CN109295221A - Application of the circular rna as colorectal cancer molecular marker - Google Patents
Application of the circular rna as colorectal cancer molecular marker Download PDFInfo
- Publication number
- CN109295221A CN109295221A CN201811168419.2A CN201811168419A CN109295221A CN 109295221 A CN109295221 A CN 109295221A CN 201811168419 A CN201811168419 A CN 201811168419A CN 109295221 A CN109295221 A CN 109295221A
- Authority
- CN
- China
- Prior art keywords
- circ
- hsa
- colorectal cancer
- circular rna
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Application the invention discloses circular rna as colorectal cancer molecular marker.Present invention firstly discovers that hsa_circ_0005758 is related to colorectal cancer, hsa_circ_0005758 expression reduces in the blood plasma of colorectal cancer patients, therefore, it can judge whether subject suffers from colorectal cancer or with the presence or absence of the risk for suffering from colorectal cancer by the expression of detection subject hsa_circ_0005758.Hsa_circ_0005758 of the invention can be used as colorectal cancer correlation diagnosis and treatment molecular marker, can be realized the early diagnosis of colorectal cancer；It is also used as the Effective target site of screening colorectal cancer diagnosis and treatment, the diagnostic tools such as diagnostic kit, test paper, chip can be made into.Meanwhile the present invention also demonstrates hsa_circ_0005758 can inhibit colon-cancer cell proliferation, therefore can be used for field of antineoplastic medicaments.
Description
Technical field
The invention belongs to biomedicine field, in particular to application of the circular rna as colorectal cancer molecular marker.
Background technique
Since gastroenteric tumor early symptom is unobvious, screening indexes specificity is not high, and therefore, early detection is examined in early days
It is broken into as a great problem, and postoperative recurrence Testing index accuracy and sensibility are still undesirable, the research of circular rna is stomach and intestine
Road early diagnosis of tumor brings dawn.
Circular rna belongs to non-coding RNA, by exon and/or introne through being not covalently linked the closure RNA formed
(Guarnerio,J.,et al.,Oncogenic Role of Fusion-circRNAs Derived from Cancer-
Associated Chromosomal Translocations.Cell,2016.166(4):p.1055-1056.).Circular rna
Feature mainly has the following: 1. circular rna is widely present in eucaryote body, and abundance is high, the spy with Space-time speciality
Point；2. not having 5 ' end caps and 3 ' end tail (ploy A) structures, because being given birth in eukaryon without being sheared by RNA ribalgilase
Has the characteristics that structural stability in object；3. there is highly conserved sequence more, it is most during biological evolution not become
It is different；4. can be widely present in human serum excretion body, and with specific expressed in tumor tissues.
Studies have shown that circular rna is played an important role in the pernicious process of tumour, regulatory pathway mainly passes through absorption
Microrna plays the role of Microrna cavernous body, releases Microrna to the inhibiting effect of target gene, and then regulate and control target gene
Express (Holdt, L.M., et al., Circular non-coding RNA ANRIL modulates ribosomal RNA
maturation and atherosclerosis in humans.NatCommun,2016.7:p.12429.).Therefore, not
In the clinical diagnosis come, the expression for monitoring blood plasma circular rna can provide reference to the clinical diagnosis of disease, become early stage
Diagnose marker relevant with disease course；By regulating and controlling the expression of circular rna, new strategy can be provided for the diagnosis and treatment of tumour.
Although nowadays more and more to the research of circular rna, it has also become the potential source biomolecule marker of early diagnosis of tumor of new generation arrives
So far, there has been no the relevant reports for the blood plasma circular rna marker that can be used for colorectal cancer early diagnosis and screening.
Summary of the invention
The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, provide circular rna as colorectal cancer
The application of molecular marker.
Another object of the present invention is to provide circular rna application in preparations of anti-tumor drugs.
The purpose of the invention is achieved by the following technical solution: application of the circular rna as colorectal cancer molecular marker.
