KR101678961B1 - Animal model for epilepsy and method for producing the same - Google Patents

Abstract

The present invention relates to a composition for inducing brain metastasis and its use. More specifically, the present invention relates to a composition for inducing brain metastasis comprising mTOR (mamalian target of rapamycin) gene or mTOR protein in which a mutation of a nucleotide sequence has occurred, a recombinant vector containing the gene, An introduced cell or embryo, an animal which is transformed with said vector, and a method for producing said animal. And to a screening method of a therapeutic agent for brain growth using the same.

Description

Animal models for epilepsy and methods for producing the same

The present invention relates to a composition for inducing brain metastasis and its use. More specifically, the present invention relates to a composition for inducing brain metastasis comprising mTOR (mamalian target of rapamycin) gene or mTOR protein in which a mutation of a nucleotide sequence has occurred, a recombinant vector containing the gene, An introduced cell or embryo, an animal which is transformed with said vector, and a method for producing said animal. And to a screening method of a therapeutic agent for brain growth using the same.

Epilepsy A group of chronic neurological diseases in which some neurons develop epileptic seizures repeatedly due to seizure-induced over-electricity in a short period of time, and are accompanied by neurobiological, psychological, cognitive, and social changes Is a serious neurological disorder.

It is the third most common neurological disorder following Alzheimer's and Stroke, with about 0.5% to 2% of the world's population having epilepsy. In addition, there are 45 new cases per 100,000 people worldwide, and about 30 ~ 400,000 cases of epilepsy are estimated to occur in Korea, and about 20,000 cases of new epilepsy occur each year . It is also known that 70% of all epilepsy starts at the age of pediatric adolescents, especially in infancy. The incidence and prevalence are highest in the first year of life, rapidly declining, and suddenly increase in the U-shape in elderly people over 60 years of age. The prevalence of life-long seizures is 10-15%.

Among epileptic patients, epilepsy which does not respond to the anticonvulsant drugs developed so far is called intractable epilepsy and accounts for about 20% of total epilepsy.

The most common cause of refractory epilepsy is malformations of Cortical Developments (MCD). The cerebral cortical developmental anomaly is a group of diseases characterized by cerebral cortical abnormalities or neuronal cell migration disorders due to neuronal migration, differentiation, and growth abnormalities. It is a group of diseases not only including brain metastasis but also developmental disorders, mental retardation, and cognitive dysfunction Resulting in multiple neurological disorders. Recently, the development of cerebral imaging equipment such as high-resolution magnetic resonance imaging has led to a rapid increase in the diagnosis of cerebral cortical development anomalies in patients with intractable epilepsy.

There are various types of cerebral cortical developmental anomalies depending on the histopathological characteristics. Among them, focal cortical dysplasia (FCD), hemimegalencephaly (HME) and Tuberous sclerosis complex, TSC) does not respond to current anticonvulsant drugs and requires neurosurgical treatment to excise brain lesions to control brain metastasis.

It is known that cerebral cortical developmental anomalies are present in more than 50% of patients with intractable epilepsy. Most sporadic cerebral cortical developmental malformations (sporadic MCD) in children can occur in only one side of identical twins, It is known to occur without special family history and external stimuli, and it is absolutely insufficient to understand the cause of illness and mechanism of disease.

GABARAP, NELF, and CD9 (Arai et al., 2002) were found in a number of genetic variants of GABA (Avoli et al., Prog. Neurobiol. 77: 166-200, 2005) Brain Res. 118: 147-151, 2003), and there is a registered prior patent (Korean Patent No. 10-1144326) for a PLCβ4 gene-deficient mouse as an animal model of an amphotropic epilepsy, The use of mTOR protein or mTOR protein for mutation of the resulting mTOR gene or amino acid sequence and the animal models of brain tumors using the same have not been disclosed at all.

Under these circumstances, the inventors of the present invention found that mTOR gene or mTOR protein mutated in the same base sequence mutation as found in MCD patients accompanied by intractable brain metastasis, , The increase of S6 protein phosphorylated by excessive mTOR activation in the cerebral cortex of the mouse was observed in mouse cerebral cortical neurons, I was able to confirm the onset.

In other words, the localization of mTOR gene or the mTOR protein in which the mutation of the amino acid sequence occurred in the nucleotide sequence mutation causes localization of brain, resulting in the production of a transgenic animal which can be used as an animal model for brain tumors The present invention has been completed.

It is an object of the present invention to provide a composition for inducing brain metastasis comprising mTOR gene in which mutation of base sequence occurs or mTOR protein in which amino acid sequence has been mutated.

More specifically, in the amino acid sequence of SEQ ID NO: 2, the cysteine (C) at position 1483 is substituted with tyrosine (Y), the glutamic acid (E) at position 2419 is substituted with lysine (K) And a protein consisting of an amino acid sequence comprising at least one mutation selected from the group consisting of substitution of proline (P) for leucine (L).

In the nucleotide sequence of SEQ ID NO: 1, guanine (G) at position 4448 is substituted with adenine (A), guanine (G) at position 7255 is substituted by adenine (A) T) is replaced with a cytosine (C). The present invention also provides a composition for inducing brain metastasis comprising a gene comprising a nucleotide sequence comprising at least one mutation selected from the group consisting of:

It is still another object of the present invention to provide a recombinant vector comprising the mTOR gene in which the mutation of the above base sequence occurs.

It is still another object of the present invention to provide a cell into which the recombinant vector has been introduced.

Further, it is intended to provide an embryo into which the recombinant vector has been introduced.

It is another object of the present invention to provide an animal in which brain transformation is induced by transformation with the recombinant vector.

It is another object of the present invention to provide a method for inducing brain metastasis by introducing the recombinant vector into cells.

It is another object of the present invention to provide a method for producing an animal in which brain injury is induced, which comprises introducing the recombinant vector into an animal embryo and then generating the recombinant vector.

It is another object of the present invention to provide a method for screening a therapeutic agent for brain inflammation, which comprises the step of administering a candidate agent for treatment of cerebral infarction to an animal in which the cerebral trauma has been induced, followed by confirming whether cerebral tremor is relieved.

(C) at position 1483 is replaced with tyrosine (Y), and glutamic acid (E) at position 2419 is substituted with lysine (C) at position 2419. In a preferred embodiment of the present invention, (K), and substitution of leucine (L) at position 2427 with proline (P). The present invention also relates to a composition for inducing brain metastasis comprising a protein consisting of an amino acid sequence comprising at least one mutation selected from the group consisting of .

Preferably, the protein in which the cysteine (C) at position 1483 is substituted with tyrosine (Y) is encoded by a gene in which the guanine (G) at position 4448 in the nucleotide sequence of SEQ ID NO: 1 is substituted with adenine (G) at position 7255 in the nucleotide sequence of SEQ ID NO: 1 is encoded by a gene substituted with adenine (A) in the nucleotide sequence of SEQ ID NO: 1, and the protein in which the glutamic acid (E) at position 2419 is substituted with lysine And the protein in which the Lucine (L) at position 2427 is substituted with proline (P) is that the thymine (T) at position 7280 in the nucleotide sequence of SEQ ID NO: 1 is coded by a gene substituted with cytosine .

(G) at position 4448 is substituted with adenine (A), and guanine (G) at position 7255 is substituted with adenine (A) in the nucleotide sequence of SEQ ID NO: 1. In another embodiment, , And a gene consisting of a nucleotide sequence comprising at least one mutation selected from the group consisting of substitution of cytosine (C) for thymine (T) at position 7280, and the like.

(G) at position 4448 is substituted with adenine (A), and guanine (G) at position 7255 is substituted with adenine (A) in the nucleotide sequence of SEQ ID NO: 1. In another embodiment, , And a nucleotide sequence comprising at least one mutation selected from the group consisting of substitution of cytosine (C) for thymine (T) at position 7280.

In another embodiment, the present invention relates to a cell into which the recombinant vector is introduced.

In another embodiment, the present invention relates to an embryo into which the recombinant vector is introduced.

In another aspect, the present invention relates to an animal in which brain transformation is induced by transformation with the recombinant vector.

Preferably, the animal may be a mammal or a rodent, but not a human.

In another embodiment, the present invention relates to a method for introducing the recombinant vector into a cell to induce brain metastasis.

In another embodiment, the present invention relates to a method for producing an animal in which brain injury is induced by introducing the recombinant vector into an embryo of an animal other than a human.

Preferably, the recombinant vector may be introduced into the brain of the embryo during the period during which the cortical layer is formed in the embryo.

In another aspect, the present invention relates to a method for screening a therapeutic agent for brain inflammation, which comprises the step of administering a candidate agent for treatment of cerebral infarction to an animal in which the cerebral trauma has been induced, followed by confirming whether cerebral angiopathy is relieved.

In a preferred embodiment, throughout the present invention, the brain metastasis may be a refractory episode or a refractory episode of cortical developmental abnormalities.

Hereinafter, the present invention will be described in more detail.

The present invention provides a composition for inducing brain metastasis comprising the above gene or protein based on the fact that mTOR gene having genetic mutation in the base sequence or mTOR protein having mutation in amino acid sequence can cause brain metastasis, A recombinant vector, a cell and an embryo into which the vector is introduced, and an animal in which brain injury is induced using the vector, and a method for inducing brain metastasis.

In a specific embodiment of the present invention, mTOR mutant constructs with genetic mutations discovered in the brains of cerebral cortical developmental malformations (MCD) patients with brain metastasis are prepared and transfected into cells, . In vitro mTOR kinase assay was performed to measure the phosphorylation and mTOR phosphorylase activity of S6 protein, which indicates the change of mTOR protein activity.

As a result, it was confirmed that the phosphorylated S6 protein was increased in the transduced cells (Fig. 1) and the mTOR phosphorylated protein was highly activated (Fig. 2). This confirmed the hyperactivation of the mTOR protein and increased phosphorylated S6 protein.

In another embodiment, immunohistochemistry was performed in a brain pathology sample of a patient who underwent surgery for brain metastasis (mTOR genetic mutation confirmation).

As a result, it was confirmed that the increase of the phosphorylated S6 protein and the size of the neural cell were greatly increased in all the samples having the mTOR mutation (Figs. 3A to 3C). This demonstrated that the mTOR mutation increased phosphorylated S6 protein and abnormal development of neural cell size development.

