KR20180119371A - A probe for detecting autophagosome and uses thereof - Google Patents

Abstract

The present invention relates to a probe for detecting autophagosome, and specifically, relates to a novel probe capable of monitoring autophagocytosis by specifically detecting LC3A, LC3C, GABARAP, GABARAPL1, or GABARAPL2 of autophagosome in living cells, and to a use of the probe. The probe for detecting autophagosome of the present invention includes an lc3-interacting motif (LIR) site of ATG13 and an HyD site which is a hydrophobic domain of Aplysia phosphodiesterase 4 (ApPDE4), wherein the LIR can specifically detect LC3A, LC3C, GABARAP, GABARAPL1, and GABARAPL2 of the autophagosome; and the HyD can improve the binding force with the membrane of the autophagosome. Thus, the probe of the present invention can be easily used for autophagosome detection.

Description

[0001] PROBE FOR DETECTING AUTOPHAGOSOME AND USES THEREOF [0002]

The present invention relates to a probe capable of specifically and stably detecting an autophagous organism, and more particularly, to a probe capable of specifically detecting an autografted organism LC3A, LC3C, GABARAP, GABARAPL1 or GABARAPL2 in living cells, To a novel probe that can be specifically monitored and its use.

Autophagy is an evolutionarily conserved lysosomal degradation pathway that forms an autophagosome by stress conditions such as starvation, various physiological or pathological conditions, (Baehrecke, EH, 2005; Yang & Klionsky, 2005), which maintains cell homeostasis by removing old proteins, organs or components in the cell, , 2009; Yang & Klionsky, 2010). When the self-predation is activated, a preautophagosomal membrane, also known as a quarantine membrane or phagophore, aggregates and expands to form an autophagosome with a bi-membrane-associated structure. Autogenous bodies that isolate these cytoplasmic cargo components are morphologic features of autopatch. Subsequently, autophagocytes can be fused with endosomes for maturation or fused with lysosomes for cell degradation. These autopoietic processes are regulated by several related proteins (AuTophaGy-related proteins), which function in autophagic induction, autophagy formation / maturation or degradation of cargo (Feng et al , 2014; Zhang & Baehrecke, 2015). The LC3 / GABARAP family of proteins important for mammalian self-predation has been implicated in the formation of autophagic bodies, cargo recognition, and the recruitment of cargo into the autopoiesis membrane (Kalvari et al , 2014) . Self-predation has been shown to preferentially select cargo through association with LC3 and selective autophagic receptors (Birgisdottir et al , 2013; Kalvari et al , 2014).

Initially, autophagy has been known as a type of defense mechanism to protect cells during starvation by providing nutrients through self-digestion, but it has been shown to play a variety of physiological roles such as cell homeostasis, differentiation, or regulation of metabolism Klionsky & Codogno, 2013). Recently, it has been reported that the autopoiesis process plays an important role in diverse diseases such as diabetes, metabolic diseases such as hypertension, degenerative brain disease, infectious disease, and cancer through various animal models and genetic analysis of diseases. Has been found to be strongly associated with many human diseases such as neurodegenerative diseases, lysosomal storage disorders, liver disease, some cancers, myopathies and certain infectious diseases (Jiang & Mizushima, 2014; Mizushima et al , 2008; Schneider &Amp; Cuervo, 2014). In particular, when the self-predation phenomenon deteriorates, accumulation of misfolded proteins is caused, resulting in neurodegenerative diseases (Komatsu et al., (2006) Nature, 441, 880-884) Importance is getting stronger.