The circular rna is hsa_circ_0005758, and nucleotide sequence is (SEQ ID NO.1) as follows:
TCACCCCAAACCAGAAGGCCTGGCTGCTGCCAAGAAGCTTTGTGAGAATCTTTTGCAAACAGTTCATG
CTGAATACTCTAGATTTGTGAATCAGATTAATACTGCTGTACCTTTACCAGGCTATACACAACCCTCTGCTATAAG
TAGTGTCCCTCCTCAACCACCATATTATCCATCCAATGGCTATCAGTCTGGTTACCCTGTTGTTCCCCCTCCTCAG
CAGCCAGTTCAACCTCCCTACGGAGTACCAAGCATAGTGCCACCAGCTGTTTCATTAGCACCTGGAGTCTTGCCGG
CATTACCTACTGGAGTCCCACCTGTGCCAACACAATACCCGATAACACAAGTGCAGCCTCCAGCTAGCACTGGAC
AG；
Cyclisation site sequence of the hsa_circ_0005758 in circbase (circbase database) is as follows
(SEQ ID NO.2): agctagcactggacagtcaccccaaaccagaagg；It is formed by variable sheer, is in closed-loop
Shape structure is not easy to be degraded by exoribonuclease, more more stable than linear rna；The response containing Microrna of part cyclic RNA molecule
Element may act as competitive endogenous RNA, in conjunction with Microrna, play the role of Microrna sponge in cell, and then release
Microrna raises the expression of target gene to the inhibiting effect of its target gene.
The hsa_circ_0005758 can be natural or artificial synthesized hsa_circ_0005758, or use
The carrier transfection cell that the DNA fragmentation of hsa_circ_0005758 can be expressed obtains.
The carrier includes viral vectors and eukaryotic vector.
The viral vectors can be any carrier appropriate, including but not limited to retroviral vector, adenovirus
Carrier, adeno-associated virus (AAV) carrier, herpesvirus vector, alphavirus vectors etc..
The herpesviral includes herpes simplex virus, vaccinia virus, Epstein-Barr virus etc..
The carrier for expression of eukaryon can be any carrier appropriate, including but not limited to pCMT-Myc expression vector,
PcDNA3.0 expression vector, pcDNA6.0 expression vector, pEGFP expression vector, Pef Bos expression vector, pTet expression vector,
PTRE expression vector or modified carrier on the basis of known expression vector, such as pBin438, pCAMBIA1301.
Circular rna is preparing kit, test paper, chip, high-flux sequence platform, excretion for diagnosing colorectal cancer
Application in body or liposome, the circular rna are hsa_circ_0005758.
The kit includes the primer or probe for diagnosing hsa_circ_0005758.
The nucleotide sequence of the primer for diagnosing hsa_circ_0005758 are as follows:
Upstream primer: 5'-gcatagtgccaccagctgtt-3'；
Downstream primer: 5'-tctggtttggggtgactgtc-3'.
Further, the primer or probe in the kit for diagnosing hsa_circ_0005758 may also include existing
In technology it has been reported that the primer or probe that can be used for detecting the circular rna expression.
The chip includes solid phase carrier, and the oligonucleotide probe being fixed on the solid phase carrier.
Further, the various conventional materials based on chip field, including but not limited to Buddhist nun can be used in the solid phase carrier
Imperial film, slide or silicon wafer, unmodified slide, plastic sheet through active group (such as aldehyde radical, amino) modification etc..
The test paper includes the primer or probe for diagnosing hsa_circ_0005758.
The nucleotide sequence of the primer for diagnosing hsa_circ_0005758 are as follows:
Upstream primer: 5'-gcatagtgccaccagctgtt-3'；
Downstream primer: 5'-tctggtttggggtgactgtc-3'.
The high-flux sequence platform includes the primer or probe for diagnosing hsa_circ_0005758.
The nucleotide sequence of the primer for diagnosing hsa_circ_0005758 are as follows:
Upstream primer: 5'-gcatagtgccaccagctgtt-3'；
Downstream primer: 5'-gcctggtaaaggtacagcagta-3'.
Circular rna is preparing the application in the reagent for detecting hsa_circ_0005758 expression, the ring
Shape RNA is hsa_circ_0005758.
Application of the circular rna as colorectal cancer molecular marker in screening treatment colorectal cancer drug, is knowing
After the Close relation of the comprehensive hsa_circ_0005758 and colorectal cancer, promotion can be screened based on this feature
The substance of hsa_circ_0005758 expression；And then it can be found from the substance actually useful for treatment colorectal cancer
Drug.Therefore, the present invention also provides a kind of method of the potential substance of screening treatment colorectal cancer, the method includes:
Colorectal cancer relevant cell system is handled with candidate substances, if the candidate substances can promote mentioned-above hsa_circ_
0005758 expression or activity then show that the candidate substances are the potential substances for treating colorectal cancer.
