KR102583910B1 - Composition for diagnosis and treatment of intractable epilepsy - Google Patents

Abstract

The present invention relates to a biomarker panel for diagnosing intractable epilepsy, and a diagnostic technology for intractable epilepsy using the same. More specifically, the present invention relates to a biomarker panel gene or protein for diagnosing intractable epilepsy, a diagnostic kit for detecting it, and a diagnostic method using the same, and to its use in preventing, improving, or treating intractable epilepsy.

Description

Composition for diagnosis and treatment of intractable epilepsy {Composition for diagnosis and treatment of intractable epilepsy}

The present invention relates to a biomarker panel for diagnosing intractable epilepsy, especially pediatric intractable epilepsy, a diagnostic technology for intractable epilepsy using the same, and a composition for preventing or treating intractable epilepsy. More specifically, the present invention relates to a biomarker panel gene or protein for diagnosing intractable epilepsy, a diagnostic kit for detecting the same, a diagnostic method using the same, and a use for preventing, improving, or treating intractable epilepsy.

Epilepsy is a group of chronic diseases in which some nerve cells generate excessive electricity in a short period of time, causing repeated seizures. It is a serious neurological disease accompanied by neurobiological, mental, cognitive, and social changes.

Epilepsy is the most common neurological disease, and approximately 0.5% to 1% of the world's population suffers from epilepsy. In addition, worldwide, approximately 45 new patients per 100,000 people occur every year, and in Korea, it is estimated that there are approximately 300,000 to 400,000 epilepsy patients, and it is reported that approximately 20,000 new epilepsy patients occur every year. It is becoming. In addition, 70% of all epilepsies begin in children and adolescents, and it is known that the incidence is particularly high in infancy. The incidence and prevalence are highest within the first year of life, then rapidly decrease, and show a U-shaped pattern with a sharp increase again in the elderly over 60 years of age, and the lifetime prevalence of experiencing seizures reaches 10-15%.

Among epilepsies, epilepsy that does not respond to antiepileptic drugs developed to date is called intractable epilepsy, and accounts for approximately 20% of all epilepsies. Causes of intractable epilepsy include malformations of cortical development such as focal cortical dysplasia (FCD), hemimegalencephaly (HME), and tuberous sclerosis complex (TSC). MCD), hippocampal sclerosis (HS), or Sturge Weber syndrome (SWS) are known.

Intractable epilepsy does not respond to currently existing anti-epileptic drugs and requires neurosurgical treatment to remove brain lesions to control epilepsy. Therefore, cerebral cortical developmental abnormalities or There is an urgent need to develop molecular biological diagnostic technology specific to hippocampal sclerosis.

Meanwhile, abnormal activation of the PI3K-AKT-mTOR signaling pathway is well known in several developmental neurological disorders. When receptor tyrosine kinase (RTK) is activated by an external stimulus such as insulin or growth hormone, it activates the phosphoinositide 3-kinase (PI3K) complex, which can phosphorylate phosphoinositides. . Phosphorylated phosphoinositide moves to the cell membrane, where protein kinase B, such as AKT3 (v-akt murine thymoma viral oncogene homolog 3), is activated by PDK1 (pyruvate dehydrogenase kinase, isozyme 1). promote Activated AKT3 causes activation of the mTOR signaling pathway through TSC1/TSC2 (Tuberous sclerosis proteins 1 and 2) and Rheb (Ras homolog enriched in brain)-GTPase. mTOR activation affects many processes such as cell differentiation and migration as well as intracellular protein synthesis (translation) and metabolism through 4E-BP (4E binding protein 1) and S6K1 (ribosomal protein S6 kinase 1). It's crazy.

However, there is no specific known relationship between the genes involved in the PI3K-AKT-mTOR signaling pathway and the overall diagnosis of intractable epilepsy.

Domestic Patent Publication 2007-0116555 (published on December 10, 2007) US Patent Publication 2010-0088778 (published on 2010.04.08)

Accordingly, the present inventors analyzed brain tissue samples from patients undergoing surgery for intractable epilepsy due to focal cortical dysplasia (FCD), unilateral megalencephaly (HME), hippocampal sclerosis (HS), or Sturge Weber syndrome (SWS), and found that PI3K- It was confirmed that brain somatic mutations specifically exist in genes involved in the AKT-mTOR signaling pathway, and it was confirmed that these mutations can be used as a biomarker panel to diagnose intractable epilepsy. Furthermore, the present inventors confirmed that introducing the above variant into cells can cause intractable epilepsy due to hyperactivation of mTOR, resulting in focal cortical dysplasia (FCD), tuberous sclerosis, unilateral megaencephalopathy (HME), and hippocampal sclerosis (HS). ) or the prevention, improvement or treatment of intractable epilepsy caused by Sturge Weber Syndrome (SWS), and the diseases that cause these intractable epilepsies, such as focal cortical dysplasia (FCD), tuberous sclerosis (TSC), and unilateral megalencephaly (HME). The present invention was completed by developing a use for preventing, improving, or treating hippocampal sclerosis (HS) or Sturge Weber Syndrome (SWS).

The present invention provides a biomarker panel for diagnosing intractable epilepsy or the disease causing it, and a diagnostic technology for intractable epilepsy using the same. Specifically, the causative disease of the intractable epilepsy is malformations of the cerebral cortex such as focal cortical dysplasia (preferably FCD type II), hemimegalencephaly (HME), and tuberous sclerosis complex (TSC). Cortical Developments (MCD), hippocampal sclerosis (HS), or Sturge Weber syndrome (SWS).

More specifically, one object of the present invention relates to a diagnostic kit for intractable epilepsy, which includes an agent capable of detecting mutations in genes or proteins involved in the PI3K-AKT-mTOR signaling pathway.

Another object of the present invention is to provide a method for diagnosing intractable epilepsy, which includes detecting mutations in genes or proteins involved in the PI3K-AKT-mTOR signaling pathway from a sample of an individual using the diagnostic kit. .

Another object of the present invention is to provide variants of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway.

Another object of the present invention is to provide a biomarker panel for diagnosing intractable epilepsy, including variants of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway.

Another object of the present invention is to provide a composition for inducing intractable epilepsy containing a variant of a gene or protein involved in the PI3K-AKT-mTOR signaling pathway.

Another object of the present invention is to provide animals with induced refractory epilepsy into which variants of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway have been introduced.

Another object of the present invention relates to a method of inducing refractory epilepsy, which includes introducing a variant of a gene or protein involved in the PI3K-AKT-mTOR signaling pathway into cells in vitro.

Another object of the present invention is to treat intractable epilepsy caused by brain somatic mutations in genes related to the PI3K-AKT-mTOR signaling pathway, or focal cortical dysplasia (FCD), unilateral megaencephalopathy (HME), hippocampal sclerosis (HS), or sterilization. To provide a pharmaceutical composition or food composition for preventing, improving, or treating intractable epilepsy caused by SWS syndrome.

A further object of the present invention is to treat intractable epilepsy caused by brain somatic mutations in genes related to the PI3K-AKT-mTOR signaling pathway, or focal cortical dysplasia (FCD), unilateral megaencephalopathy (HME), hippocampal sclerosis (HS), or sterilization. To provide a kit or method for preventing, improving, or treating intractable epilepsy caused by SWS.

The present invention relates to refractory epilepsy, or from samples of patients undergoing surgery for refractory epilepsy due to its causative diseases, such as focal cortical dysplasia (FCD), unilateral megalencephaly (HME), hippocampal sclerosis (HS), or Sturge Weber Syndrome (SWS). As a result of analyzing the base sequences of genes involved in the PI3K-AKT-mTOR signaling pathway, it was confirmed that somatic mutations specific to brain lesions existed in 21 patients (Table 1).

protein base sequence variation protein mutations mTOR C616T R206C mTOR G1871A R624H mTOR T4348G Y1450D mTOR T4447C C1483R mTOR G5126A R1709H mTOR C5930A T1977K mTOR C6577T R2193C mTOR C6644T S2215F mTOR T7280C L2427P mTOR T7280A L2427Q TSC1 C64T R22W TSC1 C610T R204C TSC1 G2432T R811L TSC2 G4639A V1547I AKT3 G740A R247H PIK3CA G3052A D1018N

In a specific embodiment of the present invention, a mutant construct (mTOR mutant construct) capable of expressing each of the above somatic mutations was prepared and transfected into cells, and as a result, the S6K protein, which shows changes in mTOR protein activity It was confirmed that phosphorylation increased and that phosphorylation decreased after rapamycin treatment. These results show that the mTOR, TSC1, TSC2, AKT3, and PIK3CA genes or proteins that have undergone the above mutations can activate the mTOR signaling system, thereby suggesting that they can cause epilepsy.

mTOR, TSC1, TSC2, AKT3, and PIK3CA genes or proteins containing the above mutations are provided as a biomarker panel gene or protein for diagnosing intractable epilepsy. Additionally, the present invention provides a diagnostic kit for detecting the biomarker panel genes or proteins from a sample of an individual and a diagnostic method using the same. Furthermore, the present invention provides a technology for constructing an epilepsy model by inducing intractable epilepsy using the genetic mutation and protein mutation.

The purpose of the present invention is to prevent, improve, or treat intractable epilepsy and prevent cortical developmental malformations such as focal cortical dysplasia, unilateral megaencephalopathy, and tuberous sclerosis, hippocampal sclerosis, or Sturge Weber Syndrome, which are diseases that cause these intractable epilepsies. , to provide a composition, kit, or method for improvement or treatment. Preferably, the intractable epilepsy relates to the use of preventing, treating and/or improving intractable epilepsy associated with brain somatic genetic mutations.

Specifically, the intractable epilepsy according to the present invention is epilepsy caused by brain somatic genetic mutation of genes involved in the PI3K-AKT-mTOR signaling pathway, or cerebral cortical development such as focal cortical dysplasia, unilateral megaencephalopathy, and tuberous sclerosis. Includes epilepsy due to malformation, hippocampal sclerosis, or Sturge Weber Syndrome.

Hereinafter, the present invention will be described in more detail.

In the present invention, the term "epilepsy" refers to a chronic disease in which some of the nerve cells generate excessive electricity in a short period of time, causing repeated seizures, and "intractable epilepsy" refers to any anti-epileptic disease developed to date. This refers to epilepsy that does not respond to drugs. The intractable epilepsy includes malformations of cortical development (MCD) such as focal cortical dysplasia (FCD), hemimegalencephaly (HME) and tuberous sclerosis complex (TSC), and hippocampus. It may be intractable epilepsy caused by hippocampal sclerosis (HS) or Sturge Weber syndrome (SWS).

As used herein, the term “diagnosis” means confirming the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis may mean confirming whether intractable epilepsy has occurred, or further confirming whether the disease has progressed or worsened.

In the present invention, the term "diagnostic marker, marker for diagnosis, or diagnosis marker" refers to a substance differentially present in samples of patients with intractable epilepsy, which can be used to diagnose the onset of intractable epilepsy by detecting these substances. It can mean a substance that can be used. For the purpose of the present invention, the diagnostic marker of the present invention may refer to mutant genes or mutant proteins of mTOR, TSC1, TSC2, AKT3, and PIK3CA that exist specifically in brain lesions of patients with intractable epilepsy.

As used herein, the term “biomarker panel” includes one or more of the biomarkers disclosed herein. These biomarker panels can be detected using a detection agent (or detection reagent) that can directly or indirectly bind or associate with the biomarker proteins or genes present in the sample.

In the present invention, the term "focal cortical dysplasia (FCD)" means that during the normal development of the cerebral cortex, neurons move from one area of the brain to another area to form a layered structure, but due to inappropriate movement of neurons, It refers to a disease that occurs due to failure to form a normal layer structure. This may be a case where some areas of the entire brain do not reach normal development, and it may be a disease that occurs when some cells pathologically exhibit abnormal cell shapes even in areas that appear to be normally developed on radiological images. These focal cortical dysplasias occur sporadically in the cerebrum, show dysmorphic neurons, and may be accompanied by destruction of the lamination of the affected area.

Brain somatic genetic mutations associated with intractable epilepsy according to the present invention may be variants of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway, for example, mTOR, TSC1, TSC2, AKT3 and PIK3CA genes or these genes. It may be an amino acid mutation of the corresponding protein. In the present invention, the term "brain somatic genetic mutation" means, for example, a mutation in the base sequence of the gene of SEQ ID NO: 1, which is the wild-type mTOR gene.

In addition, the mTOR mutant protein in which the amino acid sequence is mutated may contain additional mutations within the range that does not overall change the activity of the molecule. Amino acid exchanges in proteins and peptides that do not overall alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). In some cases, the mTOR mutant protein may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc.

In the present invention, the wild-type mTOR gene sequence is shown as SEQ ID NO: 1, and the mTOR protein sequence is shown as SEQ ID NO: 2. In addition, the wild-type TSC1 gene sequence is shown as SEQ ID NO: 3, and the TSC1 protein sequence is shown as SEQ ID NO: 4. In addition, the wild-type TSC2 gene sequence is shown as SEQ ID NO: 5, and the TSC2 protein sequence is shown as SEQ ID NO: 6. In addition, the wild-type AKT3 gene sequence is shown as SEQ ID NO: 7, and the AKT3 protein sequence is shown as SEQ ID NO: 8. In addition, the wild-type PIK3CA gene sequence is shown as SEQ ID NO: 9, and the PIK3CA protein sequence is shown as SEQ ID NO: 10.

In the present invention, the term “mTOR mutation gene” refers to a mutation in the base sequence of the gene of SEQ ID NO: 1, which is the wild-type mTOR gene. Preferably, cytosine (C) at position 616 of the base sequence of SEQ ID NO: 1 is substituted with thymine (T), guanine (G) at position 1871 is substituted with adenine (A), and thymine (T) at position 4348. This is substituted with guanine (G), thymine (T) at position 4447 is substituted with cytosine (C), guanine (G) at position 5126 is substituted with adenine (A), and cytosine (C) at position 5930 is substituted with adenine. (A), cytosine (C) at position 6577 is substituted with thymine (T), cytosine (C) at position 6644 is substituted with thymine (T), thymine (T) at position 7280 is substituted with adenine (A) ), and substitution of thymine (T) at position 7280 with cytosine (C).

In the present invention, the term “mTOR mutant protein” refers to a mutation in the amino acid sequence of the protein of SEQ ID NO: 2, which is the wild-type mTOR protein. Preferably, arginine (R) at position 206 of the amino acid sequence of SEQ ID NO: 2 is substituted with cysteine (C), arginine (R) at position 624 is substituted with histidine (H), and tyrosine (Y) at position 1450 is substituted with aspartic acid. (D), cysteine (C) at position 1483 is substituted with arginine (R), arginine (R) at position 1709 is substituted with histidine (H), and threonine (T) at position 1977 is substituted with lysine (K). Substitutions, arginine (R) at position 2193 is substituted with cysteine (C), serine (S) at position 2215 is substituted with phenylalanine (F), leucine (L) at position 2427 is substituted with proline (P), and position 2427. It may be a protein composed of an amino acid sequence containing one or more mutations selected from the group consisting of substitution of leucine (L) at position glutamine (Q).

In the present invention, the term “TSC1 mutated gene” refers to a mutation in the base sequence of the gene of SEQ ID NO: 3, which is the wild-type TSC1 gene. Preferably, in the base sequence of SEQ ID NO: 3, the 64th cytosine (C) is substituted with thymine (T), the 610th cytosine (C) is substituted with thymine (T), and the 2432nd guanine (G) is substituted with thymine ( T) may be a gene consisting of a base sequence containing one or more mutations selected from the group consisting of substitutions.

In the present invention, the term "TSC1 mutant protein" refers to a mutation in the amino acid sequence of the protein of SEQ ID NO: 4, which is the wild-type TSC1 protein. Preferably, in the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811. This may be a protein consisting of an amino acid sequence containing one or more mutations selected from the group consisting of substitution with leucine (L).

In the present invention, the term "TSC2 mutant gene" refers to a mutation in the base sequence of the gene of SEQ ID NO: 5, which is the wild-type TSC2 gene. Preferably, in the base sequence of SEQ ID NO: 5, it may be a gene consisting of a base sequence containing a substitution of guanine (G) at position 4639 with adenine (A).

In the present invention, the term “TSC2 mutant protein” refers to a mutation in the amino acid sequence of the protein of SEQ ID NO: 6, which is the wild-type TSC2 protein. Preferably, in the amino acid sequence of SEQ ID NO: 6, it may be a protein consisting of an amino acid sequence including substitution of valine (V) at position 1547 with isoleucine (I).

In the present invention, the term "AKT3 mutant gene" refers to a mutation in the base sequence of the gene of SEQ ID NO: 7, which is the wild-type AKT3 gene. Preferably, in the base sequence of SEQ ID NO: 7, the 740th position of guanine (G) may be a gene consisting of a base sequence containing adenine (A) substitution.

In the present invention, the term "AKT3 mutant protein" refers to a mutation in the amino acid sequence of the protein of SEQ ID NO: 8, which is the wild-type AKT3 protein. Preferably, in the amino acid sequence of SEQ ID NO: 8, it may be a protein composed of an amino acid sequence including the substitution of arginine (R) at position 247 with histidine (H).

In the present invention, the term "PIK3CA mutant gene" refers to a mutation in the base sequence of the gene of SEQ ID NO: 9, which is the wild-type PIK3CA gene. Preferably, in the base sequence of SEQ ID NO: 9, the gene may be a gene consisting of a base sequence containing a substitution of guanine (G) at position 3052 with adenine (A).

In the present invention, the term "PIK3CA mutant protein" refers to a mutation in the amino acid sequence of the protein of SEQ ID NO: 10, which is the wild-type PIK3CA protein. Preferably, in the amino acid sequence of SEQ ID NO: 10, it may be a protein composed of an amino acid sequence including substitution of aspartic acid (D) at position 1018 with asparagine (N).

Additionally, a mutant protein may contain additional mutations within the range that does not overall change the activity of the molecule. Amino acid exchanges in proteins and peptides that do not overall alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). In some cases, the mTOR mutant protein may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc.

For example, in the present invention, in the base sequence of SEQ ID NO: 1, cytosine (C) at position 616 is substituted with thymine (T), guanine (G) at position 1871 is substituted with adenine (A), and position 4348. Thymine (T) is substituted with guanine (G), thymine (T) at position 4447 is substituted with cytosine (C), guanine (G) at position 5126 is substituted with adenine (A), cytosine at position 5930 (C) is substituted with adenine (A), cytosine (C) at position 6577 is substituted with thymine (T), cytosine (C) at position 6644 is substituted with thymine (T), and thymine (T) at position 7280 ) is replaced with adenine (A), and thymine (T) at position 7280 is replaced with cytosine (C); In the base sequence of SEQ ID NO: 3, the 64th cytosine (C) is substituted with thymine (T), the 610th cytosine (C) is substituted with thymine (T), and the 2432nd guanine (G) is substituted with thymine (T). substitution; In the base sequence of SEQ ID NO: 5, guanine (G) at position 4639 is substituted with adenine (A); In the base sequence of SEQ ID NO: 7, guanine (G) at position 740 is substituted with adenine (A); and an agent capable of detecting the substitution of guanine (G) at position 3052 with adenine (A) in the base sequence of SEQ ID NO: 9. It relates to a diagnostic kit for intractable epilepsy.

In a preferred example, the agent capable of detecting the substitution may be a primer, probe, or antisense nucleic acid specific to each substitution site.

As another example, the present invention includes the steps of (a) processing a sample of an individual with the diagnostic kit,

(b) In the base sequence of SEQ ID NO: 1, cytosine (C) at position 616 is substituted with thymine (T), guanine (G) at position 1871 is substituted with adenine (A), and thymine at position 4348 ( T) is substituted with guanine (G), thymine (T) at position 4447 is substituted with cytosine (C), guanine (G) at position 5126 is substituted with adenine (A), cytosine (C) at position 5930 This is substituted with adenine (A), cytosine (C) at position 6577 is substituted with thymine (T), cytosine (C) at position 6644 is substituted with thymine (T), and thymine (T) at position 7280 is substituted with adenine. (A), and thymine (T) at position 7280 is replaced with cytosine (C); In the base sequence of SEQ ID NO: 3, the 64th cytosine (C) is substituted with thymine (T), the 610th cytosine (C) is substituted with thymine (T), and the 2432nd guanine (G) is substituted with thymine (T). substitution; In the base sequence of SEQ ID NO: 5, guanine (G) at position 4639 is substituted with adenine (A); In the base sequence of SEQ ID NO: 7, guanine (G) at position 740 is substituted with adenine (A); And in the base sequence of SEQ ID NO: 9, detecting in a sample of an individual a biomarker panel containing one or more substitutions selected from the group consisting of substitution of guanine (G) at position 3052 with adenine (A), and

(c) comprising determining refractory epilepsy when a biomarker panel containing one or more of the substitutions is detected,

This relates to a method of providing information for diagnosing intractable epilepsy.

As another example, in the present invention, in the amino acid sequence of SEQ ID NO: 2, arginine (R) at position 206 is substituted with cysteine (C), arginine (R) at position 624 is substituted with histidine (H), and tyrosine (Y at position 1450) ) is substituted with aspartic acid (D), cysteine (C) at position 1483 is substituted with arginine (R), arginine (R) at position 1709 is substituted with histidine (H), and threonine (T) at position 1977 is substituted with arginine (R). Substituted for lysine (K), Arginine (R) at position 2193 is substituted for Cysteine (C), Serine (S) at position 2215 is substituted for Phenylalanine (F), Leucine (L) at position 2427 is substituted for Proline (P). substitution, and leucine (L) at position 2427 is substituted for glutamine (Q); In the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811 is substituted with leucine ( Replaced with L); In the amino acid sequence of SEQ ID NO: 6, valine (V) at position 1547 is replaced with isoleucine (I); In the amino acid sequence of SEQ ID NO: 8, arginine (R) at position 247 is substituted with histidine (H); and an agent capable of detecting the substitution of aspartic acid (D) at position 1018 with asparagine (N) in the amino acid sequence of SEQ ID NO: 10.

In a preferred example, the agent capable of detecting the substitution may be an antibody or aptamer specific to each substitution site.

As another example, the present invention includes the steps of (a) processing a sample of an individual with the diagnostic kit,

(b) In the amino acid sequence of SEQ ID NO: 2, arginine (R) at position 206 is substituted with cysteine (C), arginine (R) at position 624 is substituted with histidine (H), and tyrosine (Y) at position 1450 is substituted with as. Substituted with partic acid (D), Cysteine (C) at position 1483 substituted with Arginine (R), Arginine (R) at position 1709 substituted with Histidine (H), Threonine (T) at position 1977 substituted with Lysine (K) ), arginine (R) at position 2193 is substituted with cysteine (C), serine (S) at position 2215 is substituted with phenylalanine (F), leucine (L) at position 2427 is substituted with proline (P), and Leucine (L) at position 2427 is replaced with glutamine (Q); In the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811 is substituted with leucine ( Replaced with L); In the amino acid sequence of SEQ ID NO: 6, valine (V) at position 1547 is replaced with isoleucine (I); In the amino acid sequence of SEQ ID NO: 8, arginine (R) at position 247 is substituted with histidine (H); And in the amino acid sequence of SEQ ID NO: 10, detecting in a sample of an individual a biomarker panel containing one or more substitutions selected from the group consisting of substitution of aspartic acid (D) at position 1018 with asparagine (N); and

(c) comprising determining refractory epilepsy when a biomarker panel containing one or more of the substitutions is detected,

This relates to a method of providing information for diagnosing intractable epilepsy.

In a preferred example, the sample may be a brain tissue sample from an individual.

As another example, in the present invention, in the base sequence of SEQ ID NO: 1, cytosine (C) at position 616 is substituted with thymine (T), guanine (G) at position 1871 is substituted with adenine (A), and position 4348. Thymine (T) is substituted with guanine (G), thymine (T) at position 4447 is substituted with cytosine (C), guanine (G) at position 5126 is substituted with adenine (A), cytosine at position 5930 (C) is substituted with adenine (A), cytosine (C) at position 6577 is substituted with thymine (T), cytosine (C) at position 6644 is substituted with thymine (T), and thymine (T) at position 7280 ) is replaced with adenine (A), and thymine (T) at position 7280 is replaced with cytosine (C); In the base sequence of SEQ ID NO: 3, the 64th cytosine (C) is substituted with thymine (T), the 610th cytosine (C) is substituted with thymine (T), and the 2432nd guanine (G) is substituted with thymine (T). substitution; In the base sequence of SEQ ID NO: 5, guanine (G) at position 4639 is substituted with adenine (A); In the base sequence of SEQ ID NO: 7, guanine (G) at position 740 is substituted with adenine (A); And in the base sequence of SEQ ID NO: 9, in a gene consisting of a base sequence containing one or more substitutions selected from the group consisting of one or more substitutions selected from the group consisting of substitution of guanine (G) at position 3052 with adenine (A). It's about.

As another example, in the present invention, in the amino acid sequence of SEQ ID NO: 2, arginine (R) at position 206 is substituted with cysteine (C), arginine (R) at position 624 is substituted with histidine (H), and tyrosine (Y at position 1450) ) is substituted with aspartic acid (D), cysteine (C) at position 1483 is substituted with arginine (R), arginine (R) at position 1709 is substituted with histidine (H), and threonine (T) at position 1977 is substituted with arginine (R). Substituted for lysine (K), Arginine (R) at position 2193 is substituted for Cysteine (C), Serine (S) at position 2215 is substituted for Phenylalanine (F), Leucine (L) at position 2427 is substituted for Proline (P). substitution, and leucine (L) at position 2427 is substituted for glutamine (Q); In the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811 is substituted with leucine ( Replaced with L); In the amino acid sequence of SEQ ID NO: 6, valine (V) at position 1547 is replaced with isoleucine (I); In the amino acid sequence of SEQ ID NO: 8, arginine (R) at position 247 is substituted with histidine (H); And in the amino acid sequence of SEQ ID NO: 10, it relates to a protein consisting of an amino acid sequence containing one or more substitutions selected from the group consisting of substitution of aspartic acid (D) at position 1018 with asparagine (N).

As another example, the present invention relates to a biomarker panel for diagnosing intractable epilepsy, including the mutant protein or mutant gene.

As used herein, the term "agent capable of detecting a substitution" used in relation to the detection of a base sequence substitution refers to detecting a substitution (variation) on the base sequences of mTOR, TSC1, TSC2, AKT3 and PIK3CA in a sample of an individual. means a substance that can be used for As a specific example, it may be a primer, probe, antisense oligonucleotide, etc. that can bind specifically or complementary to each base substitution site provided in the present invention. The primer, probe, or antisense nucleic acid may bind specifically to each base substitution site and not specifically bind to the wild-type sequence.

At this time, complementary binding means that the antisense nucleic acid is sufficiently complementary to selectively hybridize to the mutation site target under predetermined hybridization or annealing conditions, preferably physiological conditions, and is substantially complementary. It has a meaning that includes both (substantially complementary) and completely complementary, and preferably means completely complementary.

In one embodiment, the agent used herein to detect the mutation site of each gene may be an antisense nucleic acid. The term “antisense nucleic acid” refers to a nucleic acid-based molecule that has a complementary sequence to the target mutation site and can form a dimer with the mutation site, and can be used to detect the genetic biomarker panel herein. .

In another embodiment, the agent used to detect the mutation site of each biomarker panel gene herein may be a primer pair or probe, and the base sequences of mTOR, TSC1, TSC2, AKT3, and PIK3CA mutation genes are disclosed herein. Therefore, a person skilled in the art can design primers or probes that specifically amplify specific regions of these genes based on the above sequences.