In another embodiment of the present invention, wild type mTOR constructs were transfected with the flag-tagged pcDNA3.1 (SEQ ID NO: 2) in order to determine whether the mutated mTOR gene or the mutated mTOR protein in the amino acid sequence could induce brain metastasis The mTOR mutant vectors mTOR C1483Y, mTOR E2419K and mTOR L2427P were prepared by using the pcDNA3.1 flag-tagged wild-type mTOR construct. Subsequently, the pCIG2-vector (a vector utilizing GFP protein as a reporter) mTOR mutant vector. Which was electroporated into the lateral ventricle of an embryo mouse of embryonic day 14 (E14). Four days after the development, the brain was harvested on the 18th day of embryo (E18) and the degree of phosphorylation of S6 protein due to neuronal migration and mTOR activation was measured.

As a result, in the cerebral cortex of mice injected with mTOR C1483Y, mTOR E2419K and mTOR L2427P mutants, a serious obstacle was observed in the migration of nerve cells compared to the control group in which nerve cells were well transferred to the brain surface on the 18th day of embryonic day (E18) 4a to 4b). In addition, it was confirmed that the phosphorylated S6 protein was greatly increased due to excessive mTOR activation by the mTOR genetic mutation in embryonic day 18 (E18) mice electroporated on embryonic day 14 (E14) (Fig. 5).

In one embodiment of the present invention, a wild-type mTOR and a plasmid into which the mTOR gene having the base sequence mutation of the present invention has been introduced, an embryo obtained by electroporation in an embryonic day 14 (E14), and then a video-electroencephalography -EEG) were measured.

As a result, it was confirmed that a typical Tonic-Clonic Seizure with the same pattern as that of the actual patient appeared in the mouse injected with the plasmid in which the mTOR mutant gene having the nucleotide sequence variation of the present invention was introduced (Example 6, Figs. 8A, 8B, 8C ).

In another embodiment of the present invention, the sizes of the neurons and the normal neurons electroporated with the plasmid in which the mTOR mutant gene having the nucleotide sequence variation of the present invention is inserted are compared.

As a result, it was confirmed that the size of the neurons electroporated with the plasmid in which the mTOR mutant gene having the nucleotide sequence variation of the present invention was inserted was significantly increased compared to the adjacent neurons (Example 7, Fig. 9)

Therefore, the present invention proves that the mTOR gene in which a genetic mutation has occurred or mTOR protein mutation in the amino acid sequence can be induced.

As used herein, the term "induction " means inducing a change from a normal state to a pathological state. For the purpose of the present invention, induction is a transition from a state in which no epilepsy occurs to a state in which epilepsy occurs. Specifically, the cysteine (C) at position 1483 in SEQ ID NO: 2 is substituted with tyrosine (Y), the glutamic acid (E) at position 2419 is substituted with lysine (K) L) is replaced with proline (P), may be injected to induce brain metastasis. In the nucleotide sequence of SEQ ID NO: 1, guanine (G) at position 4448 is substituted with adenine (A), guanine (G) at position 7255 is substituted by adenine (A) ) Is replaced with a cytosine (C), to thereby induce brain metastasis. However, the present invention is not limited to this, and it is possible to introduce a composition comprising a gene consisting of a nucleotide sequence comprising at least one mutation selected from the group consisting of The gene of SEQ ID NO: 1 or the protein of SEQ ID NO: 2 in which the amino acid sequence is mutated may be injected to induce brain metastasis.

As one example of the present invention, a composition containing mTOR gene mutated in a base sequence is injected into a local region of the brain to induce brain metastasis. This is because mTOR gene having mutation in the base sequence is injected and mTOR The protein is expressed and the brain is triggered. Specifically, the mTOR genetic mutation causes excessive mTOR activation resulting in impaired mobility of neuronal cells and a marked increase in phosphorylated S6 protein, resulting in the development of brain metastasis. Specifically, the mutation of the nucleotide sequence of the gene of SEQ ID NO: 1 may result in the expression of the mutated protein of amino acid sequence of SEQ ID NO: 2. Specifically, at least one mutation selected from the group consisting of substitution of G at position 4448 of the nucleotide sequence of SEQ ID NO: 1 with A, substitution of G at position 7255 with A, and substitution of T at position 7280 with C The nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2 is composed of the group consisting of C at position 1483 of SEQ ID NO: 2 substituted by Y, E at position 2419 substituted by K, and L at position 2427 substituted by P Or may be expressed as a protein consisting of an amino acid sequence comprising at least one mutation selected.

The term "brain metastasis" in the present invention means a chronic disease in which a part of nerve cells generates excessive electricity in a short period of time and repeated seizures occur. In the present invention, the brain metastasis includes intractable brain metastasis. In addition, the brain metastasis may be brain metastasis induced by Malformations of Cortical Developments (MCD), more preferably, refractory brain metastasis induced by cerebral cortical developmental anomalies. In addition, the cerebral cortical developmental anomaly may be focal cortical dysplasia (FCD), hemimegalencephaly (HME), or tuberous sclerosis complex (TSC). Also, in the present invention, brain metastasis may be genetic mutation of mTOR gene or brain metastasis accompanied by amino acid mutation of mTOR protein.

The mTOR (mammalian target of rapamycin) protein is known as a mammalian target of rapamycin or an FK506 binding protein 12-rapamycin associated protein 1 (FRAP1) Lt; / RTI > The mTOR protein is a serine / threonine protein kinase functionally regulating cell growth, cell proliferation, cell death, cell survival, protein synthesis and transcription, and phosphatidylinositol 3-phosphorylation-related kinase protein family (phosphatidylinositol 3-kinase-related kinase protein family. In addition, mTOR is known to be an important gene for cancer formation, but there is no known information regarding genetic variation in patients with epilepsy. The mTOR gene sequence is shown in SEQ ID NO: 1, and the mTOR protein sequence is shown in SEQ ID NO: 2.

In the present invention, the term " mTOR gene with mutation of base sequence "or" mTOR gene with genetic mutation "means that a mutation occurs in a part of the base sequence of the gene of SEQ ID NO: 1 which is mTOR gene. Specifically, the term " mTOR " means a gene having a nucleotide sequence different from that of the mTOR wild type. Preferably, at least one mutation selected from the group consisting of G at position 4448 of the nucleotide sequence of SEQ ID NO: 1 is substituted with A, G at position 7255 is substituted with A, and T at position 7280 is substituted with C And the like.

The term "mTOR protein in which amino acid mutation has occurred" in the present invention means that a mutation occurs in a part of the amino acid sequence of the protein of SEQ ID NO: 2 which is mTOR protein. And specifically refers to a protein having an amino acid sequence of mTOR wild type and at least one amino acid residue having a different sequence. refers to a protein having a sequence that differs by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, with the normal amino acid sequence of mTOR and one or more amino acid residues. Amino acid exchanges in proteins and peptides that do not globally alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). In a specific example of the present invention, C in position 1483 of the amino acid sequence of SEQ ID NO: 2 is substituted with Y, E in position 2419 is substituted with K, and L in position 2427 is substituted with P Or a protein consisting of an amino acid sequence comprising at least one mutation.

In addition, the mTOR protein in which the amino acid mutation has occurred may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc. have.

The mTOR protein or the mutated mTOR protein in the amino acid sequence can be obtained by extraction and purification from nature in a manner well known in the art. The mTOR protein, in which the amino acid sequences are mutated, can be chemically synthesized (Merrifleld, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or by genetic recombination techniques.

When they are chemically synthesized, they can be obtained by using a polypeptide synthesis method well known in the art. When the recombinant technology is used, a nucleic acid encoding a mutated mTOR protein in the amino acid sequence is inserted into an appropriate expression vector, the vector is transformed into a host cell, and the host cell is cultured so that the mTOR protein having the mutated amino acid sequence is expressed And then recovering the mTOR protein having the amino acid sequence mutated from the host cell. The protein may be expressed in a selected host cell and then subjected to conventional biochemical separation techniques such as treatment with a protein precipitant (salting-out method), centrifugation, ultrasonic disruption, ultrafiltration, dialysis, (Gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, and the like. In order to separate proteins having high purity, they are used in combination.

The nucleotide sequence coding for the mTOR protein that has undergone mutation in the amino acid sequence in the composition of the present invention is a nucleotide sequence coding for a mutant mTOR protein in a wild type or amino acid sequence and in which one or more bases are substituted, deleted, inserted, And can be isolated from nature or can be prepared using chemical synthesis methods.

The nucleic acid having the nucleotide sequence may be short or double-stranded, and may be a DNA molecule (genome, cDNA) or an RNA molecule.

When a nucleotide sequence encoding a mutated mTOR protein in an amino acid sequence is chemically synthesized, a synthetic method well known in the art, for example, Engels and Uhlmann, Angew Chem Int Ed. Eng. 37: 73-127 , 1988) can be used, including triesters, phosphates, phosphoramidites and H-phosphate methods, PCR and other auto primer methods, oligonucleotide synthesis on solid supports, and the like.

More preferably, the base sequence encoding the mutated mTOR protein in the amino acid sequence is a base sequence encoding a mutated protein in the amino acid sequence of SEQ ID NO: 2. A gene having a mutation in the nucleotide sequence of SEQ ID NO: 1 may be exemplified as a nucleotide sequence encoding a mutated protein in the amino acid sequence of SEQ ID NO: 2.

In a more preferred embodiment, a nucleic acid having a nucleotide sequence encoding a mutated mTOR protein in an amino acid sequence is inserted and expressed in a recombinant vector.

In the present invention, "vector" means a means for introducing a base sequence encoding a target protein into a host cell. The vector of the present invention includes a plasmid vector, a cosmid vector, a viral vector and the like. Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control elements such as promoter, operator, initiation codon, termination codon, polyadenylation signal, enhancer, and can be prepared variously according to the purpose. The initiation codon and termination codon are generally considered to be part of the base sequence coding for the desired protein and must be present in the subject when the gene construct is administered and in the coding sequence and in frame. The promoter of the vector may be constitutive or inducible. The expression vector also includes a selectable marker for selecting a host cell containing the vector and, if the expression vector is a replicable vector, a replication origin. The vector may be self-replicating or integrated into the host genomic DNA.

Preferably, the vector is inserted into the vector and the transferred gene is fused irreversibly into the genome of the host cell, so that the gene expression in the cell can be stably maintained for a long period of time. In the nucleotide sequence of SEQ ID NO: 1, guanine (G) at position 4448 is substituted with adenine (A), guanine (G) at position 7255 is substituted by adenine (A) And a gene comprising a nucleotide sequence comprising at least one mutation selected from the group consisting of substitution of cytosine (C) for thymine (T) at the position.