Cell system of stating can be subcellular system, solution system, organizational framework, organ systems or animal system
(such as animal model, the preferably animal model of non-human mammal, such as mouse, rabbit, sheep, monkey) etc.；Preferably, to the potential of acquisition
Substance carries out further cell experiment and/or zoopery, real for treatment colorectal cancer further to select and determine
Useful substance.
Circular rna application in preparation of anti-tumor drugs, wherein the circular rna is hsa_circ_0005758.
The tumour is tumor in digestive tract, including colorectal cancer etc..
The anti-tumor drug is the drug for inhibiting colorectal cancer cell proliferation.
The anti-tumor drug includes the promotor of effective dose；The promotor can promote hsa_circ_
0005758 expression can promote the activity of hsa_circ_0005758 or can promote having for hsa_circ_0005758
Effect action time or the stability that hsa_circ_0005758 can be promoted.
The target of the promotor is not limited to hsa_circ_0005758 itself, further includes hsa_circ_0005758's
Upstream and downstream, such as: encode the genome sequence of hsa_circ_0005758, the target gene of hsa_circ_0005758, regulation
The albumen or gene of hsa_circ_0005758.
Further, the promotor includes albumen, oligonucleotides, small molecule compound, oligonucleotides expression vector etc.；
Promotor can also be slow virus liquid, expression plasmid and/or siRNA.
The anti-tumor drug further includes pharmaceutically acceptable carrier, and the carrier includes but is not limited to: dilute
Release agent, buffer, suspension, emulsion, granule, encapsulation agents, excipient, filler, adhesive, spray, cutaneous permeable agent,
Wetting agent, disintegrating agent, sorbefacient, surfactant, colorant, corrigent, absorption carrier etc..
Various dosage forms can be made according to the conventional method of field of pharmacology in the anti-tumor drug, including but not limited to suitable
In microinjection technique, suitable for the dosage form of transfection, such as injection, tablet, pulvis, granula, capsule.
The anti-tumor drug can be administered alone, or the drug that can treat colorectal cancer with other is combined
Application；Subject can be the mankind or other mammals；More specifically, subject is organ, tissue, cell.
The anti-tumor drug can be applied in vitro, specifically: the expression vector of circular rna is imported in vitro or is turned
Contaminate human body itself or variant cell (or heterogenous cell), after vitro cell expansion, defeated the Huis' body.
The anti-tumor drug can be applied in vivo, specifically: the expression vector of circular rna is introduced directly into vivo；
The expression vector can be virus type or non-viral type, even naked DNA or RNA.
The circular rna is hsa_circ_0005758.
" effective dose " that the present invention uses refers to can generate function or active and can be by people to human body and/or animal
And/or the amount that animal is received.The hsa_circ_0005758 effective dose can be with the mode and disease to be treated of administration
Severity etc. of disease and change.The selection of preferred effective dose can be by those of ordinary skill in the art depending on various factors
To determine (such as passing through clinical test).The factor includes but is not limited to: the hsa_circ_0005758 promotor
Pharmacokinetic parameter number of cases bioavailability, metabolism, half-life period etc.；Patient disease severity to be treated, patient
Weight, the immune state of patient, administration route etc..
It includes but is not limited to following several that the mode of circular rna express spectra is analyzed in the present invention: reverse transcription polymerase chain
Reaction method (RT-PCT), Fluorescent quantitative PCR method (Real-time PCR), in-situ hybridization method
(In situ hybridization), Northern hybridization blot assays (Northern blotting), ribalgilase are protected
Protect measuring method (RNase protection assay), Solexa sequencing technologies (Solexa
) and biochip sequencingtechnology.In a specific embodiment of the invention, poly- using real time fluorescent quantitative
Polymerase chain reaction method and in-situ hybridization method.
" circular rna " used in the present invention and " circular RNA ", " circRNA " are general.
" diagnosis colorectal cancer " used in the present invention includes the anticipation to colorectal cancer lesion, whether judges subject
Also include the diagnosis to colorectal cancer in the presence of the risk for suffering from colorectal cancer, that is, judges subject with the presence or absence of the possibility of recurrence
Property judges that subject has been recurred.
" treatment colorectal cancer " used in the present invention includes the improvement, alleviation, healing of disease.
The present invention is studied hsa_circ_0005758 using the colorectal cancer cell of in vitro culture and controlled colorectal cancer
Treatment effect.
The present invention has the following advantages and effects with respect to the prior art:
1, present invention firstly discovers that hsa_circ_0005758 is related to colorectal cancer, pass through detection subject hsa_
The expression of circ_0005758, it can be determined that whether subject suffers from colorectal cancer or judge that subject whether there is with knot
The risk of the carcinoma of the rectum, to know that clinician provides prevention scheme or therapeutic scheme to subject.