The LC3 / GABARAP proteins are widely used as markers for autophagy, and the MAP1LC3 (microtubule-associated protein 1 light chain) family (MAP1LC3A [LC3A], MAP1LC3B [LC3B], MAP1LC3B2 [LC3B2] and MAP1LC3C [LC3C] (GABARAPL2, GABARAPL1, GABARAPL2 / GATE-16 and GABARAPL3), which are known to be involved in the regulation of GABA receptors (Lee et al . Previously, RFP-GFP-LC3 with GFP or RFP attached to LC3 directly involved in the formation of autotrophs was used for autoradiographic marker labeling. However, because LC3 itself is directly involved in the formation of autophagic bodies, various side effects such as the formation of GFP-LC3-positive aggregates by LC3 overexpression, migration to the nucleus, and increased levels of basic autophagocytes in the presence of nutrients are avoided There has been a problem that can not be done. In addition, some investigators have attempted to detect intrinsic LC3 as an antibody, but have found it difficult to detect them in certain types of cells with low antibody specificity or under certain conditions, and a more important limitation of this detection method is that the immature LC3 positive It was impossible to detect and trace the autogranular bodies.

Accordingly, the inventors of the present invention have completed the present invention by developing a novel probe capable of specifically monitoring autopoiesis by specifically detecting intrinsic LC3 / GABARAP-positive autophagic bodies in living cells.

It is an object of the present invention to provide a novel probe capable of efficiently and efficiently detecting an autogranular body by binding specifically and stably to LC3A, LC3C, GABARAP, GABARAPL1, or GABARAPL2 existing in an autotrophic body in living cells.

In order to accomplish the above object, the present invention provides a probe for detecting an autophagosome.

The present invention also provides a composition for detecting autophagic cells.

In addition, the present invention provides a composition for autogenous somatic image imaging.

In addition, the present invention provides a composition for the diagnosis of autophagy-related disease.

According to the invention, and LC3- interaction motif (LIR) of the self-ATG13 can detect predators body specifically, ApPDE4 (Aplysia Since the hydrophobic domain HyD of phosphodiesterase 4 can enhance the binding force with the membranes of the autogranular bodies, the peptide including the LIR region of the ATG13 and the HyD region of the locus is specific for LC3A, LC3C, GABARAP, GABARAPL1 or GABARAPL2 in living cells It is possible to efficiently and effectively detect an autogranular body.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing that a probe for detecting an autografted somatic cell of the present invention binds to an autogranular host;
HyD: self hydrophobic region (20 amino acid sequence part of phosphodiesterase 4 short-form N- terminus of Aplysia) binding to membrane vesicles of macrophages;
LIR: LIR (LC3-interacting region) region of the protein ATG13 (Autophagy related gene 13) that binds to LC3-II (LC3 or GABARAP) of autophagic bodies; And
GFP: green fluorescent protein.
FIG. 2 is a view showing the structure of a probe for detecting an autocorrelation body of the present invention; FIG.
HyD: ApPDE4 (phosphodiesterase 4 of Aplysia) 20-amino-acid sequence of the hydrophobic N- terminal part of the short-form;
LIR (ATG13): LIR (LC3-interacting region) region of the protein ATG13 (Autophagy related gene 13) that binds to LC3-II (LC3 or GABARAP) of autophagic bodies; And
GFP: Green fluorescent protein.
FIG. 3 is a view showing co-localization of the probe of the present invention with the self-contained somatic marker of the probe for detecting the self-contained body of a subject;
HyD-LIR (ATG13) -GFP: probe of the present invention for detection of an autogranular body; And
LC3A, LC3B, LC3C, GABARAP, GABARAPL1 and GABARAPL2), which are autoreactive somatic specific markers, were labeled with red fluorescence Protein labeled protein.
FIG. 4 shows the localization of LC3 / GABARAP (LC3A, LC3B, LC3C, GABARAP, GABARAPL1 and GABARAPL2) -protrophoretic cells of the probe of the present invention.
5 is a diagram showing the detection strength of the probe of the present invention in an autogenous animal.

Hereinafter, the present invention will be described in detail with reference to embodiments of the present invention. It should be understood, however, that the invention is not limited thereto and that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims and their equivalents. .

In one aspect, the invention provides an autophagosome comprising an LIR (LC3-interacting region) site polypeptide of ATG13 (Autophagy related gene 13) and an N-terminal hydrophobic domain of ApPDE4 (Aplysia phosphodiesterase 4) short- To a probe for detection.