In one embodiment, the present invention relates to cells and embryos into which the recombinant vector has been introduced. Preferably, the cell may be a brain cell, and the embryo may be an embryo at the stage of development or development of the brain.

In another embodiment, the present invention relates to a method for introducing the recombinant vector into a cell to induce brain metastasis. The method of introducing the recombinant vector is not particularly limited. For example, the vector may be inserted into a cell through a method such as transformation, transfection or transduction. The vector inserted into the cell is able to produce mTOR protein with mutated amino acid sequence due to constant gene expression in the cell.

The present invention also relates to a transgenic animal with said recombinant vector. In the present invention, the term "transgenic animal" means an animal in which transformation of a trait is induced so that the activity of mTOR protein in a cell is increased as compared with that of normal cells, and a vector expressing mTOR protein having mutated amino acid sequence Transfection can be induced by intracellular entry. The transgenic animal in which the brain metastasis has occurred can be effectively used as an animal model for brain tumors.

The term " animal model "or" disease model "in the present invention refers to a disease model having a specific disease similar to a human disease so as to identify a pathogen, Means an animal. Animal for use as an animal model can predict the same effects as in humans, can easily be made, and is reproducible. It should also proceed in a manner similar to or similar to the etiology of human disease. Therefore, animals that are similar to mammalian vertebrates such as humans, similar to organs such as organs, immune system, body temperature, etc., and suffer from diseases such as hypertension, cancer, immunodeficiency and the like are suitable as animal models. Such an animal is preferably a mammal such as a horse, a sheep, a pig, a goat, a camel, a nutrition, a dog, a rabbit, a mouse, a rat, a guinea pig, a hamster and the like, more preferably a rodent such as a mouse, a rat, a guinea pig, Particularly, mice are small animals, and they are able to produce animals that have superior fertility, are easy to manage specifications, are resistant to diseases, genetically uniform, have developed various kinds of animals and have the same or similar symptoms as human diseases And is most often used to study human diseases.

The animal model of the present invention is a model produced by genetically manipulating an mTOR protein having mutated amino acid sequence to be expressed. The inventors of the present invention found that mTOR protein having mutated amino acid sequence has an ability to induce brain metastasis, and when the mTOR protein is expressed in cells, the expression of mTOR single gene whose base sequence is mutated is effectively generated I could.

Accordingly, in another aspect of the present invention, there is provided a method for producing an animal in which brain injury is induced, comprising introducing the recombinant vector of the present invention into an animal embryo and then generating the recombinant vector. The method of introducing the vector into the embryo is not particularly limited. Specifically, in the present invention, the vector of the present invention was introduced into an embryo using electroporation. Preferably, the time of introducing the vector into the embryo may be a period during which the cerebral cortical layer is formed in the embryo. When an animal model of brain metastasis is produced by the method of the present invention, the vector of the present invention can be introduced into an embryo at embryonic day 14 (E14). In addition, the site for introducing the vector of the present invention into the embryo may be the brain part, specifically, the lateral ventricle of the brain.

Another method of producing an animal model of brain trauma is to produce an animal model of brain trauma by injecting cells transfected with the vector of the present invention into an embryo or animal.

The animal model of EEG of the present invention can be effectively used for research on gene function, molecular mechanism of EEG, and search for new anticonvulsant drug.

Accordingly, in another aspect, the present invention relates to a method for screening for an agent for treating brain inflammation, comprising the step of administering a candidate agent for treating cerebral metastasis to an animal in which brain tumors are induced, followed by confirming whether cerebral angiopathy is relieved.

Specifically, the animal in which the brain metastasis is induced can be used for screening the agent for treating brain metastasis by confirming whether or not the brain metastasis symptom relief is present in the presence or absence of the candidate agent for treating the brain metastasis. Substances that indirectly or directly alleviate symptoms of epilepsy can be selected as therapeutic agents for brain tumors. In other words, after measuring the symptoms of epilepsy in the absence of candidates for treating epilepsy, comparing epilepsy symptoms in the presence of candidates for treatment of epilepsy, and comparing epileptic symptoms with epileptic symptoms, In the absence of candidate substances for treatment of hyperglycemia, a substance that alleviates symptoms can be predicted as an agent for treating epilepsy.

The present invention provides a technique for using the mTOR gene or mTOR protein in which the mutation of the nucleotide sequence has occurred in the mTOR gene or the mutated amino acid sequence for the purpose of inducing brain metastasis and using it can effectively produce an animal model of brain tumors, It is possible to study gene function using an animal model of epilepsy, molecular mechanisms of epilepsy and search for new anticonvulsant drugs.

Quot; C1483Y "is a nucleotide sequence in which the cysteine (C) at position 1483 in the amino acid sequence of SEQ ID NO: 2 is replaced with a tyrosine (Y) in the wild-type HEK293T cell, Quot; E2419K "means a protein in which glutamic acid (E) at position 2419 in the amino acid sequence of SEQ ID NO: 2 is substituted with lysine (K), and HEK293T cell in which a flag- tagged mTOR mutant expressing a protein substituted with lysine LEK273P "is an HEK293T cell transfected with a flag-tagged mTOR mutant that expresses a flag-tagged mTOR mutant, and flag-tagged mTOR (L) expressing a protein in which the leucine (L) at position 2427 in the amino acid sequence of SEQ ID NO: 2 is substituted with proline And HEK293T cells transfected with the mutant.
FIG. 1 shows the result of Western blot analysis of S6 phosphorylation of HEK293T cells expressing mTOR mutant (mutant). "Empty" indicates HEK293T cell transfected with empty flag-tagged vector, "P-S6" indicates phosphorylation of S6 protein, "S6" indicates S6 protein, "Flag" flag protein. "20% serum" was used as a positive control indicating the activity of mTOR after exposure to 20% serum for 1 hour.
Figure 2 shows the in vitro kinase assay results of the wild type mTOR protein and the mutated mTOR protein. * p <0.05 and *** p <0.001 [relative to wild type, n = 6, one-way ANOVA with Bonferroni posttest]. Error bars, sem
Figure 3a shows pathological samples of all patients with malformations of Cortical Developments (MCD) with mTOR mutations identified. "Non-MCD" is a sample with normal brain that is not a cerebral cortical development malformation. "P-S6" is phosphorylated on S6 protein, "NeuN" is neuronal marker, "Merge" is P-S6 And the image of NeuN.
FIG. 3B shows the proportion of cells that have undergone phosphorylation of S6 protein in the 4 to 5 part of the cortical region, and FIG. 3C shows the neuronal marker (NeuN) positive cell size. The number of aggregated cells is 994 to 1638 for each part. * p <0.05, *** P <0.001, *** P <0.0001 [relative to non-MCD samples, one-way ANOVA with Bonferroni posttest]. Error bars, sem Scale bars, 50um.
4A to 5, "C1483Y" indicates that when a plasmid expressing a protein in which the cysteine (C) at position 1483 in the amino acid sequence of SEQ ID NO: 2 is substituted with tyrosine (Y) is inserted into the brain of a mouse embryo, E2419K "indicates that when a plasmid expressing a protein in which glutamic acid (E) at position 2419 in the amino acid sequence of SEQ ID NO: 2 is substituted with lysine (K) is inserted into the brain of a mouse embryo," L2427P &quot; (L) at position 2427 in the amino acid sequence is replaced with proline (P) is inserted into the brain of a mouse embryo.
4A shows the neuronal cell migration disorder caused by the mTOR mutant inserted in the mouse and thus the cerebral cortical development malformation. "CP" is the cortical plate, "IZ" is the intermediate zone, "SVZ" is the subventricular zone, "VZ" is the ventricular zone, "Wild type" When a wild-type mTOR plasmid is inserted, the "relative intensity value" represents the relative intensity of GFP (green fluorescent protein) in each case.
Figure 4b shows the relative fluorescence intensity showing the distribution of electroporated cells in the cortex.
Figure 5 shows the expression of GFP and the expression of phosphorylated S6 protein when the mTOR variant according to the invention is injected into the mouse. "pS6" is a phosphorylated S6 protein, "Merge" is a combination of a GFP image and a pS6 image, and "Mander's overlap coefficient" is a result of Mentor's coexistence analysis.
Fig. 6 shows a cleavage map showing the structure of pCIG2.
FIG. 7 is a graph showing the relationship between the mTOR of the wild type mTOR and the plasmid in which the mTOR gene having the nucleotide sequence variation of the present invention was introduced, embryo obtained by electroporation in E14 (embryo day 14) And video-electroencephalography (video-EEG). " in utero electroporation (E14) "is a schematic diagram in which wild-type mTOR and an mTOR gene in which the base sequence mutation of the present invention is introduced are injected into the embryo at day 14, and" GFP screening at birth (P0) "Video-EEG monitoring (>3weeks)" is a model for classifying only mice expressing fluorescence with flashlight (Electron Microscopy Science, USA) after embryo birth. Seizure is performed only when the mouse is wet (> 3weeks) When the electrode is confirmed, it shows a schematic diagram of measuring the electroencephalogram (video-EEG) by placing the electrode.
8 shows the results of electroencephalogram measurement according to the sixth embodiment of the present invention. FIG. 8A shows a mouse into which a plasmid (p.Cys1483Tyr) into which an mTOR mutant for expressing a protein substituted with tyrosine (Y) at cysteine (C) at position 1483 in the amino acid sequence of SEQ ID NO: (P.Glu2419Lys) introduced with mTOR mutant expressing a protein in which the glutamic acid (E) at position 2419 in the amino acid sequence of SEQ ID NO: 2 is substituted with lysine (K), FIG. 8C shows a mouse in which the plasmid (P.Leu2427Pro) introduced with mTOR variant which expresses a protein in which the leucine (L) at position 2427 is substituted with proline (P) in the amino acid sequence of SEQ ID NO:
FIG. 9 shows the results of comparing sizes of neurons and normal neurons electroporated with a plasmid into which the mTOR mutant gene having the nucleotide sequence variation of the present invention was inserted.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Mutagenesis and mTOR Mutant  Construct ( mTOR mutant construct )

From the Kun-Liang Guan PhD of the University of California, San Diego, University of California, USA, the wild-type mTOR construct was tagged with the pcDNA3.1 flagged-tagged wild-type mTOR construct . The constructs were used to prepare mTOR mutant vectors (C1483Y, E2419K and L2427P) with the QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA).