2, hsa_circ_0005758 of the invention is also used as the Effective target site of screening colorectal cancer diagnosis and treatment, is made
At diagnostic tools such as diagnostic kit, test paper, chips, it can be used for early screening, the diagnosis of colorectal cancer.
3, the present invention is experimentally confirmed the biological process that hsa_circ_0005758 can inhibit colon-cancer cell to be proliferated,
Therefore, it is considered that hsa_circ_0005758 is the drug targets for treating intestinal cancer.As a kind of new colorectal cancer correlation diagnosis and treatment point
Sub- marker, compared to traditional detection means, ring-type diagnosis has more timeliness, more specificity, more sensitivity, can be realized
The early diagnosis of colorectal cancer, to reduce the death rate of colorectal cancer.The molecular marker is that clinician formulates personalization
Therapeutic scheme is provided fundamental basis, and can be used for early screening, diagnosis and the treatment of clinical tumor in digestive tract, is clinically had wide
General application prospect.
Detailed description of the invention
Fig. 1 is using Real-time PCR detection hsa_circ_0005758 in intestinal cancer group and non-intestinal cancer group patients blood plasma
In expression result figure.
Fig. 2 is the influence diagram that the expression of hsa_circ_0005758 is proliferated colon-cancer cell.
Fig. 3 is that hsa_circ_0005758 is interfered to express the influence diagram being proliferated to colon-cancer cell.
Specific embodiment
Below with reference to embodiment, the present invention is described in further detail, and embodiments of the present invention are not limited thereto.
In following embodiments, if not specially show that reagent used is that analysis is pure, and agents useful for same can be obtained from commercial channel.Text
Middle test method without specific conditions, the Science Press that such as J. Pehanorm Brooker is write usually according to normal condition
Condition described in " Molecular Cloning:A Laboratory guide " books published in 2002, or according to condition proposed by manufacturer.Unless
It separately defines, all professions and science as used herein are for identical as purpose known to one skilled in the art.In addition,
Any method similar to or equal to what is recorded and material can be applied in the present invention.
Embodiment 1:Real-time PCR detects expression of the hsa_circ_0005758 in Colorectal Carcinoma
1. sample collection and preparation
10 colorectal cancer patients, 10 polyp of colon patients and 10 healthy volunteers are collected, it is each to extract whole blood 4ml,
Respectively at 4 DEG C 12,000 × g is centrifuged 10 minutes, removes impurity that may be present, collects plasma specimen.Respectively by collected blood
It is stand-by in -80 DEG C of refrigerator storages to starch sample.
2.RNA is extracted
Above-mentioned plasma specimen is dissolved on ice, is separately added into the TRIzol LS Reagent reagent and 20 μ l ice of 750 μ l
Acetic acid, acutely oscillation tube body extremely mixes manually.Sample solves nucleic acid-protein complex completely in incubation at room temperature 5 minutes after homogenate
From, the chloroform of 0.2ml is added, manually acutely after oscillation tube body 15 seconds, incubation at room temperature 2~3 minutes.12,000 × g is centrifuged at 4 DEG C
15 minutes.The colourless aqueous phase on upper layer is left and taken after centrifugation, 500 μ l isopropanols are added, and is mixed to precipitate RNA therein.Incubation at room temperature
After ten minutes, in 4 DEG C 12,000 × g is centrifuged 10 minutes, and RNA precipitate forms gelatinous precipitate block in bottom of the tube and side wall.It removes
75% (v/v) ethyl alcohol of 1ml is added in supernatant, cleans RNA precipitate.After oscillation, 4 DEG C 7,500 × g is centrifuged 5 minutes.Remove second
Alcoholic solution, air drying RNA precipitate 5~10 minutes.The water without RNA enzyme is added and dissolves RNA, 60 DEG C are incubated for 10 minutes.It obtains
RNA solution be stored in -80 DEG C.