The term "primer" refers to a nucleic acid sequence with a short free 3' hydroxyl group that can form a base pair with a complementary template and functions as a starting point for copying the template strand. refers to 7 to 50 nucleic acid sequences. Primers are usually synthetic, but can also be used from naturally occurring nucleic acids. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but just needs to be sufficiently complementary to hybridize with the template. Primers are used to initiate polymerization (i.e., DNA synthesis in the presence of four different nucleoside triphosphates and reagents for DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. In the present invention, epilepsy can be diagnosed by performing PCR amplification using sense and antisense primers of the mTOR base sequence region. PCR conditions and lengths of sense and antisense primers are known in the art. Modifications can be made based on known methods.Preferably, the primer of the present invention may be a primer capable of amplifying the mutation site of the gene provided herein.

As another example, the agent used herein to detect the mutation site of each biomarker panel gene may be a probe. The term "probe" refers to a nucleic acid fragment, such as RNA or DNA, of as short as a few bases or as long as several hundred bases, that can specifically bind to mRNA and is labeled to confirm the presence or absence of a specific mRNA. You can. Probes may be manufactured in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, etc. In the present invention, hybridization can be performed using a probe complementary to the mTOR genetic mutation, and diagnosis can be made based on whether hybridization exists. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.

The primer or probe of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences may incorporate additional features that do not change their basic properties. Examples of additional features that can be incorporated include, but are not limited to, methylation, capping, substitution of one or more nucleic acids with homologs, and modifications between nucleic acids.

As used herein, the term “agent capable of detecting a substitution” used in relation to the detection of a substitution in an amino acid sequence refers to a substance that can be used to detect the mutation site of each biomarker panel protein in a patient's sample. Preferably, it may be an antibody or aptamer specific to a protein consisting of an amino acid sequence containing the mutation provided herein. Preferably, the antibody may be a monoclonal antibody or polyclonal antibody.

The term “antibody” is a term known in the art and refers to a specific protein molecule directed against an antigenic site. For the purpose of the present invention, an antibody refers to an antibody that specifically binds to the mutation site of each biomarker panel protein of the present invention, and such antibody is obtained by cloning each mutant gene into an expression vector according to a conventional method. Thus, mutant proteins encoded by each of the above mutant genes can be obtained, and the obtained mutant proteins can be produced by conventional methods. This also includes partial peptides that can be made from the mutant protein, and the partial peptide of the present invention contains at least 7 amino acids, preferably 9 amino acids, and more preferably 12 or more amino acids. The form of the antibody of the present invention is not particularly limited, and as long as it is a polyclonal antibody, monoclonal antibody, or has antigen binding properties, a portion thereof is included in the antibody of the present invention, and all immunoglobulin antibodies are included. Furthermore, the antibodies of the present invention also include special antibodies such as humanized antibodies.

The antibody used for detection of the diagnostic biomarker for intractable epilepsy of the present invention is a functional fragment of the antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. Includes. Functional fragments of antibody molecules refer to fragments that possess at least an antigen-binding function and include Fab, F(ab'), F(ab') 2, and Fv.

Additionally, an agent capable of detecting the biomarker panel genes or proteins of the present invention may be provided in the form of a kit. The kit of the present invention can detect biomarker panel genes or proteins. The kit of the present invention may include primers, probes, antisense nucleic acids for detecting each biomarker panel gene, or antibodies or aptamers for detecting each biomarker panel protein, and in addition, one type or aptamer suitable for the analysis method. Additional other component compositions, solutions, or devices may be included.

As a specific example, the kit for detecting a biomarker panel gene in the present invention may be a kit for diagnosing intractable epilepsy that includes the essential elements needed to perform a DNA chip. The DNA chip kit may include a substrate to which an agent for detecting a biomarker panel gene is attached, reagents, agents, enzymes, etc. for producing a fluorescent label probe. Additionally, the substrate may include an agent for detecting a quantitative control gene or a fragment thereof. Additionally, a kit for detecting a biomarker panel gene may be a kit containing the essential elements needed to perform PCR. In addition to each primer pair specific for the mTOR variant gene, the PCR kit contains test tubes or other suitable containers, reaction buffer (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerase, and It may contain the same enzyme, DNase, RNAse inhibitor, DEPC-water, sterilized water, etc. It may also include a pair of primers specific to the gene used as a quantitative control. Preferably, it may be a multiplex PCR kit that can simultaneously amplify and analyze each biomarker panel gene through multiplex PCR.

As another specific example, the kit for detecting a biomarker panel protein in the present invention may include a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate, etc. for immunological detection of antibodies. You can. In the above, the substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, and a glass slide glass, and the coloring enzyme may be peroxidase or alkaline phosphatase. Alkaline phosphatase can be used, the fluorescent substance can be FITC, RITC, etc., and the coloring substrate solution is ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid). ) or OPD (o-phenylenediamine) or TMB (tetramethyl benzidine) may be used.

Herein, in the method of detecting a biomarker panel from a sample of an individual, isolation of genomic DNA or total protein from the sample of an individual can be performed using a known process.

In the present invention, the term “sample of an individual” includes samples such as tissues and cells that can detect biomarker panel genes or proteins. Preferably, it may be a brain tissue sample, but is not limited thereto.

In one embodiment, a method of detecting a biomarker panel gene from a sample of an individual may be performed by a method comprising amplifying nucleic acid from a sample of a patient, and determining the base sequence of the amplified nucleic acid. .

Specifically, the step of amplifying the nucleic acid includes polymerase chain reaction (PCR), multiplex PCR, touchdown PCR, hot start PCR, nested PCR, and booster PCR. , real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), inverse polymerase chain reaction, vectorette ) can be performed by PCR, thermal asymmetric interlaced PCR (TAIL-PCR), ligase chain reaction, repair chain reaction, transcription-mediated amplification, self-maintaining sequence cloning, or selective amplification of the target sequence. .

In addition, the step of determining the base sequence of the amplified nucleic acid includes Sanger sequencing, Maxam-Gilbert sequencing, Shotgun sequencing, pyrosequencing, hybridization by microarray, and allele-specific It can be performed by allele specific PCR (PCR), dynamic allele-specific hybridization (DASH), PCR extension analysis, TaqMan technology, automated sequencing, or next-generation sequencing. Next-generation sequencing can be performed using a sequencing system widely used in the art, such as Roche's 454 GS FLX, Illumina's Genome Analyzer, and Applied Biosystems' SOLid Platform.

As another example, a method of detecting a biomarker panel protein from a patient's sample includes Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, and Ouchterony immunodiffusion using an antibody that specifically detects the corresponding amino acid mutation. , rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip, etc., but is not limited to these. Through the above analysis methods, the antigen-antibody complex between the mutant protein and the antibody against it can be identified, and the antigen-antibody complex between the mutant protein and the antibody against it can be determined to diagnose intractable epilepsy.

As used herein, “antigen-antibody complex” refers to a combination of a mutant protein and an antibody specific to it, and the formation of an antigen-antibody complex can be measured through the signal of a detection label.

These detection labels may be selected from the group consisting of enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules and radioisotopes, but are not necessarily limited thereto. If enzymes are used as detection labels, available enzymes include β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, peroxidase or alkaline phosphatase, acetylcholine. Terase, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofructokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphophenolpyruvate deca Examples include voxylase, β-latamase, etc., but are not limited thereto. Fluorescent substances include, but are not limited to, fluorescein, isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, α-phthaldehyde, and fluorescamine. Ligands include, but are not limited to, biotin derivatives. Luminescent substances include, but are not limited to, acridinium ester, luciferin, luciferase, etc. Microparticles include, but are not limited to, colloidal gold and colored latex. Redox molecules include ferrocene, ruthenium complex, viologen, quinone, Ti ion, Cs ion, diimide, 1,4-benzoquinone, hydroquinone, K ₄ W(CN) ₈ , [Os(bpy) ₃ ] ²⁺ , [RU(bpy) ₃ ] ²⁺ , [MO(CN) ₈ ] ^4-, etc., but are not limited thereto. Radioisotopes include, but are not limited to ^{, 3} H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, 51 Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ I, ¹³¹ I, ¹⁸⁶ Re, etc. .

In one embodiment, the antigen-antibody complex between the biomarker panel protein and the antibody for the protein is measured using the ELISA method. ELISA is a direct ELISA using a labeled antibody that recognizes an antigen attached to a solid support, an indirect ELISA using a labeled antibody that recognizes a capture antibody in a complex of an antibody recognizing an antigen attached to a solid support, and an indirect ELISA using a labeled antibody that recognizes a capture antibody in a complex of an antibody recognizing an antigen attached to a solid support. Direct sandwich ELISA using another labeled antibody that recognizes an antigen in a complex of an antibody and antigen, reacted with another antibody that recognizes an antigen in a complex of an antibody and an antigen attached to a solid support, and then using a labeled antibody that recognizes this antibody It includes a variety of ELISA methods, including indirect sandwich ELISA using secondary antibodies. More preferably, after attaching an antibody to a solid support and reacting the sample, attaching a labeled antibody that recognizes the antigen of the antigen-antibody complex to enzymatically develop color, or using an antibody that recognizes the antigen of the antigen-antibody complex. It is detected by a sandwich ELISA method in which a labeled secondary antibody is attached and color is developed enzymatically. By checking the formation of a complex between a biomarker panel protein and an antibody, it is possible to determine whether incurable epilepsy has occurred.

In another embodiment, Western blot using one or more antibodies against biomarker panel proteins can be used. For example, the entire protein can be separated from the sample, subjected to electrophoresis to separate the proteins according to size, and then transferred to a nitrocellulose membrane to react with antibodies. By checking the generated antigen-antibody complex using a labeled antibody, the amount of mutant protein produced by the expression of the mutant gene can be confirmed, thereby confirming the presence of incurable epilepsy. The detection method may be performed by examining the antigen-antibody complex between the mutant protein and the antibody against it.

Additionally, as another example, a protein chip may be used in which one or more antibodies against a biomarker panel protein are arranged at designated positions on a substrate and immobilized at high density. The method of analyzing a sample using a protein chip is to separate the protein from the sample, hybridize the isolated protein with the protein chip to form an antigen-antibody complex, read it, and confirm the presence of the protein, thereby preventing incurable epilepsy. You can check whether the disease has occurred.

Through the above detection methods, when an mTOR mutant gene or mTOR mutant protein is detected, incurable epilepsy caused by a malformation of the cerebral cortex can be diagnosed.

As another example, the present invention provides a technology for constructing an epilepsy model by inducing intractable epilepsy using the genetic mutation and protein mutation.

More specifically, as an example, the present invention relates to a composition for inducing intractable epilepsy, comprising a mutant gene or mutant protein of mTOR, TSC1, TSC2, AKT3, and/or PIK3CA.

As another example, the present invention relates to animals induced with intractable epilepsy into which the mutant genes or mutant proteins of mTOR, TSC1, TSC2, AKT3 and/or PIK3CA are introduced.

As another example, the present invention relates to a method of inducing refractory epilepsy, comprising introducing the mutant gene or mutant protein of mTOR, TSC1, TSC2, AKT3, and/or PIK3CA into cells in vitro.

As used herein, the term “induction” means causing a change from a normal state to a pathological state. For the purposes of the present invention, induction is a change from a state in which refractory epilepsy has not developed to a state in which refractory epilepsy has developed.

For example, cells in which refractory epilepsy is induced can be produced by introducing mutant genes or mutant proteins of mTOR, TSC1, TSC2, AKT3, and/or PIK3CA into cells. The cells include brain cells or embryos. Animals with intractable epilepsy can be produced by generating cells into which a mutant gene or protein has been introduced. When a mutated gene or mutated protein is introduced, excessive mTOR activation may occur due to the mutation, impeding the migration of nerve cells, and significantly increasing phosphorylated S6K protein, which may induce epilepsy.

mTOR, TSC1, TSC2, AKT3 and/or PIK3CA proteins with mutations in the amino acid sequence can be obtained from nature by extraction and purification using methods well known in the art. Alternatively, proteins with mutations in the amino acid sequence can be synthesized chemically (Merrifleld, J. Amer. Chem. Soc. 85:2149-2156, 1963) or obtained using genetic recombination technology.

When manufactured by chemical synthesis, it can be obtained using polypeptide synthesis methods well known in the art. When using genetic recombination technology, a nucleic acid encoding a protein with a mutated amino acid sequence is inserted into an appropriate expression vector, the vector is transformed into a host cell, and the host cell is cultured to express the protein with a mutated amino acid sequence. It can be obtained through the process of recovering proteins with mutated amino acid sequences from host cells. Proteins are expressed in selected host cells and then subjected to conventional biochemical separation techniques for separation and purification, such as treatment with protein precipitants (salting out), centrifugation, ultrasonic disruption, ultrafiltration, dialysis, and molecular sieve chromatography. Various chromatographies such as (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography can be used, and they are usually used in combination to separate proteins of high purity.

Base sequences encoding mTOR, TSC1, TSC2, AKT3 and/or PIK3CA proteins with mutations in the amino acid sequence can be isolated from nature or produced using chemical synthesis. The nucleic acid having the above base sequence may be single-stranded or double-stranded, and may be a DNA molecule (genome, cDNA) or RNA molecule. In the case of chemical synthesis, a synthesis method well known in the art, for example, a method described in the literature (Engels and Uhlmann, Angew Chem Int Ed Engl. 37:73-127, 1988) can be used, and triester , phosphate, phosphoramidite and H-phosphate methods, PCR and other autoprimer methods, oligonucleotide synthesis methods on solid supports, etc.

In a more preferred embodiment, the mutant protein or mutant gene of the present invention can be introduced into cells, embryos, or animals using a recombinant vector.

In the present invention, “vector” refers to a means for introducing a base sequence encoding a target protein into a host cell. Vectors of the present invention include plasmid vectors, cosmid vectors, viral vectors, etc. A suitable expression vector includes expression control elements such as a promoter, operator, start codon, stop codon, polyadenylation signal, and enhancer, as well as a signal sequence or leader sequence for membrane targeting or secretion, and can be prepared in various ways depending on the purpose. The initiation codon and stop codon are generally considered to be part of the base sequence encoding the protein of interest, and must be functional in the subject when the genetic construct is administered and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible. Additionally, the expression vector includes a selectable marker for selecting host cells containing the vector, and, in the case of an expression vector capable of replication, an origin of replication. Vectors can self-replicate or integrate into host genomic DNA.

Preferably, the vector is one in which the gene inserted into the vector is irreversibly fused into the genome of the host cell, allowing gene expression to continue stably for a long period of time within the cell.

The mutant protein or mutant gene of the present invention can be introduced into cells, preferably into brain cells. Additionally, it can be introduced into an embryo, preferably into an embryo that is in the stage of brain formation or development.

The method for introducing proteins or genes is not particularly limited. For example, vectors can be inserted into cells through methods such as transformation or transduction. Vectors inserted into cells can produce proteins with mutated amino acid sequences as gene expression continues within the cells.

In the present invention, the term "animals with induced epilepsy" refers to animals other than humans, and refers to animals in which a modification of the trait is induced such that intracellular mTOR protein activity is increased compared to normal cells, and the amino acid sequence is mutated. Transformation can be induced by introducing vectors expressing mTOR, TSC1, TSC2, AKT3, and/or PIK3CA proteins into cells. The transgenic animal that develops intractable epilepsy can be effectively used as an animal model for intractable epilepsy.

In the present invention, an “animal model” or “disease model” is a model that has a specific disease similar to a human disease and can serve as a research object to identify the etiology and confirm the condition. means animal. Animals for use as animal models can predict the same effects as in humans, are easy to make, and are reproducible. Additionally, the etiology must be the same or similar to that of the human disease. Therefore, animals that are mammalian vertebrates like humans, have similar body structures such as organs, immune systems, body temperature, etc., and suffer from diseases such as high blood pressure, cancer, and immunodeficiency are suitable as animal models. Such animals are preferably mammals such as horses, sheep, pigs, goats, camels, antelopes, dogs, rabbits, mice, rats, guinea pigs, and hamsters, and more preferably rodents such as mice, rats, guinea pigs, and hamsters. In particular, mice are small animals that have superior reproductive capacity, are easy to manage, are resistant to diseases, are genetically uniform, and various types have been developed, making it possible to produce animals that show the same or similar symptoms to diseases that occur in humans. Therefore, it is most widely used to study human diseases.

The animal model of the present invention is an epilepsy disease model, which is a model prepared by genetic engineering to express mTOR, TSC1, TSC2, AKT3, and/or PIK3CA proteins with mutated amino acid sequences. Since the mutant protein or mutant gene provided in the present invention has the ability to induce refractory epilepsy, a refractory epilepsy disease model can be easily produced by introducing them into cells or embryos and generating them.

For example, in the present invention, animals with intractable epilepsy can be produced by introducing mTOR, TSC1, TSC2, AKT3, and/or PIK3CA mutant proteins or mutant genes into animal embryos and then developing them. The mutant protein or mutant gene may be introduced into the embryo in the form of a vector. The method of introducing the vector into the embryo is not particularly limited. Preferably, the time to introduce the vector into the embryo may be during the embryonic period when the cerebral cortex layer is formed.

The epilepsy animal model of the present invention can be effectively used for research on gene function, molecular mechanisms of epilepsy, and exploration of new anti-epileptic drugs.

One example of the present invention relates to a composition, kit, and method for preventing, improving, or treating intractable epilepsy or its causative disease. Malformations of Cortical Developments (MCD) such as focal cortical dysplasia, unilateral megaencephaly, and tuberous sclerosis, hippocampal sclerosis (HS), or Sturge Weber Syndrome, which are the causes of the above-mentioned intractable epilepsy. syndrome, SWS).

The intractable epilepsy according to the present invention is intractable epilepsy caused by the causative disease of focal cortical dysplasia (FCD), tuberous sclerosis (TSC), unilateral megalencephaly (HME), hippocampal sclerosis (HS), or Sturge Weber Syndrome (SWS). , specifically, may include intractable epilepsy caused by brain somatic mutations in genes involved in the PI3K-AKT-mTOR signaling pathway.

That is, by brain somatic variants of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway, such as mTOR, TSC1, TSC2, AKT3, and PIK3CA genes or proteins, focal cortical dysplasia (FCD), Tuberous sclerosis (TSC), unilateral megalencephaly (HME), hippocampal sclerosis (HS), or Sturge Weber syndrome (SWS) may occur, and these diseases cause intractable epilepsy.

Therefore, in the present invention, cells or animal models expressing brain somatic variants of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway were prepared, and when rapamycin as an mTOR inhibitor was administered, spontaneous seizures or abnormal nerve cells were produced. When rapamycin was administered to the animal model shown above, it was confirmed that the number of behavioral seizures and brain wave seizures decreased, and the size of abnormal nerve cells decreased. Therefore, diseases caused by mTOR hyperactivation due to mutations in mTOR, TSC1, TSC2, AKT3, and PIK3CA genes, such as focal cortical dysplasia (FCD), tuberous sclerosis (TSC), unilateral megalencephaly (HME), and hippocampal sclerosis (HS). ), or mTOR inhibitors can be used to prevent, improve, or treat Sturge Weber Syndrome (SWS) and its symptoms. Currently, mTOR inhibitors are widely used as anticancer drugs.

One example of the present invention can provide a use for preventing, improving, or treating epilepsy or diseases that cause epilepsy, including an mTOR inhibitor as an active ingredient. The epilepsy is epilepsy caused by brain somatic genetic mutation, preferably epilepsy caused by brain somatic mutation of genes or proteins involved in the PI3K-AKT-mTOR signaling pathway, more preferably mTOR, TSC1, TSC2, AKT3. And it may be epilepsy caused by brain somatic genetic mutation of the PIK3CA gene. The cause of the epilepsy is a disease caused by brain somatic mutations in genes or proteins involved in the PI3K-AKT-mTOR signaling pathway, preferably caused by brain somatic genetic mutations in the mTOR, TSC1, TSC2, AKT3, and PIK3CA genes. The disease may be more preferably focal cortical dysplasia (FCD), tuberous sclerosis (TSC), unilateral megalencephaly (HME), hippocampal sclerosis (HS) or Sturge Weber Syndrome (SWS).

mTOR inhibitors that can be used for preventing, improving, or treating epilepsy or diseases causing epilepsy according to the present invention include all commonly known mTOR inhibitors. Representative examples of such mTOR inhibitors include rapamycin or a salt thereof, everolimus or a salt thereof, a compound of Formula 1 or a salt thereof, a compound of Formula 2 or a salt thereof, a compound of Formula 3 or a salt thereof, and Formula 4 It includes, but is not limited to, one or more selected from the group consisting of compounds or salts thereof.

Examples of mTOR inhibitors applicable to the present invention may include mTOR inhibitors having the following substance names, development names, or trade names: AMG954, AZD8055, AZD2014, BEZ235, BGT226, Everolimus, Sirolimus, CC-115, CC-223, LY3023414, P7170, DS-7423, OSI-027, GSK2126458, PF-04691502, PF-05212384, Temsirolimus, INK128, MLN0128, MLN1117, Ridaforolimus, Metformin, XL765, SAR245409, SF1126, VS 5584, GDC0980, GSK2126458. Additionally, further examples of mTOR inhibitors may be those described in the patent documents WO2012/104776, KR 10-1472607B, WO2010/039740, US8846670, US8263633, or WO2010/002954.

In one embodiment of the present invention, rapamycin or a salt thereof, everolimus or a salt thereof, a compound of Formula 1 or a salt thereof, a compound of Formula 2 or a salt thereof, a compound of Formula 3 or a salt thereof, and a compound of Formula 4 Intractable epilepsy, or its causative disease, focal cortical dysplasia, preferably associated with brain somatic genetic mutation, more preferably brain somatic genetic mutation, including at least one selected from the group consisting of a compound or salt thereof. To provide a pharmaceutical composition for preventing or treating associated focal cortical dysplasia.

[Formula 1]

[Formula 2]

[Formula 3

[Formula 4]

Another object of the present invention is to provide rapamycin or a salt thereof, everolimus or a salt thereof, a compound of Formula 1 or a salt thereof, a compound of Formula 2 or a salt thereof, a compound of Formula 3 or a salt thereof, and a compound of Formula 4 Intractable epilepsy, or its causative disease, focal cortical dysplasia, preferably intractable epilepsy associated with brain somatic genetic mutation, more preferably cerebral somatic genetic mutation, including at least one selected from the group consisting of a compound or a salt thereof The object is to provide a food composition for preventing or improving mutation-related focal cortical dysplasia.

In the present invention, the term "Rapamycin" refers to a macrolide lactone compound, also known as sirolimus, and a drug that has immunosuppressive activity. Rapamycin has been commercialized as an inhibitor of transplant rejection in organ transplant patients, and is also used as a treatment for immunoinflammatory skin diseases such as pneumonia, systemic lupus erythematosus, and psoriasis, immunoinflammatory enteropathy, ocular inflammation, restenosis, and rheumatoid arthritis. It is used as an anticancer agent. However, rapamycin is used for the prevention or treatment of refractory epilepsy, or the disease causing it, focal cortical dysplasia, preferably refractory epilepsy associated with brain somatic genetic mutation, more preferably focal cortical dysplasia associated with brain somatic genetic mutation. There are no enemies.

In the present invention, the term "Everolimus" is a drug used to treat kidney cancer and is effective against drugs such as sunitinib or sorafenib, which are drugs that inhibit angiogenesis. It is used when it is not available. It is also used in patients with crystalline sclerosis who have subependymal giant cell astrocytoma for which surgery is not possible. However, everolimus is used for the prevention or treatment of refractory epilepsy, or the disease causing it, focal cortical dysplasia, preferably refractory epilepsy associated with brain somatic genetic mutations, more preferably focal cortical dysplasia associated with brain somatic genetic mutations. It has never happened.

In the present invention, “compounds of formulas 1 to 4” are compounds known to be inhibitors of mTOR. However, the relationship with the prevention or treatment of intractable epilepsy, or the disease causing it, focal cortical dysplasia, preferably intractable epilepsy associated with brain somatic genetic mutation, more preferably focal cortical dysplasia associated with brain somatic genetic mutation, is completely unknown. There is not.

In the present invention, rapamycin, everolimus, and the compounds of formulas 1 to 4 include all of their derivatives or analogs and pharmaceutically acceptable salts or hydrates.

The pharmaceutically acceptable salt or hydrate may be a salt or hydrate derived from an inorganic acid or an organic acid. For example, salts include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, acetic acid, glycolic acid, lactic acid, pyruvic acid, and malic acid. Lonic acid, succinic acid, glutaric acid, fumaric acid, malic acid, mandelic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, benzoic acid, hydroxybenzoic acid, phenylacetic acid, cinnamic acid, salicylic acid, methanesulic acid. It may be fonic acid, benzenesulfonic acid, or toluenesulfonic acid, but is not limited thereto. The hydrate may mean that rapamycin, everolimus, and compounds of formulas 1 to 4 are formed by combining them with water molecules.

In the present invention, “treatment” refers to alleviation or improvement of symptoms, reduction of the extent of the disease, delay or alleviation of disease progression, improvement, relief or stabilization of the disease state, partial or complete recovery, extension of survival, and other beneficial treatment results. It can be used in an all-inclusive sense. In the present invention, rapamycin and Everor are administered to patients suffering from refractory epilepsy or its causative disease, focal cortical dysplasia, preferably refractory epilepsy associated with brain somatic genetic mutation, more preferably focal cortical dysplasia associated with brain somatic genetic mutation. Refractory epilepsy, or the disease causing it, focal cortical dysplasia, preferably refractory epilepsy associated with brain somatic genetic mutation, more preferably regional cortical disease associated with brain somatic genetic mutation, by administering limus and/or the compounds of formulas 1 to 4. Including alleviating, ameliorating, alleviating or treating symptoms associated with dysplasia.

Symptoms related to the brain somatic genetic mutation-related focal cortical dysplasia occur when nerve cells fail to migrate to the appropriate brain region during brain development, including spontaneous seizures, behavioral seizures, electroencephalographic seizures, and abnormal nerve cells in the cerebrum. The occurrence of , etc. can be exemplified.

Therefore, the treatment in the present invention is for patients with such refractory epilepsy, or its causative disease, focal cortical dysplasia, preferably refractory epilepsy associated with brain somatic genetic mutation, more preferably focal cortical dysplasia associated with brain somatic genetic mutation. By administering rapamycin, everolimus, and/or compounds of formulas 1 to 4, the number of spontaneous seizures, behavioral seizures, or electroencephalographic seizures appears is significantly reduced, and the number or size of abnormal nerve cells in the cerebrum is reduced. It can mean.

Depending on the mode and method of use of the pharmaceutical composition of the present invention, the effective amount of rapamycin, everolimus, and/or the compounds of Formulas 1 to 4 can be appropriately adjusted and used according to the selection of a person skilled in the art.

For example, the pharmaceutical composition contains rapamycin, everolimus, and/or the compounds of formulas 1 to 4 in an amount of 0.1 to 10% by weight, more preferably 0.5 to 5% by weight, based on the total weight of the entire composition. can do.