The primers used for mutagenesis are shown in Table 1.

name SEQ ID NO: direction The base sequence (5 '- &gt; 3') C1483Y SEQ ID NO: 3 Sense GCCGCATGCGCTACCTCGAGGCC SEQ ID NO: 4 Antisense GGCCTCGAGGTAGCGCATGCGGC E2419K SEQ ID NO: 5 Sense GTGTCATGGCCGTGCTGAAAGCCTTTGTCTATGAC SEQ ID NO: 6 Antisense GTCATAGACAAAGGCTTTCAGCACGGCCATGACAC L2427P SEQ ID NO: 7 Sense GTCTATGACCCCTTGCCGAACTGGAGGCTGATG SEQ ID NO: 8 Antisense CATCAGCCTCCAGTTCGGCAAGGGGTCATAGAC

In order to construct the pCIG-mTOR mutants-IRES-EGFP vector, primer sets of SEQ ID NOS: 9 and 10 were inserted into the EcoRI and XmaI sites of pCIG2 (chicken beta actin promoter-MCS-IRES-EGFP) PCIG2-C1 having enzyme sites MfeI and MluI was prepared. PCR fragments corresponding to the wild type or genetically mutated mTOR gene were subcloned into the Mfe I and Mlu I sites of pCIG2-C1 using the primer pairs of SEQ ID NOS: 11 and 12 to obtain pCIG-mTOR wild type, C1483Y, E2419K and L2427P plasmids Respectively.

name SEQ ID NO: direction The base sequence (5 '- &gt; 3') Annealed primer SEQ ID NO: 9 Forward AATTCCAATTGCCCGGGCTTAAGATCGATACGCGTA SEQ ID NO: 10 Reverse CCGGTACGCGTATCGATCTTAAGCCCGGGCAATTGG hmTOR-MfeI-flag SEQ ID NO: 11 Forward GATCACAATTGTGGCCACCATGGACTACAAGGACGACGATGACAAGATGC hmTOR-Mlu I SEQ ID NO: 12 Reverse tgatcaACGCGTttaccagaaagggcaccagccaatatagc

Example  2. Cell culture, transfection ( transfection ) And Western Blat

HEK293T cells (thermoscientific) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) medium containing 10% FBS at 37 ° C and 5% CO ₂ . Cells were transfected with empty flag-tagged vectors, flag-tagged mTOR wild type and flag-tagged mTOR mutants using jetPRIME transfection reagent (Polyplus, France). Cells were serum-starved with 0.1% FBS in DMEM medium for 24 hours after transfection and cultured in PBS containing 1 mM MgCl ₂ and CaCl ₂ at 37 ° C and 5% CO ₂ for 1 hour. Cells were lysed in PBS containing 1% Triton X-100, Halt protease and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA). Proteins were resolved by SDS-PAGE and transferred to a PVDF membrane (Milipore, USA). The membranes were blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). After that, it was washed with TBST repeatedly 4 times. The membranes contain anti-phospho-S6-ribosomal protein (5364, Cell Signaling Technology, USA) diluted 1/1000, anti-S6 ribosomal protein (2217, Cell Signaling Technology, USA) , USA) were incubated overnight at 4 ° C in TBST with the primary antibody. After incubation, the membrane was washed 4 times with TBST. HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) diluted 1/5000 were then incubated at room temperature for 2 hours. TBST was washed and immunodetection was performed using ECL reaction reagent.

The mTOR mutant transformed is a flag-tagged mTOR mutant in which the cysteine (C) at position 1483 in the amino acid sequence of SEQ ID NO: 2 is substituted with tyrosine (Y), the amino acid sequence of SEQ ID NO: Tagged mTOR mutant expressing a protein in which the glutamic acid (E) at the position is substituted with lysine (K) and a protein in which the leucine (L) at position 2427 in the amino acid sequence of SEQ ID NO: 2 is substituted with proline (P) Gt; mTOR &lt; / RTI &gt;

As a result, it was confirmed that when the mTOR mutant was transfected, mTOR was hyperactivation. This was due to the mTOR mutant and was confirmed by phosphorylation of the S6 protein, a major example of mTOR activation (FIG. 1).

Example  3. In vitro mTOR  Measurement of phosphorylase activity In vitro mTOR kinase assay )

The phosphorylation activity of mTOR was measured according to the manufacturer's protocol using the K-LISA mTOR activation kit (CBA055, Calbiochem, USA). Transfected cells (HEK293T cells) were lyse in TBS containing 1% Tween 20, Halt proteolytic enzyme and phosphatase inhibitor cocktail. 1 mg of total lysate was pre-cleared by adding 15 ul of protein G-beads (10004D, Life technologies, USA) and incubated at 4 ° C for 15 minutes. The anti-flag antibody was added to the pre-cleared lysate and incubated overnight at 4 ° C. Then, 50 ul of 20% slurry protein G-beads was added and cultured at 4 ° C for 90 minutes. The supernatant was carefully removed. The pelleted beads were washed four times with 500 ul of lysis buffer and washed once with 1X phosphorase buffer (kinase buffer) provided in the K-LISA mTOR activity kit (K-LISA mTOR activity kit) And washed. The pellet beads were resuspended in 50ul of 2X phosphorylase buffer and 50ul of mTOR substrate (p70S6K-GST fusion protein) and then incubated at 30 ° C for 30 minutes. The reaction mixture was incubated in a glutathione-coated 96-well plate (Glutathione-coated 96-well plate) and incubated at 30 ° C for 30 minutes. The phosphorylated substrate was detected using anti-p70S6K-pT389 antibody, HRP antibody-conjugate and TMB substrate. Relative activity was measured by reading the absorbance at 450 nm.

The transduced cell is a flag-tagged mTOR mutant in which the cysteine (C) at position 1483 in the amino acid sequence of SEQ ID NO: 2 is substituted with tyrosine (Y), the amino acid sequence of SEQ ID NO: Tagged mTOR mutant expressing a protein in which the glutamic acid (E) at the position is substituted with lysine (K) and a protein in which the leucine (L) at position 2427 in the amino acid sequence of SEQ ID NO: 2 is substituted with proline (P) Lt; RTI ID = 0.0 &gt; mTOR &lt; / RTI &gt;

As a result, it was confirmed that the mTOR phosphorylated protein was highly activated by the three mTOR mutants in the cells transfected with the mTOR mutant (Fig. 2).

Example  4. Immunohistochemistry in pathological samples immunohistochemistry )

Patients with FCD, TSC, and HME who underwent cataract surgery were identified at Severance Children's Hospital since 2012. Registered patients met the study entry criteria of FCD, TSC, and HME and were evaluated for preoperative evaluation (video electroencephalography (EEG) monitoring), high-resolution MRI (high-resolution MRI), fluorodexoyglucose (FDG) -PET, subtraction ictal single photon emission coumputated tomography (SPECT) co-registered to MRI (SISCOM)) to determine the anatomic lesions. Clinical and molecular biochemical data of MCD patients with mTOR mutations are shown in Table 3 below.

Patient / Sex Age of operation pathology MRI  result Sequence variation Protein mutation HME1
/south 5 months Cortical dyslamination / Dysmorphic neurons Diffuse cortical dysplasia on Rt / Thinked cortex on Rt / Deformed corpus callosum on Rt / 4448G> A 1483C> Y TSC2 @
/female 3 years 8 months Cortical abnormal laminae / nerve cell dysplasia / balloon cells / abnormal glial cells Multifocal subcortical tubers / multiple subependymal nodules (multiple subependymal nodules) 4448G> A 1483C> Y FCD3
/south 7 years 8 months Cortical abnormal lamination / nerve cell dysplasia No abnormal signal intensity 7255G> A 2419E> K FCD4
/female 5 years 2 months Cortical abnormal lamination / nerve cell dysplasia Mild brain atropy / no abnormal signal 7255G> A
7280T> C 2419E> K
2427L> P FCD6
/female 5 years Cortical abnormal lamination / nerve cell dysplasia No abnormal signal 4448G> A
7280T> C 1483C> Y
2427L> P

HME: hemiplegia (hemimegalencephaly)

TSC: Tuberous sclerosis complex (TSC)

FCD: focal cortical dysplasia (FCD)

@: A patient having a germline heterozygous cell (the gene of SEQ ID NO: 1, in which C (cytosine) at position 3355 was substituted with T (thymine) (in the amino acid sequence of SEQ ID NO: 2, A gene in which Q (Glutamine) at position 1119 is substituted with an amino acid encoded by the above-mentioned substituted gene mutation)

Non-MCD brain specimens were collected from the tumor free margin of patients with glioblastoma and confirmed to be pathologically normal without tumors. Surgical tissue block was fixed in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde overnight, cryoprotected overnight in 20% buffered sucrose, gelatin-embedded tissue lump (7.5% gelatin in 10% sucrose / PB). The cryostat-cut section (10 μm thick) was collected and placed on a glass slide and blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature ) And stained with the following antibodies: rabbit antibody to phosphorylated S6 ribosomal protein (Ser240 / Ser244) (1: 100 dilution; 5364, Cell signaling Technology) and NeuN (Mouse antibody to NeuN) (1: 100 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1: 200 dilution; A21422, Invitrogen) and rabbit (Alexa Fluor 488-conjugated goat antibody to rabbit) (1: 200 dilution; A11008, Invitrogen). The DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were obtained using a Leica DMI 3000 B inverted microscope. NeuN-positive cell numbers were measured using a 10x objective lens; Within the neuron-rich regina, 4 to 5 fields per subject were obtained, and more than 100 cells per region were recorded. The number of DAPI-positive cells represents the total number of cells. Neuron cell size was measured in NeuN-positive cells using ImageJ software's automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/).

As a result, it was confirmed that the increase of phosphorylated S6 protein and the size of nerve cell were greatly increased in all samples with mTOR mutation. As a result, mTOR overexpression and nerve cell growth dysregulation due to mTOR mutation were confirmed (Figs. 3A to 3C).