3.cDNA synthesis
1. preparing annealing mixture, including RNA template, primer mix (Random N9primers, 10uM), dNTPs Mix
(2.5mM), the H without RNA enzyme2O, by mixed liquor 65 DEG C water-bath 5 minutes, on ice place 2 minutes.System configurations are as follows:
| Reacted constituent | System proportion |
| RNA template | 600ng |
| Primer mix (10uM) | 1μl |
| dNTPs Mix(2.5mM) | 1.6μl |
| Add the H of no RNA enzyme2O is to total volume | 13.5μl |
2. solution is softly mixed, after of short duration centrifugation, RT reaction solution, including 5X First- are sequentially added in centrifuge tube
Strand Buffer, 0.1M DTT, RNase Ihibitor and SuperScript III RT.After mixing, 37 DEG C of constant temperature
1 minute.50 DEG C incubate 60 minutes.70 DEG C of incubations inactivate enzyme in 15 minutes.CDNA sets ice bath for use or -20 DEG C save.System is matched
It sets as follows:
| Reacted constituent | System proportion |
| 5X First-Strand Buffer | 4μl |
| 0.1M DTT | 1μl |
| RNase Ihibitor | 0.5μl |
| SuperScript III RT | 1μl |
| Annealing mixture | 13.5μl |
| Total volume | 20μl |
4.Real-time PCR
1. Realtime PCR reaction system is respectively configured in cDNA sample, flicks tube bottom and mix solution, 5000rpm is short
Temporarily centrifugation.Wherein:
PCR special primer F (upstream primer): 5'-gcatagtgccaccagctgtt-3'；
PCR special primer R (downstream primer): 5'-tctggtttggggtgactgtc-3'.
System configurations are as follows:
| Reacted constituent | System proportion |
| 2×Master Mix | 5μl |
| The PCR special primer F of 10uM | 0.5μl |
| The PCR special primer R of 10uM | 0.5μl |
| Add water to total volume | 8μl |
2. 8 μ l mixed liquors are added in the corresponding each hole of 384 holes-PCR plate.Add corresponding 2 μ l cDNA.Carefully
It is stained with Sealing Film sealed membrane, and after of short duration centrifugation mixing, is placed in progress PCR reaction in Realtime PCR instrument.It is all
Index press following procedure progress: 95 DEG C, 10min；40 (95 DEG C, 10 seconds of PCR cycle；60 DEG C, 60 seconds (collecting fluorescence).
In order to establish the melting curve of PCR product, after amplified reaction, by 95 DEG C, 10 seconds；60 DEG C, 60 seconds；95 DEG C, 15 seconds；And from
60 DEG C are heated slowly to 99 DEG C (progress-Ramp Rate is 0.05 DEG C/sec to instrument automatically).
5. result
As shown in Figure 1, compared with colorectal polypus patient (non-intestinal cancer group), in the blood plasma of colorectal cancer patients (intestinal cancer group)
Hsa_circ_0005758 expression reduces.
Embodiment 2: colorectal cancer cell proliferation experiment detects hsa_circ_0005758 expression to colorectal cancer cell
It influences
1. colon-cancer cell culture
Colon-cancer cell strain HCT116, HT29 (purchase is in ATCC) are adherent type cell, with containing 10% (v/v) fetal calf serum
Culture solution (McCoy's 5A (Modified) Medium, buy in Thermo FisherScientific) culture.Adjustment is thin
Born of the same parents' concentration is 3~5 × 106/ L, is inoculated in culture plate, and condition of culture is 37 DEG C, 5% (v/v) CO2, 95% humidity.It sees daily
Cell growth condition, replacement culture solution are examined, cell is grown in monolayer adherence.
2.hsa_circ_0005758 transfection
By colon-cancer cell with 1 × 105/ hole is taped against in 24 orifice plates, after culture 18~24 hours, make cell quantity be about 2 ×
105/ hole is transfected with hsa_circ_0005758 slow virus (purchase is in Guangzhou Ji Sai Biotechnology Co., Ltd).Transfection
After 24 hours, former culture medium is replaced with the 2ml fresh culture containing 6 μ g/ml polybrenes (polybrene), is added appropriate
Hsa_circ_0005758 slow virus suspension.37 DEG C of incubations.2ml fresh culture is added after 4 hours to dilute coacervation.Continue to train
It supports 24 hours, is contained virulent culture medium culture 72 hours with fresh culture replacement.
3. cell proliferation experiment
Above-mentioned hsa_circ_0005758 colon-cancer cell and its cellular control unit suspension are inoculated in 96 orifice plates, in 37 DEG C
5% (v/v) CO2Incubator preculture 24 hours.After the CCK-8 solution that 10ml is added to every hole is incubated for 1~4 hour, enzyme is used
Mark absorbance of the instrument measurement at 450nm.
4. result
As shown in Fig. 2, hsa_circ_0005758 can inhibit colon-cancer cell proliferation.