The rapamycin, everolimus, and the compounds of formulas 1 to 4 may be included alone in the pharmaceutical composition, or may further include other pharmacologically acceptable additives. The pharmaceutically acceptable additives are commonly used in formulations and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, and microcrystalline cellulose. , polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, and also as pharmaceutically acceptable excipients. Includes, but is not limited to, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. That is, pharmaceutically acceptable additives that can be added to the pharmaceutical composition of the present invention can be selected by a person skilled in the art without difficulty depending on the purpose of use, and the amount added is within a range that does not impair the purpose and effect of the present invention. can be selected from

The preferred dosage for a patient of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art. However, for a desirable effect, the extract of the present invention is administered at 1 mg/kg to 1000 mg/kg, preferably 50 mg/kg to 500 mg/kg, more preferably 150 mg/kg to 300 mg/kg per day. It is recommended to administer Administration may be administered once a day, or may be administered in several divided doses. Accordingly, the above dosage does not limit the scope of the present invention in any way.

The composition of the present invention can be administered to mammals such as rats, mice, livestock, and humans through various routes. All modes of administration are contemplated, for example, oral, rectal or by intravenous, intramuscular, subcutaneous, or intracerebroventricular injection.

In another aspect, the present invention relates to rapamycin or a salt thereof, everolimus or a salt thereof, a compound of Formula 1 or a salt thereof, a compound of Formula 2 or a salt thereof, a compound of Formula 3 or a salt thereof, and a compound of Formula 4. or intractable epilepsy, or its causative disease, focal cortical dysplasia, preferably associated with brain somatic genetic mutation, more preferably brain somatic genetic mutation, including at least one selected from the group consisting of salts thereof. It relates to a food composition for preventing or improving associated focal cortical dysplasia.

The food composition can be used together with components of other conventional food compositions, and can be used appropriately according to conventional methods. Rapamycin, everolimus, and/or compounds of formulas 1 to 4 may be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment). Generally, when manufacturing a composition for food, the active ingredient may be added in an amount of 0.01 to 10 parts by weight, preferably 0.05 to 1 part by weight, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.

The food composition may be contained in health foods for the purpose of preventing or improving intractable epilepsy, or its causative disease, focal cortical dysplasia, and preferably intractable epilepsy associated with brain somatic genetic mutation, and there is no particular limitation on its type. . In addition to the above, the food composition of the present invention may further include foodologically acceptable additives.

According to the present invention, intractable epilepsy, or cerebral cortical development abnormalities such as focal cortical dysplasia (FCD), hemigalencephaly (HME), and tuberous sclerosis complex (TSC), which are the diseases causing it, Rapamycin, Ebe in patients presenting with refractory epilepsy associated with Malformations of Cortical Developments (MCD), hippocampal sclerosis (HS), or Sturge Weber syndrome (SWS), preferably associated with brain somatic genetic mutations. By administering lolimus and/or compounds of formulas 1 to 4, the number of spontaneous seizures, behavioral seizures, or electroencephalographic seizures due to focal cortical dysplasia associated with brain somatic genetic mutations is significantly reduced, and the number of abnormal nerve cells in the cerebrum is reduced. Or you can reduce the size.

Our center provides an effective biomarker panel for intractable epilepsy and diagnostic technology for intractable epilepsy using the panel. In addition, our institute provides a technology for inducing intractable epilepsy, and it is possible to conduct research on gene function, molecular mechanisms of epilepsy, and search for new anti-epileptic drugs using the epilepsy animal model produced accordingly.

Figure 1 shows Western blot results for HEK293T cells expressing TSC-1 wild type and genetic mutations. (-) represents control, (+) represents rapamycin treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figure 2 shows Western blot results for HEK293T cells expressing TSC-2 wild type and genetic mutations. (-) represents control, (+) represents rapamycin treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figure 3 shows Western blot results for HEK293T cells expressing AKT3 wild type and genetic mutations. (-) represents control, (+) represents rapamycin treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figure 4 shows Western blot results for HEK293T cells expressing mTOR wild type and genetic mutations. (-) represents control, (+) represents rapamycin treatment (200nM). “P-S6K” represents phosphorylated S6K protein, “S6K” represents S6K protein. **p<0.01 and ***p<0.001 (compared to wild type, n=3-5 for each group, one-way ANOVA with Bonferroni's) post test)
Figure 5 shows Western blot results for HEK293T cells expressing mTOR wild type and genetic mutations. (-) represents control, (+) represents rapamycin treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figure 6 shows that according to Example 3, p.Arg22Trp and p.Arg204Cys variants of TSC-1 are associated with mTOR hyperactivation. Immunoprecipitation results are shown to confirm the mechanism by which the TSC1 variant induces mTOR hyperactivity. Empty represents cells that have not been treated with anything.
Figure 7 shows the GTP-agarose pull down assay according to Example 3. Specifically, the degree of activation of the TSC complex is measured by measuring the amount of GTP-bound Rheb protein, a substrate of the TSC complex.
Figure 8 shows the results of rapamycin treatment of HEK293T cells expressing the mTOR genetic mutation of the present invention. **p<0.01 and ***p<0.001 (compared to wild type, n=3-5 for each group, one-way ANOVA with Bonferroni's post test)
Figure 9 shows the results of rapamycin treatment of HEK293T cells expressing the mTOR genetic mutation of the present invention. “P-S6K” refers to phosphorylated S6 protein, and “S6K” refers to S6 protein.
Figure 10 shows the results of treating HEK293T cells expressing the mTOR genetic mutation of the present invention with the compounds of Formulas 1 to 4 and everolimus. “P-S6” refers to phosphorylated S6 protein, and “S6” refers to S6 protein.
Figures 11a and 11b show Western blot results confirming changes before and after treatment with six drugs in HEK293T cells expressing mTOR wild type and genetic mutation according to Example 4. (-) represents control, (+) represents drug treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figures 12a and 12b show Western blot results confirming changes before and after treatment with six drugs in HEK293T cells expressing TSC1 wild type and genetic mutations. (-) represents control, (+) represents drug treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figures 13a and 13b show Western blot results confirming changes before and after treatment with six drugs in HEK293T cells expressing TSC2 wild type and genetic mutations. (-) represents control, (+) represents drug treatment (200nM). “P-S6K” represents phosphorylated S6K protein, and “S6K” represents S6K protein.
Figures 14a and 14c show pathological samples from all focal cortical dysplasia patients in which mTOR mutations in TSC1 and 2 were confirmed. "Non-FCD" is a sample with a normal brain without focal cortical dysplasia, "P-S6" is the result of phosphorylation of the S6 protein, "NeuN" is a neuronal marker, and "Merge" is a sample of P-S6 and This is a merged image of NeuN.
Figures 14b and 14d show the proportion of cells in which S6 protein was phosphorylated in parts 4 to 5 of the cortex, and Figures 14e and f show the size of cells positive for a neuronal marker (NeuN). *p<0.05, **P<0.001, ***P<0.0001 [relative to Non-FCD samples, one-way ANOVA with Bonferroni posttest]. Error bars, sem Scale bars, 50um.
Figure 15a shows impaired nerve cell migration and resulting malformation of cerebral cortex development in a TSC mouse model. “Control” indicates the case where sgRNA is not inserted, and red text indicates the percentage of cells expressing the plasmid. Scale bars, 250um.
Figure 15B shows the distribution of electroporated cells within the cortex. *p<0.05, ***P<0.0001 [Two-way ANOVA with Bonferroni posttest]. Error bars, sem
Figure 16 shows the results of measuring the number of spontaneous seizures after administering rapamycin to a TSC2 mouse model that causes spontaneous seizures. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni?s post test)
Figure 17a shows an outline showing the process of electroporation on embryonic day 14 (E14) with a plasmid into which the mTOR gene, in which the base sequence mutation of the present invention occurred, was introduced, followed by brain coronal sectioning on embryonic day 18 (E18), and then analysis.
Figure 17b shows a mouse embryonic period 18 days (E18) into which the mTOR gene of the present invention has been introduced, in order to confirm neuronal migration disorders and mTOR activity in mice into which the mTOR gene with the base sequence mutation of the present invention has been introduced. Shows a coronal section of the brain. “CP” is the cerebral cortical plate, “IZ” is the cerebral intermediate zone, “SVZ” is the subventricular zone, “VZ” is the ventricular zone, “Wild type” When the wild-type mTOR plasmid is inserted, “Relative intensity value” indicates the relative intensity of GFP (green fluorescent protein) in each case. **p<0.01, and ****p<0.0001 (relative to wild type, n=6-8, two-way ANOVA with Bonferroni's multiple comparison test). Error bars, sem CP, cortical plate; IZ, intermediate zone; SVZ/VZ, subventricular and ventricular zone. Scale bars, 100um.
Figure 17c shows the results of confirming changes in mTOR activity during the development of the embryonic cortex of mice into which the mTOR gene with the base sequence mutation of the present invention was introduced. **p<0.01 (relative to wild type, n=6-10, Student's t-test). Scale bars, 20 micrometers, Error bars, sem
Figure 18a shows that electroporated embryos were born on embryonic day 14 (E14) with a plasmid into which the mTOR gene with the base sequence mutation of the present invention was introduced, and only mice expressing fluorescence were classified using flashlight (Electron Microscopy Science, USA). A schematic diagram showing the effect of measuring video-electroencephalography (video-EEG) and administering rapamycin after a seizure is shown. "in utero electroporation (E14)" is a schematic diagram of injecting a plasmid into which the mTOR gene, in which the base sequence mutation of the present invention has occurred, is introduced on embryonic day 14, and "GFP screening at birth (P0)" is a schematic diagram of injecting an embryo into which the plasmid has been injected. A schematic diagram of classifying only mice that express fluorescence with a flashlight (Electron Microscopy Science, USA). "Video-EEG monitoring (>3 weeks)" refers to the electrodes used when seizures are confirmed only through video monitoring after the mouse is wet (>3 weeks). A schematic diagram of measuring an electroencephalogram (video-EEG) by placing is shown.
Figure 18b shows the presence or absence of spontaneous seizures based on the results of video electroencephalogram monitoring in mice into which the mTOR gene with the base sequence mutation of the present invention has been introduced. "No. of GFP+pups" refers to the population of mice that express GFP due to the introduction of the mTOR gene in which a nucleotide sequence mutation occurred, and "No, of mice with seizures" refers to the number of mice that cause seizures due to the introduction of the mTOR gene in which a nucleotide sequence mutation occurred. represents the number of objects.
Figure 18c shows the results of video electroencephalogram monitoring of spontaneous seizures in mice into which the mTOR gene with the base sequence mutation of the present invention was introduced. “LF” stands for left frontal, “RF” stands for right frontal, “LT” stands for left temporal, and “RT” stands for right temporal.
Figure 18d shows the timing of seizures in mice into which the wild-type mTOR gene was introduced and mice into which the mTOR gene with the nucleotide sequence mutation of the present invention was introduced. (n=8-20 for each group). Error bars, sem
Figure 18e shows the results of measuring the number of spontaneous seizures after administering rapamycin to mice that cause spontaneous seizures by introducing the mTOR gene in which the base sequence mutation of the present invention has occurred. *p<0.05 and **p<0.01 (n=7-17 for each group, one-way ANOVA with Bonferroni's post test)
Figure 18f shows a mouse in which the mTOR gene with the nucleotide sequence mutation of the present invention is introduced and causes spontaneous seizures, and the results of confirming the change in size of GFP-positive cells after administering rapamycin to the mouse. ***p<0.001 (relative to GFP negative neurons, n=20-263 for each group. Student t-test). Scale bars, 20um. Error bars, sem
Figure 18g shows the frequency of interictal impulses in mice into which the mTOR gene with the base sequence mutation of the present invention has been introduced and the change in frequency of interictal impulses after administration of rapamycin to the mice. *p<0.05 (n=7-17, one-way ANOVA with Bonferroni's post test) Error bars, sem
Figure 18h shows the frequency of non-convulsive EEG seizures in mice into which the mTOR gene with the base sequence mutation of the present invention was introduced and the change in the frequency of non-convulsive EEG seizures after administration of rapamycin to the mice. *p<0.05 (n=7-17, one-way ANOVA with Bonferroni's post test) Error bars, sem

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Incurability through sequence analysis epilepsy Confirmation of genetic mutation in patient group

For the genomic DNA data obtained from patient samples, only somatic genetic mutations commonly found in two analysis methods (hybrid capture sequencing and PCR-based amplicon sequencing) were used in subsequent experiments. In addition, among the genetic mutations found in both hybrid capture sequencing and PCR-based amplicon sequencing, only genetic mutations that meet the selection criteria (depth 100 or more, 3 or more mutated calls, mapping quality 30 or more) are selected as disease-related gene candidates. was selected.

1-1: Extraction of genomic DNA from patient samples

77 surgical patients with refractory epilepsy due to focal cortical dysplasia (FCD), hemimegalencephaly (HME), hippocampal sclerosis (HS), or Sturge Weber syndrome (SWS) Saliva, brain tissue, blood, and formalin-fixed paraffin-embedded brain tissue were obtained with the patient's consent (Severance Hospital Pediatric Neurosurgery and Pediatric Neurology Department). DNA extraction kits corresponding to the following were extracted from the saliva and brain tissue samples according to the manufacturer's instructions.

Brain tissue: Qiamp mini DNA kit (Qiagen, USA), blood: Flexigene DNA kit (Qiagen, USA), saliva: prepIT?L2P purification kit (DNAgenotek, USA), formalin-fixed paraffin-embedded brain tissue: Qiamp mini FFPE DNA kit ( Qiagen, USA).

1-2. hybrid capture (Hybrid capture) sequencing

Probes specific for MTOR, TSC1, TSC2, AKT3, and PIK3CA were produced using SureDesign online tools (Agilent Technologies). A sequencing library was prepared using Agilent library preparation protocols according to the manufacturer's method. Sequencing was performed using Hiseq2500 (illumina) (median read depth 483x). The data obtained after sequencing was created as a file (bam file) that could be analyzed using the Broad Institute best practice pipeline (https://www.broadinstitute.org/gatk/).

1-3: PCR base Amplicon ( PCR -based amplicon ) Sequencing

MTOR, TSC1, TSC2, AKT3, and PIK3CA amplicons (Truseq custom amplicon kit, illumina) produced by illumina design studio (http://designstudio.illumina.com) were used, and the library was created according to the manufacturer's method. Sequencing was performed using the Miseq sequencer (Illumina) (median read depth 1,368x). It was created as a file (bam file) that can be analyzed using the BWA-MEM algorithm (http://bio-bwa.sourceforge.net).

1-4: Experiment results

Among the genetic mutations found in both hybrid capture sequencing and PCR-based amplicon sequencing, genetic mutations satisfying the selection criteria (depth 100 or more, 3 or more mutated calls, mapping quality 30 or more) were selected, resulting in MTOR and TSC1. , TSC2, AKT3, and PIK3CA were each observed to have genetic mutations. : mTOR c.616C>T (p.Arg206Cys) mTOR c.1871G>A (p.Arg624His), c. 4348T>G (p.Tyr1450Asp), c.4447T>C (p.Cys1483Arg), c.5126G>A (p.Arg1709His), c.5930C>A (p.Thr1977Lys), c.6577C>T (p. Arg2193Cys), c.6644C>T (p.Ser2215Phe), and c.7280T>A (p.Leu2427Gln); TSC1 c.64C>T (p.Arg22Trp), c.610C>T (p.Arg204Cys), c.2432G>T (p.Arg811Leu); TSC2 c.4639C>T (p.Val1547Ile); AKT3 c.740G>A (p.Arg247His), PIK3CA c.3052G>A (p.Asp1018Asn). Brain lesion-specific genetic mutations were found in 21 of a total of 77 patients with intractable epilepsy.

Patient/Gender Age at surgery pathology MRI results protein base mutation protein mutation Hybrid Capture
% Mutated alleles PCR amplicon sequencing
% Mutated alleles FCD 4/F 5yr 2m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa No abnormal signal intensity MTOR
c.7280T>C p.Leu2427Pro 7.94% 12.6% FCD 6/female 5yr Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa No abnormal signal intensity MTOR c.7280T>C p.Leu2427Pro 6.90% 7.28% FCD 64/female 6yr 9m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa Cortical dysplasia involving left fronto-parietal lobe TSC1
c.610C>T p.Arg204Cys 1.75% 1.0% HME 66/Male 2yr 8m Cortical laminar disturbance with large giant neurons Rt. hemimegalencephDaly PIK3CA c.3052G>A p.Asp1018Asn 1.03% 2.30% SWS
77/Male 11m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa Diffuse brain atrophy, Right hemisphere MTOR c.616C>T p.Arg206Cys 3.93% 3.45% FCD 81/female 12yr Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa No abnormal signal intensity TSC1 c.64C>T p.Arg22Trp 2.81% 2.0% HS86/Male 13yr 2m Hippocampal sclerosis Suggestive of HS, left. AKT3 c.740G>A p.Arg247His 1.72% 10% FCD 91/Female 7yr 1m
Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa Volume decrease of the left cerebral hemisphere and multifocal lesions in the WM MTOR c.6577C>T p.Arg2193Cys 2.99% 1.26% FCD 94/female 10yr 3m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa Subependymal heterotopia, Rt peri-trigone area TSC2 c.4639C>T p.Val1547Ile 1.19% 1.55% FCD 98/Male 14yr 3m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa No abnormal signal intensity TSC1 c.64C>T p.Arg22Trp 2.52% 1.98% FCD 104/Male 1yr 2m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa Cortical dysplasia involving right precentral and postcentral gyri, MTOR c.1871G>A p.Arg624His 1.80% 4.41% FCD 105/Male 3yr 7m Cortical dyslamination, Dysmorphic neurons,
consistent with FCDIIa No abnormal signal intensity MTOR c.5126G>A p.Arg1709His 1.63% 1.52% FCD 107/female 7yr 3m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical Dysplasia involving left occipitoparietal lobe and precentral gyrus MTOR c.6644C>T p.Ser2215Phe 2.41% 2.11% FCD 113/female 10yr Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical dysplasia involving left occipital and parietal lobe MTOR c.7280T>A p.Leu2427Gln 3.05% 5.11% FCD 116/Male 7yr 9m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical dysplasia involving left superior frontal gyrus MTOR c.5930C>A p.Thr1977Lys 3.25% 2.93% FCD 121/Male 11m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical dysplasia involving entire right lobe and left superior/middle frontal gyrus MTOR c.4348T>G p.Tyr1450Asp 2.64% 3.76% FCD 123/female 12yr 4m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical Dysplasia involving right frontal lobe TSC1 c.64C>T p.Arg22Trp 2.21% 1.37% FCD 128/female 4yr 4m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical dysplasia, right frontal lobe MTOR c.4447T>C p.Cys1483Arg 6.38% 9.77% HME141/Female 1yr 9m Cortical laminar disturbance with large giant neurons Lt. hemimegalencephaly TSC1 c.2432G>T p.Arg811Leu 1.03% 1.68% FCD 143/female 2yr 10m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb No abnormal signal intensity MTOR c.6644C>T p.Ser2215Phe 2.82% 2.33% FCD 145/female 4yr 1m Cortical dyslamination, dysmorphic neurons, balloon cells, consistent with FCDIIb Cortical dysplasia involving left precentral gyrus MTOR c.5930C>A p.Thr1977Lys 1.46% 1.51%

Example 2: Using cells mTOR hyperactive check

2-1. mutagenesis and mTOR variant construct ( mTOR mutant construct) production

pcDNA3.1 flag-tagged wild-type mTOR construct was obtained from Dr. Kun-Liang Guan at the University of California, Sandiego. provided. The construct is QuikChange ? A site-directed mutagenesis kit (200523, Stratagene, USA) was used to prepare mTOR variant vectors (Y1450D, C1483R, L2427Q, and L2427P).

To create the pCIG-mTOR mutant-IRES-EGFP vector, first use the following annealing primers [forward primer 5'-AATTCCAATTGCCCGGGCTTAAGATCGATACGCGTA-3' (SEQ ID NO. 11) and reverse primer 5'-ccggtacgcgtatcgatcttaagcccgggcaattgg-3' (SEQ ID NO. 12)] Then, MfeI and MluI restriction enzyme cut sites were inserted into pCIG2 (CAG promoter-MCS-IRES-EGFP) to create pCIG-C1. Subcloning was performed at the newly inserted MfeI and MluI restriction enzyme cut sites using the following primers [hmTOR-MfeI-flag-F;gATcACAATTGTGGCCACCATGGACTACAAGGACGACGATGACAAGatgc (SEQ ID NO: 13), hmTOR-MluI-R;tgatcaACGCGTttaccagaaagggcaccagccaatatagc (SEQ ID NO: 14)]. . pCIG-mTOR wild type-IRES-EGFP and. pCIG-mTOR mutant-IRES-EGFP vector was created. Primers used for mutagenesis are shown in Table 3.

name primer sequence number Y1450D forward 5'-tcgtgcagtttctcatcccaggtagcctggatc-3' 15 reverse 5'-gatccaggctacctgggatgagaaactgcacga-3' 16 C1483R forward 5'-GGCCTCGAGGGCGGCGCATGCGGC-3' 17 reverse 5'-GCCGCATGCGCCGCCTCGAGGCC-3' 18 L2427Q forward 5'-GTCTATGACCCCTTGCAGAACTGGAGGGCTGATG-3' 19 reverse 5'-CATCAGCCTCCAGTTCTGCAAGGGGTCATAGAC-3' 20 L2427P forward GTCTATGACCCCTTGCCGAACTGGAGGCTGATG 21 reverse CATCAGCCTCCAGTTCGGCAAGGGGTCATAGAC 22

2-2. mutagenesis and TSC1 , TSC2 , AKT3 variant construct produce

pcDNA3 (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct), in which wild-type TSC1, TSC2, or AKT3 constructs are HA-tagged, was purchased from Addgene (USA) and inquired into QuikChange ? A site-directed mutagenesis kit (200523, Stratagene, USA) was used to prepare mutant vectors.

pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct (pcDNA3 HA-tagged wild-type TSC1, TSC2, AKT3 construct) was purchased from Addgene (USA). For mutagenesis of TSC-1 R22W and R204C in pcDNA3 TSC1, TSC2, and AKT3 wild-type vectors, TSC-1 R22W-F and R22W-R primers were used for R22W, and TSC-1 R204C-F for R204C. , R204C-R primer was used. For mutagenesis of TSC-2 V1547I in pcDNA3 TSC2 wild-type vector, TSC-2 V1547I-F, V1547I-R primers were used. For mutagenesis of AKT3 R247H in pcDNA3 AKT3 wild-type vector, R247H-F, R247H-R Primer was used.

Point mutations were made using the QuikChange II site-directed mutagenesis kit (200523, Stratagene, USA). Each primer contains a site-specific point mutation sequence, so mutations occur in the cloned sequence during PCR. Primers used for mutagenesis are shown in Table 4 below.

gene Mutation location primer sequence number TSC-1 C64T R22W TSC-1R22W-F gtcacgtcgtcccacacacccagcatg 23 TSC-1R22W-R catgctgggtgtgtgggacgacgtgac 24 C610T R204C TSC-1 R204C-F ctttcatactgtaatgagaacacaaaaaggagacgaagttgca 25 TSC-1R204C-R tgcaacttcgtctcctttttgtgttctcattacagtatgaaag 26 TSC-2 G4639A V1547I TSC-2 V1547I-F tctccaacatacaggatggcgatcttgtgggtg 27 TSC-2 V1547I-R cacccacaagatcgccatcctgtatgttggaga 28 AKT3 G740A R247H AKT3 R247H-F caccatagaaacgtgtgtggtcctcagagaacacc 29 AKT3 R247H-R ggtgttctctgaggaccacacacgtttctatggtg 30

2-3. Cell culture, transduction ( transfection ) and western Blot

To determine whether TSC-1, TSC-2, mTOR, and AKT3 genetic mutations cause overactivation of mTOR, wild-type and mutant vectors were transduced into HEK293T cells, and phosphorylation of S6K protein, a well-known marker of the mTOR gene, was confirmed by Western blot. did.

Specifically, HEK293T cells (thermoscientific) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) medium containing 10% FBS at 37°C and 5% CO ₂ conditions. Cells were transformed into empty flag-tagged vector, flag-tagged mTOR wild type, flag-tagged mTOR mutant, HA-tagged TSC1 wild type, HA-tagged TSC2 wild type, and HA using jetPRIME transfection reagent (Polyplus, France). -tagged AKT3 wild type, HA-tagged TSC1 mutant, HA-tagged TSC2 mutant, and HA-tagged AKT3 mutant were each transduced.

After transduction, the cells were serum-starved with 0.1% FBS in DMEM medium for 24 hours and cultured in PBS containing 1mM MgCl ₂ and CaCl ₂ at 37°C in 5% CO ₂ conditions for 1 hour. Cells were lysed in PBS containing 1% Triton X-100, Halt protease, and phosphatase inhibitor cocktail (78440, Thermo Scientific, USA). Proteins were resolved by SDS-PAGE and transferred to a PVDF membrane (Milipore, USA). The membrane was blocked with 3% BSA in TBS containing 0.1% Tween 20 (TBST). Afterwards, washing was repeated four times with TBST. The membrane was treated with anti-phospho-S6-ribosomal protein (5364, Cell Signaling Technology, USA), anti-S6 ribosomal protein (2217, Cell Signaling Technology, USA) and anti-flag M2 (8164, Cell Signaling Technology) diluted 1/1000. , USA) and incubated overnight at 4°C in TBST. After incubation, the membrane was washed four times with TBST. Afterwards, the cells were incubated at room temperature for 2 hours with HRP-linked anti-rabbit or anti-mouse secondary antibodies (7074, Cell Signaling Technology, USA) diluted 1/5000. TBST was washed, and immunodetection was performed using ECL reaction reagent.

2-4. mutant In cells expressing rapamycin processing and western Blot

In Example 2-3, after treating cells expressing the mutant with rapamycin, changes in phosphorylation of S6K protein were confirmed.

Specifically, in the same manner as in Example 2-4, mTOR, TSC1, TSC2, and AKT3 mutants were transduced into HEK293T cells, starved for 24 hours with Empty DMEM in DMEM medium, and added with 1mM of MgCl ₂ and CaCl ₂ Rapamycin was treated with culture in PBS containing 37°C and 5% CO ₂ for 1 hour. Afterwards, Western blot was performed in the same manner as in Example 2-4.

2-5.Experiment results

According to Examples 2-3 and 2-4, p.Arg22Trp and p.Arg204Cys genetic mutations in TSC-1, p.Val1547Ile genetic mutations in TSC-2, p.Arg247His genetic mutations in AKT3, p.Tyr1450Asp, p. To determine whether Cys1483Arg, p.Leu2427Gln, and p.Leu2427Pro genetic mutations induce mTOR activation, vectors containing mTOR, TSC1, TSC2, and AKT3 wild type and mutant were transduced into HEK293T cells, and well-known markers of the mTOR gene were used. Phosphorylation of the S6K protein was confirmed by Western blot, and the results of confirming the phosphorylation change of the S6K protein after treating the cells expressing the above mutant with rapamycin are shown in Figures 1 to 5, and the results for each mutant gene are as follows. .

(1) Confirmation of activity of TSC-1 variants in cells

As can be seen in Figure 1, it was confirmed that phosphorylation of S6K protein increased in cells expressing the mutant TSC-1, and phosphorylation decreased after rapamycin treatment.

(2) Confirmation of activity of TSC-2 variant in cells

As can be seen in Figure 2, it was confirmed that phosphorylation of S6K protein increased in cells expressing the mutant TSC-2, and phosphorylation decreased after rapamycin treatment.

(3) Confirmation of activity of AKT3 variants in cells

As can be seen in Figure 3, it was confirmed that phosphorylation of S6K protein increased in cells expressing mutant AKT3, and phosphorylation decreased after rapamycin treatment.