In one embodiment, the LIR (LC3-interacting region) site of ATG13 may comprise the amino acid sequence of SEQ ID NO: 8 and the N-terminal hydrophobic domain of ApPDE4 short-form may comprise the amino acid sequence of SEQ ID NO: 4 .

In one embodiment, the probe of the present invention can be labeled with a labeling element, which can be covalently or non-covalently linked to a protein (probe of the invention) to indicate the presence or absence of a particular amino acid sequence, But are not limited to, a group consisting of chromogenic enzymes, radioactive isotopes, chromophores, luminescent materials, fluorescers, magnetic resonance imaging materials, super paramagnetic particles and ultrasuperparamagnetic particles And the fluorescent material may be any one selected from the group consisting of cyanine, fluorescein, tetramethylolamine, alexa, bodipa, and derivatives thereof, although the fluorescent material is not limited as long as it emits fluorescence of red or near- , More preferably green fluorescent protein (GFP), enhancement < RTI ID = 0.0 > Green fluorescent protein (enhanced green fluorescent protein; EGFP) or a red fluorescent protein variant (modified red fluorescent protein; mRFP) may be.

In one embodiment, the probe for autophagy detection of the present invention may comprise the amino acid sequence of SEQ ID NO: 1.

The polypeptides of the present invention include not only polypeptides having the amino acid sequences described above but also amino acid sequence variants thereof, within the scope of the present invention. A variant of the polypeptide of the present invention means a polypeptide having one or more amino acid residues in the amino acid sequence of the present invention having a different sequence by deletion, insertion, non-conservative or conservative substitution, substitution of amino acid analog, or a combination thereof. Amino acid exchanges that do not globally alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). In some cases, the polypeptides of the present invention may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like.

In one embodiment, the L3 (LC3-interacting region) site of the probe of the present invention can specifically bind LC3A, LC3B, LC3C, GABARAP, GABARAPL1 and GABARAPL2 of autologous phagocytic bodies and the HyD site (phosphodiesterase 4 of Aplysia short-form hydrophobic N-terminal 20 amino acid sequence) can bind to the membrane of the autologous phagocytic host to stably maintain the binding of the autologous phagocyte and LIR. In this connection, HyD-GFP was not located in the autophoric cells of the inventors of the present invention (Application No. 10-2016-0133372), and HyD-LIR-GFP was found to be more potent than LIR- , Confirming that localization of LIR-GFP to autorefractants is increased due to the HyD site.

In one embodiment, the probe of the present invention may be an expression vector capable of expressing a probe for detecting an autologous phagocyte having the amino acid sequence of SEQ ID NO: 1, and may be an expression vector of the LIR (LC3-interacting region) of ATG13 (Autophagy related gene 13) And a nucleic acid that encodes an N-terminal hydrophobic domain of the Aplysia phosphodiesterase 4 (ApPDE4) short-form.

In one embodiment, autophagy-induced cell-specific markers and co-localization in the cell line transformed with the expression vector expressing the probe labeled with GFP with the amino acid sequence of SEQ ID NO: 1 of the present invention , It can be used as a probe for detection of an autogranular body.

As used herein, the term "marker" or "probe" refers to a substance capable of detecting and separating autophagic bodies, Organic biomolecules such as polypeptides or nucleic acids (e.g., mRNAs) that can be bound to each other, lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, polysaccharides and the like), and the like.

As used herein, the term " nucleic acid " is intended to include any DNA or RNA, such as chromosomes, mitochondria, viruses and / or bacterial nucleic acids present in a tissue sample. Includes one or both strands of a double-stranded nucleic acid molecule and includes any fragment or portion of the intact nucleic acid molecule.

As used herein, the term " gene " refers to any nucleic acid sequence or portion thereof that has a functional role in protein coding or transcription or in the control of other gene expression. The gene may consist of only a portion of the nucleic acid encoding or expressing any nucleic acid or protein that encodes the functional protein. The nucleic acid sequence may comprise an exon, an intron, an initiation or termination region, a promoter sequence, another regulatory sequence, or a gene abnormality within a particular sequence adjacent to the gene.