Example  5. in utero electroporation  And image analysis

Pregnant mice (E14) (polyarthritis) were anesthetized with isoflurane (0.4 L / min of oxygen and isoflurane vaporizer gauge 3 during surgery). 2 ug / ml of Fast Green (F7252, Sigma, USA) coupled with 2 to 3 ug of the mTOR mutant plasmid in the lateral ventricle of each embryo was exposed to a pulled glass capillary to expose the uterine horn, . The plasmid was electroporated by discharging 50 V with an ECM830 eletroporator (BTX-harvard apparatus), which was an electric pulse five times 100 ms at intervals of 900 ms on the head of the embryo. Embryos were electroporated in embryonic day 14 (E14) and then harvested 4 days after development (E18), fixed in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde overnight and resuspended in 30% buffered sucrose It was frozen overnight and stored at -80 ° C as gelatin-embedded tissue mass (7.5% gelatin in 10% sucrose / PB). Frozen sections (30 um thick) were collected and placed on glass slides. The DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Leica DMI 3000 B inverted microscope or a Zeiss LSM510 confocal microscope. The fluorescence intensity, which shows the distribution of electroporated cells in the cortex, is converted to the gray value and is measured by the ImageJ software (VSS) from the ventricular zone (VZ) to the cortical plate (http://rsbweb.nih.gov/ij/). Mander's co-localization analysis (http://fiji.sc/wiki/index.php/Colocalization_Analysis) was performed using Fiji software.

As a result, when the brain tissue was observed on the 18th day of embryonic day (E18), mRNA expression of the mTOR C1483Y, mTOR E2419K and mTOR L2427P variants in the cerebral cortex was significantly increased A disorder was observed (Fig. 4A). Specifically, GFP-positive cells were abruptly decreased in the cortical plate, and GFP-positive cells were increased in the intermediate zone, subventricular zone, and ventricular zone. This demonstrates that there is a barrier to radial nerve cell movement in the cortex. In addition, it was confirmed that the phosphorylated S6 protein was greatly increased due to excessive mTOR activation by the mTOR genetic mutation in embryonic day 18 (E18) mice electroporated on embryonic day 14 (E14) (Fig. 5).

This experiment confirmed that mTOR mutants in vivo activate mTOR phosphorylated protein excessively, resulting in impaired development of the normal cortex.

Example  6. Video - EEG monitoring Video - Electroencephalography monitoring )

In Example 5, wild-type mTOR and a plasmid into which the mTOR gene having the nucleotide sequence variation of the present invention was introduced, embryos were electroporated on the 14th day of embryonic day (E14), and then embryos were obtained by flash light (Electron Microscopy Science, USA) Only mice were classified (Fig. 7). After the mouse was wet (> 3weeks), only the video monitoring was performed to confirm whether or not seizure occurred. Then, the electrode was placed to measure the electroencephalogram. Electrodes were placed in the epidural layer and 2 (AP + 2.8 mm, ML ± 1.5 mm) at the frontal region and 2 at the temporal region (AP-2.4 mm, ML ± 2.4 mm) were placed in the cerebellum and five electrodes were placed. After a 4-day recovery period, measurements were performed for 2 to 7 days (more than 2 hours per day) per mouse at 6:00 am to 2:00 am. Signals were amplified by an amplifier (GRASS model 9 EEG / Polysomnograph, GRASS technologies, USA) and analyzed using the pCLAMP program (Molecular Devices, USA).

As a result, almost all the mice injected with the plasmid inserted with the mTOR mutant gene of the present invention showed a typical Tonic-Clonic Seizure in the same pattern as the actual patient (Figs. 8a, 8b and 8c) The mouse with the inserted gene did not show Seizure. Table 4 summarizes the experimental results.

Group No . of GFP + pups No . of mice with seizure % Wild type 8 0 0 p. Cys1483Tyr 15 14 93.3 p. Glu2419Lys 13 12 92.3 p. Leu2427Pro 23 21 91.3

Example  7. Nerve cell size analysis of mice born after electroporation

In Example 6, the brain was excised by perfusion of the brain-conduction-monitored mouse with phosphate-buffered (PB) 4% paraformaldehyde using a Masterflex compact peristaltic pump (cole-parmer international, USA). The cells were fixed in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, frozen overnight in 30% buffered sucrose and stored at -80 ° C with gelatin-embedded tissue mass (7.5% gelatin in 10% sucrose / PB). Frozen sections (30 um thick) were collected and placed on glass slides. Blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature and stained with the following antibodies: mouse antibody to NeuN (NeuN) (1: 500 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1: 200 dilution; A21422, Invitrogen), Mounting The DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were acquired using a Nikon C2 confocal microscope or a Zeiss LSM710 confocal microscope. The size of nerve cells was measured using ImageJ software (http://rsbweb.nih.gov/ij/).

As a result, as shown in FIG. 9, the nerve cells electroporated with the plasmid inserted with the mTOR mutant gene of the present invention showed a significant increase in size compared to the adjacent normal neurons, whereas the wild type mTOR gene Were not changed in size. This is in the same pattern as that of dysmorphic neuron in a cerebral cortical developmental anomaly, and it has been proved that an animal capable of producing brain growth can be produced by using the composition for inducing brain growth according to the present invention.