(4) Confirmation of activity of mTOR variants in cells

As can be seen in Figures 4 and 5, it was confirmed that phosphorylation of S6K protein increased in cells expressing mutant mTOR, and phosphorylation decreased after rapamycin treatment.

Example 3: TSC1 and TSC2 The mutant mTOR Check activation of signal transduction system

3-1: Immunoprecipitation assay

Immunoprecipitation assay was performed to determine whether TSC1 and TSC2 variants inhibit TSC complex formation. TSC1 and TSC2 variant proteins prepared in the same manner as in Example 2-3 were incubated overnight with anti-TSC2 antibody (3990, Cell signaling Technology, USA) or anti-myc antibody (2276, cell signaling technology, USA), and then incubated with protein A. +G magnetic beads were added and incubated for 2 hours. Afterwards, the cells were washed three times with PBS containing 1% Triton-X100 and incubated in SDS buffer at 37°C for 10 minutes. After eluting the protein, it was dissolved in SDS/PAGE gel and adsorbed on a PVDF membrane. Blotting was performed in the same manner as Example 2-3.

The experimental results are shown in Figure 6. As can be seen in Figure 6, it was confirmed that the p.Arg22Trp and p.Arg204Cys mutants of TSC-1 had weakened binding to the wild-type TSC-2 protein. Through this, it was found that the TSC1 variant inhibits TSC complex formation and induces mTOR hyperactivity.

3-2: GTP-agarose pull down assay

Use lysis buffer (20mM Tris-HCl pH: 7.5, 5mM MgCl2, 2mMPMSF, 20 ?g/ _mL leupeptin, 10 ?g/mL aprotinin, 150mM NaCl and 0.1% Triton X-100) and then ultrasonication. was added for 15 seconds to lyse the cells. Afterwards, the cells were centrifuged at 4 degrees and 13000 g to separate the supernatant. This supernatant was incubated for 30 minutes in 100 ?l GTP-agarose beads (Sigma-Aldrich, cat no. G9768) at a temperature of 4 degrees. Afterwards, beads were washed with lysis buffer and incubated overnight. GTP-bound proteins were extracted and confirmed by immunoblot.

When TSC2 is overexpressed, GTP-bound Rheb protein, which is the substrate of TSC2, should be reduced. However, in the case of the TSC2 p.Val1547Ile mutant, the function of GAP (GTPase activating protein) of TSC2 is reduced, so GTP-bound Rheb protein does not decrease and remains as is. This could be confirmed (Figure 7). Through this, it was found that TSC2 mutants cause GAP domain dysfunction, leading to mTOR pathway activation.

Example 4: variant mTOR by drugs using cells expressing S6K Confirmation of protein phosphorylation changes

4-1. variant mTOR cells expressing

After treating cells expressing the mutant mTOR with drugs (rapamycin, everolimus, compounds of formulas 1 to 4), changes in phosphorylation of S6K protein were confirmed.

In the same manner as Examples 2-3 and 2-4, the mutant was transduced into HEK293T cells, serum-starved with 0.1% FBS in DMEM medium for 24 hours, and then added to PBS containing 1mM MgCl ₂ and CaCl ₂ After culturing for 1 hour at 37°C under 5% CO ₂ conditions, the cells were treated with rapamycin, everolimus, and compounds of formulas 1 to 4 (Torin1, INK128, AZD8055, GSK2126458): Torin was obtained from TOCRIS; INK128, AZD8055, and GSK2126458 were obtained from Selleckchem, and everolimus was obtained from LC laboratory. Afterwards, Western blot was performed in the same manner as in Example 2-4.

As can be seen in Figures 8 and 9, it was confirmed that phosphorylation of S6K protein was inhibited by rapamycin in cells expressing mutant mTOR. Specifically, Figure 8 shows the phosphorylation results of S6K protein after rifamycin treatment for mTOR variants C1483R, L2427P, and L2427Q. Figure 9 shows the phosphorylation results of S6K protein after treating cells expressing the mTOR variant Y1450D with rifamycin.

Figure 10 shows the phosphorylation results of S6 protein after treating cells expressing the mTOR variant L2427P with rifamycin at concentrations of 0, 25, 50, 100, and 200 nanomol (nM).

After treatment with everolimus and each of the compounds of formulas 1 to 4, changes in phosphorylation of S6K protein were confirmed. As can be seen in Figure 10, it was confirmed that phosphorylation of S6 protein was inhibited by everolimus and the compounds of Formulas 1 to 4 in cells expressing mutant mTOR. It was confirmed that phosphorylation of S6 protein was clearly decreased at concentrations above 50nM.

4-2. various mTOR Inhibitor treatment S6K Confirmation of protein phosphorylation changes

Cells expressing various mutant mTORs were treated with drugs such as rapamycin, everolimus, and compounds of formulas 1 to 4 in the same manner as in Example 3-1, and changes in phosphorylation of the S6K protein were confirmed. Specifically, the mTOR variant used in the experiment was They were R 624H, Y1450D, C1483R, R1709H, Y1977K, S2215F, L2427P and L2427Q.

Specifically, after treating cells expressing mutant mTOR with everolimus and each of the compounds of Formulas 1 to 4, changes in phosphorylation of S6K protein were confirmed. As can be seen in the figure, it was confirmed that phosphorylation of S6K protein was inhibited by everolimus and the compounds of formulas 1 to 4 in all cells expressing the mutant mTOR, and the results are shown in Figures 11a and 11b.

Example 5: TSC1 or TSC 2 mutant Confirmation of phosphorylation changes in S6K protein caused by drugs using expressing cells

In the same manner as Example 2, TSC1 or TSC 2 variants were transduced into HEK293T cells, se-rum-starved with 0.1% FBS in DMEM medium for 24 hours, and incubated in PBS containing 1mM MgCl ₂ and CaCl ₂ . It was cultured for 1 hour at 37°C and 5% CO ₂ conditions.

Then, rapamycin, everolimus, and compounds of formulas 1 to 4 (Torin1, INK128, AZD8055, GSK2126458) were treated: Torin was obtained from TOCRIS, INK128, AZD8055, and GSK2126458 were obtained from Selleckchem, and everolimus was obtained from LC laboratory. Afterwards, Western blot was performed in the same manner as in Example 4.

After treating cells expressing the variant TSC1 or TSC2 with rapamycin, changes in phosphorylation of the S6K protein were confirmed. The experimental results for the variant TSC1 are shown in Figures 12a and 12b, and the results for the variant TSC2 are shown in Figures 12a and 12b. Shown in 13a and 13b.

As shown in Figures 12a and 12b and Figures 13a and 13b, it was confirmed that phosphorylation of S6K protein was inhibited by rapamycin in cells expressing mutant TSC1 or TSC2. After treating cells expressing the mutant TSC1 or TSC2 with everolimus and each of the compounds of formulas 1 to 4, changes in phosphorylation of the S6K protein were confirmed. As can be seen in the figure, it was confirmed that phosphorylation of S6K protein was inhibited by everolimus and the compounds of formulas 1 to 4 in cells expressing mutant TSC1 or TSC2.

Example 6: FCD Immunostaining of brain tissue sections from patients

To determine whether FCDII patients with genetic mutations show mTOR hyperactivity, immunostaining was performed on brain tissue sections of FCD patients with the p.Leu2427Pro genetic mutation with antibodies against S6 phosphorylated protein and NeuN (a neuronal marker).

Non-MCD brain specimens were collected in the operating room from the tumor free margin of a patient with a brain tumor (glioblastoma) and were pathologically confirmed to be normal brains without tumors. Surgical tissue blocks were fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 20% buffered sucrose, and gelatin-embedded tissue blocks (7.5% gelatin in 10% sucrose/PB) and stored at -80°C. Cryostat-cut sections (10 μm thick) were collected and placed on glass slides. On FFPE slides from which paraffin was removed, antigen site recovery was performed with citrate buffer. Afterwards, the cells were blocked with PBS-GT (0.2% gelatin and 0.2% Triton rabbit antibody to phosphorylated S6 ribosomal protein (Ser240/Ser244) (1:100 dilution; 5364, Cell signaling Technology) and mouse antibody to NeuN (1:100 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 555-conjugated goat antibody to mouse (1:200 dilution; A21422, Invitrogen) and rabbit. Alexa Fluor 488-conjugated goat antibody to rabbit (1:200 dilution; A11008, Invitrogen). DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were obtained using a Leica DMI3000 B inverted microscope. The number of cells positive for NeuN was measured using a 10x objective lens; Within a neuron-rich region (regine), 4 to 5 fields were obtained per subject, and more than 100 cells were recorded per region. The number of DAPI-positive cells represents the total cell number. Neuron cell size was measured in NeuN-positive cells using the automated counting protocol of ImageJ software (http://rsbweb.nih.gov/ij/), and the experimental results are shown in Figures 14a to 14a. Shown in 14f.

As shown in Figures 14a to 14f, it was confirmed that the number of neurons with phosphorylated S6 protein was increased in FCD64,81,94,98,123 patients with TSC1 and TSC2 genetic mutations. On the other hand, this increase was not observed in non-FCD brain tissue. As can be seen in Figures 14b and 14d, the proportion of cells with increased S6 phosphorylation increased, and as can be seen in Figures 14e and 14f, the size of neurons with increased phosphorylation of S6 protein in pathological tissue was measured, and the size was It was confirmed that there was an increase.

Example 7: TSC1 or TSC2 Mouse model creation

7-1: TSC1 or TSC2 cast to target doing CRISPR / Cas9 vector production

pX330 plasmid (Addgene, #42230) was purchased and used as an initial template. The BbsI restriction site (GAAGAC) of the single guide ribonucleotide (sgRNA) cloning site was converted to BsaI (GGTCTC) using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Afterwards, sgRNAs targeting TSC1 and TSC2 were inserted, and their base sequences are as follows.

TSC1: 5'-TGCTGGACTCCTCCACACTG-3' (SEQ ID NO: 31)

TSC2: 5'-AATCCCAGGTGTGCAGAAGG-3' (SEQ ID NO: 32)

Then, to create a plasmid (U6-sgRNA-Cas9-IRES-mCherry) containing the mcherry fluorescent reporter, the IRES3-mCherry-CL plasmid was used as a template, PCR amplified, and then inserted between the Cas9 sequence and the NLS sequence of the pX330 plasmid.

7-2. Mouse model production

Pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4L/min of oxygen and isoflurane vaporizer gauge 3 during surgery operation). The uterine horn is exposed, and the U6-sgRNA-Cas9-IRES-mCherry plasmid targeting TSC1 or TSC2 prepared in Example 19-1 and red fluorescence are placed in the lateral ventricle of each embryo. To strengthen, pCAG-Dsred plasmid (addgene #11151) was purchased and diluted at a ratio of 3:1. 2ug/ml of Fast Green (F7252, Sigma, USA) combined with 2 to 3ug of the two diluted plasmids was injected using a pulled glass capillary. The plasmid was electroporated into the head of the embryo by discharging 50 V with an ECM830 eletroporator (BTX-harvard apparatus), which is five electric pulses of 100 ms at 900 ms intervals. After electroporated embryos were born, only mice expressing fluorescence were classified using flashlight (Electron Microscopy Science, USA).

Example 8: TSC1 or TSC2 Neuronal migration analysis in mouse model

The brain was harvested from the adult mouse (P>56) prepared in Example 7-2, fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, cryoprotected overnight in 30% buffered sucrose, and gelatin-embedded tissue. It was stored at -80°C as a lump (7.5% gelatin in 10% sucrose/PB).

Cryosections (30 μm thick) were collected and placed on glass slides. DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were obtained using a Zeiss LSM780 confocal microscope. Fluorescence intensity showing the distribution of electroporated cells in the cortex was converted to gray value from LayerII/III to LayerV/VI using ImageJ software (http://rsbweb.nih.gov/ It was measured using ij/).

As can be seen in Figures 15A and 15B, it was confirmed that dsRed positive neurons were decreased in Layer II/III and increased in cerebral Layer IV and Layer V/VI in brain tissue sections of the TSC mouse model. Through this, it was proven that there was a problem with the movement of nerve cells.

Example 9: Video-electroencephalogram monitoring (Video- Electroencephalography monitoring)

After the mouse was wet (>3 weeks), the occurrence of seizure was confirmed only through video monitoring, and then surgery was performed to install electrodes for electroencephalogram measurement. The electrodes were located on the epidural layer, with two electrodes in the frontal lobe (AP+1.8mm, ML±1.5mm) and two in the temporal lobe (AP-2.4mm, ML±1.5mm) based on the bregma. 2.4mm) A total of 5 electrodes were installed, with one electrode implanted in the cerebellum area. After a 4-day recovery period, measurements were performed for 2 to 5 days (6 hours per day) per mouse from 6 PM to 2 AM. The signal was amplified using a RHD2000 amplifier and board (Intan technoloties, USA) and analyzed using MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab).

Mice in which the TSC1 or TSC2 gene was locally removed from the cerebrum using the CRISPR/Cas9 plasmid showed spontaneous seizures accompanied by epileptic waves. The epileptic waves showed high-amplitude high-frequency waves, high-amplitude slow waves, and low-amplitude high-frequency waves. It was confirmed that mice exhibiting such spontaneous seizures show generalized tonic-clonic seizures consisting of tonic, clonic, and post-seizure phases, which are similar to FCDII patients. In addition, it was confirmed that the tonic EEG showed tuned multi-frequency waves of low voltage and high frequency, the EEG in the clonic phase showed a certain pattern of high voltage, and the postictal phase showed a tuned attenuation amplitude. The frequency of seizures was approximately 10 times a day.

Example 10: TSC1 or TSC2 Neuron size analysis in mouse model

After electroencephalogram monitoring was completed, tissue perfusion was performed on mice with phosphate-buffered (PB) 4% paraformalde-hyde using a Masterflex compact peristaltic pump (Cole-Parmer Internation-al, USA), and the brain was removed. It was fixed in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, frozen overnight in 30% buffered sucrose, and stored at -80°C as a gelatin-embedded tissue mass (7.5% gelatin in 10% sucrose/PB). Cryosections (30 μm thick) were collected and placed on glass slides. Blocked with PBS-GT (0.2% gelatin and 0.2% Triton X-100 in PBS) for one hour at room temperature and stained with the following antibodies: mouse antibody to NeuN (1:500 dilution; MAB377, Millipore). Samples were washed with PBS and stained with the following secondary antibodies: Alexa Fluor 488-conjugated goat antibody to mouse (1:200 dilution; A11008, Invitrogen), Mounting DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were obtained using a Zeiss LSM780 confocal microscope (Zeiss LSM510 confocal microscope). The size of neurons was measured using ImageJ soft-ware (http://rsbweb.nih.gov/ij/).

In mice in which the TSC1 or TSC2 gene was locally removed from the cerebrum using a CRISPR/Cas9 plasmid, nerve cells significantly increased in size compared to normal nerve cells, but mouse nerve cells electroporated with only the plasmid without sgRNA showed no change in size. Confirmed. This is the same pattern as dysmorphic neurons that appear in patients with cerebral cortex development abnormalities.

Example 11: TSC2 Confirmation of spontaneous seizure changes due to drug administration in mouse model

Changes were confirmed after administering rapamycin to the animal model showing spontaneous seizures. Specifically, rapamycin (LC Labs, USA) was diluted to 20 mg/ml in 100% ethanol to prepare a stock solution and stored at -20°C. Before injecting rapamycin, the stock solution was diluted in 5% polyethleneglycol400 and 5% Tween80 to create a 1mg/ml rapamycin and 4% ethanol solution. The prepared solution was administered by intraperitoneal injection at a concentration of 1 to 10 mg/kg for 2 weeks (10 mg/kg/d intraperitoneal injection, for 2 weeks).

As can be seen in Figure 16, it was confirmed that almost no spontaneous seizures occurred in the animal model due to the administration of rapamycin.

Example 12: In animal models mTOR hyperactive Effects on cerebral development

The frequently observed p.Leu2427Pro genetic variant was selected for functional analysis in animal models. mTOR mutant constructs were introduced into rat embryos by electroporation, and cerebral neuron migration and S6 protein phosphorylation were examined.

12-1: Animal model manufacturing

Pregnant mice (E14) (Damul Science) were anesthetized with isoflurane (0.4L/min of oxygen and isoflurane vaporizer gauge 3 during surgery operation).

The uterine horn was exposed, and Fast Green (Fast Green) combined with 2 to 3 ug of plasmids expressing the mTOR C1483Y, mTOR E2419K and mTOR L2427P variants prepared in Example 2 was placed in the lateral ventricle of each embryo. F7252, Sigma, USA) 2ug/ml was injected using a pulled glass capillary. The plasmid was electroporated into the head of the embryo by discharging 50 V with an ECM830 eletroporator (BTX-harvard apparatus), which is five electric pulses of 100 ms at 900 ms intervals.

12-2: Image analysis of mouse model

Embryonic mice were electroporated at embryonic day 14 (E14), and brains were harvested 4 days after development (E18), fixed overnight in freshly prepared phosphate-buffered (PB) 4% paraformaldehyde, and cultured in 30% buffered sucrose. It was frozen overnight and stored at -80°C as a gelatin-embedded tissue mass (7.5% gelatin in 10% sucrose/PB).

Cryosections (30 μm thick) were collected and placed on glass slides. DAPI contained in the mounting solution (P36931, Life technology) was used for nuclear staining. Images were obtained using a Leica DMI3000 B inverted microscope or a Zeiss LSM510 confocal microscope. The fluorescence intensity, which shows the distribution of electroporated cells in the cortex, was converted to gray value and measured from the ventricular zone (VZ) to the cortical plate (CP) using ImageJ software ( It was measured using http://rsbweb.nih.gov/ij/). Mander's co-localization analysis (http://fiji.sc/wiki/index.php/Colocalization_Analysis) was performed using Fiji software.

12-3: Experiment results

As shown in Figure 17a, mTOR wild type and p.Leu2427Pro mutant constructs carrying the IRES-GFP marker were introduced into cerebral developing embryos on day 14 using electroporation, followed by cerebral neuron migration and GFP-positive neurons on embryonic day 18. S6 phosphorylation was measured.

As can be seen in Figure 17b, in brain tissue sections of mice expressing mTOR mutant constructs, GFP-positive neurons were reduced in the cortical plate and in the cerebral intermediate zone and subventricular zone. zone) was confirmed to be increased in the ventricular zone. Through this, it was proven that there was a problem with the movement of nerve cells.

In addition, as can be seen in Figure 17c, it was confirmed that GFP-positive cells expressing the mTOR mutant construct coexisted with cells with increased phosphorylation of the S6 protein. Through this, it was demonstrated that the discovered genetic mutation increases the activity of mTOR phosphorylation enzyme and inhibits the development of the cerebral cortex in animals.

Example 13: In animal models mTOR hyperactive Confirmation of patient's disease phenotype

13-1. Identification of spontaneous seizures or abnormal nerve cells in animal models

As shown in Figure 18a, to confirm whether mice expressing the mTOR variant construct by electroporation show spontaneous seizures, the variant construct was introduced by electroporation on embryonic day 14, and then the construct was introduced immediately after the embryo was born. Mouse fetuses that expressed well were selected based on the presence or absence of GFP expression.

Video electroencephalogram monitoring was performed starting 3 weeks after birth. After the fetus was separated from its mother, the onset of tonic-clonic seizures was checked through video surveillance for 12 hours a day. Afterwards, rats showing seizures were monitored with video-electroencephalography for more than 6 hours a day for 2 days, and spontaneous seizures showing epileptic waves were investigated.

Specifically, after the mouse was wet (>3 weeks), the occurrence of seizure was confirmed only through video monitoring, and then surgery was performed to implant electrodes for electroencephalogram measurement. The electrodes were located on the epidural layer, with two electrodes in the frontal lobe (AP+2.8mm, ML±1.5mm) and two in the temporal lobe (AP-2.4mm, ML±1.5mm) based on the bregma. 2.4mm) A total of 5 electrodes were installed, with one electrode implanted in the cerebellum area. After a 4-day recovery period, measurements were performed for 2 to 5 days (6 hours per day) per mouse from 6 PM to 2 AM. The signal was amplified by an amplifier (GRASS model 9 EEG/Polysomnograph, GRASS technologies, USA) and analyzed using the pCLAMP program (Molecular Devices, USA). Alternatively, analysis was performed using RHD2000 amplifier, board (Intan technoloties, USA) and MATLAB EEGLAB (http://sccn.ucsd.edu/eeglab).

To measure the frequency of interictal impulse waves and non-convulsive EEG seizures, video electroencephalogram data recorded over a period of 10 to 12 hours was used, and 1 minute of data was extracted at 1 hour intervals from this data and analyzed.

The frequency of interictal impulse waves and non-convulsive EEG seizures was measured by an observer who was unaware of the genotype of the rats. Interictal interictal waves are defined as epileptiform waves of less than 200 ms appearing at regular intervals and have an amplitude more than twice that of the background EEG. Non-convulsive EEG seizures are defined as at least two consecutive spike waves (1 to 4 Hz) appearing in the background EEG. It was defined as a case where the amplitude was more than twice that of that observed and was observed in all four electrodes.

As can be seen in Figures 18B and 18C, surprisingly, more than 90% of mice expressing mutant mTOR constructs exhibited spontaneous seizures accompanied by epileptiform waves, which consisted of high amplitude radiofrequency waves, high amplitude slow waves, and It showed low-amplitude high frequencies. As can be seen in Figure 12b, it was confirmed that interictal waves also appear in mice expressing the mutant construct. It was confirmed that mice exhibiting such spontaneous seizures show generalized tonic-clonic seizures consisting of tonic, clonic, and post-seizure phases, which are similar to FCDII patients. In addition, it was confirmed that the tonic EEG showed tuned multi-frequency waves of low voltage and high frequency, the EEG in the clonic phase showed a certain pattern of high voltage, and the postictal phase showed a tuned attenuation amplitude. However, as can be seen in Figure 18B, mice expressing the wild-type mTOR construct did not show spontaneous seizures or epileptiform waves.

Mice expressing the p.Leu2427Pro mutant construct began having seizures on average at about 6 weeks of age (Figure 18d), which was confirmed to be similar to the time when seizures appear in FCDII patients (about 4 years of age) when converted to humans. As can be seen in Figure 18E, the frequency of seizures was approximately 6 times per day.

After seizures were confirmed, mice expressing the mTOR mutant construct were examined to see whether they showed abnormal neuronal morphology such as giant neurons.

As a result, it was observed that the cell size of GFP-positive cells in the cerebral region electroporated with the mTOR mutant construct was greatly increased (FIG. 18f).

13-2. Check for spontaneous seizures or abnormal nerve cell changes due to drug administration

Changes were confirmed after administering rapamycin to the animal model showing spontaneous seizures or abnormal nerve cells.

Specifically, rapamycin and everolimus (LC Labs, USA) were diluted to 20 mg/ml in 100% ethanol to prepare a stock solution and stored at -20°C. Before injecting rapamycin, the stock solution was diluted in 5% polyethleneglycol400 and 5% Tween80 to create a 1mg/ml rapamycin and 4% ethanol solution. The prepared solution was administered by intraperitoneal injection at a concentration of 1 to 10 mg/kg for 2 weeks (10 mg/kg/d intraperitoneal injection, for 2 weeks).

Torin1 (TOCRIS) was diluted to 25 mg/ml in 100% N-methyl-2-pyrrolidone to prepare a stock solution and stored at -20°C. Afterwards, the stock solution was diluted with 50% PEG-400 to create a solution with a concentration of 1 mg/ml. The prepared solution was administered by intraperitoneal injection at a concentration of 1 to 10 mg/kg for 2 weeks (10 mg/kg/d intraperitoneal injection, for 2 weeks).

INK128 (Selleckchem) powder was diluted with 5% 1-methyl-2-pyrrolidionone, 15% polyvinylpyrrolidone K30, and 80% water to make a solution of 0.1 mg/ml, and then administered orally at 0.3 to 1.0 mg/kg for 2 weeks. .

AZD8055 (Selleckchem) powder was dissolved in captisol (Cydex) to make a 30% stock solution (w/v) and then orally administered at 2.5 to 20 mg/kg for 2 weeks.

GSK2126458 is dissolved in 1% DMSO/30% polyethylene glycol/1% Tween 80 to make a stock solution of 0.1 mg/ml, and then orally administered at a concentration of 0.1 to 1.0 mg/kg for 2 weeks.

As can be seen in FIGS. 18e, 18g, and 18h, it was confirmed that administration of rapamycin resulted in almost no spontaneous seizures in the animal model, and that the frequency of interictal impulse waves and non-convulsive EEG seizures was dramatically reduced.

Furthermore, as can be seen in Figure 18f, it was confirmed that the size of abnormal cells in the animal model was also reduced due to the administration of rapamycin.