As used herein, the term " protein " also includes fragments, analogs and derivatives of proteins, which possess essentially the same biological activity or function as the reference protein.

As used herein, the term " vector " refers to any nucleic acid that is inserted into a host cell, recombined with the host cell genome, inserted into it, or contains a competent nucleotide sequence that replicates spontaneously as an episome. Such vectors include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, and viral vectors.

As used herein, the term " transfection, transfection or transfection " refers to the process in which extracellular DNA enters a host cell in the absence and presence of entities. &Quot; Transfected cells " DNA is introduced into the cell, and the DNA is introduced into the cell, the nucleic acid can be inserted into the chromosome, or it can be replicated as an extrachromosomal substance, and the cell into which the external DNA is introduced, Conversion body ".

In one aspect, the present invention relates to a composition for detecting autophagic cells comprising a probe for autophagic organism detection.

In one aspect, the present invention relates to a composition for autologous phagocyte imaging comprising a probe for detecting an autologous phagocyte as an active ingredient.

In one aspect, the present invention provides a method for detecting an autophagy body, comprising: transforming a cell line into a vector comprising a nucleic acid encoding a probe for detecting an autologous phagocyte; And identifying the degree of expression of the probe by a fluorescence signal.

The probe of the present invention can specifically detect autophagic bodies in living cells, and thus can be useful for analyzing the degree of progress of self-predation through the formation of autophagic bodies, and furthermore, Can be detected or imaged in real time.

In one aspect, the invention is directed to a composition for the diagnosis of autophagy-related disease comprising a probe for autophagic organism detection.

In one embodiment, the autophoric-related disorder can be selected from the group consisting of degenerative neurological diseases, cancer, lysosomal storage disorders, cardiomyopathy, senescence, type II programmed cell death, type 2 diabetes and bacterial infections.

In one embodiment, the retinal nerve disease is selected from the group consisting of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, Pick's Disease and Parkinson-ALS (amyotrophic lateral sclerosis) - dementia complex syndrome.

In one embodiment, the cancer is selected from the group consisting of lung cancer, liver cancer, colon cancer, pancreatic cancer, gastric cancer, breast cancer, ovarian cancer, kidney cancer, giant adenocarcinoma, pituitary cancer, esophageal cancer, prostate cancer, brain cancer, skin cancer, osteosarcoma, Cancer of the uterine cervix, endometrial cancer, choriocarcinoma, head and neck cancer, malignant melanoma, leukemia, multiple myeloma, chronic myelogenous leukemia, neuroblastoma, leukemia, leukemia, And aplastic anemia.

The content of the probe of the present invention as an active ingredient in the imaging or diagnostic composition of the present invention can be appropriately adjusted depending on the mode and purpose of use, patient condition and the like, and is 0.001 to 99.9% by weight, preferably 0.1 to 50% Weight percent, but is not limited thereto. The term 'solids weight' refers to the weight of the remaining ingredients after removal of the solvent component from the extract.

The imaging or diagnostic composition of the present invention can be administered to mammals, including humans, in a variety of routes. The mode of administration may be any manner conventionally used and may be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine, or intracerebroventricular injection. The composition of the present invention may be formulated into parenteral formulations in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, transdermal preparations, suppositories, Can be used.

In one embodiment, there is provided a method of diagnosing an autophagy-related disease comprising administering to a biological sample a composition for the diagnosis of autophagy-related disease comprising a probe for detecting an autologous animal of the present invention; And measuring the fluorescence intensity of the probe can be provided. At this time, the position and the intensity of the fluorescent material of the probe can be compared with the normal sample, and it can be confirmed whether or not an autogenous body is formed by the self-predation. The fluorescence intensity of the probe can be measured by measuring the fluorescence or fluorescence intensity generated from the fluorescent substance included in the probe described above by a conventional method (for example, fluorescence microscope, fluorescence spectroscope, or the like). The biological sample is derived from an animal, preferably a mammal (for example, a primate including humans, a rodent), and may be a tissue or a cell separated from a living body or a living body of the animal. Also, the normal sample means an animal, preferably a mammal (for example, a primate including humans, a rodent), or a tissue or cell isolated therefrom, without suffering from a self-predominant disease.

