 2 중량비로 포함하고, 최종 농도가 50 내지 100 mM인 인산완충용액(Phosphate buffer) 또는 트리스-염화수소(Tris-HCl) 완충용액, 최종 농도가 0.1% 내지 0.5% Tween 20 및 증류수를 더 포함하고, 최종 반응 pH 7.0 내지 8.5 인 액체로 된 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
The method of claim 3,
The enzymatic composition for detecting tyrosine comprises 0.5 to 2 parts by weight of a dopa chromium mutant enzyme (DCT) and tyrosinase-related protein 1 (Tyrp1) relative to 1 part by weight of the tyrosinase, 40 parts by weight of tyrosinase, (Phosphate buffer or Tris-HCl) buffer solution at a final concentration of 50 to 100 mM and a final concentration of 0.1 to 0.5% Tween 20 and distilled water at a final concentration of 0.5 to 2 And a liquid having a final reaction pH of 7.0 to 8.5.
제1항, 제3항 내지 제4항 중 어느 한 항에 있어서,
상기 주입체에는 상단 입구를 통해 공급되는 액상의 내용물이 고여 있는 상태에서 점진적으로 낙하하도록 한 제1유출공을 갖는 상부 고임판과, 상기 상부 고임판의 하측으로 이격 설치되고 상기 제1유출공을 통해 유출된 액상의 내용물이 고여 있는 상태에서 점진적으로 낙하하도록 상기 제1유출공과 대각방향에 형성된 제2유출공을 갖는 하부 고임판이 구비된 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
5. The method according to any one of claims 1 to 4,
An upper ointment plate having a first outlet hole and a second outlet hole, the first ointment plate being provided with a first outlet hole for gradually dropping the state of the liquid contents supplied through the upper inlet, And a second outlet plate having a second outlet hole formed in a diagonal direction with respect to the first outlet hole so as to gradually drop from a state where the contents of the liquid outflowed through the outlet are gradually accumulated.
제5항에 있어서,
상기 제1유출공과 제2유출공의 하측에는 각각 제1가이드 스크루와 제2가이드 스크루가 더 설치되어 상기 제1유출공과 제2유출공을 통해 유입되는 액상의 내용물이 제1가이드 스크루와 제2가이드 스크루를 타고 나선형으로 흐르면서 더욱 감속되도록 한 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
6. The method of claim 5,
Wherein a first guide screw and a second guide screw are further provided below the first outlet hole and the second outlet hole so that the contents of the liquid phase flowing through the first outlet hole and the second outlet hole are communicated with the first guide screw and the second guide screw, And further decelerates while flowing through the guide screw in a spiral manner.
제5항에 있어서,
상기 주입체는 피검수자의 소변을 전담하여 받아들이는 소변 주입체와, 시약을 전담하여 받아들이는 시약 주입체로 구비된 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
6. The method of claim 5,
Wherein the injected body is provided with a urine injected body which is exclusively absorbed by urine of the examinee and a reagent injected body which receives the reagent exclusively.
제1항에 있어서,
상기 혼합 케이싱에는 소변과 티로신 검출용 효소 조성물의 티로신 반응에 의한 색상 변화를 외부에서 관찰 가능하도록 투명 윈도우가 설치되며,
상기 투명 윈도우는, 상기 혼합 케이싱의 상면에 설치되어 내부 공간에서 티로신 검출용 효소 조성물의 티로신 반응에 의한 색상 변화를 스캐너가 스캐닝 할 수 있도록 한 제1투명 윈도우와, 상기 혼합 케이싱의 측면에 설치되어 내부 공간에서 티로신 검출용 효소 조성물의 티로신 반응에 의한 색상 변화를 육안으로 관찰할 수 있도록 한 제2투명 윈도우로 구비된 것을 특징으로 하는 암 진단 자동화 시스템용 암 진단 키트.
The method according to claim 1,
The mixed casing is provided with a transparent window so that the color change due to the tyrosine reaction of the enzyme composition for urine and tyrosine detection can be externally observed,
The transparent window may include a first transparent window provided on the upper surface of the mixed casing so that the scanner can scan the color change caused by the tyrosine reaction of the enzyme composition for detecting tyrosine in the inner space, And a second transparent window for visually observing a color change due to a tyrosine reaction of the enzyme composition for detecting tyrosine in an inner space.
삭제delete
KR1020160067620A 2016-05-31 2016-05-31 Cancer diagnostic kit for cancer diagnostic automation system KR101702594B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160067620A KR101702594B1 (en) 2016-05-31 2016-05-31 Cancer diagnostic kit for cancer diagnostic automation system