<110> KOREA ADVANCED INSTITUTE OF SCIENCE AND TECHNOLOGY Yonsei University, University - Industry Foundation (UIF) <120> Composition for diagnosis or treatment of intractable epilepsy <130> DPP20160274KR <160> 30 <170> KopatentIn 1.71 <210> 1 <211 > 7650 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(7650) <223> wild type mTOR <400> 1 atgcttggaa ccggacctgc cgccgccacc accgctgcca ccacatctag caatgtgagc 60 gtcctgcagc agtttgcc ag tggcctaaag agccggaatg aggaaaccag ggccaaagcc 120 gccaaggagc tccagcacta tgtcaccatg gaactccgag agatgagtca agaggagtct 180 actcgcttct atgaccaact gaaccatcac atttttgaat tggtttccag ctcagatgcc 240 aatgagagga aaggtggcat cttggccata gctagcctca taggagtgga aggtgggaat 300 gccacccgaa ttggcagatt tgccaactat cttcggaacc tcctcccctc caatgaccca 360 gttgtcatgg aaatggcatc caaggccatt ggccgtcttg ccatggcagg ggacactttt 420 accgctgagt acgtggaatt tgaggtgaag cgagcc ctgg aatggctggg tgctgaccgc 480 aatgagggcc ggagacatgc agctgtcctg gttctccgtg agctggccat cagcgtccct 540 accttcttct tccagcaagt gcaacccttc tttgacaaca tttttgtggc cgtgtgggac 600 cccaaacagg ccatccgtga gggagctgta gccgcccttc gtgcctgtct gattctcaca 660 acccagcgtg agccgaagga gatgcagaag c ctcagtggt acaggcacac atttgaagaa 720 gcagagaagg gatttgatga gaccttggcc aaagagaagg gcatgaatcg ggatgatcgg 780 atccatggag ccttgttgat ccttaacgag ctggtccgaa tcagcagcat ggagggagag 840 cgtctgagag aagaaatgga agaaatca ca cagcagcagc tggtacacga caagtactgc 900 aaagatctca tgggcttcgg aacaaaacct cgtcacatta cccccttcac cagtttccag 960 gctgtacagc cccagcagtc aaatgccttg gtggggctgc tggggtacag ctctcaccaa 1020 ggcctcatgg gatttgggac ctcccccagt ccagctaagt ccaccctggt ggagagccgg 1080 tgttgcagag acttgatgga ggagaaattt gatcaggtgt gcc agtgggt gctgaaatgc 1140 aggaatagca agaactcgct gatccaaatg acaatcctta atttgttgcc ccgcttggct 1200 gcattccgac cttctgcctt cacagatacc cagtatctcc aagataccat gaaccatgtc 1260 ctaagctgtg tcaagaagga gaaggaacgt acag cggcct tccaagccct ggggctactt 1320 tctgtggctg tgaggtctga gtttaaggtc tatttgcctc gcgtgctgga catcatccga 1380 gcggccctgc ccccaaagga cttcgcccat aagaggcaga aggcaatgca ggtggatgcc 1440 acagtcttca cttgcatcag catgctggct cgagcaatgg ggccaggcat ccagcaggat 1500 atcaaggagc tgctggagcc catgctggca gtgggactaa gccctgccct cactgcagtg 1560 ctctacgacc tgagccgtca gattccacag ctaaagaagg acattcaaga tgggctactg 1620 aaaatgctgt ccctggtcct tatgcacaaa ccccttcgcc acccaggcat gcccaagggc 1680 ctggcccatc agctggcctc tcctggcctc acgaccctcc ctgaggccag cgatg tgggc 1740 agcatcactc ttgccctccg aacgcttggc agctttgaat ttgaaggcca ctctctgacc 1800 caatttgttc gccactgtgc ggatcatttc ctgaacagtg agcacaagga gatccgcatg 1860 gaggctgccc gcacctgctc ccgcctgctc acaccctcca tccacctcat cagtggccat 1920 gctcatgtgg ttagccagac cgcagtgcaa gtggtggcag atgtgcttag caaactgctc 19 80 gtagttggga taacagatcc tgaccctgac attcgctact gtgtcttggc gtccctggac 2040 gagcgctttg atgcacacct ggcccaggcg gagaacttgc aggccttgtt tgtggctctg 2100 aatgaccagg tgtttgagat ccgggagctg gccatctgca ctgtgggcc g actcagtagc 2160 atgaaccctg cctttgtcat gcctttcctg cgcaagatgc tcatccagat tttgacagag 2220 ttggagcaca gtgggattgg aagaatcaaa gagcagagtg cccgcatgct ggggcacctg 2280 gtctccaatg ccccccgact catccgcccc tacatggagc ctattctgaa ggcattaatt 2340 ttgaaactga aagatccaga ccctgatcca aacccaggtg tgatcaataa tgtcctggca 2400 acaataggag aattggcaca ggttagtggc ctggaaatga ggaaatgggt tgatgaactt 2460 tttattatca tcatggacat gctccaggat tcctctttgt tggccaaaag gcaggtggct 2520 ctgtggaccc tgggacagtt ggtggccagc actggctatg tagtagagcc ctacaggaag 2580 taccctactt tgcttgagg t gctactgaat tttctgaaga ctgagcagaa ccagggtaca 2640 cgcagagagg ccatccgtgt gttagggctt ttaggggctt tggatcctta caagcacaaa 2700 gtgaacattg gcatgataga ccagtcccgg gatgcctctg ctgtcagcct gtcagaatcc 2760 aagtcaagtc aggattcctc tgactatagc actagtgaaa tgctggtcaa catgggaaac 2820 ttgcctctgg atgagttcta ccc agctgtg tccatggtgg ccctgatgcg gatcttccga 2880 gaccagtcac tctctcatca tcacaccatg gttgtccagg ccatcacctt catcttcaag 2940 tccctgggac tcaaatgtgt gcagttcctg ccccaggtca tgccccacgtt ccttaacgtc 3000 attcga gtct gtgatggggc catccgggaa tttttgttcc agcagctggg aatgttggtg 3060 tcctttgtga agagccacat cagaccttat atggatgaaa tagtcaccct catgagagaa 3120 ttctgggtca tgaacacctc aattcagagc acgatcattc ttctcattga gcaaattgtg 3180 gtagctcttg ggggtgaatt taagctctac ctgccccagc tgatcccaca catgctgcgt 3240 gtcttcatgc atgacaacag cccaggccgc att gtctcta tcaagttact ggctgcaatc 3300 cagctgtttg gcgccaacct ggatgactac ctgcatttac tgctgcctcc tattgttaag 3360 ttgtttgatg cccctgaagc tccactgcca tctcgaaagg cagcgctaga gactgtggac 3420 cgcctgacgg agtccctgg a tttcactgac tatgcctccc ggatcattca ccctattgtt 3480 cgaacactgg accagagccc agaactgcgc tccacagcca tggacacgct gtcttcactt 3540 gtttttcagc tggggaagaa gtaccaaatt ttcattccaa tggtgaataa agttctggtg 3600 cgacaccgaa tcaatcatca gcgctatgat gtgctcatct gcagaattgt caagggatac 3660 acacttgctg atgaagagga ggatcctttg atttaccagc atcggatgct taggagtggc 3720 caaggggatg cattggctag tggaccagtg gaaacaggac ccatgaagaa actgcacgtc 3780 agcaccatca acctccaaaa ggcctggggc gctgccagga gggtctccaa agatgactgg 3840 ctggaatggc tgagacggct gagcctggag ctgctgaa gg actcatcatc gccctccctg 3900 cgctcctgct gggccctggc acaggcctac aacccgatgg ccagggatct cttcaatgct 3960 gcatttgtgt cctgctggtc tgaactgaat gaagatcaac aggatgagct catcagaagc 4020 atcgagttgg ccctcacctc acaagacatc gctgaagtca cacagaccct cttaaacttg 4080 gctgaattca tggaacacag tgacaagggc cccctgccac tgagagatga caatggcatt 4140 gttctgctgg gtgagagagc tgccaagtgc cgagcatatg ccaaagcact acactacaaa 4200 gaactggagt tccagaaagg ccccacccct gccattctag aatctctcat cagcattaat 4260 aataagctac agcagccgga ggcagcggcc ggagtgttag aatatgccat gaaac acttt 4320 ggagagctgg agatccaggc tacctggtat gagaaactgc acgagtggga ggatgccctt 4380 gtggcctatg acaagaaaat ggacaccaac aaggacgacc cagagctgat gctgggccgc 4440 atgcgctgcc tcgaggcctt gggggaatgg ggtcaactcc accagcagtg ctgtgaaaag 4500 tggaccctgg ttaatgatga gacccaagcc aagatggccc ggatggctgc tgcagct gca 4560 tggggtttag gtcagtggga cagcatggaa gaatacacct gtatgatccc tcgggacacc 4620 catgatgggg cattttatag agctgtgctg gcactgcatc aggacctctt ctccttggca 4680 caacagtgca ttgacaaggc cagggacctg ctggatgctg aattaactgc gat ggcagga 4740 gagagttaca gtcgggcata tggggccatg gtttcttgcc acatgctgtc cgagctggag 4800 gaggttatcc agtacaaact tgtccccgag cgacgagaga tcatccgcca gatctggtgg 4860 gagagactgc agggctgcca gcgtatcgta gaggactggc agaaaatcct tatggtgcgg 4920 tcccttgtgg tcagccctca tgaagacatg agaacctggc tcaagtatgc aagcctgtgc 498 0 ggcaagagtg gcaggctggc tcttgctcat aaaactttag tgttgctcct gggagttgat 5040 ccgtctcggc aacttgacca tcctctgcca acagttcacc ctcaggtgac ctatgcctac 5100 atgaaaaaca tgtggaagag tgcccgcaag atcgatgcct tccagcacat g cagcatttt 5160 gtccagacca tgcagcaaca ggcccagcat gccatcgcta ctgaggacca gcagcataag 5220 caggaactgc acaagctcat ggcccgatgc ttcctgaaac ttggagagtg gcagctgaat 5280 ctacagggca tcaatgagag cacaatcccc aaagtgctgc agtactacag cgccgccaca 5340 gagcacgacc gcagctggta caaggcctgg catgcgtggg cagtgatgaa cttcgaagct 5400 gtg ctacact acaaacatca gaaccaagcc cgcgatgaga agaagaaact gcgtcatgcc 5460 agcggggcca acatcaccaa cgccaccact gccgccacca cggccgccac tgccaccacc 5520 actgccagca ccgagggcag caacagtgag agcgaggccg agagcaccga gaacagcccc 5580 accccatcg c cgctgcagaa gaaggtcact gaggatctgt ccaaaaccct cctgatgtac 5640 acggtgcctg ccgtccaggg cttcttccgt tccatctcct tgtcacgagg caacaacctc 5700 caggatacac tcagagttct caccttatgg tttgattatg gtcactggcc agatgtcaat 5760 gaggccttag tggagggggt gaaagccatc cagattgata cctggctaca ggttatacct 5820 cagctcattg caagaattga tacgcccaga cccttggtgg gacgtctcat tcaccagctt 5880 ctcacagaca ttggtcggta ccacccccag gccctcatct acccactgac agtggcttct 5940 aagtctacca cgacagcccg gcacaatgca gccaacaaga ttctgaagaa catgtgtgag 6000 cacagcaaca ccctggtcca gcagg ccatg atggtgagcg aggagctgat ccgagtggcc 6060 atcctctggc atgagatgtg gcatgaaggc ctggaagagg catctcgttt gtactttggg 6120 gaaaggaacg tgaaaggcat gtttgaggtg ctggagccct tgcatgctat gatggaacgg 6180 ggcccccaga ctctgaagga aacatccttt aatcaggcct atggtcgaga tttaatggag 6240 gcccaagagt ggtgcaggaa gtacatgaaa t cagggaatg tcaaggacct cacccaagcc 6300 tgggacctct attatcatgt gttccgacga atctcaaagc agctgcctca gctcacatcc 6360 ttagagctgc aatatgtttc cccaaaactt ctgatgtgcc gggaccttga attggctgtg 6420 ccaggaacat atgaccccaa ccagc caatc attcgcattc agtccatagc accgtctttg 6480 caagtcatca catccaagca gaggccccgg aaattgacac ttatgggcag caacggacat 6540 gagtttgttt tccttctaaa aggccatgaa gatctgcgcc aggatgagcg tgtgatgcag 6600 ctcttcggcc tggttaacac ccttctggcc aatgacccaa catctcttcg gaaaaaacctc 6660 agcatccaga gatacgctgt catcccttta tcgaccaact c gggcctcat tggctgggtt 6720 ccccactgtg acacactgca cgccctcatc cgggactaca gggagaagaa gaagatcctt 6780 ctcaacatcg agcatcgcat catgttgcgg atggctccgg actatgacca cttgactctg 6840 atgcagaagg tggaggtgtt tgagcatgcc gtca ataata cagctgggga cgacctggcc 6900 aagctgctgt ggctgaaaag ccccagctcc gaggtgtggt ttgaccgaag aaccaattat 6960 acccgttctt tagcggtcat gtcaatggtt gggtatattt taggcctggg agatagacac 7020 ccatccaacc tgatgctgga ccgtctgagt gggaagatcc tgcacattga ctttggggac 7080 tgctttgagg ttgctatgac ccgagagaag tttccagaga agattccatt tagactaaca 7140 agaatgttga ccaatgctat ggaggttaca ggcctggatg gcaactacag aatcacatgc 7200 cacacagtga tggaggtgct gcgagagcac aaggacagtg tcatggccgt gctggaagcc 7260 tttgtctatg accccttgct gaactggagg ctgatggaca ca aataccaa aggcaacaag 7320 cgatcccgaa cgaggacgga ttcctactct gctggccagt cagtcgaaat tttggacggt 7380 gtggaacttg gagagccagc ccataagaaa acggggacca cagtgccaga atctattcat 7440 tctttcattg gagacggttt ggtgaaacca gaggccctaa ataagaaagc tatccagatt 7500 attaacaggg ttcgagataa gctcactggt cgggacttct ctcatgatga cactttggat 7560 gttcca acgc aagttgagct gctcatcaaa caagcgacat cccatgaaaa cctctgccag 7620 tgctatattg gctggtgccc tttctggtaa 7650 <210> 2 <211> 2549 <212> PRT <213> Homo sapiens < 220> <221> PEPTIDE <222> (1)..(2549) <223> wild type mTOR <400> 2 Met Leu Gly Thr Gly Pro Ala Ala Ala Thr Thr Ala Ala Thr Thr Ser 1 5 10 15 Ser Asn Val Ser Val Leu Gln Gln Phe Ala Ser Gly Leu Lys Ser Arg 20 25 30 Asn Glu Glu Thr Arg Ala Lys Ala Ala Lys Glu Leu Gln His Tyr Val 35 40 45 Thr Met Glu Leu Arg Glu Met Ser Gln Glu Glu Ser Thr Arg Phe Tyr 50 55 60 Asp Gln Leu Asn His His Ile Phe Glu Leu Val Ser Ser Ser Asp Ala 65 70 75 80 Asn Glu Arg Lys Gly Gly Ile Leu Ala Ile Ala Ser Leu Ile Gly Val 85 90 95 Glu Gly Gly Asn Ala Thr Arg Ile Gly Arg Phe Ala Asn Tyr Leu Arg 100 105 110 Asn Leu Leu Pro Ser Asn Asp Pro Val Val Met Glu Met Ala Ser Lys 115 120 125 Ala Ile Gly Arg Leu Ala Met Ala Gly Asp Thr Phe Thr Ala Glu Tyr 130 135 140 Val Glu Phe Glu Val Lys Arg Ala Leu Glu Trp Leu Gly Ala Asp Arg 145 150 155 160 Asn Glu Gly Arg Arg His Ala Ala Val Leu Val Leu Arg Glu Leu Ala 165 170 175 Ile Ser Val Pro Thr Phe Phe Phe Gln Gln Val Gln Pro Phe Phe Asp 180 185 190 Asn Ile Phe Val Ala Val Trp Asp Pro Lys Gln Ala Ile Arg Glu Gly 195 200 205 Ala Val Ala Ala Leu Arg Ala Cys Leu Ile Leu Thr Thr Gln Arg Glu 210 215 220 Pro Lys Glu Met Gln Lys Pro Gln Trp Tyr Arg His Thr Phe Glu Glu 225 230 235 240 Ala Glu Lys Gly Phe Asp Glu Thr Leu Ala Lys Glu Lys Gly Met Asn 245 250 255 Arg Asp Asp Arg Ile His Gly Ala Leu Leu Ile Leu Asn Glu Leu Val 260 265 270 Arg Ile Ser Ser Met Glu Gly Glu Arg Leu Arg Glu Glu Met Glu Glu 275 280 285 Ile Thr Gln Gln Gln Leu Val His Asp Lys Tyr Cys Lys Asp Leu Met 290 295 300 Gly Phe Gly Thr Lys Pro Arg His Ile Thr Pro Phe Thr Ser Phe Gln 305 310 315 320 Ala Val Gln Pro Gln Gln Ser Asn Ala Leu Val Gly Leu Leu Gly Tyr 325 330 335 Ser Ser His Gln Gly Leu Met Gly Phe Gly Thr Ser Pro Ser Pro Ala 340 345 350 Lys Ser Thr Leu Val Glu Ser Arg Cys Cys Arg Asp Leu Met Glu Glu 355 360 365 Lys Phe Asp Gln Val Cys Gln Trp Val Leu Lys Cys Arg Asn Ser Lys 370 375 380 Asn Ser Leu Ile Gln Met Thr Ile Leu Asn Leu Leu Pro Arg Leu Ala 385 390 395 400 Ala Phe Arg Pro Ser Ala Phe Thr Asp Thr Gln Tyr Leu Gln Asp Thr 405 410 415 Met Asn His Val Leu Ser Cys Val Lys Lys Glu Lys Glu Arg Thr Ala 420 425 430 Ala Phe Gln Ala Leu Gly Leu Leu Ser Val Ala Val Arg Ser Glu Phe 435 440 445 Lys Val Tyr Leu Pro Arg Val Leu Asp Ile Ile Arg Ala Ala Leu Pro 450 455 460 Pro Lys Asp Phe Ala His Lys Arg Gln Lys Ala Met Gln Val Asp Ala 465 470 475 480 Thr Val Phe Thr Cys Ile Ser Met Leu Ala Arg Ala Met Gly Pro Gly 485 490 495 Ile Gln Gln Asp Ile Lys Glu Leu Leu Glu Pro Met Leu Ala Val Gly 500 505 510 Leu Ser Pro Ala Leu Thr Ala Val Leu Tyr Asp Leu Ser Arg Gln Ile 515 520 525 Pro Gln Leu Lys Lys Asp Ile Gln Asp Gly Leu Leu Lys Met Leu Ser 530 535 540 Leu Val Leu Met His Lys Pro Leu Arg His Pro Gly Met Pro Lys Gly 545 550 555 560 Leu Ala His Gln Leu Ala Ser Pro Gly Leu Thr Thr Leu Pro Glu Ala 565 570 575 Ser Asp Val Gly Ser Ile Thr Leu Ala Leu Arg Thr Leu Gly Ser Phe 580 585 590 Glu Phe Glu Gly His Ser Leu Thr Gln Phe Val Arg His Cys Ala Asp 595 600 605 His Phe Leu Asn Ser Glu His Lys Glu Ile Arg Met Glu Ala Ala Arg 610 615 620 Thr Cys Ser Arg Leu Leu Thr Pro Ser Ile His Leu Ile Ser Gly His 625 630 635 640 Ala His Val Val Ser Gln Thr Ala Val Gln Val Val Ala Asp Val Leu 645 650 655 Ser Lys Leu Leu Val Val Gly Ile Thr Asp Pro Asp Pro Asp Ile Arg 660 665 670 Tyr Cys Val Leu Ala Ser Leu Asp Glu Arg Phe Asp Ala His Leu Ala 675 680 685 Gln Ala Glu Asn Leu Gln Ala Leu Phe Val Ala Leu Asn Asp Gln Val 690 695 700 Phe Glu Ile Arg Glu Leu Ala Ile Cys Thr Val Gly Arg Leu Ser Ser 705 710 715 720 Met Asn Pro Ala Phe Val Met Pro Phe Leu Arg Lys Met Leu Ile Gln 725 730 735 Ile Leu Thr Glu Leu Glu His Ser Gly Ile Gly Arg Ile Lys Glu Gln 740 745 750 Ser Ala Arg Met Leu Gly His Leu Val Ser Asn Ala Pro Arg Leu Ile 755 760 765 Arg Pro Tyr Met Glu Pro Ile Leu Lys Ala Leu Ile Leu Lys Leu Lys 770 775 780 Asp Pro Asp Pro Asp Pro Asn Pro Gly Val Ile Asn Asn Val Leu Ala 785 790 795 800 Thr Ile Gly Glu Leu Ala Gln Val Ser Gly Leu Glu Met Arg Lys Trp 805 810 815 Val Asp Glu Leu Phe Ile Ile Ile Met Asp Met Leu Gln Asp Ser Ser 820 825 830 Leu Leu Ala Lys Arg Gln Val Ala Leu Trp Thr Leu Gly Gln Leu Val 835 840 845 Ala Ser Thr Gly Tyr Val Val Glu Pro Tyr Arg Lys Tyr Pro Thr Leu 850 855 860 Leu Glu Val Leu Leu Asn Phe Leu Lys Thr Glu Gln Asn Gln Gly Thr 865 870 875 880 Arg Arg Glu Ala Ile Arg Val Leu Gly Leu Leu Gly Ala Leu Asp Pro 885 890 895 Tyr Lys His Lys Val Asn Ile Gly Met Ile Asp Gln Ser Arg Asp Ala 900 905 910 Ser Ala Val Ser Leu Ser Glu Ser Lys Ser Ser Gln Asp Ser Ser Asp 915 920 925 Tyr Ser Thr Ser Glu Met Leu Val Asn Met Gly Asn Leu Pro Leu Asp 930 935 940 Glu Phe Tyr Pro Ala Val Ser Met Val Ala Leu Met Arg Ile Phe Arg 945 950 955 960 Asp Gln Ser Leu Ser His His His Thr Met Val Val Gln Ala Ile Thr 965 970 975 Phe Ile Phe Lys Ser Leu Gly Leu Lys Cys Val Gln Phe Leu Pro Gln 980 985 990 Val Met Pro Thr Phe Leu Asn Val Ile Arg Val Cys Asp Gly Ala Ile 995 1000 1005 Arg Glu Phe Leu Phe Gln Gln Leu Gly Met Leu Val Ser Phe Val Lys 1010 1015 1020 Ser His Ile Arg Pro Tyr Met Asp Glu Ile Val Thr Leu Met Arg Glu 1025 1030 1035 1040 Phe Trp Val Met Asn Thr Ser Ile Gln Ser Thr Ile Ile Leu Leu Ile 1045 1050 1055 Glu Gln Ile Val Val Ala Leu Gly Gly Glu Phe Lys Leu Tyr Leu Pro 1060 1065 1070 Gln Leu Ile Pro His Met Leu Arg Val Phe Met His Asp Asn Ser Pro 1075 1080 1085 Gly Arg Ile Val Ser Ile Lys Leu Leu Ala Ala Ile Gln Leu Phe Gly 1090 1095 1100 Ala Asn Leu Asp Asp Tyr Leu His Leu Leu Leu Pro Pro Ile Val Lys 1105 1110 1115 1120 Leu Phe Asp Ala Pro Glu Ala Pro Leu Pro Ser Arg Lys Ala Ala Leu 1125 1130 1135 Glu Thr Val Asp Arg Leu Thr Glu Ser Leu Asp Phe Thr Asp Tyr Ala 1140 1145 1150 Ser Arg Ile Ile His Pro Ile Val Arg Thr Leu Asp Gln Ser Pro Glu 1155 1160 1165 Leu Arg Ser Thr Ala Met Asp Thr Leu Ser Ser Leu Val Phe Gln Leu 1170 1175 1180 Gly Lys Lys Tyr Gln Ile Phe Ile Pro Met Val Asn Lys Val Leu Val 1185 1190 1195 1200 Arg His Arg Ile Asn His Gln Arg Tyr Asp Val Leu Ile Cys Arg Ile 1205 1210 1215 Val Lys Gly Tyr Thr Leu Ala Asp Glu Glu Glu Asp Pro Leu Ile Tyr 1220 1225 1230 Gln His Arg Met Leu Arg Ser Gly Gln Gly Asp Ala Leu Ala Ser Gly 1235 1240 1245 Pro Val Glu Thr Gly Pro Met Lys Lys Leu His Val Ser Thr Ile Asn 1250 1255 1260 Leu Gln Lys Ala Trp Gly Ala Ala Arg Arg Val Ser Lys Asp Asp Trp 1265 1270 1275 1280 Leu Glu Trp Leu Arg Arg Leu Ser Leu Glu Leu Leu Lys Asp Ser Ser 1285 1290 1295 Ser Pro Ser Leu Arg Ser Cys Trp Ala Leu Ala Gln Ala Tyr Asn Pro 1300 1305 1310 Met Ala Arg Asp Leu Phe Asn Ala Ala Phe Val Ser Cys Trp Ser Glu 1315 1320 1325 Leu Asn Glu Asp Gln Gln Asp Glu Leu Ile Arg Ser Ile Glu Leu Ala 1330 1335 1340 Leu Thr Ser Gln Asp Ile Ala Glu Val Thr Gln Thr Leu Leu Asn Leu 1345 1350 1355 1360 Ala Glu Phe Met Glu His Ser Asp Lys Gly Pro Leu Pro Leu Arg Asp 1365 1370 1375 Asp Asn Gly Ile Val Leu Leu Gly Glu Arg Ala Ala Lys Cys Arg Ala 1380 1385 1390 Tyr Ala Lys Ala Leu His Tyr Lys Glu Leu Glu Phe Gln Lys Gly Pro 1395 1400 1405 Thr Pro Ala Ile Leu Glu Ser Leu Ile Ser Ile Asn Asn Lys Leu Gln 1410 1415 1420 Gln Pro Glu Ala Ala Ala Gly Val Leu Glu Tyr Ala Met Lys His Phe 1425 1430 1435 1440 Gly Glu Leu Glu Ile Gln Ala Thr Trp Tyr Glu Lys Leu His Glu Trp 1445 1450 1455 Glu Asp Ala Leu Val Ala Tyr Asp Lys Lys Met Asp Thr Asn Lys Asp 1460 1465 1470 Asp Pro Glu Leu Met Leu Gly Arg Met Arg Cys Leu Glu Ala Leu Gly 1475 1480 1485 Glu Trp Gly Gln Leu His Gln Gln Cys Cys Glu Lys Trp Thr Leu Val 1490 1495 1500 Asn Asp Glu Thr Gln Ala Lys Met Ala Arg Met Ala Ala Ala Ala Ala 1505 1510 1515 1520 Trp Gly Leu Gly Gln Trp Asp Ser Met Glu Glu Tyr Thr Cys Met Ile 1525 1530 1535 Pro Arg Asp Thr His Asp Gly Ala Phe Tyr Arg Ala Val Leu Ala Leu 1540 1545 1550 His Gln Asp Leu Phe Ser Leu Ala Gln Gln Cys Ile Asp Lys Ala Arg 1555 1560 1565 Asp Leu Leu Asp Ala Glu Leu Thr Ala Met Ala Gly Glu Ser Tyr Ser 1570 1575 1580 Arg Ala Tyr Gly Ala Met Val Ser Cys His Met Leu Ser Glu Leu Glu 1585 1590 1595 1600 Glu Val Ile Gln Tyr Lys Leu Val Pro Glu Arg Arg Glu Ile Ile Arg 1605 1610 1615 Gln Ile Trp Trp Glu Arg Leu Gln Gly Cys Gln Arg Ile Val Glu Asp 1620 1625 1630 Trp Gln Lys Ile Leu Met Val Arg Ser Leu Val Val Ser Pro His Glu 1635 1640 1645 Asp Met Arg Thr Trp Leu Lys Tyr Ala Ser Leu Cys Gly Lys Ser Gly 1650 1655 1660 Arg Leu Ala Leu Ala His Lys Thr Leu Val Leu Leu Leu Gly Val Asp 1665 1670 1675 1680 Pro Ser Arg Gln Leu Asp His Pro Leu Pro Thr Val His Pro Gln Val 1685 1690 1695 Thr Tyr Ala Tyr Met Lys Asn Met Trp Lys Ser Ala Arg Lys Ile Asp 1700 1705 1710 Ala Phe Gln His Met Gln His Phe Val Gln Thr Met Gln Gln Gln Ala 1715 1720 1725 Gln His Ala Ile Ala Thr Glu Asp Gln Gln His Lys Gln Glu Leu His 1730 1735 1740 Lys Leu Met Ala Arg Cys Phe Leu Lys Leu Gly Glu Trp Gln Leu Asn 1745 1750 1755 1760 Leu Gln Gly Ile Asn Glu Ser Thr Ile Pro Lys Val Leu Gln Tyr Tyr 1765 1770 1775 Ser Ala Ala Thr Glu His Asp Arg Ser Trp Tyr Lys Ala Trp His Ala 1780 1785 1790 Trp Ala Val Met Asn Phe Glu Ala Val Leu His Tyr Lys His Gln Asn 1795 1800 1805 Gln Ala Arg Asp Glu Lys Lys Lys Leu Arg His Ala Ser Gly Ala Asn 1810 1815 1820 Ile Thr Asn Ala Thr Thr Ala Ala Thr Thr Ala Ala Thr Ala Thr Thr 1825 1830 1835 1840 Thr Ala Ser Thr Glu Gly Ser Asn Ser Glu Ser Glu Ala Glu Ser Thr 1845 1850 1855 Glu Asn Ser Pro Thr Pro Ser Pro Leu Gln Lys Lys Val Thr Glu Asp 1860 1865 1870 Leu Ser Lys Thr Leu Leu Met Tyr Thr Val Pro Ala Val Gln Gly Phe 1875 1880 1885 Phe Arg Ser Ile Ser Leu Ser Arg Gly Asn Asn Leu Gln Asp Thr Leu 1890 1895 1900 Arg Val Leu Thr Leu Trp Phe Asp Tyr Gly His Trp Pro Asp Val Asn 1905 1910 1915 1920 Glu Ala Leu Val Glu Gly Val Lys Ala Ile Gln Ile Asp Thr Trp Leu 1925 1930 1935 Gln Val Ile Pro Gln Leu Ile Ala Arg Ile Asp Thr Pro Arg Pro Leu 1940 1945 1950 Val Gly Arg Leu Ile His Gln Leu Leu Thr Asp Ile Gly Arg Tyr His 1955 1960 1965 Pro Gln Ala Leu Ile Tyr Pro Leu Thr Val Ala Ser Lys Ser Thr Thr 1970 1975 1980 Thr Ala Arg His Asn Ala Ala Asn Lys Ile Leu Lys Asn Met Cys Glu 1985 1990 1995 2000 His Ser Asn Thr Leu Val Gln Gln Ala Met Met Val Ser Glu Glu Leu 2005 2010 2015 Ile Arg Val Ala Ile Leu Trp His Glu Met Trp His Glu Gly Leu Glu 2020 2025 2030 Glu Ala Ser Arg Leu Tyr Phe Gly Glu Arg Asn Val Lys Gly Met Phe 2035 2040 2045 Glu Val Leu Glu Pro Leu His Ala Met Met Glu Arg Gly Pro Gln Thr 2050 2055 2060 Leu Lys Glu Thr Ser Phe Asn Gln Ala Tyr Gly Arg Asp Leu Met Glu 2065 2070 2075 2080 Ala Gln Glu Trp Cys Arg Lys Tyr Met Lys Ser Gly Asn Val Lys Asp 2085 2090 2095 Leu Thr Gln Ala Trp Asp Leu Tyr Tyr His Val Phe Arg Arg Ile Ser 2100 2105 2110 Lys Gln Leu Pro Gln Leu Thr Ser Leu Glu Leu Gln Tyr Val Ser Pro 2115 2120 2125 Lys Leu Leu Met Cys Arg Asp Leu Glu Leu Ala Val Pro Gly Thr Tyr 2130 2135 2140 Asp Pro Asn Gln Pro Ile Ile Arg Ile Gln Ser Ile Ala Pro Ser Leu 2145 2150 2155 2160 Gln Val Ile Thr Ser Lys Gln Arg Pro Arg Lys Leu Thr Leu Met Gly 2165 2170 2175 Ser Asn Gly His Glu Phe Val Phe Leu Leu Lys Gly His Glu Asp Leu 2180 2185 2190 Arg Gln Asp Glu Arg Val Met Gln Leu Phe Gly Leu Val Asn Thr Leu 2195 2200 2205 Leu Ala Asn Asp Pro Thr Ser Leu Arg Lys Asn Leu Ser Ile Gln Arg 2210 2215 2220 Tyr Ala Val Ile Pro Leu Ser Thr Asn Ser Gly Leu Ile Gly Trp Val 2225 2230 2235 2240 Pro His Cys Asp Thr Leu His Ala Leu Ile Arg Asp Tyr Arg Glu Lys 2245 2250 2255 Lys Lys Ile Leu Leu Asn Ile Glu His Arg Ile Met Leu Arg Met Ala 2260 2265 2270 Pro Asp Tyr Asp His Leu Thr Leu Met Gln Lys Val Glu Val Phe Glu 2275 2280 2285 His Ala Val Asn Asn Thr Ala Gly Asp Asp Leu Ala Lys Leu Leu Trp 2290 2295 2300 Leu Lys Ser Pro Ser Ser Glu Val Trp Phe Asp Arg Arg Thr Asn Tyr 2305 2310 2315 2320 Thr Arg Ser Leu Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu 2325 2330 2335 Gly Asp Arg His Pro Ser Asn Leu Met Leu Asp Arg Leu Ser Gly Lys 2340 2345 2350 Ile Leu His Ile Asp Phe Gly Asp Cys Phe Glu Val Ala Met Thr Arg 2355 2360 2365 Glu Lys Phe Pro Glu Lys Ile Pro Phe Arg Leu Thr Arg Met Leu Thr 2370 2375 2380 Asn Ala Met