As used herein, the term " autoimmune disease " refers to a disease caused or exacerbated by the involvement of autophagy. But are not limited to, malignant tumors, neurodegenerative diseases, ischemic diseases, diabetes mellitus, pulmonary fibrosis and the like, and more preferably malignant tumors such as breast cancer, lung cancer, fibrosarcoma, colon cancer and the like; Neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Huntington's disease; Ischemic diseases such as angina pectoris, myocardial infarction, cardiac failure, ischemic colitis, ischemic acute renal failure, acute ischemic stroke; Diabetes such as type 1 diabetes, type 2 diabetes, and pulmonary fibrosis.

As used herein, the term " diagnosis " means identifying the presence or characteristic of a pathological condition. Among them, the present invention is useful for providing information on auto-predation related diseases. In the present invention, the increase / decrease characteristics of the number of autotrophs can be used as useful indicators (diagnostic markers).

The term " subject " or " patient " as used herein refers to any single entity requiring treatment, including human, cow, dog, guinea pig, rabbit, chicken, insect and the like. In addition, any subject who participates in a clinical study test that does not show any disease clinical findings, or who participates in epidemiological studies or used as a control group is included.

As used herein, the term " tissue or cell sample " refers to a collection of similar cells obtained from a subject or tissue of a patient. The source of the tissue or cell sample may be a solid tissue from fresh, frozen and / or preserved organ or tissue sample or biopsy or aspirate; Blood or any blood components; It may be a cell at any point in the pregnancy or development of the subject. Tissue samples can also be primary or cultured cells or cell lines.

In one aspect, the present invention provides a method for detecting a host cell, comprising the steps of: treating a candidate substance to cells expressing a probe for detecting an autologous animal of the present invention; Causing an autophagy action on the cell; Analyzing the fluorescence signal of the probe; And determining that the candidate substance is an autopoiesis inhibitor if autocotyloid formation is inhibited by the candidate substance. The candidate compound may include various compounds, proteins, nucleic acids, and the like.

In one aspect, the present invention provides a method for detecting a host cell, comprising the steps of: treating a candidate substance to cells expressing a probe for detecting an autologous animal of the present invention; And analyzing the fluorescence signal of the probe; Wherein the candidate substance is an autophagic activator when the candidate substance forms an autophagic organism. The present invention also relates to a method for screening an autophagic activator. The candidate compound may include various compounds, proteins, nucleic acids, and the like.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

Example  One. Autogenous body  Specific probe HyD - LIR ( ATG13 ) -GFP production

(LIR) of the autophagy related gene 13 (ATG13), which binds to the autophagous body LC3 / GABARAP, in order to more stably bind to the host organism and to increase the detection efficiency. HyD a hydrophobic domain was added to prepare a probe for detecting an autogranular body (FIG. 1).

Specifically, the nucleotides encoding the 20 amino acid sites (HyD) (SEQ ID NO: 4) at the N-terminal which is the hydrophobic domain of the phosphodiesterase 4 (ApPDE4) short-form of Aplysia are shown in SEQ ID NOS: 2 and 3 , And then digested with restriction enzymes NheI and HindIII, and inserted into pGFP-N3 vector to prepare pGFP-N3-HyD. In addition, the gene region coding for the LIR motif (SEQ ID NO: 8) of ATG13 was amplified using the primers of SEQ ID NOS: 5 to 7 in Table 1, followed by digestion with restriction enzymes HindIII and KpnI to obtain pGFP-N3-HyD vector (ATG13) -GFP (FIG. 2), in which the amino acid sequence of SEQ ID NO: 1 was labeled with GFP.