<110> KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGY          Yonsei University, University - Industry Foundation (UIF) <120> Animal model for epilepsy and method for producing same <130> DPP20143239 <150> KR10-2013-0139045 <151> 2013-11-15 <160> 12 <170> Kopatentin 1.71 <210> 1 <211> 7650 <212> DNA <213> Homo sapiens <220> <221> gene &Lt; 222 > (1) .. (7650) <223> wild type mTOR <400> 1 atgcttggaa ccggacctgc cgccgccacc accgctgcca ccacatctag caatgtgagc 60 gtcctgcagc agtttgccag tggcctaaag agccggaatg aggaaaccag ggccaaagcc 120 gccaaggagc tccagcacta tgtcaccatg gaactccgag agatgagtca agaggagtct 180 actcgcttct atgaccaact gaaccatcac atttttgaat tggtttccag ctcagatgcc 240 aatgagagga aaggtggcat cttggccata gctagcctca taggagtgga aggtgggaat 300 gccacccgaa ttggcagatt tgccaactat cttcggaacc tcctcccctc caatgaccca 360 gttgtcatgg aaatggcatc caaggccatt ggccgtcttg ccatggcagg ggacactttt 420 accgctgagt acgtggaatt tgaggtgaag cgagccctgg aatggctggg tgctgaccgc 480 aatgagggcc ggagacatgc agctgtcctg gttctccgtg agctggccat cagcgtccct 540 accttcttct tccagcaagt gcaacccttc tttgacaaca tttttgtggc cgtgtgggac 600 cccaaacagg ccatccgtga gggagctgta gccgcccttc gtgcctgtct gattctcaca 660 acccagcgtg agccgaagga gatgcagaag cctcagtggt acaggcacac atttgaagaa 720 gcagagaagg gatttgatga gaccttggcc aaagagaagg gcatgaatcg ggatgatcgg 780 atccatggag ccttgttgat ccttaacgag ctggtccgaa tcagcagcat ggagggagag 840 cgtctgagag aagaaatgga agaaatcaca cagcagcagc tggtacacga caagtactgc 900 aaagatctca tgggcttcgg aacaaaacct cgtcacatta cccccttcac cagtttccag 960 gctgtacagc cccagcagtc aaatgccttg gtggggctgc tggggtacag ctctcaccaa 1020 ggcctcatgg gatttgggac ctcccccagt ccagctaagt ccaccctggt ggagagccgg 1080 tgttgcagag acttgatgga ggagaaattt gatcaggtgt gccagtgggt gctgaaatgc 1140 aggaatagca agaactcgct gatccaaatg acaatcctta atttgttgcc ccgcttggct 1200 gcattccgac cttctgcctt cacagatacc cagtatctcc aagataccat gaaccatgtc 1260 ctaagctgtg tcaagaagga gaaggaacgt acagcggcct tccaagccct ggggctactt 1320 tctgtggctg tgaggtctga gtttaaggtc tatttgcctc gcgtgctgga catcatccga 1380 gcggccctgc ccccaaagga cttcgcccat aagaggcaga aggcaatgca ggtggatgcc 1440 acagtcttca cttgcatcag catgctggct cgagcaatgg ggccaggcat ccagcaggat 1500 atcaaggagc tgctggagcc catgctggca gtgggactaa gccctgccct cactgcagtg 1560 ctctacgacc tgagccgtca gattccacag ctaaagaagg acattcaaga tgggctactg 1620 aaaatgctgt ccctggtcct tatgcacaaa ccccttcgcc acccaggcat gcccaagggc 1680 ctggcccatc agctggcctc tcctggcctc acgaccctcc ctgaggccag cgatgtgggc 1740 agcatcactc ttgccctccg aacgcttggc agctttgaat ttgaaggcca ctctctgacc 1800 caatttgttc gccactgtgc ggatcatttc ctgaacagtg agcacaagga gatccgcatg 1860 gaggctgccc gcacctgctc ccgcctgctc acaccctcca tccacctcat cagtggccat 1920 gctcatgtgg ttagccagac cgcagtgcaa gtggtggcag atgtgcttag caaactgctc 1980 gtagttggga taacagatcc tgaccctgac attcgctact gtgtcttggc gtccctggac 2040 gagcgctttg atgcacacct ggcccaggcg gagaacttgc aggccttgtt tgtggctctg 2100 aatgaccagg tgtttgagat ccgggagctg gccatctgca ctgtgggccg actcagtagc 2160 atgaaccctg cctttgtcat gcctttcctg cgcaagatgc tcatccagat tttgacagag 2220 ttggagcaca gtgggattgg aagaatcaaa gagcagagtg cccgcatgct ggggcacctg 2280 gtctccaatg ccccccgact catccgcccc tacatggagc ctattctgaa ggcattaatt 2340 ttgaaactga aagatccaga ccctgatcca aacccaggtg tgatcaataa tgtcctggca 2400 acaataggag aattggcaca ggttagtggc ctggaaatga ggaaatgggt tgatgaactt 2460 tttattatca tcatggacat gctccaggat tcctctttgt tggccaaaag gcaggtggct 2520 ctgtggaccc tgggacagtt ggtggccagc actggctatg tagtagagcc ctacaggaag 2580 taccctactt tgcttgaggt gctactgaat tttctgaaga ctgagcagaa ccagggtaca 2640 cgcagagagg ccatccgtgt gttagggctt ttaggggctt tggatcctta caagcacaaa 2700 gtgaacattg gcatgataga ccagtcccgg gatgcctctg ctgtcagcct gtcagaatcc 2760 aagtcaagtc aggattcctc tgactatagc actagtgaaa tgctggtcaa catgggaaac 2820 ttgcctctgg atgagttcta cccagctgtg tccatggtgg ccctgatgcg gatcttccga 2880 gaccagtcac tctctcatca tcacaccatg gttgtccagg ccatcacctt catcttcaag 2940 tccctgggac tcaaatgtgt gcagttcctg ccccaggtca tgcccacgtt ccttaacgtc 3000 attcgagtct gtgatggggc catccgggaa tttttgttcc agcagctggg aatgttggtg 3060 tcctttgtga agagccacat cagaccttat atggatgaaa tagtcaccct catgagagaa 3120 ttctgggtca tgaacacctc aattcagagc acgatcattc ttctcattga gcaaattgtg 3180 gtagctcttg ggggtgaatt taagctctac ctgccccagc tgatcccaca catgctgcgt 3240 gtcttcatgc atgacaacag cccaggccgc attgtctcta tcaagttact ggctgcaatc 3300 cagctgtttg gcgccaacct ggatgactac ctgcatttac tgctgcctcc tattgttaag 3360 ttgtttgatg cccctgaagc tccactgcca tctcgaaagg cagcgctaga gactgtggac 3420 cgcctgacgg agtccctgga tttcactgac tatgcctccc ggatcattca ccctattgtt 3480 cgaacactgg accagagccc agaactgcgc tccacagcca tggacacgct gtcttcactt 3540 gtttttcagc tggggaagaa gtaccaaatt ttcattccaa tggtgaataa agttctggtg 3600 cgacaccgaa tcaatcatca gcgctatgat gtgctcatct gcagaattgt caagggatac 3660 accttgctg atgaagagga ggatcctttg atttaccagc atcggatgct taggagtggc 3720 caaggggatg cattggctag tggaccagtg gaaacaggac ccatgaagaa actgcacgtc 3780 agcaccatca acctccaaaa ggcctggggc gctgccagga gggtctccaa agatgactgg 3840 ctggaatggc tgagacggct gagcctggag ctgctgaagg actcatcatc gccctccctg 3900 cgctcctgct gggccctggc acaggcctac aacccgatgg ccagggatct cttcaatgct 3960 gcatttgtgt cctgctggtc tgaactgaat gaagatcaac aggatgagct catcagaagc 4020 atcgagttgg ccctcacctc acaagacatc gctgaagtca cacagaccct cttaaacttg 4080 gctgaattca tggaacacag tgacaagggc cccctgccac tgagagatga caatggcatt 4140 gttctgctgg gtgagagagc tgccaagtgc cgagcatatg ccaaagcact acactacaaa 4200 gaactggagt tccagaaagg ccccacccct gccattctag aatctctcat cagcattaat 4260 aataagctac agcagccgga ggcagcggcc ggagtgttag aatatgccat gaaacacttt 4320 ggagagctgg agatccaggc tacctggtat gagaaactgc acgagtggga ggatgccctt 4380 gtggcctatg acaagaaaat ggacaccaac aaggacgacc cagagctgat gctgggccgc 4440 atgcgctgcc tcgaggcctt gggggaatgg ggtcaactcc accagcagtg ctgtgaaaag 4500 tggaccctgg ttaatgatga gacccaagcc aagatggccc ggatggctgc tgcagctgca 4560 tggggtttag gtcagtggga cagcatggaa gaatacacct gtatgatccc tcgggacacc 4620 catgatgggg cattttatag agctgtgctg gcactgcatc aggacctctt ctccttggca 4680 caacagtgca ttgacaaggc cagggacctg ctggatgctg aattaactgc gatggcagga 4740 gagagttaca gtcgggcata tggggccatg gtttcttgcc acatgctgtc cgagctggag 4800 gaggttatcc agtacaaact tgtccccgag cgacgagaga tcatccgcca gatctggtgg 4860 gagagactgc agggctgcca gcgtatcgta gaggactggc agaaaatcct tatggtgcgg 4920 tcccttgtgg tcagccctca tgaagacatg agaacctggc tcaagtatgc aagcctgtgc 4980 ggcaagagtg gcaggctggc tcttgctcat aaaactttag tgttgctcct gggagttgat 5040 ccgtctcggc aacttgacca tcctctgcca acagttcacc ctcaggtgac ctatgcctac 5100 atgaaaaaca tgtggaagag tgcccgcaag atcgatgcct tccagcacat gcagcatttt 5160 gtccagacca tgcagcaaca ggcccagcat gccatcgcta ctgaggacca gcagcataag 5220 caggaactgc acaagctcat ggcccgatgc ttcctgaaac ttggagagtg gcagctgaat 5280 ctacagggca tcaatgagag cacaatcccc aaagtgctgc agtactacag cgccgccaca 5340 gagcacgacc gcagctggta caaggcctgg catgcgtggg cagtgatgaa cttcgaagct 5400 gtgctacact acaaacatca gaaccaagcc cgcgatgaga agaagaaact gcgtcatgcc 5460 agcggggcca acatcaccaa cgccaccact gccgccacca cggccgccac tgccaccacc 5520 actgccagca ccgagggcag caacagtgag agcgaggccg agagcaccga gaacagcccc 5580 accccatcgc cgctgcagaa gaaggtcact gaggatctgt ccaaaaccct cctgatgtac 5640 acggtgcctg ccgtccaggg cttcttccgt tccatctcct tgtcacgagg caacaacctc 5700 caggatacac tcagagttct caccttatgg tttgattatg gtcactggcc agatgtcaat 5760 gaggccttag tggagggggt gaaagccatc cagattgata cctggctaca ggttatacct 5820 cagctcattg caagaattga tacgcccaga cccttggtgg gacgtctcat tcaccagctt 5880 ctcacagaca ttggtcggta ccacccccag gccctcatct acccactgac agtggcttct 5940 aagtctacca cgacagcccg gcacaatgca gccaacaaga ttctgaagaa catgtgtgag 6000 cacagcaaca ccctggtcca gcaggccatg atggtgagcg aggagctgat ccgagtggcc 6060 atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgttt gtactttggg 6120 gaaaggaacg tgaaaggcat gtttgaggtg ctggagccct tgcatgctat gatggaacgg 6180 ggcccccaga ctctgaagga aacatccttt aatcaggcct atggtcgaga tttaatggag 6240 gcccaagagt ggtgcaggaa gtacatgaaa tcagggaatg tcaaggacct cacccaagcc 6300 tgggacctct attatcatgt gttccgacga atctcaaagc agctgcctca gctcacatcc 6360 ttagagctgc aatatgtttc cccaaaactt ctgatgtgcc gggaccttga attggctgtg 6420 ccaggaacat atgaccccaa ccagccaatc attcgcattc agtccatagc accgtctttg 6480 caagtcatca catccaagca gaggccccgg aaattgacac ttatgggcag caacggacat 6540 gagtttgttt tccttctaaa aggccatgaa gatctgcgcc aggatgagcg tgtgatgcag 6600 ctcttcggcc tggttaacac ccttctggcc aatgacccaa catctcttcg gaaaaacctc 6660 agcatccaga gatacgctgt catcccttta tcgaccaact cgggcctcat tggctgggtt 6720 ccccactgtg acacactgca cgccctcatc cgggactaca gggagaagaa gaagatcctt 6780 ctcaacatcg agcatcgcat catgttgcgg atggctccgg actatgacca cttgactctg 6840 atgcagaagg tggaggtgtt tgagcatgcc gtcaataata cagctgggga cgacctggcc 6900 aagctgctgt ggctgaaaag ccccagctcc gaggtgtggt ttgaccgaag aaccaattat 6960 acccgttctt tagcggtcat gtcaatggtt gggtatattt taggcctggg agatagacac 7020 ccatccaacc tgatgctgga ccgtctgagt gggaagatcc tgcacattga ctttggggac 7080 tgctttgagg ttgctatgac ccgagagaag tttccagaga agattccatt tagactaaca 7140 agaatgttga ccaatgctat ggaggttaca ggcctggatg gcaactacag aatcacatgc 7200 cacacagtga tggaggtgct gcgagagcac aaggacagtg tcatggccgt gctggaagcc 7260 tttgtctatg accccttgct gaactggagg ctgatggaca caaataccaa aggcaacaag 7320 cgatcccgaa cgaggacgga ttcctactct gctggccagt cagtcgaaat tttggacggt 7380 gtggaacttg gagagccagc ccataagaaa acggggacca cagtgccaga atctattcat 7440 tctttcattg gagacggttt ggtgaaacca gaggccctaa ataagaaagc tatccagatt 7500 attaacaggg ttcgagataa gctcactggt cgggacttct ctcatgatga cactttggat 7560 gttccaacgc aagttgagct gctcatcaaa caagcgacat cccatgaaaa cctctgccag 7620 tgctatattg gctggtgccc tttctggtaa 7650 <210> 2 <211> 2549 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE &Lt; 222 > (1) .. (2549) <223> wild type mTOR <400> 2 Met Leu Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser   1 5 10 15 Ser Asn Val Ser Val Leu Gln Gln Phe Ala Ser Gly Leu Lys Ser Arg              20 25 30 Asn Glu Glu Thr Arg Ala Lys Ala Ala Lys Glu Leu Gln His Tyr Val          35 40 45 Thr Met Glu Leu Arg Glu Met Ser Gln Glu Glu Ser Thr Arg Phe Tyr      50 55 60 Asp Gln Leu Asn His His Ile Phe Glu Leu Val Ser Ser Ser Asp Ala  65 70 75 80 Asn Glu Arg Lys Gly Gly Ile Leu Ala Ile Ala Ser Leu Ile Gly Val                  85 90 95 Glu Gly Gly Asn Ala Thr Arg Ile Gly Arg Phe Ala Asn Tyr Leu Arg             100 105 110 Asn Leu Leu Pro Ser Asn Pro Val Val Met Glu Met Ala Ser Lys         115 120 125 Ala Ile Gly Arg Leu Ala Met Ala Gly Asp Thr Phe Thr Ala Glu Tyr     130 135 140 Val Glu Phe Glu Val Lys Arg Ala Leu Glu Trp Leu Gly Ala Asp Arg 145 150 155 160 Asn Glu Gly Arg Arg His Ala Ala Val Leu Val Leu Arg Glu Leu Ala                 165 170 175 Ile Ser Val Pro Thr Phe Phe Phe Gln Gln Val Gln Pro Phe Phe Asp             180 185 190 Asn Ile Phe Val Ala Val Trp Asp Pro Lys Gln Ala Ile Arg Glu Gly         195 200 205 Ala Val Ala Ala Leu Arg Ala Cys Leu Ile Leu Thr Thr Gln Arg Glu     210 215 220 Pro Lys Glu Met Gln Lys Pro Gln Trp Tyr Arg His Thr Phe Glu Glu 225 230 235 240 Ala Glu Lys Gly Phe Asp Glu Thr Leu Ala Lys Glu Lys Gly Met Asn                 245 250 255 Arg Asp Asp Arg Ile His Gly Ala Leu Leu Ile Leu Asn Glu Leu Val             260 265 270 Arg Ile Ser Ser Met Glu Gly Glu Arg Leu Arg Glu Glu Met Glu Glu         275 280 285 Ile Thr Gln Gln Gln Leu Val His Asp Lys Tyr Cys Lys Asp Leu Met     290 295 300 Gly Phe Gly Thr Lys Pro Arg His Ile Thr Pro Phe Thr Ser Phe Gln 305 310 315 320 Ala Val Gln Pro Gln Gln Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr                 325 330 335 Ser Ser His Gln Gly Leu Met Gly Phe Gly Thr Ser Ser Ser Ser Ala             340 345 350 Lys Ser Thr Leu Val Glu Ser Arg Cys Cys Arg Asp Leu Met Glu Glu         355 360 365 Lys Phe Asp Gln Val Cys Gln Trp Val Leu Lys Cys Arg Asn Ser Lys     370 375 380 Asn Ser Leu Ile Gln Met Thr Ile Leu Asn Leu Leu Pro Arg Leu Ala 385 390 395 400 Ala Phe Arg Pro Ser Ala Phe Thr Asp Thr Gln Tyr Leu Gln Asp Thr                 405 410 415 Met Asn His Val Leu Ser Cys Val Lys Lys Glu Lys Glu Arg Thr Ala             420 425 430 Ala Phe Gln Ala Leu Gly Leu Leu Ser Val Ala Val Arg Ser Glu Phe         435 440 445 Lys Val Tyr Leu Pro Arg Val Leu Asp Ile Ile Arg Ala Ala Leu Pro     450 455 460 Pro Lys Asp Phe Ala His Lys Arg Gln Lys Ala Met Gln Val Asp Ala 465 470 475 480 Thr Val Phe Thr Cys Ile Ser Met Leu Ala Arg Ala Met Gly Pro Gly                 485 490 495 Ile Gln Gln Asp Ile Lys Glu Leu Leu Glu Pro Met Leu Ala Val Gly             500 505 510 Leu Ser Pro Ala Leu Thr Ala Val Leu Tyr Asp Leu Ser Arg Gln Ile         515 520 525 Pro Gln Leu Lys Lys Asp Ile Gln Asp Gly Leu Leu Lys Met Leu Ser     530 535 540 Leu Val Leu Met His Lys