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160067620A KR101702594B1 (en) 2016-05-31 2016-05-31 Cancer diagnostic kit for cancer diagnostic automation system

Publications (1)

Publication Number Publication Date
KR101702594B1 true KR101702594B1 (en) 2017-02-06

Family

ID=58108824

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160067620A KR101702594B1 (en) 2016-05-31 2016-05-31 Cancer diagnostic kit for cancer diagnostic automation system

Country Status (1)

Country Link
KR (1) KR101702594B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0332444B1 (en) * 1988-03-11 1992-07-01 SAM I1 PHARMACEUTICAL MANUFACTURING CO., Ltd Reagent for diagnosis of cancer
KR20120124320A (en) 2011-05-03 2012-11-13 (주)에스에이치제약 Apparatus and manufacturing method of a diagnostic kit with the sample of urine to diagnose the prostate cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0332444B1 (en) * 1988-03-11 1992-07-01 SAM I1 PHARMACEUTICAL MANUFACTURING CO., Ltd Reagent for diagnosis of cancer
KR20120124320A (en) 2011-05-03 2012-11-13 (주)에스에이치제약 Apparatus and manufacturing method of a diagnostic kit with the sample of urine to diagnose the prostate cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J. Biol. Chem., Vol.85:261-273 (1929) *
J. Clin. Chem. Clin. Biochem.(1986), Vol.24:167-173 *
Journal of Investigative Dermatology Vol.100(2):126-131 *

Similar Documents

Publication Publication Date Title
KR101685086B1 (en) Total system for cancer diagnosis
US6887660B2 (en) Compounds for immunodiagnosis of prostate cancer and methods for their use
EP2298877A1 (en) Compounds for immunotherapy of prostate cancer and methods for their use
KR20140057331A (en) Methods and compositions for the treatment and diagnosis of breast cancer
KR101702596B1 (en) Self-detectable Diagnostic Kit for Detecting Cancer Existence Using Enzyme Composition
KR101705185B1 (en) Self-detectable Diagnostic Kit for Detecting Cancer Existence Using Enzyme Composition And Method for Diagnosing Cancer Existence
CA2640932A1 (en) Methods for diagnosing and treating prostate cancer
KR20020007362A (en) Compounds for immunotherapy and diagnosis of breast cancer and methods for their use
CN109295221A (en) Application of the circular rna as colorectal cancer molecular marker
CN109182569A (en) The loop-mediated isothermal amplification detection method and kit of high virulence helicobacter pylori
KR101702601B1 (en) Portable Diagnostic Kit for Detecting Cancer Existence Using Enzyme Composition
KR20170124401A (en) Enzyme Compositions for Detecting Cancer Biomarker Tyrosine
KR101702594B1 (en) Cancer diagnostic kit for cancer diagnostic automation system
Trabulsi et al. Development of a voided urine assay for detecting prostate cancer non‐invasively: a pilot study
KR950006170B1 (en) Method &amp; probe in vitro for detecting the presence of ring shaped particles and malignancy in human &amp; animals
CN105238872B (en) Application of product for detecting CALN1 gene expression in diagnosis and treatment of bile duct cancer
KR101707123B1 (en) Diagnostic Kit for Detecting Cancer Existence of in the Toilet bowl and Cancer Self-diagnostic System having the same
US7833757B2 (en) Method for conducting non-invasive early detection of colon cancer and/or of colon cancer precursor cells
CN1721554B (en) Method of testing anticancer agent-sensitivity of tumor cells
KR101685089B1 (en) Portable Diagnostic Kit for Detecting Cancer Existence
KR101749629B1 (en) System and Method for Determining Color of Cancer Diagnostic Kit using Smart Devices
CN106460047B (en) For identifying the method and kit of colorectal polyp and colorectal cancer before cancer
KR101749631B1 (en) Universal Color Determination System of Cancer Diagnostic Kit using Smart Devices
KR101696757B1 (en) Diagnostic Device for Detecting Cancer Existence
KR101666960B1 (en) Method for Measuring amount of Cancer Biomarker of body

Legal Events

Date Code Title Description
GRNT Written decision to grant