Sequences (5 '-> 3') Name of sequence SEQ ID NO: 2 CTAGGGCTAGCGCCACCATGCAGAAGCTGAATTTC HyD forward primer SEQ ID NO: 3 CGCCCAAGCTTACCGTCGCGGTTTTTCCC HyD reverse primer SEQ ID NO: 4 MQKLNFLSPLFNKNGKNRDG HyD amino acid sequence SEQ ID NO: 5 AATACCCATGATGACTTTGTTATCATAGACTTTAAACCAGCTT ATG13 forward primer 1 SEQ ID NO: 6 CGCCCAAGCTTGGGGGCAGCAGTGGCAATACCCATGATGACTTT ATG13 forward primer 2 SEQ ID NO: 7 GACGGTACCAATGTCATCTTTAGAAAAAGCTGGTTTAAAGTCTA ATG13 reverse primer SEQ ID NO: 8 GGSSGNTHDD FVMI DFKPAFSKDDI LIR motif of ATG13

Example  2. Autogenous body  For specificity verification mRFP -LC3 / GABARAP family  Vector production

mRFP (spectral variants monomeric red fluorescent protein) was amplified by PCR using primers set forth in SEQ ID NOs: 9 and 10 in Table 2, and then digested with restriction enzymes BamHI and NotI and inserted into the GFP of pGFP-C3 vector to obtain pmRFP -C3 vector was prepared. Then, the pmRFP-C3 vector was digested with restriction enzymes NheI and HindIII and inserted into the pcDNA3.1 vector to construct pcDNA3.1-mRFP.

GABARAP and GABARAPL2, which are involved in autophagy formation, were amplified by PCR followed by digestion with restriction enzymes HindIII and SalI and insertion into the pmRFP-C3 vector. LC3A, LC3C, and GABARAPL1 were also amplified in the same manner and then digested with restriction enzymes BamH1 and NotI and inserted into pcDNA3.1-mRFP vector. As a result, mRFP-LC3A, mRFP-LC3B, mRFP-LC3C, mRFP-GABARAP, mRFP-GABARAPL1 and mRFP-GABARAPL2, which are autophoretic substance specific markers, were produced.

Sequences (5 '-> 3') Name of sequence SEQ ID NO: 9 CGCGGATCCATGGCCTCCTCCGAGGAC mRFP forward primer for pmRFP-N3 SEQ ID NO: 10 ATAAGAATGCGGCCGCTTAGGCGCCGGTGGAGTG mRFP reverse primer for pmRFP-N3

Example  3. HyD - LIR ( ATG13 ) -GFP of Autogenous body  Detection confirmation

3-1. HyD - LIR ( ATG13 ) -GFP and Autogenous body Marker  Confirm co-localization

The autologous phagocyte-specific probe of the present invention In order to confirm whether or not the HyD-LIR (ATG13) -GFP was detected in an autologous phagocyte, the MEF cell line was transformed with the vectors of Examples 1 and 2 and then autophagy was induced to obtain LC3A, LC3B, LC3C , GABARAP, GABARAPL1 and GABARAPL2 and HyD-LIR (ATG13) -GFP were identified and quantified by fluorescence imaging.

Specifically, MEFs (mouse embryonic fibroblast) cell lines were cultured in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% (v / v) fetal bovine serum and penicillin / streptomycin under the conditions of 5% CO ₂ and 37 ° C . Then, HyD-LIR (ATG13) -GFP and mRFP-LC3A, mRFP-LC3B, mRFP-LC3C, mRFP-GABARAP, mRFP-GABARAPL1 or mRFP-GABARAPL2 prepared in Examples 1 and 2 were mixed with Lipofectamine 2000 , Carlsbad, Calif., USA) and incubated for 24 hours. Processing the characters, the incubation the rapamycin (rapamycin) and 10mM of NH ₄ Cl in 100 nM in MEFs (due to lysosomal degradation (inhibiting lysosomal degradation)) to lead to phagocytosis, which was incubated for 4 hours. Thereafter, at least 20 cells of live cells in a 5% (v / v) CO ₂ incubator at 37 ° C were randomly selected and the fluorescence images were analyzed using a confocal laser-scanning microscope Respectively.