Embodiment 3: the detection interference hsa_circ_0005758 expression of colorectal cancer cell proliferation experiment is thin to colorectal cancer
The influence of born of the same parents
1. colon-cancer cell culture
Colon-cancer cell strain HCT116, HT29 (purchase is in ATCC) are adherent type cell, with containing 10% (v/v) fetal calf serum
Culture solution (McCoy's 5A (Modified) Medium, buy in Thermo Fisher Scientific) culture.Adjustment
Cell concentration is 3~5 × 106/ L, is inoculated in culture plate, and condition of culture is 37 DEG C, 5% (v/v) CO2, 95% humidity.Daily
Observe cell growth condition, with changing culture solution, cell is grown in monolayer adherence.
2. interfering hsa_circ_0005758 transfection
Interfere the target sequence of hsa_circ_0005758 are as follows: GCTAGCACTGGACAGTCAC.Cumulative interference hsa_circ_
0005758 RNA (si-hsa_circ_0005758, siRNA).By taking six orifice plates as an example, the day before transfection, 5 × 105A intestinal cancer
Cell inoculation is in 6 orifice plates, 2ml complete medium, and cell confluency reaches 70~90% before transfecting.In 100 μ l free serum cultures
2.5 μ l siRNA (final concentration 50nM), soft mixing is added in base.Lipofectamine reagent is mixed, is trained with 100 μ l serum-frees
It supports base and dilutes 4 μ l lipofectamine reagents, mix gently, be placed at room temperature for 5min.By the siRNA diluted and
The mixing of lipofectamine reagent, it is soft to mix, it is placed at room temperature for 20min, it is compound to form siRNA-lipofectamine
Object.200 μ lsiRNA-lipofectamine compounds are added in the cell hole for having replaced 800 μ l serum free mediums, back and forth
Softly rock tissue culture plate.Cell is at 37 DEG C, 5% (v/v) CO2In incubator, transfection media is sucked after cultivating 5~6h,
Complete medium is replaced, culture 24 hours is continued.
3. cell proliferation experiment
(control group is not added the colon-cancer cell and its control group that above-mentioned interference hsa_circ_0005758 is inoculated in 96 orifice plates
Enter siRNA) cell suspension, in 37 DEG C of 5% (v/v) CO2Incubator preculture 24 hours.The CCK-8 of 10ml is added to every hole
After solution is incubated for 1~4 hour, the absorbance at 450nm is measured with microplate reader.
4. result
As shown in figure 3, interference hsa_circ_0005758 can promote colon-cancer cell proliferation.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Sequence table
<110>Ji'nan University
<120>application of the circular rna as colorectal cancer molecular marker
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 373
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223> hsa_circ_0005758
<400> 1
tcaccccaaa ccagaaggcc tggctgctgc caagaagctt tgtgagaatc ttttgcaaac 60
agttcatgct gaatactcta gatttgtgaa tcagattaat actgctgtac ctttaccagg 120
ctatacacaa ccctctgcta taagtagtgt ccctcctcaa ccaccatatt atccatccaa 180
tggctatcag tctggttacc ctgttgttcc ccctcctcag cagccagttc aacctcccta 240
cggagtacca agcatagtgc caccagctgt ttcattagca cctggagtct tgccggcatt 300
acctactgga gtcccacctg tgccaacaca atacccgata acacaagtgc agcctccagc 360
tagcactgga cag 373
<210> 2
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>it is cyclized site sequence
<400> 2
agctagcact ggacagtcac cccaaaccag aagg 34
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>upstream primer
<400> 3
gcatagtgcc accagctgtt 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>downstream primer
<400> 4
tctggtttgg ggtgactgtc 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>upstream primer 2
<400> 5
gcatagtgcc accagctgtt 20
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>downstream primer 2
<400> 6
gcctggtaaa ggtacagcag ta 22
<210> 7
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<223>target sequence of hsa_circ_0005758 is interfered
<400> 7
gctagcactg gacagtcac 19
Claims (10)
1. application of the circular rna as colorectal cancer molecular marker, it is characterised in that: the circular rna is hsa_circ_
0005758。
2. circular rna preparation for diagnose the kit of colorectal cancer, test paper, chip, high-flux sequence platform, excretion body or
Application in liposome, it is characterised in that: the circular rna is hsa_circ_0005758.