Pro Leu Arg His Pro Gly Met Pro Lys Gly 545 550 555 560 Leu Ala His Gln Leu Ala Ser Pro Gly Leu Thr Thr Leu Pro Glu Ala                 565 570 575 Ser Asp Val Gly Ser Ile Thr Leu Ala Leu Arg Thr Leu Gly Ser Phe             580 585 590 Glu Phe Glu Gly His Ser Leu Thr Gln Phe Val Arg His Cys Ala Asp         595 600 605 His Phe Leu Asn Ser Glu His Lys Glu Ile Arg Met Glu Ala Ala Arg     610 615 620 Thr Cys Ser Arg Leu Leu Thr Pro Ser Ile His Leu Ile Ser Gly His 625 630 635 640 Ala His Val Val Ser Gln Thr Ala Val Gln Val Val Ala Asp Val Leu                 645 650 655 Ser Lys Leu Leu Val Val Gly Ile Thr Asp Pro Asp Pro Asp Ile Arg             660 665 670 Tyr Cys Val Leu Ala Ser Leu Asp Glu Arg Phe Asp Ala His Leu Ala         675 680 685 Gln Ala Glu Asn Leu Gln Ala Leu Phe Val Ala Leu Asn Asp Gln Val     690 695 700 Phe Glu Ile Arg Glu Leu Ala Ile Cys Thr Val Gly Arg Leu Ser Ser 705 710 715 720 Met Asn Pro Ala Phe Val Met Pro Phe Leu Arg Lys Met Leu Ile Gln                 725 730 735 Ile Leu Thr Glu Leu Glu His Ser Gly Ile Gly Arg Ile Lys Glu Gln             740 745 750 Ser Ala Arg Met Leu Gly His Leu Val Ser Asn Ala Pro Arg Leu Ile         755 760 765 Arg Pro Tyr Met Glu Pro Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys     770 775 780 Asp Pro Asp Pro Asp Pro Asn Pro Gly Val Ile Asn Asn Val Leu Ala 785 790 795 800 Thr Ile Gly Glu Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys Trp                 805 810 815 Val Asp Glu Leu Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser             820 825 830 Leu Leu Ala Lys Arg Gln Val Ala Leu Trp Thr Leu Gly Gln Leu Val         835 840 845 Ala Ser Thr Gly Tyr Val Val Glu Pro Tyr Arg Lys Tyr Pro Thr Leu     850 855 860 Leu Glu Val Leu Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly Thr 865 870 875 880 Arg Arg Glu Ala Ile Arg Val Leu Gly Leu Leu Gly Ala Leu Asp Pro                 885 890 895 Tyr Lys His Lys Val Asn Ile Gly Met Ile Asp Gln Ser Arg Asp Ala             900 905 910 Ser Ala Val Ser Leu Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser As Ser         915 920 925 Tyr Ser Thr Ser Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu Asp     930 935 940 Glu Phe Tyr Pro Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg 945 950 955 960 Asp Gln Ser Leu Ser His His His Thr Met Val Val Gln Ala Ile Thr                 965 970 975 Phe Ile Phe Lys Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln             980 985 990 Val Met Pro Thr Phe Leu Asn Val Ile Arg Val Cys Asp Gly Ala Ile         995 1000 1005 Arg Glu Phe Leu Phe Gln Gln Leu Gly Met Leu Val Ser Phe Val Lys    1010 1015 1020 Ser His Ile Arg Pro Tyr Met Asp Glu Ile Val Thr Leu Met Arg Glu 1025 1030 1035 1040 Phe Trp Val Met Asn Thr Ser Ile Gln Ser Thr Ile Ile Leu Leu Ile                1045 1050 1055 Glu Gln Ile Val Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro            1060 1065 1070 Gln Leu Ile Pro His Met Leu Arg Val Phe Met His Asp Asn Ser Pro        1075 1080 1085 Gly Arg Ile Val Ser Ile Lys Leu    1090 1095 1100 Ala Asn Leu Asp Asp Tyr Leu His Leu Leu Leu Pro Pro Ile Val Lys 1105 1110 1115 1120 Leu Phe Asp Ala Pro Glu Ala Pro Leu Pro Ser Arg Lys Ala Ala Leu                1125 1130 1135 Glu Thr Val Asp Arg Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala            1140 1145 1150 Ser Arg Ile Ile His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu        1155 1160 1165 Leu Arg Ser Thr Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu    1170 1175 1180 Gly Lys Lys Tyr Gln Ile Phe Ile Pro Met Val Asn Lys Val Leu Val 1185 1190 1195 1200 Arg His Arg Ile Asn His Gln Arg Tyr Asp Val Leu Ile Cys Arg Ile                1205 1210 1215 Val Lys Gly Tyr Thr Leu Ala Asp Glu Glu Asp Pro Leu Ile Tyr            1220 1225 1230 Gln His Arg Met Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser Gly        1235 1240 1245 Pro Val Glu Thr Gly Pro Met Lys Lys Leu His Val Ser Thr Ile Asn    1250 1255 1260 Leu Gln Lys Ala Trp Gly Ala Ala Arg Arg Val Ser Lys Asp Asp Trp 1265 1270 1275 1280 Leu Glu Trp Leu Arg Arg Leu Ser Leu Glu Leu Leu Lys Asp Ser Ser                1285 1290 1295 Ser Pro Ser Leu Arg Ser Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro            1300 1305 1310 Met Ala Arg Asp Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu        1315 1320 1325 Leu Asn Glu Asp Glu Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala    1330 1335 1340 Leu Thr Ser Gln Asp Ile Ala Glu Val Thr Gln Thr Leu Leu Asn Leu 1345 1350 1355 1360 Ala Glu Phe Met Glu His Ser Asp Lys Gly Pro Leu Pro Leu Arg Asp                1365 1370 1375 Asp Asn Gly Ile Val Leu Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala            1380 1385 1390 Tyr Ala Lys Ala Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro        1395 1400 1405 Thr Pro Ala Ile Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln    1410 1415 1420 Gln Pro Glu Ala Ala Gly Val Leu Glu Tyr Ala Met Lys His Phe 1425 1430 1435 1440 Gly Glu Leu Glu Ile Gln Ala Thr Trp Tyr Glu Lys Leu His Glu Trp                1445 1450 1455 Glu Asp Ala Leu Val Ala Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp            1460 1465 1470 Asp Pro Glu Leu Met Leu Gly Arg Met Cys Leu Glu Ala Leu Gly        1475 1480 1485 Glu Trp Gly Gln Leu His Gln Gln Cys Cys Glu Lys Trp Thr Leu Val    1490 1495 1500 Asn Asp Glu Thr Gln Ala Lys Met Ala Arg Met Ala Ala Ala Ala Ala 1505 1510 1515 1520 Trp Gly Leu Gly Gln Trp Asp Ser Met Glu Glu Tyr Thr Cys Met Ile                1525 1530 1535 Pro Arg Asp Thr His Asp Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu            1540 1545 1550 His Gln Asp Leu Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg        1555 1560 1565 Asp Leu Leu Asp Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser    1570 1575 1580 Arg Ala Tyr Gly Ala Met Val Ser Cys His Met Leu Ser Glu Leu Glu 1585 1590 1595 1600 Glu Val Ile Gln Tyr Lys Leu Val Pro Glu Arg Arg Glu Ile Ile Arg                1605 1610 1615 Gln Ile Trp Trp Glu Arg Leu Gln Gly Cys Gln Arg Ile Val Glu Asp            1620 1625 1630 Trp Gln Lys Ile Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu        1635 1640 1645 Asp Met Arg Thr Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly    1650 1655 1660 Arg Leu Ala Leu Ala His Lys Thr Leu Val Leu Leu Leu Gly Val Asp 1665 1670 1675 1680 Pro Ser Arg Gln Leu Asp His Pro Leu Pro Thr Val His Pro Gln Val                1685 1690 1695 Thr Tyr Ala Tyr Met Lys Asn Met Trp Lys Ser Ala Arg Lys Ile Asp            1700 1705 1710 Ala Phe Gln His Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala        1715 1720 1725 Gln His Ala Ile Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu His    1730 1735 1740 Lys Leu Met Ala Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln Leu Asn 1745 1750 1755 1760 Leu Gln Gly Ile Asn Glu Ser Thr Ile Pro Lys Val Leu Gln Tyr Tyr                1765 1770 1775 Ser Ala Ala Thr Glu His Asp Arg Ser Trp Tyr Lys Ala Trp His Ala            1780 1785 1790 Trp Ala Val Met Asn Phe Glu Ala Val Leu His Tyr Lys His Gln Asn        1795 1800 1805 Gln Ala Arg Asp Glu Lys Lys Lys Leu Arg His Ala Ser Gly Ala Asn    1810 1815 1820 Ile Thr Asn Ala Thr Thr Ala Thr Thr 1825 1830 1835 1840 Thr Ala Ser Thr Glu Gly Ser Ser                1845 1850 1855 Glu Asn Ser Pro Thr Pro Ser Pro Leu Gln Lys Lys Val Thr Glu Asp            1860 1865 1870 Leu Ser Lys Thr Leu Leu Met Tyr Thr Val Ala Val Gln Gly Phe        1875 1880 1885 Phe Arg Ser Ser Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu    1890 1895 1900 Arg Val Leu Thr Leu Trp Phe Asp Tyr Gly His Trp Pro Asp Val Asn 1905 1910 1915 1920 Glu Ala Leu Val Glu Gly Val Lys Ala Ile Gln Ile Asp Thr Trp Leu                1925 1930 1935 Gln Val Ile Pro Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu            1940 1945 1950 Val Gly Arg Leu Ile His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His        1955 1960 1965 Pro Gln Ala Leu Ile Tyr Pro Leu Thr Val Ala Ser Lys Ser Thr Thr    1970 1975 1980 Thr Ala Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu 1985 1990 1995 2000 His Ser Asn Thr Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu                2005 2010 2015 Ile Arg Val Ala Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu            2020 2025 2030 Glu Ala Ser Arg Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe        2035 2040 2045 Glu Val Leu Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Gln Thr    2050 2055 2060 Leu Lys Glu Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu 2065 2070 2075 2080 Ala Gln Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp                2085 2090 2095 Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser            2100 2105 2110 Lys Gln Leu Pro Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro        2115 2120 2125 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr    2130 2135 2140 Asp Pro Asn Gln Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu 2145 2150 2155 2160 Gln Val Ile Thr Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly                2165 2170 2175 Ser Asn Gly His Glu Phe Val Phe Leu Leu Lys Gly His Glu Asp Leu            2180 2185 2190 Arg Gln Asp Glu Arg Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu        2195 2200 2205 Leu Ala Asn Asp Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln Arg    2210 2215 2220 Tyr Ala Val Ile Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly Trp Val 2225 2230 2235 2240 Pro His Cys Asp Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu Lys                2245 2250 2255 Lys Lys Ile Leu Leu Asn Ile Glu His Arg Ile Met Leu Arg Met Ala            2260 2265 2270 Pro Asp Tyr Asp His Leu Thr Leu Met Gln Lys Val Glu Val Phe Glu        2275 2280 2285 His Ala Val Asn Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu Trp    2290 2295 2300 Leu Lys Ser Pro Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr 2305 2310 2315 2320 Thr Arg Ser Leu Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu                2325 2330 2335 Gly Asp Arg His Pro Ser Asn Leu Met Leu Asp Arg Leu Ser Gly Lys            2340 2345 2350 Ile Leu His Ile Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg        2355 2360 2365 Glu Lys Phe Pro Glu Lys Ile Pro Phe Arg Leu Thr Arg Met Leu Thr    2370 2375 2380 Asn A Met Glu Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile Thr Cys 2385 2390 2395 2400 His Thr Val Met Glu Val Leu Arg Glu His Lys Asp Ser Val Met Ala                2405 2410 2415 Val Leu Glu Ala Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met            2420 2425 2430 Asp Thr Asn Thr Lys Gly Asn Lys Arg Ser Ser Thr Arg Thr Asp Ser        2435 2440 2445 Tyr Ser Ala Gly Gln Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly    2450 2455 2460 Glu Pro Ala His Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile His 2465 2470 2475 2480 Ser Phe Ile Gly Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys Lys                2485 2490 2495 Ala Ile Gln Ile Ile Asn Arg Val Arg Asp Lys Leu Thr Gly Arg Asp            2500 2505 2510 Phe Ser His Asp Asp Thr Leu Asp Val Pro Thr Gln Val Glu Leu Leu        2515 2520 2525 Ile Lys Gln Ala Thr Ser His Glu Asn Leu Cys Gln Cys Tyr Ile Gly    2530 2535 2540 Trp Cys Pro Phe Trp 2545 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C1483Y sense primer <400> 3 gccgcatgcg ctacctcgag gcc 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C1483Y antisense primer <400> 4 ggcctcgagg tagcgcatgc ggc 23 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> E2419K sense primer <400> 5 gtgtcatggc cgtgctgaaa gcctttgtct atgac 35 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> E2419K antisense primer <400> 6 gtcatagaca aaggctttca gcacggccat gacac 35 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427P sense primer <400> 7 gtctatgacc ccttgccgaa ctggaggctg atg 33 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427P antisense primer <400> 8 catcagcctc cagttcggca aggggtcata gac 33 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Annealed primer forward <400> 9 aattccaatt gcccgggctt aagatcgata cgcgta 36 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Annealed primer reverse <400> 10 ccggtacgcg tatcgatctt aagcccgggc aattgg 36 <210> 11 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> hmTOR-MfeI-flag forward <400> 11 gatcacaatt gtggccacca tggactacaa ggacgacgat gacaagatgc 50 <210> 12 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> hmTOR-MluI Reverse <400> 12 tgatcaacgc gtttaccaga aagggcacca gccaatatag c 41