Glu Val Thr Gly Leu Asp Gly Asn Tyr Arg Ile Thr Cys 2385 2390 2395 2400 His Thr Val Met Glu Val Leu Arg Glu His Lys Asp Ser Val Met Ala 2405 2410 2415 Val Leu Glu Ala Phe Val Tyr Asp Pro Leu Leu Asn Trp Arg Leu Met 2420 2425 2430 Asp Thr Asn Thr Lys Gly Asn Lys Arg Ser Arg Thr Arg Thr Asp Ser 2435 2440 2445 Tyr Ser Ala Gly Gln Ser Val Glu Ile Leu Asp Gly Val Glu Leu Gly 2450 2455 2460 Glu Pro Ala His Lys Lys Thr Gly Thr Thr Val Pro Glu Ser Ile His 2465 2470 2475 2480 Ser Phe Ile Gly Asp Gly Leu Val Lys Pro Glu Ala Leu Asn Lys Lys 2485 2490 2495 Ala Ile Gln Ile Ile Asn Arg Val Arg Asp Lys Leu Thr Gly Arg Asp 2500 2505 2510 Phe Ser His Asp Asp Thr Leu Asp Val Pro Thr Gln Val Glu Leu Leu 2515 2520 2525 Ile Lys Gln Ala Thr Ser His Glu Asn Leu Cys Gln Cys Tyr Ile Gly 2530 2535 2540 Trp Cys Pro Phe Trp 2545 < 210> 3 <211> 3495 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(3495) <223> wild type TSC1 <400> 3 atggcccaac aagcaaatgt cggggagctt cttgccatgc tggactcccc catgctgggt 60 gtgcgggacg acgtgacagc tgtctttaaa gagaacctca attctgaccg tggccctatg 120 cttgtaaaca ccttggtgga ttattacctg gaaaccagct ctcagccggc attgcacatc 180 ctgaccacct tgcaagagcc acatgacaag cacctcttgg acaggattaa cgaatatg tg 240 ggcaaagccg ccactcgttt atccatcctc tcgttactgg gtcatgtcat aagactgcag 300 ccatcttgga agcataagct ctctcaagca cctcttttgc cttctttact aaaatgtctc 360 aagatggaca ctgacgtcgt tgtcctcaca acaggcgtct tggt gttgat aaccatgcta 420 ccaatgattc cacagtctgg gaaacagcat cttcttgatt tctttgacat ttttggccgt 480 ctgtcatcat ggtgcctgaa gaaaccaggc cacgtggcgg aagtctatct cgtccatctc 540 catgccagtg tgtacgcact ctttcatcgc ctttatggaa tgtacccttg caacttcgtc 600 tcctttttgc gttctcatta cagtatgaaa gaaaacctgg agactttt ga agaagtggtc 660 aagccaatga tggagcatgt gcgaattcat ccggaattag tgactggatc caaggaccat 720 gaactggacc ctcgaaggtg gaagagatta gaaactcatg atgttgtgat cgagtgtgcc 780 aaaatctctc tggatcccac agaagcctca tatgaagatg gctattct gt gtctcaccaa 840 atctcagccc gctttcctca tcgttcagcc gatgtcacca ccagccctta tgctgacaca 900 cagaatagct atgggtgtgc tacttctacc ccttactcca cgtctcggct gatgttgtta 960 aatatgccag ggcagctacc tcagactctg agttccccat cgacacggct gataactgaa 1020 ccaccacaag ctactctttg gagcccatct atggtttgtg gtatgaccac tcctccaact 1080 t ctcctggaa atgtcccacc tgatctgtca cacccttaca gtaaagtctt tggtacaact 1140 gcaggtggaa aaggaactcc tctgggaacc ccagcaacct ctcctcctcc agccccactc 1200 tgtcattcgg atgactacgt gcacatttca ctcccccagg ccacagtcac acccccccagg 126 0 aaggaagaga gaatggattc tgcaagacca tgtctacaca gacaacacca tcttctgaat 1320 gacagaggat cagaagagcc acctggcagc aaaggttctg tcactctaag tgatcttcca 1380 gggtttttag gtgatctggc ctctgaagaa gatagtattg aaaaagataa agaagaagct 1440 gcaatatcta gagaactttc tgagatcacc acagcagagg cagagcctgt ggttcctcga 1500 ggaggct ttg actctccctt ttaccgagac agtctcccag gttctcagcg gaagacccac 1560 tcggcagcct ccagttctca gggcgccagc gtgaaccctg agcctttaca ctcctccctg 1620 gacaagcttg ggcctgacac accaaagcaa gcctttactc ccatagacct gccctgcgg c 1680 agtgctgatg aaagccctgc gggagacagg gaatgccaga cttctttgga gaccagtatc 1740 ttcactccca gtccttgtaa aattccacct ccgacgagag tgggctttgg aagcgggcag 1800 cctcccccgt atgatcatct ttttgaggtg gcattgccaa agacagccca tcattttgtc 1860 atcaggaaga ctgaggagct gttaaagaaa gcaaaaggaa acacagagga agatggtgtg 1920 ccctctacct ccccaat gga agtgctggac agactgatac agcagggagc agacgcgcac 1980 agcaaggagc tgaacaagtt gcctttaccc agcaagtctg tcgactggac ccactttgga 2040 ggctctcctc cttcagatga gatccgcacc ctccgagacc agttgctttt actgcacaac 21 00 cagttactct atgagcgttt taagaggcag cagcatgccc tccggaacag gcggctcctc 2160 cgcaaggtga tcaaagcagc agctctggag gaacataatg ctgccatgaa agatcagttg 2220 aagttacaag agaaggacat ccagatgtgg aaggttagtc tgcagaaaga acaagctaga 2280 tacaatcagc tccaggagca gcgtgacact atggtaacca agctccacag ccagatcaga 2340 cagctgcagc atgaccgaga ggaattctac aaccagagcc aggaattaca gacgaagctg 2400 gaggactgca ggaacatgat tgcggagctg cggatagaac tgaagaaggc caacaacaag 2460 gtgtgtcaca ctgagctgct gctcagtcag gtttcccaaa agctctcaaa cagtgagtcg 2520 gtccagcagc agatggagtt cttgaaca gg cagctgttgg ttcttgggga ggtcaacgag 2580 ctctatttgg aacaactgca gaacaagcac tcagatacca caaaggaagt agaaatgatg 2640 aaagccgcct atcggaaaga gctagaaaaa aacagaagcc atgttctcca gcagactcag 2700 aggcttgata cctcccaaaa acggattttg gaactggaat ctcacctggc caagaaagac 2760 caccttcttt tggaacagaa gaaatatcta gaggatgtca aact ccaggc aagaggacag 2820 ctgcaggccg cagagagcag gtatgaggct cagaaaagga taacccaggt gtttgaattg 2880 gagatcttag atttatatgg caggttggag aaagatggcc tcctgaaaaa acttgaagaa 2940 gaaaaaagcag aagcagctga agcagcagaa gaaaggcttg actgt tgtaa tgacgggtgc 3000 tcagattcca tggtagggca caatgaagag gcatctggcc acaacggtga gaccaagacc 3060 cccaggccca gcagcgcccg gggcagtagt ggaagcagag gtggtggagg cagcagcagc 3120 agcagcagcg agctttctac cccagagaaa cccccacacc agagggcagg cccattcagc 3180 agtcggtggg agacgactat gggagaagcg tctgccagca tcccc accac tgtgggctca 3240 cttcccagtt caaaaagctt cctgggtatg aaggctcgag agttatttcg taataagagc 3300 gagagccagt gtgatgagga cggcatgacc agtagccttt ctgagagcct aaagacagaa 3360 ctgggcaaag acttgggtgt ggaagccaag at tcccctga acctagatgg ccctcacccg 3420 tctccccccga ccccggacag tgttggacag ctacatatca tggactacaa tgagactcat 3480 catgaacaca gctaa 3495 <210> 4 <211> 1164 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(1164) <223> wild type TSC1 <400> 4 Met Ala Gln Gln Ala Asn Val Gly Glu Leu Leu Ala Met Leu Asp Ser 1 5 10 15 Pro Met Leu Gly Val Arg Asp Asp Val Thr Ala Val Phe Lys Glu Asn 20 25 30 Leu Asn Ser Asp Arg Gly Pro Met Leu Val Asn Thr Leu Val Asp Tyr 35 40 45 Tyr Leu Glu Thr Ser Ser Gln Pro Ala Leu His Ile Leu Thr Thr Leu 50 55 60 Gln Glu Pro His Asp Lys His Leu Leu Asp Arg Ile Asn Glu Tyr Val 65 70 75 80 Gly Lys Ala Ala Thr Arg Leu Ser Ile Leu Ser Leu Leu Gly His Val 85 90 95 Ile Arg Leu Gln Pro Ser Trp Lys His Lys Leu Ser Gln Ala Pro Leu 100 105 110 Leu Pro Ser Leu Leu Lys Cys Leu Lys Met Asp Thr Asp Val Val Val 115 120 125 Leu Thr Thr Gly Val Leu Val Leu Ile Thr Met Leu Pro Met Ile Pro 130 135 140 Gln Ser Gly Lys Gln His Leu Leu Asp Phe Phe Asp Ile Phe Gly Arg 145 150 155 160 Leu Ser Ser Trp Cys Leu Lys Lys Pro Gly His Val Ala Glu Val Tyr 165 170 175 Leu Val His Leu His Ala Ser Val Tyr Ala Leu Phe His Arg Leu Tyr 180 185 190 Gly Met Tyr Pro Cys Asn Phe Val Ser Phe Leu Arg Ser His Tyr Ser 195 200 205 Met Lys Glu Asn Leu Glu Thr Phe Glu Glu Val Val Lys Pro Met Met 210 215 220 Glu His Val Arg Ile His Pro Glu Leu Val Thr Gly Ser Lys Asp His 225 230 235 240 Glu Leu Asp Pro Arg Arg Trp Lys Arg Leu Glu Thr His Asp Val Val 245 250 255 Ile Glu Cys Ala Lys Ile Ser Leu Asp Pro Thr Glu Ala Ser Tyr Glu 260 265 270 Asp Gly Tyr Ser Val Ser His Gln Ile Ser Ala Arg Phe Pro His Arg 275 280 285 Ser Ala Asp Val Thr Thr Ser Pro Tyr Ala Asp Thr Gln Asn Ser Tyr 290 295 300 Gly Cys Ala Thr Ser Thr Pro Tyr Ser Thr Ser Arg Leu Met Leu Leu 305 310 315 320 Asn Met Pro Gly Gln Leu Pro Gln Thr Leu Ser Ser Pro Ser Thr Arg 325 330 335 Leu Ile Thr Glu Pro Pro Pro Gln Ala Thr Leu Trp Ser Pro Ser Met Val 340 345 350 Cys Gly Met Thr Thr Pro Pro Thr Ser Pro Gly Asn Val Pro Pro Asp 355 360 365 Leu Ser His Pro Tyr Ser Lys Val Phe Gly Thr Thr Ala Gly Gly Lys 370 375 380 Gly Thr Pro Leu Gly Thr Pro Ala Thr Ser Pro Pro Pro Ala Pro Leu 385 390 395 400 Cys His Ser Asp Asp Tyr Val His Ile Ser Leu Pro Gln Ala Thr Val 405 410 415 Thr Pro Pro Arg Lys Glu Glu Arg Met Asp Ser Ala Arg Pro Cys Leu 420 425 430 His Arg Gln His His Leu Leu Asn Asp Arg Gly Ser Glu Glu Pro Pro 435 440 445 Gly Ser Lys Gly Ser Val Thr Leu Ser Asp Leu Pro Gly Phe Leu Gly 450 455 460 Asp Leu Ala Ser Glu Glu Asp Ser Ile Glu Lys Asp Lys Glu Glu Ala 465 470 475 480 Ala Ile Ser Arg Glu Leu Ser Glu Ile Thr Thr Ala Glu Ala Glu Pro 485 490 495 Val Val Pro Arg Gly Gly Phe Asp Ser Pro Phe Tyr Arg Asp Ser Leu 500 505 510 Pro Gly Ser Gln Arg Lys Thr His Ser Ala Ala Ser Ser Ser Gln Gly 515 520 525 Ala Ser Val Asn Pro Glu Pro Leu His Ser Ser Leu Asp Lys Leu Gly 530 535 540 Pro Asp Thr Pro Lys Gln Ala Phe Thr Pro Ile Asp Leu Pro Cys Gly 545 550 555 560 Ser Ala Asp Glu Ser Pro Ala Gly Asp Arg Glu Cys Gln Thr Ser Leu 565 570 575 Glu Thr Ser Ile Phe Thr Pro Ser Pro Cys Lys Ile Pro Pro Pro Thr 580 585 590 Arg Val Gly Phe Gly Ser Gly Gln Pro Pro Pro Tyr Asp His Leu Phe 595 600 605 Glu Val Ala Leu Pro Lys Thr Ala His His Phe Val Ile Arg Lys Thr 610 615 620 Glu Glu Leu Leu Lys Lys Ala Lys Gly Asn Thr Glu Glu Asp Gly Val 625 630 635 640 Pro Ser Thr Ser Pro Met Glu Val Leu Asp Arg Leu Ile Gln Gln Gly 645 650 655 Ala Asp Ala His Ser Lys Glu Leu Asn Lys Leu Pro Leu Pro Ser Lys 660 665 670 Ser Val Asp Trp Thr His Phe Gly Gly Ser Pro Pro Ser Asp Glu Ile 675 680 685 Arg Thr Leu Arg Asp Gln Leu Leu Leu Leu His Asn Gln Leu Leu Tyr 690 695 700 Glu Arg Phe Lys Arg Gln Gln His Ala Leu Arg Asn Arg Arg Leu Leu 705 710 715 720 Arg Lys Val Ile Lys Ala Ala Ala Leu Glu Glu His Asn Ala Ala Met 725 730 735 Lys Asp Gln Leu Lys Leu Gln Glu Lys Asp Ile Gln Met Trp Lys Val 740 745 750 Ser Leu Gln Lys Glu Gln Ala Arg Tyr Asn Gln Leu Gln Glu Gln Arg 755 760 765 Asp Thr Met Val Thr Lys Leu His Ser Gln Ile Arg Gln Leu Gln His 770 775 780 Asp Arg Glu Glu Phe Tyr Asn Gln Ser Gln Glu Leu Gln Thr Lys Leu 785 790 795 800 Glu Asp Cys Arg Asn Met Ile Ala Glu Leu Arg Ile Glu Leu Lys Lys 805 810 815 Ala Asn Asn Lys Val Cys His Thr Glu Leu Leu Leu Ser Gln Val Ser 820 825 830 Gln Lys Leu Ser Asn Ser Glu Ser Val Gln Gln Gln Met Glu Phe Leu 835 840 845 Asn Arg Gln Leu Leu Val Leu Gly Glu Val Asn Glu Leu Tyr Leu Glu 850 855 860 Gln Leu Gln Asn Lys His Ser Asp Thr Thr Lys Glu Val Glu Met Met 865 870 875 880 Lys Ala Ala Tyr Arg Lys Glu Leu Glu Lys Asn Arg Ser His Val Leu 885 890 895 Gln Gln Thr Gln Arg Leu Asp Thr Ser Gln Lys Arg Ile Leu Glu Leu 900 905 910 Glu Ser His Leu Ala Lys Lys Asp His Leu Leu Leu Glu Gln Lys Lys 915 920 925 Tyr Leu Glu Asp Val Lys Leu Gln Ala Arg Gly Gln Leu Gln Ala Ala 930 935 940 Glu Ser Arg Tyr Glu Ala Gln Lys Arg Ile Thr Gln Val Phe Glu Leu 945 950 955 960 Glu Ile Leu Asp Leu Tyr Gly Arg Leu Glu Lys Asp Gly Leu Leu Lys 965 970 975 Lys Leu Glu Glu Glu Lys Ala Glu Ala Ala Glu Ala Ala Glu Glu Arg 980 985 990 Leu Asp Cys Cys Asn Asp Gly Cys Ser Asp Ser Met Val Gly His Asn 995 1000 1005 Glu Glu Ala Ser Gly His Asn Gly Glu Thr Lys Thr Pro Arg Pro Ser 1010 1015 1020 Ser Ala Arg Gly Ser Ser Gly Ser Arg Gly Gly Gly Gly Ser Ser Ser 1025 1030 1035 1040 Ser Ser Ser Glu Leu Ser Thr Pro Glu Lys Pro Pro His Gln Arg Ala 1045 1050 1055 Gly Pro Phe Ser Ser Arg Trp Glu Thr Thr Met Gly Glu Ala Ser Ala 1060 1065 1070 Ser Ile Pro Thr Thr Val Gly Ser Leu Pro Ser Ser Lys Ser Phe Leu 1075 1080 1085 Gly Met Lys Ala Arg Glu Leu Phe Arg Asn Lys Ser Glu Ser Gln Cys 1090 1095 1100 Asp Glu Asp Gly Met Thr Ser Ser Leu Ser Glu Ser Leu Lys Thr Glu 1105 1110 1115 1120 Leu Gly Lys Asp Leu Gly Val Glu Ala Lys Ile Pro Leu Asn Leu Asp 1125 1130 1135 Gly Pro His Pro Ser Pro Pro Thr Pro Asp Ser Val Gly Gln Leu His 1140 1145 1150 Ile Met Asp Tyr Asn Glu Thr His His Glu His Ser 1155 1160 <210 > 5 <211> 5424 <212> DNA <213> Homo sapiens <220> <221> gene <222> (1)..(5424) <223> wild type TSC2 <400> 5 atggccaaac caacaagcaa agattcaggc ttgaaggaga agtttaagat tctgttggga 60 ctgggaacac cgaggccaaa tcccaggtct gcagagggta aacagacgga gtttatcatc 120 accgcggaaa tactgagaga actgagcatg gaatgtggcc tcaacaatcg catccggatg 180 atagggcaga tttgtgaagt cgcaaaaacc aagaaatttg aagagcacgc agtggaagca 24 0 ctctggaagg cggtcgcgga tctgttgcag ccggagcggc cgctggaggc ccggcacgcg 300 gtgctggctc tgctgaaggc catcgtgcag gggcagggcg agcgtttggg ggtcctcaga 360 gccctcttct ttaaggtcat caaggattac ccttccaacg aaga ccttca cgaaaggctg 420 gaggttttca aggccctcac agacaatggg agacacatca cctacttgga ggaagagctg 480 gctgactttg tcctgcagtg gatggatgtt ggcttgtcct cggaattcct tctggtgctg 540 gtgaacttgg tcaaattcaa tagctgttac ctcgacgagt acatcgcaag gatggttcag 600 atgatctgtc tgctgtgcgt ccggaccgcg tcctctgtgg acatagaggt ctccct gcag 660 gtgctggacg ccgtggtctg ctacaactgc ctgccggctg agagcctccc gctgttcatc 720 gttaccctct gtcgcaccat caacgtcaag gagctctgcg agccttgctg gaagctgatg 780 cggaacctcc ttggcaccca cctgggccac agcgccatct aca acatgtg ccacctcatg 840 gaggacagag cctacatgga ggacgcgccc ctgctgagag gagccgtgtt ttttgtgggc 900 atggctctct ggggagccca ccggctctat tctctcagga actcgccgac atctgtgttg 960 ccatcatttt accaggccat ggcatgtccg aacgaggtgg tgtcctatga gatcgtcctg 1020 tccatcacca ggctcatcaa gaagtatagg aaggagctcc aggtggtggc gtgggacatt 1080 ctgctgaaca tcatcgaacg gctccttcag cagctccaga ccttggacag cccggagctc 1140 aggaccatcg tccatgacct gttgaccacg gtggaggagc tgtgtgacca gaacgagttc 1200 cacgggtctc aggagagata ctttgaactg gtggagagat gtgcggacca gaggcctgag 1260 tcctccctcc tgaacctgat ctcctataga gcgcagtcca tccacccggc caaggacggc 1320 tggattcaga acctgcaggc gctgatggag agattcttca ggagcgagtc ccgaggcgcc 1380 gtgcgcatca aggtgctgga cgtgctgtcc tttgtgctgc tcatcaacag gcagttctat 1440 gaggaggagc tgattaactc agtggtcatc tcgcagctct cccacatccc cgaggataaa 1500 gaccaccagg tccga aagct ggccacccag ttgctggtgg acctggcaga gggctgccac 1560 acacaccact tcaacagcct gctggacatc atcgagaagg tgatggcccg ctccctctcc 1620 ccacccccgg agctggaaga aagggatgtg gccgcatact cggcctcctt ggaggatgtg 1680 aagacagccg tcctggggct tctggtcatc cttcagacca agctgtacac cctgcctgca 1740 agccacgcca cgcgtgtgta tgagatgctg gtcagccaca ttcagctcca ctacaagcac 1800 agctacaccc tgccaatcgc gagcagcatc cggctgcagg cctttgactt cctgttgctg 1860 ctgcgggccg actcactgca ccgcctgggc ctgcccaaca aggatggagt cgtgcggttc 1920 agcccctact gcgtct gcga ctacatggag ccagagagag gctctgagaa gaagaccagc 1980 ggcccccttt ctcctcccac agggcctcct ggcccggcgc ctgcaggccc cgccgtgcgg 2040 ctggggtccg tgccctactc cctgctcttc cgcgtcctgc tgcagtgctt gaagcaggag 2100 tctgactgga aggtgctgaa gctggttctg ggcaggctgc ctgagtccct gcgctataaa 2160 gtgctcatct ttacttcccc ttgcagtgtg gaccagctgt gctctgctct ctgctccatg 2220 ctttcaggcc caaagacact ggagcggctc cgaggcgccc cagaaggctt ctccagaact 2280 gacttgcacc tggccgtggt tccagtgctg acagcattaa tctcttacca taactacctg 2340 gacaaaacca aacagcgcga gatggtctac tgcctggagc ag ggcctcat ccaccgctgt 2400 gccagccagt gcgtcgtggc cttgtccatc tgcagcgtgg agatgcctga catcatcatc 2460 aaggcgctgc ctgttctggt ggtgaagctc acgcacatct cagccacagc cagcatggcc 2520 gtcccactgc tggagttcct g tccactctg gccaggctgc cgcacctcta caggaacttt 2580 gccgcggagc agtatgccag tgtgttcgcc atctccctgc cgtacaccaa cccctccaag 2640 tttaatcagt acatcgtgtg tctggcccat cacgtcatag ccatgtggtt catcaggtgc 2700 cgcctgccct tccggaagga ttttgtccct ttcatcacta agggcctgcg gtccaatgtc 2760 ctcttgtctt ttgatgacac ccccgagaag gacagctt ca gggcccggag tactagtctc 2820 aacgagagac ccaagagtct gaggatagcc agaccccca aacaaggctt gaataactct 2880 ccacccgtga aagaattcaa ggagagctct gcagccgagg ccttccggtg ccgcagcatc 2940 agtgtgtctg aacatgtggt ccgcagcagg at acagacgt ccctcaccag tgccagcttg 3000 gggtctgcag atgagaactc cgtggcccag gctgacgata gcctgaaaaa cctccacctg 3060 gagctcacgg aaacctgtct ggacatgatg gctcgatacg tcttctccaa cttcacggct 3120 gtcccgaaga ggtctcctgt gggcgagttc ctcctagcgg gtggcaggac caaaacctgg 3180 ctggttggga acaagcttgt cactgtgacg acaagcgtgg gaaccgggac ccggtcgtta 3240 ctaggcctgg actcggggga gctgcagtcc ggcccggagt cgagctccag ccccggggtg 3300 catgtgagac agaccaagga ggcgccggcc aagctggagt cccaggctgg gcagcaggtg 3360 tcccgtgggg cccgggatcg ggtccgttcc atgtc ggggg gccatggtct tcgagttggc 3420 gccctggacg tgccggcctc ccagttcctg ggcagtgcca cttctccagg accacggact 3480 gcaccagccg cgaaacctga gaaggcctca gctggcaccc gggttcctgt gcaggagaag 3540 acgaacctgg cggcctatgt gcccctgctg acccagggct gggcggagat cctggtccgg 3600 aggcccacag ggaacaccag ctggctgatg agcctggaga acccgctcag ccctttctcc 366 0 tcggacatca acaacatgcc cctgcaggag ctgtctaacg ccctcatggc ggctgagcgc 3720 ttcaaggagc accgggacac agccctgtac aagtcactgt cggtgccggc agccagcacg 3780 gccaaacccc ctcctctgcc tcgctccaac acagtggcct cttt ctcctc cctgtaccag 3840 tccagctgcc aaggacagct gcacaggagc gtttcctggg cagactccgc cgtggtcatg 3900 gaggagggaa gtccgggcga ggttcctgtg ctggtggagc ccccagggtt ggaggacgtt 3960 gaggcagcgc taggcatgga caggcgcacg gatgcctaca gcaggtcgtc ctcagtctcc 4020 agccaggagg agaagtcgct ccacgcggag gagctggttg gcaggggcat ccccatcgag 4080 cgagtcgtct cctcggaggg tggccggccc tctgtggacc tctccttcca gccctcgcag 4140 cccctgagca agtccagctc ctctcccgag ctgcagactc tgcaggacat cctcggggac 4200 cctggggaca aggccgacgt gggccggctg agccctgagg ttaaggcccg g tcacagtca 4260 gggaccctgg acggggaaag tgctgcctgg tcggcctcgg gcgaagacag tcggggccag 4320 cccgagggtc ccttgccttc cagctccccc cgctcgccca gtggcctccg gccccgaggt 4380 tacaccatct ccgactcggc cccatcacgc aggggcaaga gagtagagag ggacgcctta 4440 aagagcagag ccacagcctc caatgcagag aaagtgccag gcatcaaccc cagtttcgtg 4500 ttcctgcagc tctaccatt c ccccttcttt ggcgacgagt caaacaagcc aatcctgctg 4560 cccaatgagt cacagtcctt tgagcggtcg gtgcagctcc tcgaccagat cccatcatac 4620 gacacccaca agatcgccgt cctgtatgtt ggagaaggcc agagcaacag cgagctcgcc 468 0 atcctgtcca atgagcatgg ctcctacagg tacacggagt tcctgacggg cctgggccgg 4740 ctcatcgagc tgaaggactg ccagccggac aaggtgtacc tgggaggcct ggacgtgtgt 4800 ggtgaggacg gccagttcac ctactgctgg cacgatgaca tcatgcaagc cgtcttccac 4860 atcgccaccc tgatgcccac caaggacgtg gacaagcacc gctgcgacaa gaagcgccac 4920 ctgggcaacg actttgtg tc cattgtctac aatgactccg gtgaggactt caagcttggc 4980 accatcaagg gccagttcaa ctttgtccac gtgatcgtca ccccgctgga ctacgagtgc 5040 aacctggtgt ccctgcagtg caggaaagac atggagggcc ttgtggacac cagcgtggcc 510 0 aagatcgtgt ctgaccgcaa cctgcccttc gtggcccgcc agatggccct gcacgcaaat 5160 atggcctcac aggtgcatca tagccgctcc aaccccaccg atatctaccc ctccaagtgg 5220 attgcccggc tccgccacat caagcggctc cgccagcgga tctgcgagga agccgcctac 5280 tccaacccca gcctacctct ggtgcaccct ccgtcccata gcaaagcccc tgcacagact 5340 ccagccgagc ccacacctgg ctatgaggtg ggcc agcgga agcgcctcat ctcctcggtg 5400 gaggacttca ccgagtttgt gtga 5424 <210> 6 <211> 1807 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(1807) <223> wild type TSC2 <400> 6 Met Ala Lys Pro Thr Ser Lys Asp Ser Gly Leu Lys Glu Lys Phe Lys 1 5 10 15 Ile Leu Leu Gly Leu Gly Thr Pro Arg Pro Asn Pro Arg Ser Ala Glu 20 25 30 Gly Lys Gln Thr Glu Phe Ile Ile Thr Ala Glu Ile Leu Arg Glu Leu 35 40 45 Ser Met Glu Cys Gly Leu Asn Asn Arg Ile Arg Met Ile Gly Gln Ile 50 55 60 Cys Glu Val Ala Lys Thr Lys Lys Phe Glu Glu His Ala Val Glu Ala 65 70 75 80 Leu Trp Lys Ala Val Ala Asp Leu Leu Gln Pro Glu Arg Pro Leu Glu 85 90 95 Ala Arg His Ala Val Leu Ala Leu Leu Lys Ala Ile Val Gln Gly Gln 100 105 110 Gly Glu Arg Leu Gly Val Leu Arg Ala Leu Phe Phe Lys Val Ile Lys 115 120 125 Asp Tyr Pro Ser Asn Glu Asp Leu His Glu Arg Leu Glu Val Phe Lys 130 135 140 Ala Leu Thr Asp Asn Gly Arg His Ile Thr Tyr Leu Glu Glu Glu Leu 145 150 155 160 Ala Asp Phe Val Leu Gln Trp Met Asp Val Gly Leu Ser Ser Glu Phe 165 170 175 Leu Leu Val Leu Val Asn Leu Val Lys Phe Asn Ser Cys Tyr Leu Asp 180 185 190 Glu Tyr Ile Ala Arg Met Val Gln Met Ile Cys Leu Leu Cys Val Arg 195 200 205 Thr Ala Ser Ser Val Asp Ile Glu Val Ser Leu Gln Val Leu Asp Ala 210 215 220 Val Val Cys Tyr Asn Cys Leu Pro Ala Glu Ser Leu Pro Leu Phe Ile 225 230 235 240 Val Thr Leu Cys Arg Thr Ile Asn Val Lys Glu Leu Cys Glu Pro Cys 245 250 255 Trp Lys Leu Met Arg Asn Leu Leu Gly Thr His Leu Gly His Ser Ala 260 265 270 Ile Tyr Asn Met Cys His Leu Met Glu Asp Arg Ala Tyr Met Glu Asp 275 280 285 Ala Pro Leu Leu Arg Gly Ala Val Phe Phe Val Gly Met Ala Leu Trp 290 295 300 Gly Ala His Arg Leu Tyr Ser Leu Arg Asn Ser Pro Thr Ser Val Leu 305 310 315 320 Pro Ser Phe Tyr Gln Ala Met Ala Cys Pro Asn Glu Val Val Ser Tyr 325 330 335 Glu Ile Val Leu Ser Ile Thr Arg Leu Ile Lys Lys Tyr Arg Lys Glu 340 345 350 Leu Gln Val Val Ala Trp Asp Ile Leu Leu Asn Ile Ile Glu Arg Leu 355 360 365 Leu Gln Gln Leu Gln Thr Leu Asp Ser Pro Glu Leu Arg Thr Ile Val 370 375 380 His Asp Leu Leu Thr Thr Val Glu Glu Leu Cys Asp Gln Asn Glu Phe 385 390 395 400 His Gly Ser Gln Glu Arg Tyr Phe Glu Leu Val Glu Arg Cys Ala Asp 405 410 415 Gln Arg Pro Glu Ser Ser Leu Leu Asn Leu Ile Ser Tyr Arg Ala Gln 420 425 430 Ser Ile His Pro Ala Lys Asp Gly Trp Ile Gln Asn Leu Gln Ala Leu 435 440 445 Met Glu Arg Phe Phe Arg Ser Glu Ser Arg Gly Ala Val Arg Ile Lys 450 455 460 Val Leu Asp Val Leu Ser Phe Val Leu Leu Ile Asn Arg Gln Phe Tyr 465 470 475 480 Glu Glu Glu Leu Ile Asn Ser Val Val Ile Ser Gln Leu Ser His Ile 485 490 495 Pro Glu Asp Lys Asp His Gln Val Arg Lys Leu Ala Thr Gln Leu Leu 500 505 510 Val Asp Leu Ala Glu Gly Cys His Thr His His Phe Asn Ser Leu Leu 515 520 525 Asp Ile Ile Glu Lys Val Met Ala Arg Ser Leu Ser Pro Pro Pro Glu 530 535 540 Leu Glu Glu Arg Asp Val Ala Ala Tyr Ser Ala Ser Leu Glu Asp Val 545 550 555 560 Lys Thr Ala Val Leu Gly Leu Leu Val Ile Leu Gln Thr Lys Leu Tyr 565 570 575 Thr Leu Pro Ala Ser His Ala Thr Arg Val Tyr Glu Met Leu Val Ser 580 585 590 His Ile Gln Leu His Tyr Lys His Ser Tyr Thr Leu Pro Ile Ala Ser 595 600 605 Ser Ile Arg Leu Gln Ala Phe Asp Phe Leu Leu Leu Leu Arg Ala Asp 610 615 620 Ser Leu His Arg Leu Gly Leu Pro Asn Lys Asp Gly Val Val Arg Phe 625 630 635 640 Ser Pro Tyr Cys Val Cys Asp Tyr Met Glu Pro Glu Arg Gly Ser Glu 645 650 655 Lys Lys Thr Ser Gly Pro Leu Ser Pro Pro Thr Gly Pro Pro Gly Pro 660 665 670 Ala Pro Ala Gly Pro Ala Val Arg Leu Gly Ser Val Pro Tyr Ser Leu 675 680 685 Leu Phe Arg Val Leu Leu Gln Cys Leu Lys Gln Glu Ser Asp Trp Lys 690 695 700 Val Leu Lys Leu Val Leu Gly Arg Leu Pro Glu Ser Leu Arg Tyr Lys 705 710 715 720 Val Leu Ile Phe Thr Ser Pro Cys Ser Val Asp Gln Leu Cys Ser Ala 725 730 735 Leu Cys Ser Met Leu Ser Gly Pro Lys Thr Leu Glu Arg Leu Arg Gly 740 745 750 Ala Pro Glu Gly Phe Ser Arg Thr Asp Leu His Leu Ala Val Val Pro 755 760 765 Val Leu Thr Ala Leu Ile Ser Tyr His Asn Tyr Leu Asp Lys Thr Lys 770 775 780 Gln Arg Glu Met Val Tyr Cys Leu Glu Gln Gly Leu Ile His Arg Cys 785 790 795 800 Ala