3. application according to claim 2, it is characterised in that: the kit and test paper includes for diagnosing hsa_
The primer or probe of circ_0005758；The nucleotide sequence of the primer for diagnosing hsa_circ_0005758 are as follows:
Upstream primer: 5'-gcatagtgccaccagctgtt-3'；
Downstream primer: 5'-tctggtttggggtgactgtc-3'；
The high-flux sequence platform includes the primer or probe for diagnosing hsa_circ_0005758；Described is used to examine
The nucleotide sequence of the primer of disconnected hsa_circ_0005758 are as follows:
Upstream primer: 5'-gcatagtgccaccagctgtt-3'；
Downstream primer: 5'-gcctggtaaaggtacagcagta-3'.
4. circular rna is preparing the application in the reagent for detecting hsa_circ_0005758 expression, it is characterised in that:
The circular rna is hsa_circ_0005758.
5. application of the circular rna as colorectal cancer molecular marker in screening treatment colorectal cancer drug, it is characterised in that:
The circular rna is hsa_circ_0005758.
6. circular rna application in preparation of anti-tumor drugs, it is characterised in that: the circular rna is hsa_circ_
0005758。
7. circular rna application in preparation of anti-tumor drugs according to claim 6, it is characterised in that: described is swollen
Tumor is colorectal cancer.
8. circular rna application in preparation of anti-tumor drugs according to claim 7, it is characterised in that: described is anti-
Tumour medicine is the drug for inhibiting colorectal cancer cell proliferation.
9. according to the described in any item circular rna application in preparations of anti-tumor drugs of claim 6~8, it is characterised in that:
The anti-tumor drug includes the promotor of effective dose；The promotor is albumen, oligonucleotides, small molecule chemical combination
Object, oligonucleotides expression vector, slow virus liquid, expression plasmid and/or siRNA.
10. according to the described in any item circular rna application in preparations of anti-tumor drugs of claim 6~8, feature exists
In: the anti-tumor drug includes pharmaceutically acceptable carrier；The carrier be diluent, buffer, suspension,
Emulsion, granule, encapsulation agents, excipient, filler, adhesive, spray, cutaneous permeable agent, wetting agent, disintegrating agent, absorption
Promotor, surfactant, colorant, corrigent or absorption carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811168419.2A CN109295221B (en) | 2018-10-08 | 2018-10-08 | Application of circular RNA as colorectal cancer molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811168419.2A CN109295221B (en) | 2018-10-08 | 2018-10-08 | Application of circular RNA as colorectal cancer molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109295221A true CN109295221A (en) | 2019-02-01 |
| CN109295221B CN109295221B (en) | 2021-07-27 |
Family
ID=65161878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811168419.2A Active CN109295221B (en) | 2018-10-08 | 2018-10-08 | Application of circular RNA as colorectal cancer molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109295221B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592221A (en) * | 2019-10-28 | 2019-12-20 | 郑州大学第一附属医院 | Early colorectal cancer diagnosis marker circ4953 and application thereof |
| CN110592220A (en) * | 2019-10-28 | 2019-12-20 | 郑州大学第一附属医院 | Early colorectal cancer diagnosis marker circ3823 and application thereof |
| CN111424017A (en) * | 2020-03-27 | 2020-07-17 | 暨南大学 | Exosome loading shRNA (short hairpin ribonucleic acid) and construction method and application thereof |
| CN112662776A (en) * | 2021-01-19 | 2021-04-16 | 广东医科大学 | Application of preparation for detecting circular RNA and/or expression quantity of circular RNA in preparation of colorectal cancer auxiliary diagnostic reagent |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012050975A2 (en) * | 2010-09-29 | 2012-04-19 | The University Of North Carolina At Chapel Hill | Novel circular mammalian rna molecules and uses thereof |
| CN106047989A (en) * | 2015-04-08 | 2016-10-26 | 中国科学院北京基因组研究所 | Application of circular RNA to colorectal cancer inspection marker |
| CN108611420A (en) * | 2018-05-14 | 2018-10-02 | 江苏省肿瘤医院 | Applications of the circ-0000423 in preparing or screening the drug of colon cancer |
-
2018
- 2018-10-08 CN CN201811168419.2A patent/CN109295221B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012050975A2 (en) * | 2010-09-29 | 2012-04-19 | The University Of North Carolina At Chapel Hill | Novel circular mammalian rna molecules and uses thereof |