Claims (16)

In the amino acid sequence of SEQ ID NO: 2,
The cysteine (C) at position 1483 is replaced with tyrosine (Y), the glutamic acid (E) at position 2419 is substituted with lysine (K), and the leucine (L) at position 2427 is replaced with proline &Lt; RTI ID = 0.0 &gt; and / or &lt; / RTI &gt;
A composition for inducing brain metastasis by focal cortical dysplasia (FCD).
The method according to claim 1,
The protein in which cysteine (C) at position 1483 is substituted with tyrosine (Y) is encoded by a gene in which guanine (G) at position 4448 in the nucleotide sequence of SEQ ID NO: 1 is substituted with adenine (A)
The protein in which glutamic acid (E) at position 2419 is substituted with lysine (K) is guanine (G) at position 7255 in the nucleotide sequence of SEQ ID NO: 1 is encoded by a gene substituted with adenine (A)
Wherein the protein in which Lucine (L) at position 2427 is substituted with proline (P) is encoded by a gene in which the thymine (T) at position 7280 in the nucleotide sequence of SEQ ID NO: 1 is substituted with cytosine (C)
Composition for inducing brain metastasis.
The composition according to claim 1, wherein the brain is a refractory brain metastasis.
delete In the nucleotide sequence of SEQ ID NO: 1,
The guanine (G) at position 4448 is replaced with adenine (A), the guanine (G) at position 7255 is replaced with adenine (A) and the thymine (T) at position 7280 is replaced with cytosine Comprising a gene consisting of a base sequence comprising at least one mutation selected from the group consisting of SEQ ID NO:
A composition for inducing brain metastasis by focal cortical dysplasia (FCD).
6. The composition according to claim 5, wherein the brain metastasis is a refractory brain metastasis.
delete In the nucleotide sequence of SEQ ID NO: 1,
A gene consisting of a nucleotide sequence comprising at least one mutation selected from the group consisting of substitution of guanine (G) at position 7255 with adenine (A) and substitution of thymine (T) at position 7280 with cytosine (C) Comprising a recombinant vector.
At least one mutation selected from the group consisting of substitution of guanine (G) at position 7255 with adenine (A) and substitution of thymine (T) at position 7280 with cytosine (C) in the nucleotide sequence of SEQ ID NO: And a recombinant vector comprising a gene consisting of a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO.
At least one mutation selected from the group consisting of substitution of guanine (G) at position 7255 with adenine (A) and substitution of thymine (T) at position 7280 with cytosine (C) in the nucleotide sequence of SEQ ID NO: Wherein the recombinant vector comprises a gene consisting of a nucleotide sequence comprising a nucleotide sequence which comprises the nucleotide sequence of SEQ ID NO:
(G) at position 4448 is replaced with adenine (A), guanine (G) at position 7255 is replaced with adenine (A), and the thymine (T) at position 7280 is substituted with adenine (C), and the resultant is transformed into a recombinant vector containing a gene consisting of a nucleotide sequence comprising at least one mutation selected from the group consisting of cytosine (C) substitution, and induction of focal cortical dysplasia (FCD) Animal, except humans.
12. The animal according to claim 11, wherein the animal is a mammal or rodent except for a human.
(G) at position 4448 is replaced with adenine (A), guanine (G) at position 7255 is replaced with adenine (A), and the thymine (T) at position 7280 is substituted with adenine And a step of introducing a recombinant vector comprising a gene consisting of a nucleotide sequence comprising at least one mutation selected from the group consisting of cytosine (C) into a cell into a focal cortical dysplasia (FCD) &Lt; / RTI &gt;
(G) at position 4448 is replaced with adenine (A), guanine (G) at position 7255 is replaced with adenine (A), and the thymine (T) at position 7280 is substituted with adenine And introducing the recombinant vector comprising the gene consisting of the nucleotide sequence containing at least one mutation selected from the group consisting of cytosine (C) into an embryo of an animal other than a human,
A method for producing an animal in which brain growth is induced by focal cortical dysplasia (FCD).
15. The method of claim 14, wherein the recombinant vector is introduced into the brain of the embryo during a period during which a cortical layer is formed in the embryo.
A method for producing an animal in which brain growth is induced by focal cortical dysplasia (FCD).
11. A method for preventing brain metastasis, comprising the step of administering a candidate agent for treatment of cerebral apoplexy to an animal which has been induced by focal cortical dysplasia (FCD) according to claim 11,
Screening method for therapeutic agent for cerebral infarction.

Images