As a result, the autoradiographic somatic-specific probe HyD-LIR (ATG13) -GFP of the present invention was identified as an autogranular somatic marker, mRFP-LC3A, mRFP-LC3B, mRFP-LC3C, mRFP-GABARAP, mRFP-GABARAPL1 and mRFP- co-localization (Fig. 3).

3-2. HyD - LIR ( ATG13 ) -GFP and Autogenous body Marker  co-localization quantification

Fluorescence images of Example 3-1 were analyzed for intracellular HyD-LIR (ATG13) -GFP and LC3 / GABARAP-positive autoradiographic spots in two channels using ZEN imaging software (Carl Zeiss) The co-localization of the probe and autoradiographic marker was quantitatively analyzed. Specifically, the ratio of probe positive mRFP-LC3 / GABARAP spots was calculated by dividing the number of spots co-localized by HyD-LIR (ATG13) -GFP-positive spots and LC3 / GABARAP-positive spots with the total number of LC3 / GABARAP- (Fig. 3 and Fig. 4). ≪ tb > < TABLE > Id = Table 3 Columns = 3 < tb > In addition, by measuring the average value of fluorescence intensity in autopoietic somatic or cytoplasm in at least 5 parts of autologous and cytoplasmic cells of one cell and quantifying the A / C ratio in randomly selected 20 or more cells, The ratio of the fluorescence intensity of the cell substrate (A / C) was determined, and the detection strength of the probe of the present invention in an autogranular body was confirmed (Table 3 and FIG. 5). All statistical data were calculated and plotted using GraphPad Prism 5 (GraphPad, Inc., La Jolla, Calif., USA).

Autophagosome / Cytosol ratio of the fluorescent intensity
(Sensor-positive mRFP-LC3 spots (ratio)) LIR protein LC3A LC3B LC3C GABARAP GABARAP-L1 GABARAP-L2 ATG13 4.89 ± 0.26
(0.96 + - 0.01) 2.56 ± 0.11
(0.86 + - 0.01) 5.09 ± 0.25
(0.95 + - 0.01) 4.21 + - 0.14
(0.98 ± 0.00) 4.88 ± 0.22
(0.99 ± 0.00) 4.54 ± 0.18
(0.99 ± 0.00)

The results show that the autoantibody-specific probe HyD-LIR (ATG13) -GFP of the present invention can be co-precipitated with autoradiographic marker mRFP-LC3A, mRFP-LC3C, mRFP-GABARAP, mRFP- GABARAPL1 and mRFP- LC3B, LC3A, GABARAP, GABARAPL1 and GABARAPL2 pro-apoptotic bodies were detectable in the probe of the present invention (Fig. 4). In addition, LC3A, LC3C, GABARAP, GABARAPL1 or GABARAPL2 positively co-localized with the predatory cells, indicating that LC3B, It was found that the detection effect was remarkably higher than that of the progenitor-predator (Fig. 5).

From the results of the above examples, HyD-LIR (ATG13) -GFP of the present invention is autospecific specific and specifically can detect LC3A, LC3C, GABARAP, GABARAPL1 or GABARAPL2 specifically, It can be used as a probe for detection.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> A PROBE FOR DETECTING AUTOPHAGOSOME AND USES THEREOF <130> PN1704-159 <160> 10 <170> KoPatentin 3.0 <210> 1 <211> 47 <212> PRT <213> Artificial Sequence <220> <223> HyD-LIR (ATG13) amino acid sequence <400> 1 Met Gln Lys Leu Asn Phe Leu Ser Pro Leu Phe Asn Lys Asn Gly Lys   1 5 10 15 Asn Arg Asp Gly Lys Leu Gly Gly Ser Ser Gly Asn Thr His Asp Asp              20 25 30 Phe Val Met Ile Asp Phe Lys Pro Ala Phe Ser Lys Asp Asp Ile          35 40 45 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> HyD forward primer <400> 2 ctagggctag cgccaccatg cagaagctga atttc 35 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HyD reverse primer <400> 3 cgcccaagct taccgtcgcg gtttttccc 29 <210> 4 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> HyD amino acid sequence <400> 4 Met Gln Lys Leu Asn Phe Leu Ser Pro Leu Phe Asn Lys Asn Gly Lys   1 5 10 15 Asn Arg Asp Gly              20 <210> 5 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ATG13 forward primer 1 <400> 5 aatacccatg atgactttgt tatcatagac tttaaaccag ctt 43 <210> 6 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ATG13 forward primer 2 <400> 6 cgcccaagct tgggggcagc agtggcaata cccatgatga cttt 44 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ATG13 reverse primer <400> 7 gacggtacca atgtcatctt tagaaaaagc tggtttaaag tcta 44 <210> 8 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> ATG13 LIR motif <400> 8 Gly Gly Ser Ser Gly Asn Thr His Asp Asp Phe Val Met Ile Asp Phe   1 5 10 15 Lys Pro Ala Phe Ser Lys Asp Asp Ile              20 25 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> mRFP forward primer <400> 9 cgcggatcca tggcctcctc cgaggac 27 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> mRFP reverse primer <400> 10 ataagaatgc ggccgcttag gcgccggtgg agtg 34

Claims (12)

A probe for detecting an autophagosome comprising an LIR (LC3-interacting region) site polypeptide of ATG13 (Autophagy related gene 13) and an N-terminal hydrophobic domain of ApPDE4 (Aplysia phosphodiesterase 4) short-form. 2. The probe of claim 1, wherein the LIR (LC3-interacting region) site of ATG13 comprises the amino acid sequence of SEQ ID NO: 8. 4. The probe of claim 1, wherein the N-terminal hydrophobic domain of ApPDE4 short-form comprises the amino acid sequence of SEQ ID NO: 4. 2. The method according to claim 1, further comprising the step of preparing a mixture of a coloring enzyme, a radioactive isotope, a chromophore, a luminescent material, a fluorescer, a magnetic resonance imaging material, super paramagnetic particles and ultrasuperparamagnetic particles A probe for detecting a self-contained body selected from the group consisting of: 2. The method according to claim 1, wherein the host is an autopoietic substance labeled with a green fluorescent protein (GFP), an enhanced green fluorescent protein (EGFP) or a modified red fluorescent protein (mRFP) Detection probe. The probe of claim 1, wherein the probe comprises the amino acid sequence of SEQ ID NO: 1. A composition for the detection of autophagic cells comprising the probe for the detection of an autologous phagocyte of claim 1. A composition for autologous phagocyte imaging comprising the probe of claim 1 as an active ingredient. A composition for the diagnosis of autophagy-related disease, comprising the probe for the detection of an autograft body according to claim 1. 10. The method of claim 9, wherein the autophorosis-related disease is selected from the group consisting of degenerative neurological diseases, cancer, lysosomal storage disorders, cardiomyopathy, senescence, type II programmed cell death, type 2 diabetes and bacterial infections. A composition for diagnosing predation-related diseases. 11. The method of claim 10, wherein the retinal nerve disease is selected from the group consisting of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, Pick's Disease, and amyotrophic lateral sclerosis ) - dementia complex. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt; 11. The method of claim 10, wherein the cancer is selected from the group consisting of lung cancer, liver cancer, colon cancer, pancreatic cancer, stomach cancer, breast cancer, ovarian cancer, kidney cancer, giant adenocarcinoma, papillary cancer, esophageal cancer, prostate cancer, brain cancer, skin cancer, osteosarcoma, Lymphoma, nasopharyngeal cancer, laryngeal cancer, adenocarcinoma, colon cancer, ureter cancer, gallbladder cancer, bladder cancer, testicular cancer, cervical cancer, endometrial cancer, choriocarcinoma, head and neck cancer, malignant melanoma, leukemia, multiple myeloma, And aplastic anemia. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt;

Images