Ser Gln Cys Val Val Ala Leu Ser Ile Cys Ser Val Glu Met Pro 805 810 815 Asp Ile Ile Ile Lys Ala Leu Pro Val Leu Val Val Lys Leu Thr His 820 825 830 Ile Ser Ala Thr Ala Ser Met Ala Val Pro Leu Leu Glu Phe Leu Ser 835 840 845 Thr Leu Ala Arg Leu Pro His Leu Tyr Arg Asn Phe Ala Ala Glu Gln 850 855 860 Tyr Ala Ser Val Phe Ala Ile Ser Leu Pro Tyr Thr Asn Pro Ser Lys 865 870 875 880 Phe Asn Gln Tyr Ile Val Cys Leu Ala His His Val Ile Ala Met Trp 885 890 895 Phe Ile Arg Cys Arg Leu Pro Phe Arg Lys Asp Phe Val Pro Phe Ile 900 905 910 Thr Lys Gly Leu Arg Ser Asn Val Leu Leu Ser Phe Asp Asp Thr Pro 915 920 925 Glu Lys Asp Ser Phe Arg Ala Arg Ser Thr Ser Leu Asn Glu Arg Pro 930 935 940 Lys Ser Leu Arg Ile Ala Arg Pro Pro Lys Gln Gly Leu Asn Asn Ser 945 950 955 960 Pro Pro Val Lys Glu Phe Lys Glu Ser Ser Ala Ala Glu Ala Phe Arg 965 970 975 Cys Arg Ser Ile Ser Val Ser Glu His Val Val Arg Ser Arg Ile Gln 980 985 990 Thr Ser Leu Thr Ser Ala Ser Leu Gly Ser Ala Asp Glu Asn Ser Val 995 1000 1005 Ala Gln Ala Asp Asp Ser Leu Lys Asn Leu His Leu Glu Leu Thr Glu 1010 1015 1020 Thr Cys Leu Asp Met Met Ala Arg Tyr Val Phe Ser Asn Phe Thr Ala 1025 1030 1035 1040 Val Pro Lys Arg Ser Pro Val Gly Glu Phe Leu Leu Ala Gly Gly Arg 1045 1050 1055 Thr Lys Thr Trp Leu Val Gly Asn Lys Leu Val Thr Val Thr Thr Ser 1060 1065 1070 Val Gly Thr Gly Thr Arg Ser Leu Leu Gly Leu Asp Ser Gly Glu Leu 1075 1080 1085 Gln Ser Gly Pro Glu Ser Ser Ser Ser Pro Gly Val His Val Arg Gln 1090 1095 1100 Thr Lys Glu Ala Pro Ala Lys Leu Glu Ser Gln Ala Gly Gln Gln Val 1105 1110 1115 1120 Ser Arg Gly Ala Arg Asp Arg Val Arg Ser Met Ser Gly Gly His Gly 1125 1130 1135 Leu Arg Val Gly Ala Leu Asp Val Pro Ala Ser Gln Phe Leu Gly Ser 1140 1145 1150 Ala Thr Ser Pro Gly Pro Arg Thr Ala Pro Ala Ala Lys Pro Glu Lys 1155 1160 1165 Ala Ser Ala Gly Thr Arg Val Pro Val Gln Glu Lys Thr Asn Leu Ala 1170 1175 1180 Ala Tyr Val Pro Leu Leu Thr Gln Gly Trp Ala Glu Ile Leu Val Arg 1185 1190 1195 1200 Arg Pro Thr Gly Asn Thr Ser Trp Leu Met Ser Leu Glu Asn Pro Leu 1205 1210 1215 Ser Pro Phe Ser Ser Asp Ile Asn Asn Met Pro Leu Gln Glu Leu Ser 1220 1225 1230 Asn Ala Leu Met Ala Ala Glu Arg Phe Lys Glu His Arg Asp Thr Ala 1235 1240 1245 Leu Tyr Lys Ser Leu Ser Val Pro Ala Ala Ser Thr Ala Lys Pro Pro 1250 1255 1260 Pro Leu Pro Arg Ser Asn Thr Val Ala Ser Phe Ser Ser Leu Tyr Gln 1265 1270 1275 1280 Ser Ser Cys Gln Gly Gln Leu His Arg Ser Val Ser Trp Ala Asp Ser 1285 1290 1295 Ala Val Val Met Glu Glu Gly Ser Pro Gly Glu Val Pro Val Leu Val 1300 1305 1310 Glu Pro Pro Gly Leu Glu Asp Val Glu Ala Ala Leu Gly Met Asp Arg 1315 1320 1325 Arg Thr Asp Ala Tyr Ser Arg Ser Ser Ser Val Ser Ser Gln Glu Glu 1330 1335 1340 Lys Ser Leu His Ala Glu Glu Leu Val Gly Arg Gly Ile Pro Ile Glu 1345 1350 1355 1360 Arg Val Val Ser Ser Glu Gly Gly Arg Pro Ser Val Asp Leu Ser Phe 1365 1370 1375 Gln Pro Ser Gln Pro Leu Ser Lys Ser Ser Ser Ser Pro Glu Leu Gln 1380 1385 1390 Thr Leu Gln Asp Ile Leu Gly Asp Pro Gly Asp Lys Ala Asp Val Gly 1395 1400 1405 Arg Leu Ser Pro Glu Val Lys Ala Arg Ser Gln Ser Gly Thr Leu Asp 1410 1415 1420 Gly Glu Ser Ala Ala Trp Ser Ala Ser Gly Glu Asp Ser Arg Gly Gln 1425 1430 1435 1440 Pro Glu Gly Pro Leu Pro Ser Ser Ser Pro Arg Ser Pro Ser Gly Leu 1445 1450 1455 Arg Pro Arg Gly Tyr Thr Ile Ser Asp Ser Ala Pro Ser Arg Arg Gly 1460 1465 1470 Lys Arg Val Glu Arg Asp Ala Leu Lys Ser Arg Ala Thr Ala Ser Asn 1475 1480 1485 Ala Glu Lys Val Pro Gly Ile Asn Pro Ser Phe Val Phe Leu Gln Leu 1490 1495 1500 Tyr His Ser Pro Phe Phe Gly Asp Glu Ser Asn Lys Pro Ile Leu Leu 1505 1510 1515 1520 Pro Asn Glu Ser Gln Ser Phe Glu Arg Ser Val Gln Leu Leu Asp Gln 1525 1530 1535 Ile Pro Ser Tyr Asp Thr His Lys Ile Ala Val Leu Tyr Val Gly Glu 1540 1545 1550 Gly Gln Ser Asn Ser Glu Leu Ala Ile Leu Ser Asn Glu His Gly Ser 1555 1560 1565 Tyr Arg Tyr Thr Glu Phe Leu Thr Gly Leu Gly Arg Leu Ile Glu Leu 1570 1575 1580 Lys Asp Cys Gln Pro Asp Lys Val Tyr Leu Gly Gly Leu Asp Val Cys 1585 1590 1595 1600 Gly Glu Asp Gly Gln Phe Thr Tyr Cys Trp His Asp Asp Ile Met Gln 1605 1610 1615 Ala Val Phe His Ile Ala Thr Leu Met Pro Thr Lys Asp Val Asp Lys 1620 1625 1630 His Arg Cys Asp Lys Lys Arg His Leu Gly Asn Asp Phe Val Ser Ile 1635 1640 1645 Val Tyr Asn Asp Ser Gly Glu Asp Phe Lys Leu Gly Thr Ile Lys Gly 1650 1655 1660 Gln Phe Asn Phe Val His Val Ile Val Thr Pro Leu Asp Tyr Glu Cys 1665 1670 1675 1680 Asn Leu Val Ser Leu Gln Cys Arg Lys Asp Met Glu Gly Leu Val Asp 1685 1690 1695 Thr Ser Val Ala Lys Ile Val Ser Asp Arg Asn Leu Pro Phe Val Ala 1700 1705 1710 Arg Gln Met Ala Leu His Ala Asn Met Ala Ser Gln Val His His Ser 1715 1720 1725 Arg Ser Asn Pro Thr Asp Ile Tyr Pro Ser Lys Trp Ile Ala Arg Leu 1730 1735 1740 Arg His Ile Lys Arg Leu Arg Gln Arg Ile Cys Glu Glu Ala Ala Tyr 1745 1750 1755 1760 Ser Asn Pro Ser Leu Pro Leu Val His Pro Pro Ser His Ser Lys Ala 1765 1770 1775 Pro Ala Gln Thr Pro Ala Glu Pro Thr Pro Gly Tyr Glu Val Gly Gln 1780 1785 1790 Arg Lys Arg Leu Ile Ser Ser Val Glu Asp Phe Thr Glu Phe Val 1795 1800 1805 <210> 7 <211> 1398 <212> DNA <213> Homo sapiens <220> <221> gene <222 > (1)..(1398) <223> wild type AKT3 <400> 7 atgagcgatg ttaccattgt gaaagaaggt tgggttcaga agaggggaga atatataaaa 60 aactggaggc caagatactt ccttttgaag acagatggct cattcatagg atataaagag 120 aaacctcaag atgtggattt acctta tccc ctcaacaact tttcagtggc aaaatgccag 180 ttaatgaaaa cagaacgacc aaagccaaac acatttataa tcagatgtct ccagtggact 240 actgttatag agagaacatt tcatgtagat actccagagg aaagggaaga atggacagaa 300 gctatccagg ctgtagcaga cagactgcag aggcaagaag aggagagaat gaattgtagt 360 ccaacttcac aaattgataa tataggagag gaagagatgg atgcctctac aacccatcat 420 aaaagaaaga caatgaatga ttttgactat ttgaaactac taggtaaagg cacttttggg 480 aaagttattt tggttcgaga gaaggcaagt ggaaaatact atgctatgaa gattctgaag 540 aaagaagtca ttattgcaaa ggatgaagtg gcacacactc taactgaaag cagagtatta 600 aagaacacta gacatccctt tttaacatcc ttgaaatatt ccttccagac aaaagacc gt 660 ttgtgttttg tgatggaata tgttaatggg ggcgagctgt ttttccattt gtcgagagag 720 cgggtgttct ctgaggaccg cacacgtttc tatggtgcag aaattgtctc tgccttggac 780 tatctacatt ccggaaagat tgtgtaccgt gatctcaagt tggagaatct aatgctggac 840 aaagatggcc acataaaaat tacagattt t ggactttgca aagaagggat cacagatgca 900 gccaccatga agacattctg tggcactcca gaatatctgg caccagaggt gttagaagat 960 aatgactatg gccgagcagt agactggtgg ggcctagggg ttgtcatgta tgaaatgatg 1020 tgtgggaggt tacctttcta caaccaggac cat gagaaac tttttgaatt aatattaatg 1080 gaagacatta aatttcctcg aacactctct tcagatgcaa aatcattgct ttcagggctc 1140 ttgataaagg atccaaataa acgccttggt ggaggaccag atgatgcaaa agaaattatg 1200 agacacagtt tcttctctgg agtaaactgg caagatgtat atgataaaaa gcttgtacct 1260 ccttttaaac ctcaagtaac atctgagaca gatactagat attttga tga agaatttaca 1320 gctcagacta ttacaataac accacctgaa aaatgtcagc aatcagattg tggcatgctg 1380 ggtaactgga aaaaataa 1398 <210> 8 <211> 465 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(465) <223> wild type AKT3 <400> 8 Met Ser Asp Val Thr Ile Val Lys Glu Gly Trp Val Gln Lys Arg Gly 1 5 10 15 Glu Tyr Ile Lys Asn Trp Arg Pro Arg Tyr Phe Leu Leu Lys Thr Asp 20 25 30 Gly Ser Phe Ile Gly Tyr Lys Glu Lys Pro Gln Asp Val Asp Leu Pro 35 40 45 Tyr Pro Leu Asn Asn Phe Ser Val Ala Lys Cys Gln Leu Met Lys Thr 50 55 60 Glu Arg Pro Lys Pro Asn Thr Phe Ile Ile Arg Cys Leu Gln Trp Thr 65 70 75 80 Thr Val Ile Glu Arg Thr Phe His Val Asp Thr Pro Glu Glu Arg Glu 85 90 95 Glu Trp Thr Glu Ala Ile Gln Ala Val Ala Asp Arg Leu Gln Arg Gln 100 105 110 Glu Glu Glu Arg Met Asn Cys Ser Pro Thr Ser Gln Ile Asp Asn Ile 115 120 125 Gly Glu Glu Glu Met Asp Ala Ser Thr Thr His His Lys Arg Lys Thr 130 135 140 Met Asn Asp Phe Asp Tyr Leu Lys Leu Leu Gly Lys Gly Thr Phe Gly 145 150 155 160 Lys Val Ile Leu Val Arg Glu Lys Ala Ser Gly Lys Tyr Tyr Ala Met 165 170 175 Lys Ile Leu Lys Lys Glu Val Ile Ile Ala Lys Asp Glu Val Ala His 180 185 190 Thr Leu Thr Glu Ser Arg Val Leu Lys Asn Thr Arg His Pro Phe Leu 195 200 205 Thr Ser Leu Lys Tyr Ser Phe Gln Thr Lys Asp Arg Leu Cys Phe Val 210 215 220 Met Glu Tyr Val Asn Gly Gly Glu Leu Phe Phe His Leu Ser Arg Glu 225 230 235 240 Arg Val Phe Ser Glu Asp Arg Thr Arg Phe Tyr Gly Ala Glu Ile Val 245 250 255 Ser Ala Leu Asp Tyr Leu His Ser Gly Lys Ile Val Tyr Arg Asp Leu 260 265 270 Lys Leu Glu Asn Leu Met Leu Asp Lys Asp Gly His Ile Lys Ile Thr 275 280 285 Asp Phe Gly Leu Cys Lys Glu Gly Ile Thr Asp Ala Ala Thr Met Lys 290 295 300 Thr Phe Cys Gly Thr Pro Glu Tyr Leu Ala Pro Glu Val Leu Glu Asp 305 310 315 320 Asn Asp Tyr Gly Arg Ala Val Asp Trp Trp Gly Leu Gly Val Val Met 325 330 335 Tyr Glu Met Met Cys Gly Arg Leu Pro Phe Tyr Asn Gln Asp His Glu 340 345 350 Lys Leu Phe Glu Leu Ile Leu Met Glu Asp Ile Lys Phe Pro Arg Thr 355 360 365 Leu Ser Ser Asp Ala Lys Ser Leu Leu Ser Gly Leu Leu Ile Lys Asp 370 375 380 Pro Asn Lys Arg Leu Gly Gly Gly Pro Asp Asp Ala Lys Glu Ile Met 385 390 395 400 Arg His Ser Phe Phe Ser Gly Val Asn Trp Gln Asp Val Tyr Asp Lys 405 410 415 Lys Leu Val Pro Pro Phe Lys Pro Gln Val Thr Ser Glu Thr Asp Thr 420 425 430 Arg Tyr Phe Asp Glu Glu Phe Thr Ala Gln Thr Ile Thr Ile Thr Pro 435 440 445 Pro Glu Lys Cys Gln Gln Ser Asp Cys Gly Met Leu Gly Asn Trp Lys 450 455 460 Lys 465 <210> 9 <211> 3207 <212> DNA < 213> Homo sapiens <220> <221> gene <222> (1)..(3207) <223> wild type PIK3CA <400> 9 atgcctccac gaccatcatc aggtgaactg tggggcatcc acttgatgcc cccaagaatc 60 ctagtagaat gtttacctacc aaatggaatg atagtgactt tagaatgcct ccgtgaggct 120 acattaataa ccataaagca tgaactattt aaagaagcaa gaaaataccc cctccatcaa 180 cttcttcaag atgaatcttc ttacattttc gtaagtgtta ctcaagaagc agaaagggaa 240 gaattttttg atgaaacaag acgactttgt gaccttcggc tttttcaacc ctttttaaaa 300 gtaattgaac cagtaggcaa ccgtgaaga a aagatcctca atcgagaaat tggttttgct 360 atcggcatgc cagtgtgtga atttgatatg gttaaagatc cagaagtaca ggacttccga 420 agaaatattc tgaacgtttg taaagaagct gtggatctta gggacctcaa ttcacctcat 480 agtagagcaa tgtatgtcta t cctccaaat gtagaatctt caccagaatt gccaaagcac 540 atatataata aattagataa agggcaaata atagtggtga tctgggtaat agtttctcca 600 aataatgaca agcagaagta tactctgaaa atcaaccatg actgtgtacc agaacaagta 660 attgctgaag caatcaggaa aaaaactcga agtatgttgc tatcctctga acaactaaaa 720 ctctgtgttt tagaatatca gggcaagtat attttaaaag tgtgtggat g tgatgaatac 780 ttcctagaaa aatatcctct gagtcagtat aagtatataa gaagctgtat aatgcttggg 840 aggatgccca atttgatgtt gatggctaaa gaaagccttt attctcaact gccaatggac 900 tgttttacaa tgccatctta ttccagacgc atttccacag ctacaccata tatgaatgga 960 gaaacatcta caaaatccct ttgggttata aatagtgcac tcagaataaa aattctttgt 1020 gcaacctacg tgaatgtaaa tattcgagac attgataaga tctatgttcg aacaggtatc 1080 taccatggag gagaaccctt atgtgacaat gtgaacactc aaagagtacc ttgttccaat 1140 cccaggtgga atgaatggct gaattatgat atatacattc ctgatcttcc tcg tgctgct 1200 cgactttgcc tttccatttg ctctgttaaa ggccgaaagg gtgctaaaga ggaacactgt 1260 ccattggcat ggggaaatat aaacttgttt gattacacag acactctagt atctggaaaa 1320 atggctttga atctttggcc agtacctcat ggattagaag atttgctgaa ccctattggt 1380 gttactggat caaatccaaa taaagaaact ccatgcttag agttggagtt tgactggttc 1440 agcagtgtgg taaagttccc agatatgtca gtgattgaag agcatgccaa ttggtctgta 1500 tcccgagaag caggatttag ctattcccac gcaggactga gtaacagact agctagagac 1560 aatgaattaa gggaaaatga caaagaacag ctcaaagcaa tttctacacg agatcctctc 1 620 tctgaaatca ctgagcagga gaaagatttt ctatggagtc acagacacta ttgtgtaact 1680 atccccgaaa ttctacccaa attgcttctg tctgttaaat ggaattctag agatgaagta 1740 gcccagatgt attgcttggt aaaagattgg cctccaatca aacctgaaca ggctat ggaa 1800 cttctggact gtaattaccc agatcctatg gttcgaggtt ttgctgttcg gtgcttggaa 1860 aaatatttaa cagatgacaa actttctcag tatttaattc agctagtaca ggtcctaaaa 1920 tatgaacaat atttggataa cttgcttgtg agatttttac tgaagaaagc attgactaat 1980 caaaggattg ggcacttttt cttttggcat ttaaaatctg agatgcacaa taaaacagtt 204 0 agccagaggt ttggcctgct tttggagtcc tattgtcgtg catgtgggat gtatttgaag 2100 cacctgaata ggcaagtcga ggcaatggaa aagctcatta acttaactga cattctcaaa 2160 caggagaaga aggatgaaac acaaaaggta cagatgaagt ttttagttga gcaaatgagg 2220 cgaccagatt tcatggatgc tctacagggc tttctgtctc ctctaaaccc tgctcatcaa 2280 ctaggaaacc tcaggcttga agagtgtcga attatgtcct ctgcaaaaag gccactgtgg 2340 ttgaattggg agaacccaga catcatgtca gagttactgt ttcagaacaa tgagatcatc 2400 tttaaaaatg gggatgattt acggcaagat atgctaacac ttcaaattat tcgtattatg 2460 gaaaatatct ggca aaatca aggtcttgat cttcgaatgt taccttatgg ttgtctgtca 2520 atcggtgact gtgtgggact tattgaggtg gtgcgaaatt ctcacactat tatgcaaatt 2580 cagtgcaaag gcggcttgaa aggtgcactg cagttcaaca gccacacact acatcagtgg 2640 ctcaaagaca agaacaaagg agaaatatat gatgcagcca ttgacctgtt tacacgttca 2700 tgtgctggat actgtgtagc taccttcatt ttgggaattg gagatcgtca caatagtaac 2760 atcatggtga aagacgatgg acaactgttt catatagatt ttggacactt tttggatcac 2820 aagaagaaaa aatttggtta taaacgagaa cgtgtgccat ttgttttgac acaggatttc 2880 ttaatagtga ttagtaaagg agcccaaga a tgcacaaaga caagagaatt tgagaggttt 2940 caggagatgt gttacaaggc ttatctagct attcgacagc atgccaatct cttcataaat 3000 cttttctcaa tgatgcttgg ctctggaatg ccagaactac aatcttttga tgacattgca 3060 tacattcgaa agaccctagc cttagataaa actgagcaag aggctttgga gtatttcatg 3120 aaacaaaatga atgatgcaca tcatggtggc tggacaaacaa aaatggattg gatcttccac 3180 acaattaaac agcatgcatt gaactga 3207 <210> 10 <211> 1068 <212> PRT <213> Homo sapiens <220> <221> PEPTIDE <222> (1)..(1068) <223> wild type PIK3CA <400 > 10 Met Pro Pro Arg Pro Ser Ser Gly Glu Leu Trp Gly Ile His Leu Met 1 5 10 15 Pro Pro Arg Ile Leu Val Glu Cys Leu Leu Pro Asn Gly Met Ile Val 20 25 30 Thr Leu Glu Cys Leu Arg Glu Ala Thr Leu Ile Thr Ile Lys His Glu 35 40 45 Leu Phe Lys Glu Ala Arg Lys Tyr Pro Leu His Gln Leu Leu Gln Asp 50 55 60 Glu Ser Ser Tyr Ile Phe Val Ser Val Thr Gln Glu Ala Glu Arg Glu 65 70 75 80 Glu Phe Phe Asp Glu Thr Arg Arg Leu Cys Asp Leu Arg Leu Phe Gln 85 90 95 Pro Phe Leu Lys Val Ile Glu Pro Val Gly Asn Arg Glu Glu Lys Ile 100 105 110 Leu Asn Arg Glu Ile Gly Phe Ala Ile Gly Met Pro Val Cys Glu Phe 115 120 125 Asp Met Val Lys Asp Pro Glu Val Gln Asp Phe Arg Arg Asn Ile Leu 130 135 140 Asn Val Cys Lys Glu Ala Val Asp Leu Arg Asp Leu Asn Ser Pro His 145 150 155 160 Ser Arg Ala Met Tyr Val Tyr Pro Pro Asn Val Glu Ser Ser Pro Glu 165 170 175 Leu Pro Lys His Ile Tyr Asn Lys Leu Asp Lys Gly Gln Ile Ile Val 180 185 190 Val Ile Trp Val Ile Val Ser Pro Asn Asn Asp Lys Gln Lys Tyr Thr 195 200 205 Leu Lys Ile Asn His Asp Cys Val Pro Glu Gln Val Ile Ala Glu Ala 210 215 220 Ile Arg Lys Lys Thr Arg Ser Met Leu Leu Ser Ser Glu Gln Leu Lys 225 230 235 240 Leu Cys Val Leu Glu Tyr Gln Gly Lys Tyr Ile Leu Lys Val Cys Gly 245 250 255 Cys Asp Glu Tyr Phe Leu Glu Lys Tyr Pro Leu Ser Gln Tyr Lys Tyr 260 265 270 Ile Arg Ser Cys Ile Met Leu Gly Arg Met Pro Asn Leu Met Leu Met 275 280 285 Ala Lys Glu Ser Leu Tyr Ser Gln Leu Pro Met Asp Cys Phe Thr Met 290 295 300 Pro Ser Tyr Ser Arg Arg Ile Ser Thr Ala Thr Pro Tyr Met Asn Gly 305 310 315 320 Glu Thr Ser Thr Lys Ser Leu Trp Val Ile Asn Ser Ala Leu Arg Ile 325 330 335 Lys Ile Leu Cys Ala Thr Tyr Val Asn Val Asn Ile Arg Asp Ile Asp 340 345 350 Lys Ile Tyr Val Arg Thr Gly Ile Tyr His Gly Gly Glu Pro Leu Cys 355 360 365 Asp Asn Val Asn Thr Gln Arg Val Pro Cys Ser Asn Pro Arg Trp Asn 370 375 380 Glu Trp Leu Asn Tyr Asp Ile Tyr Ile Pro Asp Leu Pro Arg Ala Ala 385 390 395 400 Arg Leu Cys Leu Ser Ile Cys Ser Val Lys Gly Arg Lys Gly Ala Lys 405 410 415 Glu Glu His Cys Pro Leu Ala Trp Gly Asn Ile Asn Leu Phe Asp Tyr 420 425 430 Thr Asp Thr Leu Val Ser Gly Lys Met Ala Leu Asn Leu Trp Pro Val 435 440 445 Pro His Gly Leu Glu Asp Leu Leu Asn Pro Ile Gly Val Thr Gly Ser 450 455 460 Asn Pro Asn Lys Glu Thr Pro Cys Leu Glu Leu Glu Phe Asp Trp Phe 465 470 475 480 Ser Ser Val Lys Phe Pro Asp Met Ser Val Ile Glu Glu His Ala 485 490 495 Asn Trp Ser Val Ser Arg Glu Ala Gly Phe Ser Tyr Ser His Ala Gly 500 505 510 Leu Ser Asn Arg Leu Ala Arg Asp Asn Glu Leu Arg Glu Asn Asp Lys 515 520 525 Glu Gln Leu Lys Ala Ile Ser Thr Arg Asp Pro Leu Ser Glu Ile Thr 530 535 540 Glu Gln Glu Lys Asp Phe Leu Trp Ser His Arg His Tyr Cys Val Thr 545 550 555 560 Ile Pro Glu Ile Leu Pro Lys Leu Leu Leu Ser Val Lys Trp Asn Ser 565 570 575 Arg Asp Glu Val Ala Gln Met Tyr Cys Leu Val Lys Asp Trp Pro Pro 580 585 590 Ile Lys Pro Glu Gln Ala Met Glu Leu Leu Asp Cys Asn Tyr Pro Asp 595 600 605 Pro Met Val Arg Gly Phe Ala Val Arg Cys Leu Glu Lys Tyr Leu Thr 610 615 620 Asp Asp Lys Leu Ser Gln Tyr Leu Ile Gln Leu Val Gln Val Leu Lys 625 630 635 640 Tyr Glu Gln Tyr Leu Asp Asn Leu Leu Val Arg Phe Leu Leu Lys Lys 645 650 655 Ala Leu Thr Asn Gln Arg Ile Gly His Phe Phe Phe Trp His Leu Lys 660 665 670 Ser Glu Met His Asn Lys Thr Val Ser Gln Arg Phe Gly Leu Leu Leu 675 680 685 Glu Ser Tyr Cys Arg Ala Cys Gly Met Tyr Leu Lys His Leu Asn Arg 690 695 700 Gln Val Glu Ala Met Glu Lys Leu Ile Asn Leu Thr Asp Ile Leu Lys 705 710 715 720 Gln Glu Lys Lys Asp Glu Thr Gln Lys Val Gln Met Lys Phe Leu Val 725 730 735 Glu Gln Met Arg Arg Pro Asp Phe Met Asp Ala Leu Gln Gly Phe Leu 740 745 750 Ser Pro Leu Asn Pro Ala His Gln Leu Gly Asn Leu Arg Leu Glu Glu 755 760 765 Cys Arg Ile Met Ser Ser Ala Lys Arg Pro Leu Trp Leu Asn Trp Glu 770 775 780 Asn Pro Asp Ile Met Ser Glu Leu Leu Phe Gln Asn Asn Glu Ile Ile 785 790 795 800 Phe Lys Asn Gly Asp Asp Leu Arg Gln Asp Met Leu Thr Leu Gln Ile 805 810 815 Ile Arg Ile Met Glu Asn Ile Trp Gln Asn Gln Gly Leu Asp Leu Arg 820 825 830 Met Leu Pro Tyr Gly Cys Leu Ser Ile Gly Asp Cys Val Gly Leu Ile 835 840 845 Glu Val Val Arg Asn Ser His Thr Ile Met Gln Ile Gln Cys Lys Gly 850 855 860 Gly Leu Lys Gly Ala Leu Gln Phe Asn Ser His Thr Leu His Gln Trp 865 870 875 880 Leu Lys Asp Lys Asn Lys Gly Glu Ile Tyr Asp Ala Ala Ile Asp Leu 885 890 895 Phe Thr Arg Ser Cys Ala Gly Tyr Cys Val Ala Thr Phe Ile Leu Gly 900 905 910 Ile Gly Asp Arg His Asn Ser Asn Ile Met Val Lys Asp Asp Gly Gln 915 920 925 Leu Phe His Ile Asp Phe Gly His Phe Leu Asp His Lys Lys Lys Lys Lys 930 935 940 Phe Gly Tyr Lys Arg Glu Arg Val Pro Phe Val Leu Thr Gln Asp Phe 945 950 955 960 Leu Ile Val Ile Ser Lys Gly Ala Gln Glu Cys Thr Lys Thr Arg Glu 965 970 975 Phe Glu Arg Phe Gln Glu Met Cys Tyr Lys Ala Tyr Leu Ala Ile Arg 980 985 990 Gln His Ala Asn Leu Phe Ile Asn Leu Phe Ser Met Met Leu Gly Ser 995 1000 1005 Gly Met Pro Glu Leu Gln Ser Phe Asp Asp Ile Ala Tyr Ile Arg Lys 1010 1015 1020 Thr Leu Ala Leu Asp Lys Thr Glu Gln Glu Ala Leu Glu Tyr Phe Met 1025 1030 1035 1040 Lys Gln Met Asn Asp Ala His His Gly Gly Trp Thr Thr Lys Met Asp 1045 1050 1055 Trp Ile Phe His Thr Ile Lys Gln His Ala Leu Asn 1060 1065 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence < 220> <223> annealing forward primer for pCIG-mTOR mutant-IRES-EGFP <400> 11 aattccaatt gcccgggctt aagatcgata cgcgta 36 <210> 12 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> annealing reverse primer for pCIG-mTOR mutant-IRES-EGFP <400> 12 ccggtacgcg tatcgatctt aagcccgggc aattgg 36 <210> 13 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> forward primer for pCIG-mTOR mutant -IRES-EGFP <400> 13 gatcacaatt gtggccacca tggactacaa ggacgacgat gacaagatgc 50 <210> 14 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for pCIG-mTOR mutant-IRES-EGFP <400 > 14 tgatcaacgc gtttaccaga aagggcacca gccaatatag c 41 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Y1450D sense primer <400> 15 tcgtgcagtt tctcatccca ggtagcctgg atc 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Y1450D antisense primer <400> 16 gatccaggct acctgggatg agaaactgca cga 33 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223 > C1483R sense primer <400> 17 ggcctcgagg cggcgcatgc ggc 23 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C1483R antisense primer <400> 18 gccgcatgcg ccgcctcgag gcc 23 <210 > 19 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427Q sense primer <400> 19 gtctatgacc ccttgcagaa ctggaggctg atg 33 <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <220 > <223> L2427Q antisense primer <400> 20 catcagcctc cagttctgca aggggtcata gac 33 <210> 21 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427P sense primer <400> 21 gtctatgacc ccttgccgaa ctgg aggctg atg 33 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> L2427P antisense primer <400> 22 catcagcctc cagttcggca aggggtcata gac 33 <210> 23 <211> 27 <212> DNA <213 > Artificial Sequence <220> <223> TSC-1 R22W-F primer <400> 23 gtcacgtcgt cccacacacc cagcatg 27 <210> 24 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R22W-R primer <400> 24 catgctgggt gtgtgggacg acgtgac 27 <210> 25 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R204C-F primer <400> 25 ctttcatact gtaatgagaa cacaaaaagg agacga agtt gca 43 <210> 26 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> TSC-1 R204C-R primer <400> 26 tgcaacttcg tctccttttt gtgttctcat tacagtatga aag 43 <210> 27 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> TSC-2 V1547I-F primer <400> 27 tctccaacat acaggatggc gatcttgtgg gtg 33 <210> 28 <211> 33 <212> DNA <213> Artificial Sequence <220 > <223> TSC-2 V1547I-R primer <400> 28 cacccacaag atcgccatcc tgtatgttgg aga 33 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> AKT3 R247H-F primer <400 > 29 caccatagaa acgtgtgtgg tcctcagaga acacc 35 <210> 30 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> AKT3 R247H-R primer <400> 30 ggtgttctct gaggaccaca cacgtttcta tggtg 35 <210> 3 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence corresponding to TSC1 targeting sgRNA <400> 31 tgctggactc ctccacactg 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> DNA sequence corresponding to TSC2 targeting sgRNA<400> 32 aatcccaggt gtgcagaagg 20

Claims (26)

In the base sequence of SEQ ID NO: 1, cytosine (C) at position 616 is base substituted with thymine (T), guanine (G) at position 1871 is base substituted with adenine (A), and thymine (T) at position 4348 ) is substituted with guanine (G), guanine (G) at position 5126 is substituted with adenine (A), cytosine (C) at position 5930 is substituted with adenine (A), cytosine at position 6577 ( C) base substitution with thymine (T), and base substitution of cytosine (C) at position 6644 with thymine (T),
In the base sequence of SEQ ID NO: 3, cytosine (C) at position 64 is substituted with thymine (T), cytosine (C) at position 610 is substituted with thymine (T), and guanine (G) at position 2432 is substituted with thymine (T). ) base substitution,
In the base sequence of SEQ ID NO: 5, guanine (G) at position 4639 is substituted with adenine (A),
In the base sequence of SEQ ID NO: 7, guanine (G) at position 740 is substituted with adenine (A), and
In the base sequence of SEQ ID NO: 9, an agent capable of detecting one or more base substitutions selected from the group consisting of a base substitution of guanine (G) at position 3052 with adenine (A) or a mutant base sequence having the base substitution is included. And
The base substitution is a brain somatic mutation and is a mutation that causes symptoms due to type 2 focal cortical dysplasia (FCD type II) or type 2 focal cortical dysplasia,
Diagnostic kit for focal cortical dysplasia type 2 (FCD type II) or symptoms caused by focal cortical dysplasia type 2. The diagnostic kit according to claim 1, wherein the agent capable of detecting the base substitution or a mutant base sequence having the base substitution is a primer, probe, or antisense nucleic acid specific to each of the substitution sites. In the amino acid sequence of SEQ ID NO: 2, arginine (R) at position 206 is amino acid substituted with cysteine (C), arginine (R) at position 624 is amino acid substituted with histidine (H), and tyrosine (Y) at position 1450 is aspart. Amino acid substitution for acid (D), amino acid substitution 1709 for arginine (R) to histidine (H), amino acid substitution 1977 for threonine (T) to lysine (K), 2193 arginine (R) for cysteine (C) ), and amino acid substitution of serine (S) at position 2215 with phenylalanine (F),
In the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is amino acid substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811 is substituted with cysteine (C). Amino acid substitution with leucine (L),
In the amino acid sequence of SEQ ID NO: 6, amino acid substitution of valine (V) at position 1547 with isoleucine (I),
In the amino acid sequence of SEQ ID NO: 8, amino acid substitution of arginine (R) at position 247 with histidine (H), and
In the amino acid sequence of SEQ ID NO: 10, an agent capable of detecting one or more amino acid substitutions selected from the group consisting of substitution of aspartic acid (D) at position 1018 with asparagine (N) or a mutant amino acid sequence having the amino acid substitution is included. doing,
The amino acid substitution is a brain somatic mutation and is a mutation that causes symptoms due to type 2 focal cortical dysplasia (FCD type II) or type 2 focal cortical dysplasia,
Diagnostic kit for focal cortical dysplasia type 2 (FCD type II) or symptoms caused by focal cortical dysplasia type 2. The diagnostic kit according to claim 3, wherein the agent capable of detecting the substitution or a mutant sequence having the substitution is an antibody or aptamer specific to each substitution site. A method of providing information for diagnosis of focal cortical dysplasia type 2 (FCD type II) or symptoms caused by focal cortical dysplasia type 2, comprising the step of analyzing a sample of an individual using the diagnostic kit according to claim 1,
The step of analyzing the sample of the object is
In the base sequence of SEQ ID NO: 1, cytosine (C) at position 616 is substituted with thymine (T), guanine (G) at position 1871 is substituted with adenine (A), and thymine (T) at position 4348. Base substitution of guanine (G), guanine (G) at position 5126 with adenine (A), base substitution of cytosine (C) at position 5930 with adenine (A), cytosine (C) at position 6577. Base substitution of this with thymine (T), and base substitution of cytosine (C) at position 6644 with thymine (T),
In the base sequence of SEQ ID NO: 3, cytosine (C) at position 64 is substituted with thymine (T), cytosine (C) at position 610 is substituted with thymine (T), and guanine (G) at position 2432 is substituted with thymine (T). ) base substitution,
In the base sequence of SEQ ID NO: 5, guanine (G) at position 4639 is substituted with adenine (A),
In the base sequence of SEQ ID NO: 7, guanine (G) at position 740 is substituted with adenine (A), and
In the base sequence of SEQ ID NO: 9, a biomarker containing one or more base substitutions selected from the group consisting of a base substitution of guanine (G) at position 3052 with adenine (A) or a mutant base sequence having the base substitution is used in the individual. Detecting in a sample, and determining refractory epilepsy when a biomarker containing the one or more base substitutions or a mutant base sequence having the base substitution is detected,
The base substitution is a brain somatic mutation and is a mutation that causes symptoms due to type 2 focal cortical dysplasia (FCD type II) or type 2 focal cortical dysplasia,
A method of providing information for the diagnosis of focal cortical dysplasia type 2 (FCD type II) or symptoms due to focal cortical dysplasia type 2. The method of claim 5, wherein the sample is a brain tissue sample from an individual.
A method of providing information for diagnosis of type 2 focal cortical dysplasia (FCD type II) or symptoms caused by type 2 focal cortical dysplasia, comprising the step of analyzing a sample of an individual using the diagnostic kit according to claim 3,
The step of analyzing the sample of the object is
In the amino acid sequence of SEQ ID NO: 2, arginine (R) at position 206 is amino acid substituted with cysteine (C), arginine (R) at position 624 is amino acid substituted with histidine (H), and tyrosine (Y) at position 1450 is aspart. Amino acid substitution for acid (D), amino acid substitution 1709 for arginine (R) to histidine (H), amino acid substitution 1977 for threonine (T) to lysine (K), 2193 arginine (R) for cysteine (C) ), and amino acid substitution of serine (S) at position 2215 with phenylalanine (F),
In the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811 is substituted with leucine. Amino acid substitution with (L),
In the amino acid sequence of SEQ ID NO: 6, amino acid substitution of valine (V) at position 1547 with isoleucine (I),
In the amino acid sequence of SEQ ID NO: 8, amino acid substitution of arginine (R) at position 247 with histidine (H), and
In the amino acid sequence of SEQ ID NO: 10, the 1018th aspartic acid (D) is replaced with asparagine (N), an amino acid substitution selected from the group consisting of one or more amino acid substitutions or a mutant amino acid sequence having the amino acid substitution. , comprising the step of detecting in a sample, and determining refractory epilepsy when the one or more biomarkers are detected,
The amino acid substitution is a brain somatic mutation and is a mutation that causes symptoms due to type 2 focal cortical dysplasia (FCD type II) or type 2 focal cortical dysplasia,
A method of providing information for the diagnosis of focal cortical dysplasia type 2 (FCD type II) or symptoms due to focal cortical dysplasia type 2. The method of claim 7, wherein the sample is a brain tissue sample from an individual.
In the amino acid sequence of SEQ ID NO: 2, cytosine (C) at position 616 is replaced with thymine (T),
In the amino acid sequence of SEQ ID NO: 4, arginine (R) at position 22 is substituted with tryptophan (W), arginine (R) at position 204 is substituted with cysteine (C), and arginine (R) at position 811 is substituted with leucine. Amino acid substitution with (L),
In the amino acid sequence of SEQ ID NO: 6, amino acid substitution of valine (V) at position 1547 with isoleucine (I),
In the amino acid sequence of SEQ ID NO: 8, amino acid substitution of arginine (R) at position 247 with histidine (H), and
In the amino acid sequence of SEQ ID NO: 10, it is a protein consisting of an amino acid sequence containing one or more substitutions selected from the group consisting of amino acid substitutions where aspartic acid (D) at position 1018 is replaced with asparagine (N),
The amino acid substitution is a brain somatic mutation and is a mutation that causes symptoms due to type 2 focal cortical dysplasia (FCD type II) or type 2 focal cortical dysplasia. In the base sequence of SEQ ID NO: 1, cytosine (C) at position 616 is substituted with thymine (T),
In the base sequence of SEQ ID NO: 3, cytosine (C) at position 64 is substituted with thymine (T), cytosine (C) at position 610 is substituted with thymine (T), and guanine (G) at position 2432 is substituted with thymine (T). base substitution,
In the base sequence of SEQ ID NO: 5, guanine (G) at position 4639 is substituted with adenine (A),
In the base sequence of SEQ ID NO: 7, guanine (G) at position 740 is substituted with adenine (A), and
In the base sequence of SEQ ID NO: 9, the 3052nd guanine (G) is a nucleic acid molecule consisting of a base sequence containing one or more substitutions selected from the group consisting of adenine (A) base substitution,
The base substitution is a brain somatic mutation, and is a nucleic acid molecule that is a mutation that causes symptoms due to type 2 focal cortical dysplasia (FCD type II) or type 2 focal cortical dysplasia. A biomarker panel for the diagnosis of focal cortical dysplasia type 2 (FCD type II) or symptoms caused by focal cortical dysplasia type 2, comprising the protein of claim 9 or the nucleic acid molecule of claim 10. delete An animal, other than a human, into which the nucleic acid molecule of claim 10 has been introduced, in which type 2 focal cortical dysplasia (FCD type II) or symptoms due to type 2 focal cortical dysplasia are induced. The method of claim 1, wherein the diagnostic kit:
In the base sequence of SEQ ID NO: 1, thymine (T) at position 4447 is base substituted with cytosine (C), thymine (T) at position 7280 is base substituted with adenine (A), and thymine ( A diagnostic kit, wherein T) further comprises an agent capable of detecting at least one base substitution selected from the group consisting of a base substitution with cytosine (C) or a mutant base sequence having the base substitution. The method of claim 3, wherein the diagnostic kit:
In the amino acid sequence of SEQ ID NO: 2, amino acid substitution of cysteine (C) at position 1483 with arginine (R), amino acid substitution of leucine (L) at position 2427 with proline (P), and leucine at position 2427 ( A diagnostic kit, wherein L) further comprises an agent capable of detecting one or more amino acid substitutions selected from the group consisting of amino acid substitutions with glutamine (Q) or a mutant amino acid sequence having the amino acid substitutions. The diagnostic kit according to any one of claims 1 to 4, wherein the symptoms due to type 2 focal cortical dysplasia are spontaneous seizures, behavioral seizures, electroencephalographic seizures, or the generation of abnormal nerve cells in the cerebrum. The method of claim 5, wherein the diagnostic kit:
In the base sequence of SEQ ID NO: 1, thymine (T) at position 4447 is base substituted with cytosine (C), thymine (T) at position 7280 is base substituted with adenine (A), and thymine ( The method further comprises an agent capable of detecting at least one base substitution selected from the group consisting of a base substitution where T) is cytosine (C) or a mutant base sequence having the base substitution. The method of claim 7, wherein the diagnostic kit:
In the amino acid sequence of SEQ ID NO: 2, amino acid substitution of cysteine (C) at position 1483 with arginine (R), amino acid substitution of leucine (L) at position 2427 with proline (P), and leucine at position 2427 ( The method further comprises an agent capable of detecting one or more amino acid substitutions selected from the group consisting of amino acid substitutions where L) is glutamine (Q) or a mutant amino acid sequence having the amino acid substitutions. The method according to any one of claims 5 to 8, wherein the symptoms due to type 2 focal cortical dysplasia are spontaneous seizures, behavioral seizures, electroencephalographic seizures, or the generation of abnormal nerve cells in the cerebrum. delete delete delete delete delete delete delete

Images