| CN106047989A (en) * | 2015-04-08 | 2016-10-26 | 中国科学院北京基因组研究所 | Application of circular RNA to colorectal cancer inspection marker |
| CN108611420A (en) * | 2018-05-14 | 2018-10-02 | 江苏省肿瘤医院 | Applications of the circ-0000423 in preparing or screening the drug of colon cancer |
Non-Patent Citations (3)
| Title |
|---|
| NIANCHUN PENG等: "microarray profiling of circular RNAs in human papillary thyroid carcinoma", 《PLOS ONE》 * |
| ZHANG X L等: "Hsa_circ_0020397 regulates colorectal cancer cell viability, apoptosis and invasion by promoting the expression of the miR-138 targets TERT and PD-L1", 《CELL BIOL INT》 * |
| 李金莹等: "环状RNA：消化道肿瘤诊治的新靶点", 《中国肿瘤生物治疗杂志》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592221A (en) * | 2019-10-28 | 2019-12-20 | 郑州大学第一附属医院 | Early colorectal cancer diagnosis marker circ4953 and application thereof |
| CN110592220A (en) * | 2019-10-28 | 2019-12-20 | 郑州大学第一附属医院 | Early colorectal cancer diagnosis marker circ3823 and application thereof |
| CN110592220B (en) * | 2019-10-28 | 2023-04-14 | 郑州大学第一附属医院 | Early colorectal cancer diagnosis marker circ3823 and application thereof |
| CN110592221B (en) * | 2019-10-28 | 2023-04-25 | 郑州大学第一附属医院 | Early colorectal cancer diagnosis marker circ4953 and application thereof |
| CN111424017A (en) * | 2020-03-27 | 2020-07-17 | 暨南大学 | Exosome loading shRNA (short hairpin ribonucleic acid) and construction method and application thereof |
| CN111424017B (en) * | 2020-03-27 | 2022-08-09 | 暨南大学 | Exosome loading shRNA (short hairpin ribonucleic acid) and construction method and application thereof |
| CN112662776A (en) * | 2021-01-19 | 2021-04-16 | 广东医科大学 | Application of preparation for detecting circular RNA and/or expression quantity of circular RNA in preparation of colorectal cancer auxiliary diagnostic reagent |
| CN112662776B (en) * | 2021-01-19 | 2022-06-21 | 广东医科大学 | Application of preparation for detecting circular RNA and/or expression quantity of circular RNA in preparation of colorectal cancer auxiliary diagnostic reagent |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109295221B (en) | 2021-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109295221A (en) | Application of the circular rna as colorectal cancer molecular marker | |
| CN109576297A (en) | A kind of recombinant plasmid and its construction method and the application of gene promoter containing WSB1 and reporter gene | |
| CN107190052A (en) | The purposes of LOC101928926 genes | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN112430665B (en) | Molecular biomarker for diagnosing and treating triple negative breast cancer and application thereof | |
| CN107190005B (en) | Applications of the lncRNA as biomarker in adenocarcinoma of lung diagnosis and treatment | |
| CN1721554B (en) | Method of testing anticancer agent-sensitivity of tumor cells | |
| CN107385083A (en) | The diagnosis marker and its therapeutic targets of a kind of clear cell carcinoma of kidney | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN110229900A (en) | Gene hsa_circ_0103520 relevant to breast cancer diagnosis and treatment and its application | |
| CN106916887B (en) | Application of the ERH genes in carcinoma of urinary bladder diagnosis and treatment product is prepared | |
| CN108165631A (en) | A kind of biomarker SYT12 of osteosarcoma and its application | |
| CN109486816A (en) | A kind of polynucleotide and its application for oncotherapy | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN105132547B (en) | The application of STAC2 genes and its encoding proteins in pelvic prolapse is suppressed | |
| CN114015779A (en) | Application of CPB1 gene and/or protein in clinical medication after pancreatic cancer total resection | |
| CN106868197B (en) | Application of the gene marker in Huppert's disease | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN106702002A (en) | Biomarker for lung adenocarcinoma diagnosis and treatment | |
| CN108114283A (en) | Applications of the biomarker MUC21 in osteosarcoma diagnose and treat | |
| CN107217054B (en) | Application of G6PD gene and expression product thereof in treating colorectal cancer | |
| CN106086027A (en) | Gastric cancer dependency miRNA marker and application thereof | |
| CN105420366B (en) | The application of ADAMTS-2 genes and its expression product in diagnosis and treatment gastric cancer | |
| CN108277225A (en) | A kind of application of circular rna in diagnosing and/or treating ameloblastoma | |
| CN107354210A (en) | The application of CMYA5 genes and its expression product in larynx squamous carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |