KR101636159B1 - Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same - Google Patents
Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same Download PDFInfo
- Publication number
- KR101636159B1 KR101636159B1 KR1020140148598A KR20140148598A KR101636159B1 KR 101636159 B1 KR101636159 B1 KR 101636159B1 KR 1020140148598 A KR1020140148598 A KR 1020140148598A KR 20140148598 A KR20140148598 A KR 20140148598A KR 101636159 B1 KR101636159 B1 KR 101636159B1
- Authority
- KR
- South Korea
- Prior art keywords
- gene
- rice
- loc
- os06g22440
- blight
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y201/00—Transferases transferring one-carbon groups (2.1)
- C12Y201/01—Methyltransferases (2.1.1)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
본 발명은 메틸전이효소인 LOC_Os06g22440 유전자가 불활성화되도록 T-DNA 서열이 삽입된, 식물의 병 저항성 증진용 재조합 벡터, 상기 재조합 벡터를 포함하는 식물 형질전환체, 및 상기 형질전환체의 제조방법에 관한 것이다. 또한, 상기 재조합 벡터를 이용하여, LOC_Os06g22440 유전자를 불활성화시키는 단계를 포함하는 벼의 병 저항성의 증진방법에 관한 것이다. 본 발명은 벼에 내재적으로 존재하며 흰잎 마름병에 대한 이병성 유전자, LOC_Os06g22440의 유전자 서열 내에 T-DNA 서열을 삽입함으로써, 흰잎 마름병에 대해 강력한 저항성을 갖는 형질전환 벼에 대한 것으로, 본 발명의 형질전환 벼를 이용하면 병 저항성을 통해 농약사용 절감, 생산성 향상 및 안전한 농산물 공급이 가능하게 되어 널리 이용될 수 있다.The present invention relates to a recombinant vector for enhancing disease resistance of a plant, in which a T-DNA sequence is inserted so that the LOC_Os06g22440 gene, which is a methyltransferase, is inactivated, a plant transformant containing the recombinant vector, and a method for producing the transformant . In addition, the present invention relates to a method for enhancing rice disease resistance, comprising the step of inactivating the LOC_Os06g22440 gene using the above recombinant vector. The present invention relates to a transgenic rice plant which is intrinsically present in rice and has a strong resistance against blight of blight by inserting a T-DNA sequence into the gene sequence of the deletion gene for L. vivax, LOC_Os06g22440, Can be widely used because it can reduce the use of pesticides, improve productivity, and provide safe agricultural products through disease resistance.
Description
본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성이 약화 또는 불활성화된, 식물 형질 전환체, 상기 유전자의 활성을 약화 또는 불활성화시키는 T-DNA 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터 및 상기 식물 형질 전환체의 제조방법에 관한 것이다. 또한, 상기 LOC_Os06g22440 유전자의 활성을 약화 또는 불활성화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법에 관한 것이다.
The present invention relates to a plant transformant, wherein the activity of the LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase is weakened or inactivated, a T-DNA sequence which attenuates or inactivates the activity of the gene , A recombinant vector for promoting disease resistance of a plant, and a method for producing the plant transformant. Further, the present invention relates to a method for enhancing plant disease resistance, comprising the step of weakening or inactivating the activity of the LOC_Os06g22440 gene.
벼 흰잎 마름병은 Xanthomonas oryzae pv. oryzae 에 의해서 발생되는 세균성 도관병으로, 발병시기는 7월 초~수확기이나 주로 7월 상순~8월 중순에 발병한다. 중간 기주식물인 줄풀 및 겨풀 등의 땅속줄기 또는 뿌리주위나 병든 볏짚 및 벼 그루터기에서 세균의 월동이 가능하다. 세균이 편모(鞭毛)에 의해 물을 따라 전염하고 벼잎의 물구멍과 공기구멍 부위 및 절단된 뿌리로 침입한다. 병 발생은 해마다 발생이 많은 상습발생지 위주로 발생하나 침관수지역이 아닌 지역에서도 발생이 많다.Rice blight caused by Xanthomonas oryzae pv. It is a bacterial tuberculosis caused by oryzae. Its onset occurs from early July to harvesting season, mainly from early July to mid-August. Bacterial wintering is possible in underground stalks, roots, or diseased rice straw and rice stubble, which are intermediate host plants. Bacteria spread along the water by flagella and invade into the water holes, air holes and cut roots of the leaves. Disease occurs mainly in the area of frequent occurrence of the disease every year, but it also occurs in areas not in the area of the pelvic area.
보통 출수기 전후에 나타나나 상습발생지나 다발생 발생지에는 본답 초기에 발병하며, 드물게는 묘판에서도 발병된다. 국내에서 최초 발병보고는 1930년 전라남도 해남군에서 처음 발견된 이래 1960년까지 남부 일부 지역에 제한적인 발생을 보이다 이병(罹病)성 품종인 금남풍의 재배 확대로 전국적인 발생을 나타내었으며, 이후 다수계 품종 재배에 의한 밀양 23호에 의해 피해가 확대되어 재배기간 중 후기에 발생되는 잎에서의 발병 뿐만 아니라 이앙 후 분열기까지 주 전체가 발생되는 금성형 증상을 보여 벼의 3대 병해의 하나로 간주된다.Usually it appears before and after the heading period, but the occurrence of the rash or the occurrence of the rash occurs at the beginning of the reply. The first occurrence of this disease in Korea was first reported in Haenam, Jeollanam-do in 1930, and it was limited in some parts of the southern part of Korea until 1960. It was caused by the cultivation of Gyeongnam-myeon, It is considered to be one of the three major diseases of rice, showing not only the onset of leaf in later stage of cultivation period, but also the symptom of gold molding in which the whole body occurs until the post - transplantation division.
벼 흰잎 마름병균은 그람음성세균으로 분류되고 벼의 세균성 위조병을 유발하는 식물병원세균으로 세계적으로 널리 분포하여 벼에 큰 피해를 주지만, 병원균이 벼의 도관 내에서 증식하므로 약제방제 효과는 매우 낮으며, 현재까지 이 병에 특이적인 살균제 또한 없는 실정이다. The rice blotting bacteria are classified as Gram negative bacteria and are widely distributed throughout the world because of bacterial fungi causing bacterial fake disease of rice. Although they cause great damage to rice, pathogens propagate in the ducts of rice, And there is no specific fungicide to date.
또한, 기존의 작물에 대한 저항성 부여방법은 외래 유전자의 도입을 통해 식물체로 하여금 새로운 형질을 부여하는 기술이 대다수였다.
In addition, the conventional method of imparting resistance to crops is a technique in which plants are given new traits through the introduction of foreign genes.
한편, 동진벼는 내병, 양질, 다수성 신품종육성을 목표로 1975년에 농촌진흥청에서 금남풍과 낙동벼 그리고 사도미노리를 교배하여 개발된 품종으로, 병해 저항성의 경우 줄무늬잎마름병에 강하고, 도열병에는 중간 정도의 저항성을 가지며, 흰잎 마름병과 기타 병충해에는 약한 편이다. 이에, 동진벼의 흰잎 마름병과 도열병에 대한 저항성 연구와 개량된 품종에 대한 육성 전략이 요구되고 있다.
Meanwhile, Dongjinbyeong was developed in 1975 as a cross breed between gold southern wind, Nakdong rice and Sadominori in 1975 with the goal of raising the disease, quality and diversity of new varieties. It is resistant to streak blight in case of disease resistance, , And it is weak against blight of white blotch and other pests. Therefore, it is required to study resistance to blight of white blossom and blast disease in Dongjinbyeong, and to cultivate improved varieties.
이에 본 발명자들은 아직 극복되지 못한 벼 흰잎 마름병에 대한 이병(罹病)성 유전자를 동정하기 위해 예의 연구 노력한 결과, 천연형 벼 동진의 보유 유전자 중 흰잎 마름병에 이병(罹病)성을 부여하는 메틸전이 효소 유전자 (LOC_Os06g22440)를 동정해내어, 이를 불활성화시킨 형질전환체가 흰잎 마름병에 저항성을 나타냄을 확인함으로써 본 발명을 완성하였다.
Accordingly, the present inventors have made intensive researches to identify a disease-causing gene for blight-resistant rice blight that has not yet been overcome. As a result, the inventors of the present invention have found that a methyltransferase The gene (LOC_Os06g22440) was identified and the inactivated transformant was found to be resistant to blight of blight of white blight, thereby completing the present invention.
본 발명의 하나의 목적은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성이 약화 또는 불활성화된, 식물 형질 전환체를 제공하는 것이다.One object of the present invention is to provide a plant transformant in which the activity of the LOC_Os06g22440 gene containing the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase is weakened or inactivated.
본 발명의 다른 목적은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성을 약화 또는 불활성화시키는 T-DNA 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터를 제공하는 것이다.Another object of the present invention is to provide a recombinant vector for promoting disease resistance of a plant, which comprises a T-DNA sequence which weakens or inactivates the activity of the LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase .
본 발명의 또 다른 목적은 (a) 상기 재조합 벡터가 도입된 아그로박테리움으로 식물을 감염시키는 단계; 및 (b) 상기 (a) 단계에서 감염된 식물의 세포를 캘러스(callus)화하여 형질전환된 식물의 세포를 수득하는 단계를 포함하는, 병 저항성이 증진된 식물 형질 전환체의 제조방법을 제공하는 것이다.Yet another object of the present invention is to provide a method for producing a recombinant vector comprising: (a) infecting a plant with Agrobacterium to which the recombinant vector is introduced; And (b) callusing the cells of the infected plant in step (a) to obtain cells of the transformed plant. will be.
본 발명의 또 다른 목적은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성을 약화 또는 불활성화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법을 제공하는 것이다.
It is still another object of the present invention to provide a method for enhancing the disease resistance of a plant, comprising the step of attenuating or inactivating the activity of the LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding the methyltransferase.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성이 약화 또는 불활성화된, 식물 형질 전환체를 제공한다.According to one aspect of the present invention, there is provided a plant transformant in which the activity of the LOC_Os06g22440 gene containing the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase is weakened or inactivated.
본 발명에서는 벼에 내재적으로 존재하는 이병성 유전자인, LOC_Os06g22440의 서열 내에 T-DNA 서열을 삽입함으로써, 해당 유전자가 불활성화되도록 하여 흰잎 마름병에 대해 저항성을 갖춘 형질전환 벼를 제조하였다.In the present invention, a T-DNA sequence is inserted into the sequence of LOC_Os06g22440, which is an inherited disease gene inherent in rice, so that the gene is inactivated to produce transgenic rice resistant to blight of blight.
보다 상세하게는 본 발명자들은 아그로박테리움(Agrobacterium)을 이용한 형질전환 방법을 통해 만들어진 10만 개통의 벼 돌연변이 집단에서 흰잎마름병에 저항성이 있는 돌연변이체를 관찰하였다. 돌연변이 식물체는 아그로박테리움(Agrobacterium)에 의해 유전자를 발현시키는 발현 유도 서열을 포함하는 T-DNA 가 genome 상에 삽입되어 삽입된 지역의 유전자 기능이 불활성화된 식물체이다. T-DNA 삽입 위치를 genome DNA PCR과 염기서열 분석을 통해 확인할 수 있으며, 데이터 베이스에서 유전자 locus id를 찾을 수 있다.More specifically, the present inventors observed a mutant resistant to blight of blight in a 100,000 rice mutant population produced by the transformation method using Agrobacterium. The mutant plant is a plant in which T-DNA containing an expression inducing sequence for expressing a gene by Agrobacterium is inserted into the genome and the gene function of the inserted region is inactivated. The location of T-DNA insertion can be confirmed by genome DNA PCR and sequencing, and the gene locus id can be found in the database.
본 발명에서 용어 “메틸전이효소”는 메틸기전이를 촉매하는 효소의 총칭으로, 메틸기전달효소의 일종으로 기질인 아미노기, 히드록시기, 티올기를 메틸화하여 메틸화효소라고 부르는 경우도 있다The term " methyltransferase " in the present invention is a generic term for an enzyme that catalyzes the methyltransferase, and may be referred to as a methylation enzyme by methylating an amino group, a hydroxyl group or a thiol group, which is a substrate,
본 발명에서 용어, “LOC_Os06g22440”는 Oryza sativa 여섯번째 유전체 (chromosome)에 존재하는 유전자로, 이의 발현물은 단백질 메틸전이효소의 일종이다. 상기 LOC_Os06g22440 유전자는 서열번호 1 또는 서열번호 2의 염기서열을 가지는 유전자 일 수 있으며, 바람직하게는 서열번호 2의 염기서열을 가지는 유전자 일 수 있으며, 또는 서열번호 3의 아미노산 서열로 코딩되는 유전자 일 수 있다.In the present invention, the term " LOC_Os06g22440 " is a gene located in the sixth chromosome of Oryza sativa, and its expression product is a kind of protein methyltransferase. The LOC_Os06g22440 gene may be a gene having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, preferably a gene having the nucleotide sequence of SEQ ID NO: 2, or a gene encoded by the amino acid sequence of SEQ ID NO: 3 have.
상기 LOC_Os06g22440 (TIGR, Os06g0329900 (RAP-DB))의 genome DNA 크기는 2284 bp (서열번호 1)이며 대표 coding sequence (LOC_Os06g22440.1)의 크기는 1101 bp (서열번호 2)로 4개의 exon과 3개의 intron으로 구성되며 366 개의 아미노산으로 번역되어 단백질 (서열번호 3)이 만들어진다. 이 단백질은 plant methyltransferase domain (Methyltransf_7)을 암호화 한다 (도 1B).The genome DNA size of LOC_Os06g22440 (TIGR, Os06g0329900 (RAP-DB)) is 2284 bp (SEQ ID NO: 1) and the size of representative coding sequence (LOC_Os06g22440.1) is 1101 bp intron and translated into 366 amino acids to make a protein (SEQ ID NO: 3). This protein encodes the plant methyltransferase domain (Methyltransf_7) (Fig. 1B).
상기 LOC_Os06g22440 유전자는 벼에 내재적으로 존재하는 유전자이다. 본 발명에서 용어, "내재적"이란 생물이 천연의 상태로 가지고 있는 것을 의미하는데, 본 발명에서는 식물, 바람직하게는 벼(Oriza sp.) 유전체(chromosome)가 천연적으로 가지고 있는 유전자를 표시할 때 사용한다. 본 발명의 LOC_Os06g22440 유전자는 천연형 벼에서 내재적인 유전자이다.The LOC_Os06g22440 gene is a gene that is inherently present in rice. The term "intrinsic" in the present invention means that a living organism has a natural state. In the present invention, when a plant, preferably a genus of a rice (Oriza sp.) Chromosome, use. The LOC_Os06g22440 gene of the present invention is an intrinsic gene in native rice.
본 발명에서 용어 "활성 약화"는 DNA, 즉 유전자 상으로는 존재하나 RNA로 전사(transcription)되는 비율이 낮거나, 단백질로 번역(translation) 되는 비율이 낮아서 본연의 기능을 발휘하지 못하는 것을 의미하고, 본 발명에서는 벼가 내재적으로 가지고 있는 유전자가 전사 또는 번역이 되는 비율이 낮아서 그 기능을 제대로 발현하지 못하는 것을 의미하고, 특히, LOC_Os06g22440 유전자가 그 기능을 제대로 발현하지 못하는 것을 의미한다.The term "active weakening" in the present invention means that DNA is present in a gene, that is, in a gene, but the rate of transcription into RNA is low or the rate of translation into protein is low, In the present invention, it is meant that the gene in which rice is intrinsically present has a low ratio of transcription or translation, and thus can not express its function properly. In particular, LOC_Os06g22440 gene does not express its function properly.
본 발명에서 용어 "불활성화"는 DNA, 즉 유전자 상으로는 존재하나 RNA로 전사(transcription)되지 못하거나, 단백질로 번역(translation)되지 못하여 본연의 기능을 발휘하지 못하는 것을 의미하고, 본 발명에서는 벼가 내재적으로 가지고 있는 유전자가 전사 또는 번역되지 않는 특성상 그 기능을 발현하지 못하는 것을 의미하고, 특히, LOC_Os06g22440 유전자가 그 기능을 발현하지 못하는 것을 의미한다.The term "inactivated" in the present invention means DNA, that is, it exists as a gene, but is not transcribed into RNA or can not be translated into protein and thus can not exhibit its function. In the present invention, Means that the gene that is inherently present does not express its function due to the nature of transcription or translation, and in particular, the LOC_Os06g22440 gene does not express its function.
본 발명에서 상기 유전자의 "활성 약화" 또는 "불활성화"를 위하여 1) 해당 유전자의 서열 내에 T-DNA 서열을 삽입, 2) 활성이 불활성화된 형태로 변형시키는 방법으로 소실, 또는 3) 이의 조합에 의해 불활성화되도록 변형시킬 수 있다.In the present invention, for the purpose of "attenuating" or "inactivation" of the gene, 1) inserting a T-DNA sequence into the sequence of the corresponding gene, 2) transforming the gene into a form in which the activity is inactivated, or 3) Can be modified to be inactivated by combination.
본 발명에서는 바람직하게는 상기 LOC_Os06g22440 유전자 서열 내에 T-DNA를 삽입할 수 있으며, 더욱 바람직하게는 서열번호 4로 기재되는 염기서열을 삽입할 수 있다. 가장 바람직하게는 상기 LOC_Os06g22440 유전자의 서열 내의 두 번째 인트론 부위 (intron region)에 T-DNA 서열 (서열번호 4)을 삽입하여, 상기 LOC_Os06g22440 유전자를 불활성화 시킬 수 있다. 본 발명에서 상기 LOC_Os06g22440 유전자의 두번째 인트론 부위인 서열번호 1의 1272~1283 염기서열 사이에 서열번호 4로 기재되는 T-DNA 서열을 삽입하였다. In the present invention, preferably, the T-DNA may be inserted into the LOC_Os06g22440 gene sequence, more preferably the nucleotide sequence of SEQ ID NO: 4 may be inserted. Most preferably, the LOC_Os06g22440 gene can be inactivated by inserting a T-DNA sequence (SEQ ID NO: 4) in a second intron region in the sequence of the LOC_Os06g22440 gene. In the present invention, the T-DNA sequence shown in SEQ ID NO: 4 is inserted between the nucleotide sequence of 1272 to 1283 of SEQ ID NO: 1 which is the second intron site of the LOC_Os06g22440 gene.
본 발명의 구체적인 일 실시예에서는, LOC_Os06g22440 유전자 서열 내에 T-DNA(서열번호 4)를 삽입함으로써, LOC_Os06g22440의 유전자를 불활성화시켰으며, 이에 의해 LOC_Os06g22440 유전자가 불활성화되도록 형질전환된 식물 형질 전환체가 흰잎 마름병에 대해 병 저항성을 가지는 것을 확인하였다(도 5).
In a specific embodiment of the present invention, the gene of LOC_Os06g22440 is inactivated by inserting T-DNA (SEQ ID NO: 4) in the LOC_Os06g22440 gene sequence, whereby the plant transformant transformed so that the LOC_Os06g22440 gene is inactivated is a white leaf And was found to have disease resistance against blight (FIG. 5).
본 명세서에서, 용어 "식물"은 성숙한 식물 뿐만 아니라 성숙한 식물로 발육할 있는 식물 세포, 식물 조직 및 식물의 종자 등을 모두 포함하는 의미로서 이해된다. 본 발명에서 상기 벡터로 식물 형질전환체를 제조하기 위하여 당업자에게 공지된 형질전환기술에 의해 수행될 수 있다. 바람직하게는 아그로박테리움을 이용한 형질전환방법, 미세사출법(microprojectile bombardment), 일렉트로포레이션(electroporation), PEG-매개 융합법(PEG-mediated fusion), 미세주입법(microinjection), 리포좀 매개법(liposome-mediated method), 인-플란타 형질전환법(In planta transformation), 진공 침윤법(Vacuum infiltration method), 화아침지법(floral meristem dipping method), 및 아그로박테리아 분사법(Agrobacteria spraying method)을 이용할 수 있으며, 더 바람직하게는 아그로박테리움을 이용한 형질전환방법을 이용할 수 있다.As used herein, the term "plant" is understood to include not only mature plants but also plant cells, plant tissues and plant seeds that develop into mature plants. In the present invention, transformation can be carried out by a transformation technique known to a person skilled in the art in order to produce a plant transformant with said vector. The microorganism is preferably transformed with Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome (liposome) method, mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method, and Agrobacteria spraying method can be used. And more preferably, a transformation method using Agrobacterium can be used.
본 발명의 일실시예에 따르면, LOC_Os06g22440 유전자가 불활성화된 벼의 형질전환체를 제작하기 위하여 상기와 같은 T-DNA를 포함하는 재조합 벡터를 아그로박테리움을 통해 벼 세포에 도입하여 형질전환체를 제작하였으며, 상기 형질전환체는 평균 병증의 길이가 천연형 동진벼의 반 정도에 불과하여 (천연형 vs. SAMT 19 : 24.2cm vs. 8.6cm), 흰잎 마름병에 대한 강력한 저항성을 가짐을 확인할 수 있었다(도 5). According to an embodiment of the present invention, a recombinant vector containing the T-DNA is introduced into rice cells through Agrobacterium to prepare a transformant of rice in which the LOC_Os06g22440 gene is inactivated, , And the length of the mean pathology of the transformants was only about half of that of wild-type Dong Jinbin (natural type vs. SAMT 19: 24.2 cm vs. 8.6 cm), indicating strong resistance to blight of blight (Fig. 5).
본 발명에서 용어, "형질전환"은 DNA 염기서열 상의 삽입, 결실 또는 대체 등의 변이를 통해 특정 형질이 발생하거나 사라지거나 조절되는 모든 행위를 의미하며, 특히 본 발명에서는 외부로부터 주어진 DNA에 의하여 생물의 유전적인 성질이 변하는 것을 의미한다. 본 발명에서 용어, "형질 전환체"는 형질전환으로 인해 생성된 형질전환 식물을 의미하며, 유전자 재조합 기술을 이용하여 특정 유전자의 변형 또는 활성의 변이가 유발되어 생성된 유전자 재조합체를 포함한다.The term "transformed" in the present invention means all the activities in which a specific trait occurs, disappears or is controlled through mutation such as insertion, deletion or substitution on the DNA base sequence. In particular, in the present invention, Which means that the genetic properties of In the present invention, the term "transformant" refers to a transgenic plant produced by transformation, and includes genetic recombinants produced by mutation of a specific gene or activation of an activity using genetic recombination technology.
본 발명에서 용어, "식물 형질 전환체"는 형질전환의 대상이 될 수 있는 모든 식물을 포함하며, 특히, LOC_Os06g22440 유전자 또는 이에 해당하는 유전자가 포함되어 있는 식물은 모두 제한없이 포함한다. 바람직하게는 상기 식물 형질 전환체는 벼(Oryza sp.)일 수 있으며, 더욱 바람직하게는 동진벼일 수 있다. In the present invention, the term "plant transformant" includes all plants that can be subjected to transformation, and in particular, all plants including LOC_Os06g22440 gene or a gene corresponding thereto are included without limitation. Preferably, the plant transformant may be rice (Oryza sp.), More preferably Dongjin rice.
본 발명에서 상기 식물 형질 전환체는 흰잎 마름병에 대한 저항성을 가질 수 있다. In the present invention, the plant transformant may have resistance to blight of blight.
본 발명의 구체적인 일 실시예에서 LOC_Os06g22440 유전자는 천연형 벼에서 내재적인 유전자이며, 유전자 서열내에 서열번호 4의 T-DNA 서열을 삽입하는 형질전환을 통하여 LOC_Os06g22440에 해당하는 유전자가 불활성화되는 형질전환체를 제조하였으며, 이를 SAMT 19 이라고 명명하였다.
In a specific embodiment of the present invention, the LOC_Os06g22440 gene is an intrinsic gene in native rice, and a transformant in which a gene corresponding to LOC_Os06g22440 is inactivated through transfection in which a T-DNA sequence of SEQ ID NO: 4 is inserted into the gene sequence Was named
또 하나의 양태로서, 본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성을 약화 또는 불활성화시키는 T-DNA 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터를 제공한다. In another aspect, the present invention provides a recombinant vector for enhancing plant disease resistance, comprising a T-DNA sequence which attenuates or inactivates the activity of the LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase to provide.
상기 메틸전이효소, LOC_Os06g22440, 활성 약화, 불활성화, 및 T-DNA 서열은 상기 설명한 바와 같다.The methyltransferase, LOC_Os06g22440, active weakened, inactivated, and T-DNA sequences are as described above.
본 발명에서 용어, "병 저항성"은 각종 질병에 대해 발병이 잘 일어나지 않거나, 발병되더라도 병 진행의 속도가 현저히 느리거나, 회복이 되는 능력이 뛰어난 것을 의미한다. 본 발명에서 병 저항성은 흰잎 마름병에 대한 저항성을 의미할 수 있다.In the present invention, the term "disease resistance" means that the onset of disease does not occur well, or that the disease progression rate is significantly slower or recoverable. In the present invention, disease resistance may mean resistance to blight of blight.
본 발명에서 용어, "재조합 벡터"는 특정 서열이 변이, 삽입 또는 제거되는 유전자 재조합 과정을 거친 벡터를 의미하며, 본 발명에서는 상기 LOC_Os06g22440 유전자의 발현이 불활성화되도록 상기 LOC_Os06g22440 유전자 서열 내에 T-DNA가 삽입된 것이다. In the present invention, the term "recombinant vector" means a vector that has undergone a gene recombination process in which a specific sequence is mutated, inserted or deleted. In the present invention, T- DNA is inserted into the LOC_Os06g22440 gene sequence so that expression of the LOC_Os06g22440 gene is inactivated It is inserted.
본 발명에서 일실시예에 따르면, 상기 LOC_Os06g22440 유전자가 이병(罹病)에 관여하는지를 확인하기 위하여, 동진벼에 존재하는 LOC_Os06g22440 유전자의 서열 내의 두 번째 인트론 부위 (intron region)에 T-DNA 서열 (서열번호 4)을 삽입하여, LOC_Os06g22440 유전자를 불활성화시켰다(도 2). 또한, 본 발명의 구체적인 일 실시예에서 상기 LOC_Os06g22440 유전자가 불활성화되도록 형질전환된 식물 형질 전환체가 흰잎 마름병에 대해 병 저항성을 가지는 것을 확인하였다(도 5).
According to one embodiment of the present invention, in order to confirm whether the LOC_Os06g22440 gene is involved in the disease, a T-DNA sequence (SEQ ID NO: 4) is inserted in the second intron region in the sequence of the LOC_Os06g22440 gene existing in Dongjin- ) Was inserted to inactivate the LOC_Os06g22440 gene (Fig. 2). In addition, in a specific embodiment of the present invention, it was confirmed that the plant transformant transformed to inactivate the LOC_Os06g22440 gene has disease resistance against blight of blight (FIG. 5).
또 하나의 양태로서, 본 발명은 (a) 상기 재조합 벡터가 도입된 아그로박테리움으로 식물을 감염시키는 단계; 및 (b) 상기 (a) 단계에서 감염된 식물의 세포를 캘러스(callus)화하여 형질전환된 식물의 세포를 수득하는 단계를 포함하는, 병 저항성이 증진된 식물 형질 전환체의 제조방법을 제공한다.In another embodiment, the present invention provides a method for producing a recombinant vector comprising: (a) infecting a plant with Agrobacterium to which the recombinant vector is introduced; And (b) callusing cells of the infected plant in step (a) to obtain cells of the transformed plant, wherein the method comprises the steps of: .
본 발명에서 용어, "아그로박테리움"은 그람양성의 세균으로, 식물의 뿌리나 줄기의 상처를 통해 식물세포에 감염되어, 자신이 가지고 있는 유전자를 식물 세포의 유전체에 삽입하여 식물세포의 형질전환을 일으키는 암종세균의 일종이다. 본 발명에서 상기 아그로박테리움은 바람직하게는 아그로박테리움 투메파키엔스(Agrobacterium tumefaciens)일 수 있다. The term "Agrobacterium" in the present invention refers to a gram-positive bacterium, which is infected with plant cells through scars of the roots or stems of plants, and inserts the gene of interest into the genome of the plant cell to transform the plant cell Is a kind of carcinoma bacteria that causes cancer. In the present invention, the Agrobacterium may be Agrobacterium tumefaciens.
본 발명에서 용어, "캘러스(callus)"란, 식물에 상처가 났을 때 생기는 분화되지 않은 부정형의 세포덩어리로 즉, 미분화세포를 의미하며, 특히, 본 발명에서는 식물의 잘린 부위에 아그로박테리움 등 형질전환용 암종세균을 감염시켰을 때 감염된 세포가 미분화상태로 상처부위에 덩어리진 것을 의미한다. 즉, 본 발명에서는 암종세균에 감염되어 형질전환된 세포만이 암종 덩어리를 생성하는 특징을 이용하여 형질전환된 미분화세포를 얻을 수 있는데 이것이 캘러스 형태로 생성되게 된다.The term "callus " in the present invention means an undifferentiated amorphous cell mass produced when a plant is injured, that is, undifferentiated cell. Particularly, in the present invention, Agrobacterium When the transforming carcinoma bacterium is infected, it means that the infected cells are undifferentiated and lump on the wound site. That is, in the present invention, transformed undifferentiated cells can be obtained using only the cells transformed by infection with carcinoma bacteria to produce a mass of carcinoma, which is produced as a callus.
상기 병 저항성이 증진된 형질전환체의 제조방법은, 바람직하게는 수득된 캘러스를 뿌리 및 성체로 분화시키는 단계를 추가로 포함할 수 있다. 캘러스는 상기 설명한대로 미분화된 상태의 세포 덩어리에 불과하기 때문에, 이를 온전한 종자로 수득하기 위해서는 뿌리 및 성체로 분화하는 것을 유도하는 것이 필요할 수 있다.The method for producing a transformant having enhanced disease resistance may further include the step of differentiating the obtained callus into root and adult. Since the callus is only a cell mass in an undifferentiated state as described above, it may be necessary to induce differentiation into roots and adults in order to obtain it as a whole seed.
본 발명의 구체적인 일 실시예에서는, 수득된 캘러스를 루트-인덕션 배지에서 배양하여 뿌리 및 성체로 분화하는 것을 유도하였다(실시예 2).
In one specific embodiment of the present invention, the obtained callus was cultured in root-induction medium to induce differentiation into root and adult (Example 2).
또 하나의 양태로, 본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성을 약화 또는 불활성화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법을 제공한다.In another aspect, the present invention provides a method for enhancing plant disease resistance, comprising the step of attenuating or inactivating the activity of the LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.
본 발명의 재조합 벡터, LOC_Os06g22440 유전자, 활성 약화, 불활성화 및 병 저항성 등은 상기 설명한 바와 같다.The recombinant vector, LOC_Os06g22440 gene, activity attenuation, inactivation and disease resistance of the present invention are as described above.
본 발명에서, 상기 용어 "증진"은 본 발명에서 대조군 벼와 비교하여 적어도 5% 또는 10%, 바람직하게는 적어도 20% 또는 40%, 더욱 바람직하게는 50%, 60%, 70% 또는 80% 이상의 병 저항성을 의미하며, 벼가 원래 가지고 있는 병 저항성에 비해 상기 유전자를 도입하여 병 저항성이 증가되는 것을 의미한다.
In the present invention, the term " promotion "is used herein to refer to at least 5% or 10%, preferably at least 20% or 40%, more preferably 50%, 60%, 70% Means that the disease resistance is increased by introducing the gene as compared to the inherent disease resistance of the rice.
본 발명의 벼에 내재적으로 존재하는 흰잎 마름병에 대한 이병(罹病)성 유전자인 LOC_Os06g22440의 유전자 서열 내에 T-DNA 서열을 삽입함으로써, 흰잎 마름병에 대해 강력한 저항성을 갖는 형질전환 벼에 대한 것으로, 본 발명의 형질전환 벼를 이용하면 병 저항성을 통해 농약사용 절감, 생산성 향상 및 안전한 농산물 공급이 가능하게 되어 널리 이용될 수 있다.
The present invention relates to a transgenic rice having a strong resistance to blight of blight by inserting a T-DNA sequence in the gene sequence of LOC_Os06g22440, which is a morbid disease gene for blight-resistant blight present intrinsic to rice of the present invention, The use of transgenic rice can be widely used because it can reduce the use of pesticides, improve productivity, and provide safe agricultural products through disease resistance.
도 1은 흰잎 마름병에 대한 이병(罹病)성과 관련된 유전자로 선별된 LOC_Os06g22440의 구조에 대한 개요도로, 도 1의 A는 유전자 상의 구조를 나타내며, 도 1의 B는 상기 유전자가 불활성화되도록 제작된 단백질의 구조를 나타낸다. 이에 표시된 Methyltransf_7은 메틸전이효소 활성 부분 (methyltransferase domain)을 의미한다.
도 2는 LOC_Os06g22440의 유전자 서열 내에 T-DNA 서열이 삽입된 SAMT 19 유전자 변형 벼의 게놈 DNA의 일부분을 나타내는 구조도이다.
도 3은 SAMT 19 유전자 변형 벼에서 T-DNA 삽입위치를 PCR로 확인한 도면이다.
도 4는 SAMT 19 유전자 변형 벼에서 LOC_Os06g22440의 발현 여부를 확인하는 RT-PCR 결과를 보여주는 도면이다.
도 5는 SAMT 19 유전자 변형 벼의 흰잎 마름병에 대한 저항성을 실험한 결과를 보여주는 도면으로, 도 5의 A는 천연형 벼 및 SAMT 19 유전자 변형 벼의 흰잎 마름병균을 가위 접종법으로 접종한 결과를 보여주는 사진이고, 도 5의 B는 이의 감염에 의해 파괴된 벼 잎의 길이를 측정하여 평균 낸 결과를 나타낸 그래프이다. FIG. 1 is a schematic diagram of the structure of LOC_Os06g22440 selected as a gene related to a disease related to blight of blight. FIG. 1 (A) shows the structure of the gene phase. FIG. 1 (B) . Methyltransf_7, as shown, is a methyltransferase domain.
FIG. 2 is a structural diagram showing a portion of genomic DNA of a SAMT 19 genetically modified rice in which a T-DNA sequence is inserted in a gene sequence of LOC_Os06g22440.
FIG. 3 is a diagram showing PCR-confirmed positions of T-DNA insertion in
FIG. 4 is a graph showing the results of RT-PCR to confirm the expression of LOC_Os06g22440 in
FIG. 5 is a graph showing the results of an experiment for resistance to blight of blight of SAMT 19 genetically modified rice, and FIG. 5A shows the result of inoculation of blunt-spotted blight of native-type rice and
이하, 하기 실시예에 의하여 본 발명을 보다 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들로 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited thereto.
실시예Example
1. One.
BioinformaticsBioinformatics
를 통한 형질전환 Transformation through
타겟target
유전자 선별 Gene selection
동진벼의 유전체가 보유한 식물체의 질환 저항성과 밀접한 관련이 있을 것으로 예측되는 메틸전이효소 230개를 동정하였다. 이 중, microarray data를 바탕으로 MeV v2.0 프로그램을 이용하여 흰잎 마름병에 이병(罹病)성을 가질 확률이 높은 유전자를 24개 선별하였다. 선별된 유전자에 대하여 형질전환체를 제조하여 병 저항성을 갖는 유전자를 동정해 내는 과정에서, 본 발명의 LOC_Os06g22440이 흰잎마름병에 이병(罹病)성을 갖는 유전자로 선별되었다.
We identified 230 methyltransferases that are expected to be closely related to the disease resistance of the plants possessed by the genomes of Dongjinbara. Based on the microarray data, we selected 24 genes with high probability of susceptibility to blight disease in MeV v2.0 program. In the process of identifying a gene having a disease resistance by producing a transformant for the selected gene, LOC_Os06g22440 of the present invention was selected as a gene having a disease susceptibility to blight of blight.
실시예Example 2. 발현 유도체 삽입된 형질전환 벼 제조 2. Production of Transgenic Rice Inserted with Expression Derivatives
2-1. 벼 형질전환용 재조합 벡터 제조2-1. Production of recombinant vector for rice transformation
LOC_Os06g22440 유전자의 두번째 인트론 부위에 T-DNA 서열을 삽입하기 위해 벡터를 제작하였다. 먼저, 유전체 삽입을 위한 T-DNA, 삽입위치의 왼쪽 유전자 서열을 확인하기 위한 N-GUS를 포함하는 재조합 벡터를 제조하기 위한, 담배 잎 모자이크바이러스 35S 프로모터 유래 DNA, 삽입위치의 오른쪽 유전자 서열을 확인하기 위한 L-0.5/1.5를 가지는 벡터를 제작하였다. 삽입된 유전체로부터 타겟 유전자의 확인과 증폭을 위한 프라이머는 아래와 같다.
A vector was constructed to insert the T-DNA sequence into the second intron site of the LOC_Os06g22440 gene. First, the DNA from Tobacco Leaf Mosaic Virus 35S promoter, the right gene sequence at the insertion site was identified to prepare a recombinant vector containing T-DNA for inserting the genome and N-GUS for confirming the left gene sequence at the insertion site A vector having L-0.5 / 1.5 was prepared. The primers for identification and amplification of the target gene from the inserted genome are as follows.
T-DNA 서열의 확인과 증폭을 위한 프라이머는 아래와 같다.The primers for identification and amplification of T-DNA sequences are shown below.
T-DNA-F (정방향, 서열번호 8)T-DNA-F (forward, SEQ ID NO: 8)
5’- GTTTACCCGCCAATATATCCTGTCA -3’5'-GTTTACCCGCCAATATATCCTGTCA -3 '
T-DNA-R (역방향, 서열번호 9)T-DNA-R (reverse, SEQ ID NO: 9)
5’- CTAAGAGAAAAGAGCGTTTA -3’
5'-CTAAGAGAAAAGAGCGTTTA -3 '
PCR 증폭 조건은 처음 DNA의 열변성을 위하여 94℃에서 3분간 1 cycle, 그리고 94℃ 1분, 58℃에서 1분, 72℃에서 2분간으로 총 35 cycle을 실시하였으며, 최종 DNA 합성은 7분으로 하였다. The PCR amplification conditions were 1 cycle at 94 ° C for 3 minutes, 1 cycle at 94 ° C for 1 minute, 1 minute at 58 ° C and 2 minutes at 72 ° C for thermal denaturation of DNA for the first time, Respectively.
해당 증폭된 PCR 산물을 1.0%의 아가로즈겔(agarose gel)로 전기영동 한 후 EtBr(ethidium bromide) 용액에 염색하여 UV lamp하에서 염기 크기에 해당하는 band를 절단하여 아가로즈겔(agarose gel) 정제법으로 정제하였다. The amplified PCR product was electrophoresed with 1.0% agarose gel, stained with EtBr (ethidium bromide) solution, and the band corresponding to the base size was cut under UV lamp to obtain agarose gel purified ≪ / RTI >
추출한 PCR 산물을 상기 제한효소 BamHⅠ/KpnⅠ으로 절단하였다. 또한, 재조합 벡터인 pGA2772 벡터를 제한효소 BamHⅠ/KpnⅠ로 절단하여, 절단된 벡터를 상기 아가로즈겔 정제법으로 정제하였다. 상기 PCR 산물에 의한 DNA 단편을 절단된 재조합 벡터에 삽입하여, T-DNA 서열(T-DNA sequence, 서열번호 4)이 삽입된 재조합 벡터 pGA2772 vector를 제조하였다.
The extracted PCR product was digested with the restriction enzyme BamHI / KpnI. Further, the recombinant vector pGA2772 vector was digested with restriction enzyme BamHI / KpnI, and the digested vector was purified by the above agarose gel purification method. A DNA fragment of the above PCR product was inserted into the cleaved recombinant vector to prepare a recombinant vector pGA2772 vector into which a T-DNA sequence (T-DNA sequence, SEQ ID NO: 4) was inserted.
2-2. 형질전환체 제조2-2. Transformant production
상기 제조된 벡터를 전기충격 방법(electroporation)을 이용하여 아그로박테리움 투메파키엔스(Agrobacterium tumefaciens)에 도입하였다. 배양실에서 무균상태로 자란 동진벼에 리프 디스트(leaf disc)법으로 형질전환하였다. 구체적으로는 벼잎을 대략 5 x 5 mm 크기로 잘라서 200 ㎕의 아그로박테리움이 포함된 MSO 액체 배지(MS 염 4.3g, 수크로스 30g/L, pH 5.6 내지 5.8)에 넣었다가 암조건에서 2 내지 3일 동안 배양하고, 배양된 잎 절편을 캘러스-슈트(callus-shoot) 유도 배지(MSO배지에 100㎍ NAA, 1mg BA, 500㎍ 세포탁심, 1 mg 포스피노트리신(phospinothricin), 0.7% 피토 한천(phyto agar), pH 5.6)으로 옮기고, 새로운 배지로 옮겨 주었다. 유도된 발아는 1.5 내지 2 cm 정도 자라면 루트-인덕션 배지(MSO배지에 250㎍ 세포탁심, 10mg 포스피노트리신, 0.7% 피토 한천, pH 5.6)로 옮겨 주었다. The prepared vector was introduced into Agrobacterium tumefaciens using electroporation. The cells were transformed into the aseptic state of Dongjinbyeon in the culture room by leaf disc method. Specifically, the rice leaves were cut into approximately 5 x 5 mm size and placed in an MSO liquid medium (4.3 g of MS salt, 30 g / L of sucrose, pH 5.6 to 5.8) containing 200 μl of Agrobacterium, The cells were cultured for 3 days and the cultured leaf slices were seeded in callus-shoot induction medium (100 μg NAA, 1 mg BA, 500 μg cell supernatant, 1 mg phospinothricin, 0.7% phytoplankton, Phyto agar, pH 5.6) and transferred to fresh medium. Induced germination was transferred to root-induction medium (250 μg of cell suspension, 10 mg phosphinotricin, 0.7% phyto-agar, pH 5.6) in MSO medium if it grew to about 1.5 to 2 cm.
T-DNA서열이 삽입된 상기 유전자 형질전환 벼를 SAMT 19로 명명하였으며, 이의 유전자 구조는 도 2에 개시된 바와 같다. 구체적으로는, 동진벼에 존재하는 LOC_Os06g22440의 서열 내에 예측되는 두 번째 인트론 부위 (intron region)에 T-DNA 서열 (서열번호 4)을 삽입하여, 상기 실시예 1에서 선별된 목적 유전자 LOC_Os06g22440가 불활성화된 형질전환체를 제조하였다(도 2).
The gene transgenic rice in which the T-DNA sequence was inserted was named
2-3. 재조합 벡터의 벼 유전체 삽입위치 확인2-3. Identification of rice embryo insertion position of recombinant vector
T-DNA 삽입에 의해 만들어진 SAMT 19에 대한 inverse-PCR 및 염기 서열 분석을 통해 T-DNA가 삽입된 염색체를 분석하였다.T-DNA inserted chromosomes were analyzed by inverse-PCR and sequence sequencing of SAMT 19 produced by T-DNA insertion.
상기 선발된 계통의 벼 종자를 MSO 배지에 28℃에서 10일간 배양하였다. 이렇게 배양한 개체들의 잎 100mg을 채취하여 액체질소를 이용하여 급냉각한 후 분쇄하였다. 분쇄된 잎에서 one step buffer (1M Tris (pH9.5) 5ml, 0.5M EDTA 1ml, KCl 3.73g을 넣고 물로 50ml을 맞춰 조제)을 이용하여 DNA를 추출하였다. The selected lineage rice seeds were cultured in MSO medium at 28 ° C for 10 days. 100 mg of the leaves of the cultivated individuals were sampled and pulverized by rapid cooling using liquid nitrogen. DNA was extracted from the pulverized leaves using one step buffer (5 ml of 1 M Tris (pH 9.5), 1 ml of 0.5 M EDTA, and 3.73 g of KCl, followed by 50 ml of water).
SAMT 19는 LOC_Os06g22440 유전자의 인트론 부분에 T-DNA가 삽입된 계통으로 T-DNA 삽입위치에서 앞뒤에서 만들어진 프라이머 (서열번호 5 및 서열번호 6)와 T-DNA 삽입서열 중 iR2 프라이머 (서열번호 7)를 이용하여 PCR로 유전형 분석을 하였다.
PCR 반응은 95℃에서 5분 후; 95℃에서 1분, 57℃에서 1분, 72℃에서 1분 을 38회 반복하고, 마지막으로 72℃에서 7분을 진행하였다. PCR 산물은 agarose gel을 이용하여 전기영동으로 확인하였다(도 3). 이를 통해 유전형을 선발하였다.
PCR reactions were performed after 5 minutes at 95 ° C; Repeating 38 times at 95 ° C for 1 minute, at 57 ° C for 1 minute, and 72 ° C for 1 minute, and finally at 72 ° C for 7 minutes. PCR products were confirmed by electrophoresis using agarose gel (Fig. 3). The genotype was selected through this.
이에 사용된 프라이머 서열은 다음과 같다.The primer sequences used here are as follows.
SAMT 19_F (서열번호 5)SAMT 19_F (SEQ ID NO: 5)
5’- TATCACGCTCGATATGGGTG - 3’ 5'-TATCACGCTCGATATGGGTG-3 '
SAMT 19_R (서열번호 6)SAMT 19_R (SEQ ID NO: 6)
5’- CAGCTTCTCAGGATGCCATA- 3’ 5'-CAGCTTCTCAGGATGCCATA-3 '
iR2 (서열번호 7)iR2 (SEQ ID NO: 7)
5’- CAGGACGTAACATAAGGGACTGA - 3’
5'-CAGGACGTAACATAAGGGACTGA-3 '
실시예Example
3. 형질전환 벼의 유전자 불활성 검증 3. Verification of gene inactivation of transgenic rice
LOC_Os06g22440 유전자의 유전자 서열 내에 T-DNA를 삽입한 형질전환 벼 (SAMT 19)에서 LOC_Os06g22440 유전자 불활성을 역전사 효소 PCR (RT-PCR, reverse transcriptase-PCR)로 확인 하였다. The inactivation of LOC_Os06g22440 gene was confirmed by reverse transcriptase PCR (RT-PCR) in transgenic rice (SAMT 19) in which T-DNA was inserted into the gene sequence of LOC_Os06g22440 gene.
구체적으로는, 형질전환 벼 (SAMT 19)의 잎 0.1g에서 total RNA를 추출하였다. 이를 주형으로 하여 LOC_Os06g22440의 발현을 확인할 수 있는 RNA 역전사용 프라이머(정방향 서열번호 10, 역방향 서열번호 11)와 역전사 효소 (reverse transcriptase DNA polymerase)를 이용하여 역전사 효소 PCR을 수행하였다. 도 4 에서 확인할 수 있듯이, 천연형 동진벼 에서는 LOC_Os06g22440의 발현이 나타나지만 SAMT19에는 유전자의 발현이 나타나지 않는 것을 확인할 수 있었다.
Specifically, total RNA was extracted from 0.1 g leaf of transformed rice (SAMT 19). Reverse transcriptase PCR was performed using reverse transcription primers (forward sequence SEQ ID NO: 10, reverse sequence SEQ ID NO: 11) and reverse transcriptase DNA polymerase which can confirm the expression of LOC_Os06g22440 using this as a template. As can be seen from FIG. 4, it was confirmed that expression of LOC_Os06g22440 was observed in wild-type Dong Jinbin, but gene expression was not observed in SAMT19.
이에 사용된 프라이머 서열은 다음과 같다.The primer sequences used here are as follows.
RT-SAMT 19_F (정방향, 서열번호 10)RT-SAMT 19_F (forward, SEQ ID NO: 10)
5’- TGACATGGTCACTATGGGTG -3’5'-TGACATGGTCACTATGGGTG -3 '
RT-SAMT 19_R (역방향, 서열번호 11)RT-SAMT 19_R (reverse direction, SEQ ID NO: 11)
5’- TCTCAGCATACTTGCTACCC -3’
5'-TCTCAGCATACTTGCTACCC -3 '
실시예Example
4. 형질전환 벼( 4. Transgenic rice (
SAMTSAMT
19)의 19)
흰잎 마름병에To blight of blight
대한 저항성 검정 Resistance test for
상기 실시예 2에서 제조된 형질전환 벼가 흰잎 마름병에 대해 저항성을 보이는지 확인하기 위해, LOC_Os06g22440 유전자 서열 내에 T-DNA가 삽입된 형질전환 벼인 SAMT 19와 대조군으로 천연형 동진벼를 6주간 생장시켜 흰잎 마름병을 유발하는 균주인 Xanthomonas oryzae pv. oryzae (strain : PXO99Az)를 가위에 묻혀 접종한 2주 후 병증 측정하였다 (도 5). 병증 측정은 접종한 부위로부터 감염되어 파괴된 상처 길이(Lesion Lengths)를 측정하여 천연형 동진벼와 비교하였다.In order to confirm whether the transgenic rice produced in Example 2 showed resistance to blight of leaf blight,
도 5의 B에서 확인할 수 있듯이, SAMT 19 형질전환체는 평균 병증의 길이가 천연형 동진벼의 반 정도에 불과하여 (천연형 vs. SAMT 19 : 24.2cm vs. 8.6cm), 흰잎 마름병에 대한 강력한 저항성을 가짐을 확인할 수 있었다.
As can be seen from FIG. 5B, the average pathogenicity of SAMT 19 transformants is only about half of that of wild-type Dong Jinbin (natural type vs. SAMT 19: 24.2 cm vs. 8.6 cm) And it was confirmed that it has resistance.
이와 같은 결과를 통하여, 본 발명의 형질전환 벼 SAMT 19는 내재적 유전자 LOC_Os06g22440를 불활성화시킴으로써 흰잎 마름병에 대한 저항성을 가질 수 있음을 확인하였다.
From these results, it was confirmed that the transformed
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.
<110> University-Industry Cooperation Group of Kyung Hee University <120> Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same <130> KPA141026KR <160> 11 <170> KopatentIn 2.0 <210> 1 <211> 2284 <212> DNA <213> LOC_Os06g22440 <400> 1 tactaattct ataattgaaa aggaagcagg atggcattaa ttaattgtgc caaatgtcta 60 tatattagca gccagaatag ttatgccata tgattggcac agaaaagaat atacctagtg 120 ttcgccggtg agtgtacaac tacaagatct gcgttttttt ctagctagct ctagctagca 180 gatgaagtat ctggtgttca gcgctgctcc aagcaaatta ggcaaaaacc atggcatcca 240 aacagatggt acatatgaat cgaggccaag gggaaacaag ctatgctcga aactccattc 300 ttcaggtcgt ttctctgctc ttaattagtt aatctacaat tttttttagt taatcaacaa 360 ttgcctatga tcttttctgc ttagaggaag aatgtaatta ttattttttt ttatagagag 420 aaaaaatgaa aatcaactga acatatataa gtcagacttt tcgataaagt aaaagaagtt 480 tgcaaaatgt cttcaaattt gctcaaaata caaatgttct cggaccgata tattccgaaa 540 ttttcttaat ttcgggttta tagtcacccc cgaaattttt tggctttcag aaaagctgtt 600 aatcccgagt aaaacgcacc tgcagaacgc tgaacagaac aggatgaggc cgctgataga 660 agacgccatc gccgacctcg tatgcagcag aagcatggtg atcgccgacc tgggctgctc 720 atccggcccg aacgcgctcg cgctcgcgtc gatcgccgtc gacgccttcc gccgccggtg 780 cctcgcgctc cggcggccac cgccaccggc ggagctctgc gtactcctca acgatctccc 840 cgacaacgac ttcgccacgg tggtgaagag cctcgtggag ttcaggcgaa acaacggcga 900 cgagcctgtc ctcctgaccg gcgtcgtgcc tggctccttc tacgggaggc tcttcgccgc 960 tgaatccctg catctcgtct gctcgtccaa cagcctccac tggctctccg aggtcagaaa 1020 tcctaagatt ttttttcttc tataataaaa gtaacctttt taagacttat tttgagcata 1080 cgaaccttct aaccatacta acagaggcaa aacaacattg tcacgctagt ttgtctggca 1140 tgacagcgtt gttctaccac acaccatgac tgtcgtgata gaacaaaact atcacgctcg 1200 atatgggtgg tgcagacatt gttatttgtc acgttagcgt aattaaaagg ttcagaattt 1260 gaaataagtt ttataaaagt ttatttttaa ataaaaagtt tagaaaataa taaaaatttg 1320 aatcatacag tactgatcac cagcatgcat tctgaattta ttattctttg aggcgaaaat 1380 tttgtttcaa tttcatggca gcaggctcct gaagatctga agatgaacgg aattccggca 1440 tacgacgttg acgcgaacgt gaggagagag agacgagccg tggtcgttgg ggcttatgca 1500 cggcagttca ggaaggattt catggcgttt ctgaagatga gggctgtaga actggtccca 1560 ggaggccgaa tggtactctc acttgcaggc aggcgatctg ttgatctcgc ctccgaactc 1620 acgcacgcat gggaatccac agccatgacc ctaagtgaca tggtcactat ggtaaattta 1680 actgttttac cttgctagaa cttcaccatt tgctaacgaa caaatgatta gtactatcta 1740 tggcatcctg agaagctgag attttggagt aattgacagg gtgtgattga caaagaaaag 1800 tttgaaacat tctacatgcc gatttacgga ccttccgatg aagagatcag acagatcatc 1860 caagaagaag ggtccttctt gatacgggag atgcaggtac ctgaactcac gagtggtgcg 1920 tacagcgcgc tgatcacctc ggcaagggta gcaagtatgc tgagagccgc attcgagccc 1980 ataattgttc agcattttgg accgaccgga tgcgatggaa aagaagggat catggatgag 2040 ttcgtgagga cggcggagcg tcggtggagc ttggagggca gcttgcaaga cgagcttgca 2100 caaaaccctc gaggcgttct gcttgtgtcc ctcgagaaga agccgtcatg accatccggt 2160 agattataat tataattatg taactgctac cttctgtcga cagtaaatcc attcttaaat 2220 ctggtagatt ttataccact atattggccg attttagttc ataaaaagaa attttttagt 2280 tgtc 2284 <210> 2 <211> 1101 <212> DNA <213> Coding Sequence <400> 2 atggcatcca aacagatggt acatatgaat cgaggccaag gggaaacaag ctatgctcga 60 aactccattc ttcagaacgc tgaacagaac aggatgaggc cgctgataga agacgccatc 120 gccgacctcg tatgcagcag aagcatggtg atcgccgacc tgggctgctc atccggcccg 180 aacgcgctcg cgctcgcgtc gatcgccgtc gacgccttcc gccgccggtg cctcgcgctc 240 cggcggccac cgccaccggc ggagctctgc gtactcctca acgatctccc cgacaacgac 300 ttcgccacgg tggtgaagag cctcgtggag ttcaggcgaa acaacggcga cgagcctgtc 360 ctcctgaccg gcgtcgtgcc tggctccttc tacgggaggc tcttcgccgc tgaatccctg 420 catctcgtct gctcgtccaa cagcctccac tggctctccg aggctcctga agatctgaag 480 atgaacggaa ttccggcata cgacgttgac gcgaacgtga ggagagagag acgagccgtg 540 gtcgttgggg cttatgcacg gcagttcagg aaggatttca tggcgtttct gaagatgagg 600 gctgtagaac tggtcccagg aggccgaatg gtactctcac ttgcaggcag gcgatctgtt 660 gatctcgcct ccgaactcac gcacgcatgg gaatccacag ccatgaccct aagtgacatg 720 gtcactatgg gtgtgattga caaagaaaag tttgaaacat tctacatgcc gatttacgga 780 ccttccgatg aagagatcag acagatcatc caagaagaag ggtccttctt gatacgggag 840 atgcaggtac ctgaactcac gagtggtgcg tacagcgcgc tgatcacctc ggcaagggta 900 gcaagtatgc tgagagccgc attcgagccc ataattgttc agcattttgg accgaccgga 960 tgcgatggaa aagaagggat catggatgag ttcgtgagga cggcggagcg tcggtggagc 1020 ttggagggca gcttgcaaga cgagcttgca caaaaccctc gaggcgttct gcttgtgtcc 1080 ctcgagaaga agccgtcatg a 1101 <210> 3 <211> 366 <212> PRT <213> LOC_Os06g22440 <400> 3 Met Ala Ser Lys Gln Met Val His Met Asn Arg Gly Gln Gly Glu Thr 1 5 10 15 Ser Tyr Ala Arg Asn Ser Ile Leu Gln Asn Ala Glu Gln Asn Arg Met 20 25 30 Arg Pro Leu Ile Glu Asp Ala Ile Ala Asp Leu Val Cys Ser Arg Ser 35 40 45 Met Val Ile Ala Asp Leu Gly Cys Ser Ser Gly Pro Asn Ala Leu Ala 50 55 60 Leu Ala Ser Ile Ala Val Asp Ala Phe Arg Arg Arg Cys Leu Ala Leu 65 70 75 80 Arg Arg Pro Pro Pro Pro Ala Glu Leu Cys Val Leu Leu Asn Asp Leu 85 90 95 Pro Asp Asn Asp Phe Ala Thr Val Val Lys Ser Leu Val Glu Phe Arg 100 105 110 Arg Asn Asn Gly Asp Glu Pro Val Leu Leu Thr Gly Val Val Pro Gly 115 120 125 Ser Phe Tyr Gly Arg Leu Phe Ala Ala Glu Ser Leu His Leu Val Cys 130 135 140 Ser Ser Asn Ser Leu His Trp Leu Ser Glu Ala Pro Glu Asp Leu Lys 145 150 155 160 Met Asn Gly Ile Pro Ala Tyr Asp Val Asp Ala Asn Val Arg Arg Glu 165 170 175 Arg Arg Ala Val Val Val Gly Ala Tyr Ala Arg Gln Phe Arg Lys Asp 180 185 190 Phe Met Ala Phe Leu Lys Met Arg Ala Val Glu Leu Val Pro Gly Gly 195 200 205 Arg Met Val Leu Ser Leu Ala Gly Arg Arg Ser Val Asp Leu Ala Ser 210 215 220 Glu Leu Thr His Ala Trp Glu Ser Thr Ala Met Thr Leu Ser Asp Met 225 230 235 240 Val Thr Met Gly Val Ile Asp Lys Glu Lys Phe Glu Thr Phe Tyr Met 245 250 255 Pro Ile Tyr Gly Pro Ser Asp Glu Glu Ile Arg Gln Ile Ile Gln Glu 260 265 270 Glu Gly Ser Phe Leu Ile Arg Glu Met Gln Val Pro Glu Leu Thr Ser 275 280 285 Gly Ala Tyr Ser Ala Leu Ile Thr Ser Ala Arg Val Ala Ser Met Leu 290 295 300 Arg Ala Ala Phe Glu Pro Ile Ile Val Gln His Phe Gly Pro Thr Gly 305 310 315 320 Cys Asp Gly Lys Glu Gly Ile Met Asp Glu Phe Val Arg Thr Ala Glu 325 330 335 Arg Arg Trp Ser Leu Glu Gly Ser Leu Gln Asp Glu Leu Ala Gln Asn 340 345 350 Pro Arg Gly Val Leu Leu Val Ser Leu Glu Lys Lys Pro Ser 355 360 365 <210> 4 <211> 8275 <212> DNA <213> Inserting Sequence <400> 4 gtttacccgc caatatatcc tgtcaaacac ggatccgagg taccaggtac caggtgagtt 60 ccattcttac taccacggtg ctattttttt tgctatgtgg ctaattacat gactaacttg 120 gggtgctaaa tcttacaggt tatatgcagg ttatatgcag gtcccgggta ggtcagtccc 180 ttatgttacg tcctgtagaa accccaaccc gtgaaatcaa aaaactcgac ggcctgtggg 240 cattcagtct ggatcgcgaa aactgtggaa ttgatcagcg ttggtgggaa agcgcgttac 300 aagaaagccg ggcaattgct gtgccaggca gttttaacga tcagttcgcc gatgcagata 360 ttcgtaatta tgcgggcaac gtctggtatc agcgcgaagt ctttataccg aaaggttggg 420 caggccagcg tatcgtgctg cgtttcgatg cggtcactca ttacggcaaa gtgtgggtca 480 ataatcagga agtgatggag catcagggcg gctatacgcc atttgaagcc gatgtcacgc 540 cgtatgttat tgccgggaaa agtgtacgta tcaccgtttg tgtgaacaac gaactgaact 600 ggcagactat cccgccggga atggtgatta ccgacgaaaa cggcaagaaa aagcagtctt 660 acttccatga tttctttaac tatgccggaa tccatcgcag cgtaatgctc tacaccacgc 720 cgaacacctg ggtggacgat atcaccgtgg tgacgcatgt cgcgcaagac tgtaaccacg 780 cgtctgttga ctggcaggtg gtggccaatg gtgatgtcag cgttgaactg cgtgatgcgg 840 atcaacaggt ggttgcaact ggacaaggca ctagcgggac tttgcaagtg gtgaatccgc 900 acctctggca accgggtgaa ggttatctct atgaactgtg cgtcacagcc aaaagccaga 960 cagagtgtga tatctacccg cttcgcgtcg gcatccggtc agtggcagtg aagggccaac 1020 agttcctgat taaccacaaa ccgttctact ttactggctt tggtcgtcat gaagatgcgg 1080 acttacgtgg caaaggattc gataacgtgc tgatggtgca cgaccacgca ttaatggact 1140 ggattggggc caactcctac cgtacctcgc attaccctta cgctgaagag atgctcgact 1200 gggcagatga acatggcatc gtggtgattg atgaaactgc tgctgtcggc tttaacctct 1260 ctttaggcat tggtttcgaa gcgggcaaca agccgaaaga actgtacagc gaagaggcag 1320 tcaacgggga aactcagcaa gcgcacttac aggcgattaa agagctgata gcgcgtgaca 1380 aaaaccaccc aagcgtggtg atgtggagta ttgccaacga accggatacc cgtccgcaag 1440 tgcacgggaa tatttcgcca ctggcggaag caacgcgtaa actcgacccg acgcgtccga 1500 tcacctgcgt caatgtaatg ttctgcgacg ctcacaccga taccatcagc gatctctttg 1560 atgtgctgtg cctgaaccgt tattacggat ggtatgtcca aagcggcgat ttggaaacgg 1620 cagagaaggt actggaaaaa gaacttctgg cctggcagga gaaactgcat cagccgatta 1680 tcatcaccga atacggcgtg gatacgttag ccgggctgca ctcaatgtac accgacatgt 1740 ggagtgaaga gtatcagtgt gcatggctgg atatgtatca ccgcgtcttt gatcgcgtca 1800 gcgccgtcgt cggtgaacag gtatggaatt tcgccgattt tgcgacctcg caaggcatat 1860 tgcgcgttgg cggtaacaag aaagggatct tcactcgcga ccgcaaaccg aagtcggcgg 1920 cttttctgct gcaaaaacgc tggactggca tgaacttcgg tgaaaaaccg cagcagggag 1980 gcaaacaatg aatcaacaac tctcctggcg caccatcgtc ggctacagcc tcgggaattg 2040 ctaccgagct cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg 2100 aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat 2160 gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc 2220 ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa 2280 ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat taattcatcg ataggctagt 2340 catggtgact gtacgttgta agtgcagcaa actgccgacg cgatgcaaac tgtacacgtt 2400 aacatgccac tcacctggaa cgcacaatgg ccactaggtg cggccgtagt gtggatttca 2460 aagagagaga gagagagaga gagctaatca cgtaaacgta aacacagcag atagcagaga 2520 tgttgattag gcaaaacagt ataaaagcca atccaataaa ctacatttag cgaagtgcta 2580 tactaatgca ctaataacga actgttcttt tcttaagatc ggagccagta atgggttgtc 2640 agcaggagaa gcacgtaaac cttgaaacat actaagttcc acagtcgaga gtaaaccgta 2700 atcaacacaa gaaacaaaca taaaattgaa caaacgcgca tattataagt gacgaagcgg 2760 tctcacataa aacagggcac acaggttaca acaacgaggg ttgtaagccc attaagcccc 2820 aaacatcaga tcaccacaag caaatgtctc gaagacacac gcacacggca acaggataac 2880 tccacactgg cagatcatgg gatagcagca gttatcaatc aggccttgac acacagaaca 2940 tcaagccccc agacgacgac gactcctcta gatcccggtc ggcatctact ctattccttt 3000 gccctcggac gagtgctggg gcgtcggttt ccactatcgg cgagtacttc tacacagcca 3060 tcggtccaga cggccgcgct tctgcgggcg atttgtgtac gcccgacagt cccggctccg 3120 gatcggacga ttgcgtcgca tcgaccctgc gcccaagctg catcatcgaa attgccgtca 3180 accaagctct gatagagttg gtcaagacca atgcggagca tatacgcccg gagccgcggc 3240 gatcctgcaa gctccggatg cctccgctcg aagtagcgcg tctgctgctc catacaagcc 3300 aaccacggcc tccagaagaa gatgttggcg acctcgtatt gggaatcccc gaacatcgcc 3360 tcgctccagt caatgaccgc tgttatgcgg ccattgtccg tcaggacatt gttggagccg 3420 aaatccgcgt gcacgaggtg ccggacttcg gggcagtcct cggcccaaag catcagctca 3480 tcgagagcct gcgcgacgga cgcactgacg gtgtcgtcca tcacagtttg ccagtgatac 3540 acatggggat cagcaatcgc gcatatgaaa tcacgccatg tagtgtattg accgattcct 3600 tgcggtccga atgggccgaa cccgctcgtc tggctaagat cggccgcagc gatcgcatcc 3660 atggcctccg cgaccggctg cagaacagcg ggcagttcgg tttcaggcag gtcttgcaac 3720 gtgacaccct gtgcacggcg ggagatgcaa taggtcaggc tctcgctgaa ttccccaatg 3780 tcaagcactt ccggaatcgg gagcgcggcc gatgcaaagt gccgataaac ataacgatct 3840 ttgtagaaac catcggcgca gctatttacc cgcaggacat atccacgccc tcctacatcg 3900 aagctgaaag cacgagattc ttcgccctcc gagagctgca tcaggtcgga gacgctgtcg 3960 aacttttcga tcagaaactt ctcgacagac gtcgcggtga gttcaggctt tttcatatct 4020 cattgccccc cgggatccgt cgagtcagcc tgaaaggaca aaatacatgt tagcgcctta 4080 gtggtacatt attatttcag tacagcaaga taacacaatt caaaagactg acccataata 4140 aataactagt cctcaattta aaatttgagt tcctaaatag acatctatga atatgctgta 4200 catcggcact acagaaaata cgattcccaa taattgaaca attgtacttt atttagttgt 4260 tactacaaca atggaagata caagatcgtt tcaaaactac catacatgca tggagtattt 4320 gttccacaga tctggaaaaa acagatctga cgggcagtgt caccaaacac tagacatatg 4380 tatttgtatt aggtggatga cgtgtacaaa catgactacc agatctagaa ttagaacgcg 4440 gcgtgctttg gaaatgttaa gtagatccaa atacatcggt aacaaatgaa catattcata 4500 tgacatagct gtaaaacatc atgatctatc atatcaacta gaggggatct cggcatgtat 4560 cattctattg catctagaac catagcattt ccatgtgaca aacaattttg aaacatacat 4620 tgctcagatc taccataaga acaccatgtt catgacagca tcgaccatga tttccacatt 4680 taacagcatc ccgaggtcag atccagtgtt tagaactatc atttcagcaa aattcacaaa 4740 ataaatcctc caattcgcct acatatatcc attccacgca tcctaggacc agatccacca 4800 taccagtata cacgaacact aaacatttca tcagatccgc taactacgac agagaaaacg 4860 cagatccaga caaccagatc caccgacaaa taaacacagc cccccacatc caacaaccgc 4920 gaatccaccc agatctgacc cagaagcagg cacgaagaac acggggggtg agggagatgg 4980 gacgcggatc caagcttggc ggcggattgg gttgatgctg cgacggcggc ggagaaggga 5040 gagaggggag aggaggaaaa gcgcggaggc gcggagagag gcgagtacga agacgccttt 5100 ctctgcgttg tctcggctta gggtttgcga tccccgcact ccgcccgttt tatagggcca 5160 gacagcctgg acctctcagg agcggaagcg aagggatggg ggagtttttc gttttacccc 5220 ctttgacgtc ttcaaaattc actcgcatct cacatcgtgc ctgcaaaggt cgggtggttg 5280 gatcatatcg agaatattta ataagttagg gagctttctg ataatatcca ccgcaaggag 5340 gccatttcgt ttgcactcgg ttgaagtcca tacccgcctc tcgttagttt cactgacagg 5400 tgggtccaga ggcttccttc gtgtgcggtt agcgagtgca cgcgtcgctc caagaaaaag 5460 cagtaggtga cctggccacc tcgttgtagg tgcgaccgat gcagacgtcc cgcttgccgg 5520 tgggcccacg ttacagctgg gtcccacata tcggtgggtg cgatgagttg ttcggtgcgt 5580 aggagtagat tggatcccaa cgggtggttg cgtcgtcggc ggccctgccg attttatttt 5640 cgatttttga aatgcgagag cgggagaacg gcaccgttgg cttggctgtg gatgccgtta 5700 gccgcaccgg actattcggc ccagttccat tttggcccaa cttgaaacag cgcggagcac 5760 aagacggggg agcccattta ggcccgtaat ctcagccctg tagaaagtcc gtgtcgttgc 5820 gatggaccag aaagcccata aaccttggag gcgttctctg ctgggaataa aataagttca 5880 cactctgtcc ctcaacttta cgtcgagttt gtttgacatc gctaatgccc agtaccagaa 5940 atcttggata caaataaggt ttgatataaa gtggcacgtg gtgaatggca tcgtttgaaa 6000 aatcttcaga tcgagcgggc ttcacaagcc gtaagtgcaa gtgccaaaat ttgtgaagaa 6060 aattacttcc ttcatttcac aatgtaagtt attttagcat tttccacatt catattgata 6120 tcaataaatt tagatagata tatatgtctg aattcgtacc gttaacgagc tctagaagct 6180 tcagtactac gcgtctcgag gcctattatt gaagcattta tcagggttat tgtctcatga 6240 gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc 6300 cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa 6360 ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 6420 gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 6480 aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 6540 catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg 6600 taaggagaaa ataccgcatc aggcgccatt cgccattcag gctgcgcaac tgttgggaag 6660 ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 6720 ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 6780 gtgaattcac tagtgattgc tctagacact gatagtttcg gatctagata tcacatcaat 6840 ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgttc ctcgtgggtg 6900 ggggtccatc tttgggacca ctgtcggtag aggcatcttg aacgatagcc tttcctttat 6960 cgcaatgatg gcatttgtag aagccatctt ccttttctac tgtcctttcg atgaagtgac 7020 agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 7080 caatagccct ctggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 7140 cgtgctccac catgttgggg atctagatat cacatcaatc cacttgcttt gaagacgtgg 7200 ttggaacgtc ttctttttcc acgatgttcc tcgtgggtgg gggtccatct ttgggaccac 7260 tgtcggtaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 7320 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 7380 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 7440 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgggga 7500 tctagatatc acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca 7560 cgatgttcct cgtgggtggg ggtccatctt tgggaccact gtcggtagag gcatcttgaa 7620 cgatagcctt tcctttatcg caatgatggc atttgtagaa gccatcttcc ttttctactg 7680 tcctttcgat gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta 7740 ccctttgttg aaaagtctca atagccctct ggtcttctga gactgtatct ttgatattct 7800 tggagtagac gagagtgtcg tgctccacca tgttggggat ctagatatca catcaatcca 7860 cttgctttga agacgtggtt ggaacgtctt ctttttccac gatgttcctc gtgggtgggg 7920 gtccatcttt gggaccactg tcggtagagg catcttgaac gatagccttt cctttatcgc 7980 aatgatggca tttgtagaag ccatcttcct tttctactgt cctttcgatg aagtgacaga 8040 tagctgggca atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa 8100 tagccctctg gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt 8160 gctccaccat gttggggatc ctctagagtc gagaattcag tacattaaaa acgtccgcaa 8220 tgtgttatta agttgtctaa gcgtcaattt gtttacacca caatatatcc tgcca 8275 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 19_F <400> 5 tatcacgctc gatatgggtg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 19_R <400> 6 cagcttctca ggatgccata 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> iR2 <400> 7 caggacgtaa cataagggac tga 23 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> T-DNA-F <400> 8 gtttacccgc caatatatcc tgtca 25 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T-DNA-R <400> 9 ctaagagaaa agagcgttta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 19_F <400> 10 tgacatggtc actatgggtg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 19_R <400> 11 tctcagcata cttgctaccc <110> University-Industry Cooperation Group of Kyung Hee University <120> Methyltrasniferase gene resistant to a bacterial blight, and the transgenic plant using the same <130> KPA141026KR <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 2284 <212> DNA <213> LOC_Os06g22440 <400> 1 tactaattct ataattgaaa aggaagcagg atggcattaa ttaattgtgc caaatgtcta 60 tatattagca gccagaatag ttatgccata tgattggcac agaaaagaat atacctagtg 120 ttcgccggtg agtgtacaac tacaagatct gcgttttttt ctagctagct ctagctagca 180 gatgaagtat ctggtgttca gcgctgctcc aagcaaatta ggcaaaaacc atggcatcca 240 aacagatggt acatatgaat cgaggccaag gggaaacaag ctatgctcga aactccattc 300 ttcaggtcgt ttctctgctc ttaattagtt aatctacaat tttttttagt taatcaacaa 360 ttgcctatga tcttttctgc ttagaggaag aatgtaatta ttattttttt ttatagagag 420 aaaaaatgaa aatcaactga acatatataa gtcagacttt tcgataaagt aaaagaagtt 480 tgcaaaatgt cttcaaattt gctcaaaata caaatgttct cggaccgata tattccgaaa 540 ttttcttaat ttcgggttta tagtcacccc cgaaattttt tggctttcag aaaagctgtt 600 aatcccgagt aaaacgcacc tgcagaacgc tgaacagaac aggatgaggc cgctgataga 660 agacgccatc gccgacctcg tatgcagcag aagcatggtg atcgccgacc tgggctgctc 720 atccggcccg aacgcgctcg cgctcgcgtc gatcgccgtc gacgccttcc gccgccggtg 780 cctcgcgctc cggcggccac cgccaccggc ggagctctgc gtactcctca acgatctccc 840 cgacaacgac ttcgccacgg tggtgaagag cctcgtggag ttcaggcgaa acaacggcga 900 cgagcctgtc ctcctgaccg gcgtcgtgcc tggctccttc tacgggaggc tcttcgccgc 960 tgaatccctg catctcgtct gctcgtccaa cagcctccac tggctctccg aggtcagaaa 1020 tcctaagatt ttttttcttc tataataaaa gtaacctttt taagacttat tttgagcata 1080 cgaaccttct aaccatacta acagaggcaa aacaacattg tcacgctagt ttgtctggca 1140 tgacagcgtt gttctaccac acaccatgac tgtcgtgata gaacaaaact atcacgctcg 1200 atatgggtgg tgcagacatt gttatttgtc acgttagcgt aattaaaagg ttcagaattt 1260 gaaataagtt ttataaaagt ttatttttaa ataaaaagtt tagaaaataa taaaaatttg 1320 aatcatacag tactgatcac cagcatgcat tctgaattta ttattctttg aggcgaaaat 1380 tttgtttcaa tttcatggca gcaggctcct gaagatctga agatgaacgg aattccggca 1440 tacgacgttg acgcgaacgt gaggagagag agacgagccg tggtcgttgg ggcttatgca 1500 cggcagttca ggaaggattt catggcgttt ctgaagatga gggctgtaga actggtccca 1560 ggaggccgaa tggtactctc acttgcaggc aggcgatctg ttgatctcgc ctccgaactc 1620 acgcacgcat gggaatccac agccatgacc ctaagtgaca tggtcactat ggtaaattta 1680 actgttttac cttgctagaa cttcaccatt tgctaacgaa caaatgatta gtactatcta 1740 tggcatcctg agaagctgag attttggagt aattgacagg gtgtgattga caaagaaaag 1800 tttgaaacat tctacatgcc gatttacgga ccttccgatg aagagatcag acagatcatc 1860 caagaagaag ggtccttctt gatacgggag atgcaggtac ctgaactcac gagtggtgcg 1920 tacagcgcgc tgatcacctc ggcaagggta gcaagtatgc tgagagccgc attcgagccc 1980 ataattgttc agcattttgg accgaccgga tgcgatggaa aagaagggat catggatgag 2040 ttcgtgagga cggcggagcg tcggtggagc ttggagggca gcttgcaaga cgagcttgca 2100 caaaaccctc gaggcgttct gcttgtgtcc ctcgagaaga agccgtcatg accatccggt 2160 agattataat tataattatg taactgctac cttctgtcga cagtaaatcc attcttaaat 2220 ctggtagatt ttataccact atattggccg attttagttc ataaaaagaa attttttagt 2280 tgtc 2284 <210> 2 <211> 1101 <212> DNA <213> Coding Sequence <400> 2 atggcatcca aacagatggt acatatgaat cgaggccaag gggaaacaag ctatgctcga 60 aactccattc ttcagaacgc tgaacagaac aggatgaggc cgctgataga agacgccatc 120 gccgacctcg tatgcagcag aagcatggtg atcgccgacc tgggctgctc atccggcccg 180 aacgcgctcg cgctcgcgtc gatcgccgtc gacgccttcc gccgccggtg cctcgcgctc 240 cggcggccac cgccaccggc ggagctctgc gtactcctca acgatctccc cgacaacgac 300 ttcgccacgg tggtgaagag cctcgtggag ttcaggcgaa acaacggcga cgagcctgtc 360 ctcctgaccg gcgtcgtgcc tggctccttc tacgggaggc tcttcgccgc tgaatccctg 420 catctcgtct gctcgtccaa cagcctccac tggctctccg aggctcctga agatctgaag 480 atgaacggaa ttccggcata cgacgttgac gcgaacgtga ggagagagag acgagccgtg 540 gtcgttgggg cttatgcacg gcagttcagg aaggatttca tggcgtttct gaagatgagg 600 gctgtagaac tggtcccagg aggccgaatg gtactctcac ttgcaggcag gcgatctgtt 660 gatctcgcct ccgaactcac gcacgcatgg gaatccacag ccatgaccct aagtgacatg 720 gtcactatgg gtgtgattga caaagaaaag tttgaaacat tctacatgcc gatttacgga 780 ccttccgatg aagagatcag acagatcatc caagaagaag ggtccttctt gatacgggag 840 atgcaggtac ctgaactcac gagtggtgcg tacagcgcgc tgatcacctc ggcaagggta 900 gcaagtatgc tgagagccgc attcgagccc ataattgttc agcattttgg accgaccgga 960 tgcgatggaa aagaagggat catggatgag ttcgtgagga cggcggagcg tcggtggagc 1020 ttggagggca gcttgcaaga cgagcttgca caaaaccctc gaggcgttct gcttgtgtcc 1080 ctcgagaaga agccgtcatg a 1101 <210> 3 <211> 366 <212> PRT <213> LOC_Os06g22440 <400> 3 Met Ala Ser Lys Gln Met Val His Met Asn Arg Gly Gln Gly Glu Thr 1 5 10 15 Ser Tyr Ala Arg Asn Ser Ile Leu Gln Asn Ala Glu Gln Asn Arg Met 20 25 30 Arg Pro Leu Ile Glu Asp Ala Ile Ala Asp Leu Val Cys Ser Ser Ser 35 40 45 Met Val Ile Ala Asp Leu Gly Cys Ser Ser Gly Pro Asn Ala Leu Ala 50 55 60 Leu Ala Ser Ile Ala Val Asp Ala Phe Arg Arg Cys Leu Ala Leu 65 70 75 80 Arg Arg Pro Pro Pro Ala Glu Leu Cys Val Leu Leu Asn Asp Leu 85 90 95 Pro Asp Asn Asp Phe Ala Thr Val Val Lys Ser Leu Val Glu Phe Arg 100 105 110 Arg Asn Asn Gly Asp Glu Pro Val Leu Leu Thr Gly Val Val Pro Gly 115 120 125 Ser Phe Tyr Gly Arg Leu Phe Ala Ala Glu Ser Leu His Leu Val Cys 130 135 140 Ser Ser Asn Ser Leu His Trp Leu Ser Glu Ala Pro Glu Asp Leu Lys 145 150 155 160 Met Asn Gly Ile Pro Ala Tyr Asp Val Asp Ala Asn Val Arg Arg Glu 165 170 175 Arg Arg Ala Val Val Gly Ala Tyr Ala Arg Gln Phe Arg Lys Asp 180 185 190 Phe Met Ala Phe Leu Lys Met Arg Ala Val Glu Leu Val Pro Gly Gly 195 200 205 Arg Met Val Leu Ser Leu Ala Gly Arg Arg Ser Val Asp Leu Ala Ser 210 215 220 Glu Leu Thr His Ala Trp Glu Ser Thr Ala Met Thr Leu Ser Asp Met 225 230 235 240 Val Thr Met Gly Val Ile Asp Lys Glu Lys Phe Glu Thr Phe Tyr Met 245 250 255 Pro Ile Tyr Gly Pro Ser Asp Glu Glu Ile Arg Gln Ile Ile Gln Glu 260 265 270 Glu Gly Ser Phe Leu Ile Arg Glu Met Gln Val Pro Glu Leu Thr Ser 275 280 285 Gly Ala Tyr Ser Ala Leu Ile Thr Ser Ala Arg Val Ala Ser Met Leu 290 295 300 Arg Ala Phe Glu Pro Ile Ile Val Gln His Phe Gly Pro Thr Gly 305 310 315 320 Cys Asp Gly Lys Glu Gly Ile Met Asp Glu Phe Val Arg Thr Ala Glu 325 330 335 Arg Arg Trp Ser Leu Glu Gly Ser Leu Gln Asp Glu Leu Ala Gln Asn 340 345 350 Pro Arg Gly Val Leu Leu Val Ser Leu Glu Lys Lys Pro Ser 355 360 365 <210> 4 <211> 8275 <212> DNA <213> Inserting Sequence <400> 4 gtttacccgc caatatatcc tgtcaaacac ggatccgagg taccaggtac caggtgagtt 60 ccattcttac taccacggtg ctattttttt tgctatgtgg ctaattacat gactaacttg 120 gggtgctaaa tcttacaggt tatatgcagg ttatatgcag gtcccgggta ggtcagtccc 180 ttatgttacg tcctgtagaa accccaaccc gtgaaatcaa aaaactcgac ggcctgtggg 240 cattcagtct ggatcgcgaa aactgtggaa ttgatcagcg ttggtgggaa agcgcgttac 300 aagaaagccg ggcaattgct gtgccaggca gttttaacga tcagttcgcc gatgcagata 360 ttcgtaatta tgcgggcaac gtctggtatc agcgcgaagt ctttataccg aaaggttggg 420 caggccagcg tatcgtgctg cgtttcgatg cggtcactca ttacggcaaa gtgtgggtca 480 ataatcagga agtgatggag catcagggcg gctatacgcc atttgaagcc gatgtcacgc 540 cgtatgttat tgccgggaaa agtgtacgta tcaccgtttg tgtgaacaac gaactgaact 600 ggcagactat cccgccggga atggtgatta ccgacgaaaa cggcaagaaa aagcagtctt 660 acttccatga tttctttaac tatgccggaa tccatcgcag cgtaatgctc tacaccacgc 720 cgaacacctg ggtggacgat atcaccgtgg tgacgcatgt cgcgcaagac tgtaaccacg 780 cgtctgttga ctggcaggtg gtggccaatg gtgatgtcag cgttgaactg cgtgatgcgg 840 atcaacaggt ggttgcaact ggacaaggca ctagcgggac tttgcaagtg gtgaatccgc 900 acctctggca accgggtgaa ggttatctct atgaactgtg cgtcacagcc aaaagccaga 960 cagagtgtga tatctacccg cttcgcgtcg gcatccggtc agtggcagtg aagggccaac 1020 agttcctgat taaccacaaa ccgttctact ttactggctt tggtcgtcat gaagatgcgg 1080 acttacgtgg caaaggattc gataacgtgc tgatggtgca cgaccacgca ttaatggact 1140 ggattggggc caactcctac cgtacctcgc attaccctta cgctgaagag atgctcgact 1200 gggcagatga acatggcatc gtggtgattg atgaaactgc tgctgtcggc tttaacctct 1260 ctttaggcat tggtttcgaa gcgggcaaca agccgaaaga actgtacagc gaagaggcag 1320 tcaacgggga aactcagcaa gcgcacttac aggcgattaa agagctgata gcgcgtgaca 1380 aaaaccaccc aagcgtggtg atgtggagta ttgccaacga accggatacc cgtccgcaag 1440 tgcacgggaa tatttcgcca ctggcggaag caacgcgtaa actcgacccg acgcgtccga 1500 tcacctgcgt caatgtaatg ttctgcgacg ctcacaccga taccatcagc gatctctttg 1560 atgtgctgtg cctgaaccgt tattacggat ggtatgtcca aagcggcgat ttggaaacgg 1620 caggaaggt actggaaaaa gaacttctgg cctggcagga gaaactgcat cagccgatta 1680 tcatcaccga atacggcgtg gatacgttag ccgggctgca ctcaatgtac accgacatgt 1740 ggagtgaaga gtatcagtgt gcatggctgg atatgtatca ccgcgtcttt gatcgcgtca 1800 gcgccgtcgt cggtgaacag gtatggaatt tcgccgattt tgcgacctcg caaggcatat 1860 tgcgcgttgg cggtaacaag aaagggatct tcactcgcga ccgcaaaccg aagtcggcgg 1920 cttttctgct gcaaaaacgc tggactggca tgaacttcgg tgaaaaaccg cagcagggag 1980 gcaaacaatg aatcaacaac tctcctggcg caccatcgtc ggctacagcc tcgggaattg 2040 ctaccgagct cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg 2100 aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat 2160 gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc 2220 ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa 2280 ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat taattcatcg ataggctagt 2340 catggtgact gtacgttgta agtgcagcaa actgccgacg cgatgcaaac tgtacacgtt 2400 aacatgccac tcacctggaa cgcacaatgg ccactaggtg cggccgtagt gtggatttca 2460 aagagagaga gagagagaga gagctaatca cgtaaacgta aacacagcag atagcagaga 2520 tgttgattag gcaaaacagt ataaaagcca atccaataaa ctacatttag cgaagtgcta 2580 tactaatgca ctaataacga actgttcttt tcttaagatc ggagccagta atgggttgtc 2640 agcaggagaa gcacgtaaac cttgaaacat actaagttcc acagtcgaga gtaaaccgta 2700 atcaacacaa gaaacaaaca taaaattgaa caaacgcgca tattataagt gacgaagcgg 2760 tctcacataa aacagggcac acaggttaca acaacgaggg ttgtaagccc attaagcccc 2820 aaacatcaga tcaccacaag caaatgtctc gaagacacac gcacacggca acaggataac 2880 tccacactgg cagatcatgg gatagcagca gttatcaatc aggccttgac acacagaaca 2940 tcaagccccc agacgacgac gactcctcta gatcccggtc ggcatctact ctattccttt 3000 gccctcggac gagtgctggg gcgtcggttt ccactatcgg cgagtacttc tacacagcca 3060 tcggtccaga cggccgcgct tctgcgggcg atttgtgtac gcccgacagt cccggctccg 3120 gatcggacga ttgcgtcgca tcgaccctgc gcccaagctg catcatcgaa attgccgtca 3180 accaagctct gatagagttg gtcaagacca atgcggagca tatacgcccg gagccgcggc 3240 gatcctgcaa gctccggatg cctccgctcg aagtagcgcg tctgctgctc catacaagcc 3300 aaccacggcc tccagaagaa gatgttggcg acctcgtatt gggaatcccc gaacatcgcc 3360 tcgctccagt caatgaccgc tgttatgcgg ccattgtccg tcaggacatt gttggagccg 3420 aaatccgcgt gcacgaggtg ccggacttcg gggcagtcct cggcccaaag catcagctca 3480 tcgagagcct gcgcgacgga cgcactgacg gtgtcgtcca tcacagtttg ccagtgatac 3540 acatggggat cagcaatcgc gcatatgaaa tcacgccatg tagtgtattg accgattcct 3600 tgcggtccga atgggccgaa cccgctcgtc tggctaagat cggccgcagc gatcgcatcc 3660 atggcctccg cgaccggctg cagaacagcg ggcagttcgg tttcaggcag gtcttgcaac 3720 gtgacaccct gtgcacggcg ggagatgcaa taggtcaggc tctcgctgaa ttccccaatg 3780 tcaagcactt ccggaatcgg gagcgcggcc gatgcaaagt gccgataaac ataacgatct 3840 ttgtagaaac catcggcgca gctatttacc cgcaggacat atccacgccc tcctacatcg 3900 aagctgaaag cacgagattc ttcgccctcc gagagctgca tcaggtcgga gacgctgtcg 3960 aacttttcga tcagaaactt ctcgacagac gtcgcggtga gttcaggctt tttcatatct 4020 cattgccccc cgggatccgt cgagtcagcc tgaaaggaca aaatacatgt tagcgcctta 4080 gtggtacatt attatttcag tacagcaaga taacacaatt caaaagactg acccataata 4140 aataactagt cctcaattta aaatttgagt tcctaaatag acatctatga atatgctgta 4200 catcggcact acagaaaata cgattcccaa taattgaaca attgtacttt atttagttgt 4260 tactacaaca atggaagata caagatcgtt tcaaaactac catacatgca tggagtattt 4320 gttccacaga tctggaaaaa acagatctga cgggcagtgt caccaaacac tagacatatg 4380 tatttgtatt aggtggatga cgtgtacaaa catgactacc agatctagaa ttagaacgcg 4440 gcgtgctttg gaaatgttaa gtagatccaa atacatcggt aacaaatgaa catattcata 4500 tgacatagct gtaaaacatc atgatctatc atatcaacta gaggggatct cggcatgtat 4560 cattctattg catctagaac catagcattt ccatgtgaca aacaattttg aaacatacat 4620 tgctcagatc taccataaga acaccatgtt catgacagca tcgaccatga tttccacatt 4680 taacagcatc ccgaggtcag atccagtgtt tagaactatc atttcagcaa aattcacaaa 4740 ataaatcctc caattcgcct acatatatcc attccacgca tcctaggacc agatccacca 4800 taccagtata cacgaacact aaacatttca tcagatccgc taactacgac agagaaaacg 4860 cagatccaga caaccagatc caccgacaaa taaacacagc cccccacatc caacaaccgc 4920 gaatccaccc agatctgacc cagaagcagg cacgaagaac acggggggtg agggagatgg 4980 gacgcggatc caagcttggc ggcggattgg gttgatgctg cgacggcggc ggagaaggga 5040 gagaggggag aggaggaaaa gcgcggaggc gcggagagag gcgagtacga agacgccttt 5100 ctctgcgttg tctcggctta gggtttgcga tccccgcact ccgcccgttt tatagggcca 5160 gacagcctgg acctctcagg agcggaagcg aagggatggg ggagtttttc gttttacccc 5220 ctttgacgtc ttcaaaattc actcgcatct cacatcgtgc ctgcaaaggt cgggtggttg 5280 gatcatatcg agaatattta ataagttagg gagctttctg ataatatcca ccgcaaggag 5340 gccatttcgt ttgcactcgg ttgaagtcca tacccgcctc tcgttagttt cactgacagg 5400 tgggtccaga ggcttccttc gtgtgcggtt agcgagtgca cgcgtcgctc caagaaaaag 5460 cagtaggtga cctggccacc tcgttgtagg tgcgaccgat gcagacgtcc cgcttgccgg 5520 tgggcccacg ttacagctgg gtcccacata tcggtgggtg cgatgagttg ttcggtgcgt 5580 aggagtagat tggatcccaa cgggtggttg cgtcgtcggc ggccctgccg attttatttt 5640 cgatttttga aatgcgagag cgggagaacg gcaccgttgg cttggctgtg gatgccgtta 5700 gccgcaccgg actattcggc ccagttccat tttggcccaa cttgaaacag cgcggagcac 5760 aagacggggg agcccattta ggcccgtaat ctcagccctg tagaaagtcc gtgtcgttgc 5820 gatggaccag aaagcccata aaccttggag gcgttctctg ctgggaataa aataagttca 5880 cactctgtcc ctcaacttta cgtcgagttt gtttgacatc gctaatgccc agtaccagaa 5940 atcttggata caaataaggt ttgatataaa gtggcacgtg gtgaatggca tcgtttgaaa 6000 aatcttcaga tcgagcgggc ttcacaagcc gtaagtgcaa gtgccaaaat ttgtgaagaa 6060 aattacttcc ttcatttcac aatgtaagtt attttagcat tttccacatt catattgata 6120 tcaataaatt tagatagata tatatgtctg aattcgtacc gttaacgagc tctagaagct 6180 tcagtactac gcgtctcgag gcctattatt gaagcattta tcagggttat tgtctcatga 6240 gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc 6300 cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa 6360 ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 6420 gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 6480 aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 6540 catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg 6600 taaggagaaa ataccgcatc aggcgccatt cgccattcag gctgcgcaac tgttgggaag 6660 ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 6720 ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 6780 gtgaattcac tagtgattgc tctagacact gatagtttcg gatctagata tcacatcaat 6840 ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgttc ctcgtgggtg 6900 ggggtccatc tttgggacca ctgtcggtag aggcatcttg aacgatagcc tttcctttat 6960 cgcaatgatg gcatttgtag aagccatctt ccttttctac tgtcctttcg atgaagtgac 7020 agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 7080 caatagccct ctggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 7140 cgtgctccac catgttgggg atctagatat cacatcaatc cacttgcttt gaagacgtgg 7200 ttggaacgtc ttctttttcc acgatgttcc tcgtgggtgg gggtccatct ttgggaccac 7260 tgtcggtaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 7320 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 7380 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 7440 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgggga 7500 tctagatatc acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca 7560 cgatgttcct cgtgggtggg ggtccatctt tgggaccact gtcggtagag gcatcttgaa 7620 cgatagcctt tcctttatcg caatgatggc atttgtagaa gccatcttcc ttttctactg 7680 tcctttcgat gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta 7740 ccctttgttg aaaagtctca atagccctct ggtcttctga gactgtatct ttgatattct 7800 tggagtagac gagagtgtcg tgctccacca tgttggggat ctagatatca catcaatcca 7860 cttgctttga agacgtggtt ggaacgtctt ctttttccac gatgttcctc gtgggtgggg 7920 gtccatcttt gggaccactg tcggtagagg catcttgaac gatagccttt cctttatcgc 7980 aatgatggca tttgtagaag ccatcttcct tttctactgt cctttcgatg aagtgacaga 8040 tagctgggca atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa 8100 tagccctctg gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt 8160 gctccaccat gttggggatc ctctagagtc gagaattcag tacattaaaa acgtccgcaa 8220 tgtgttatta agttgtctaa gcgtcaattt gtttacacca caatatatcc tgcca 8275 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 19_F <400> 5 tatcacgctc gatatgggtg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 19_R <400> 6 cagcttctca ggatgccata 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> iR2 <400> 7 caggacgtaa cataagggac tga 23 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> T-DNA-F <400> 8 gtttacccgc caatatatcc tgtca 25 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T-DNA-R <400> 9 ctaagagaaa agagcgttta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 19_F <400> 10 tgacatggtc actatgggtg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 19_R <400> 11 tctcagcata cttgctaccc
Claims (19)
상기 재조합 벡터는 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g22440 유전자의 활성을 약화 또는 불활성화시키는 T-DNA 서열을 포함하는 것인,
형질전환 벼.
As a transgenic rice containing a recombinant vector for promoting blight resistance to rice blast,
Wherein the recombinant vector comprises a T-DNA sequence which attenuates or inactivates the activity of the LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.
Transgenic rice.
2. The transgenic rice of claim 1, wherein the LOC_Os06g22440 gene comprises the nucleotide sequence of SEQ ID NO: 1.
2. The transgenic rice of claim 1, wherein the LOC_Os06g22440 gene is encoded by a methyltransferase comprising the amino acid sequence of SEQ ID NO: 3.
The transformed rice according to claim 1, wherein the rice is Dongjin rice.
2. The transformed rice of claim 1, wherein the T-DNA sequence comprises the nucleotide sequence of SEQ ID NO: 4.
A recombinant vector for promoting resistance to blight of blight of rice blast, comprising a T-DNA sequence which weakens or inactivates the activity of LOC_Os06g22440 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.
10. The recombinant vector according to claim 9, wherein the LOC_Os06g22440 gene comprises the nucleotide sequence of SEQ ID NO: 1.
10. The recombinant vector according to claim 9, wherein the LOC_Os06g22440 gene is encoded by a methyltransferase comprising the amino acid sequence of SEQ ID NO: 3.
10. The recombinant vector according to claim 9, wherein the T-DNA sequence comprises the nucleotide sequence of SEQ ID NO: 4.
(b) 상기 (a) 단계에서 감염된 벼의 세포를 캘러스(callus)화하여 형질전환된 벼의 세포를 수득하는 단계를 포함하는,
흰잎 마름병 저항성이 증진된 형질전환 벼의 제조방법.
(a) infecting rice with Agrobacterium to which the recombinant vector of any one of claims 9 to 12 has been introduced; And
(b) callusing cells of infected rice in step (a) to obtain cells of transformed rice,
A method for producing transgenic rice with improved blight resistance to blight.
The method according to claim 15, further comprising (c) inducing differentiation of the callus produced in step (b) into root and adult.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140148598A KR101636159B1 (en) | 2014-10-29 | 2014-10-29 | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140148598A KR101636159B1 (en) | 2014-10-29 | 2014-10-29 | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20160052962A KR20160052962A (en) | 2016-05-13 |
KR101636159B1 true KR101636159B1 (en) | 2016-07-05 |
Family
ID=56022906
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020140148598A KR101636159B1 (en) | 2014-10-29 | 2014-10-29 | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101636159B1 (en) |
-
2014
- 2014-10-29 KR KR1020140148598A patent/KR101636159B1/en active IP Right Grant
Non-Patent Citations (2)
Title |
---|
Journal of Plant Biology, February 2012, Volume 55, Issue 1, pp 64-72 |
The Plant Journal (2006) 45, 123-132 |
Also Published As
Publication number | Publication date |
---|---|
KR20160052962A (en) | 2016-05-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102107735B1 (en) | Method for producing whole plants from protoplasts | |
WO2016057515A9 (en) | Genetic control of axillary bud growth in tobacco plants | |
CN111233991B (en) | Rice OsNBARC1 protein and application of encoding gene thereof in regulation and control of rice bacterial leaf blight resistance | |
CN110468142B (en) | Negative regulatory factor AtRTP5 gene and application thereof in phytophthora infestans resistance | |
CN115894646B (en) | OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight | |
CN112646011B (en) | Protein PHD-Finger17 related to plant stress resistance and coding gene and application thereof | |
CN108220304B (en) | Application of wheat stripe rust PSTG _06371 gene in stripe rust prevention and control and stripe rust resistant wheat cultivation method | |
KR101636155B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
KR101640278B1 (en) | Kinase gene resistant to a bacterial blight and blast, and the transgenic plant using the same | |
KR101636160B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
CN108034662B (en) | Application of wheat stripe rust PSTG _06025 gene in stripe rust prevention and treatment and cultivation method of stripe rust resistant wheat | |
KR101636159B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
KR101636161B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
US20230030612A1 (en) | Solanaceous plant and solanaceous plant cell having resistance to tomato spotted wilt virus, and method for producing solanaceous plant | |
KR101636156B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
KR101636157B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
KR101636158B1 (en) | Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same | |
CN109535236B (en) | Heme binding protein gene TaHBP1, recombinant interference vector and application thereof | |
KR101639102B1 (en) | Kinase gene resistant to a bacterial blight, and the transgenic plant using the same | |
EP3913059A1 (en) | Nematode resistance in plants | |
KR102550308B1 (en) | Method for producing genome-edited tomato plant with increased salt tolerance by SlHKT1;2 gene editing and genome-edited tomato plant with increased salt tolerance produced by the same method | |
CN116375835B (en) | Application of Yan flower MYB4b protein in regulation and control of plant leaf morphology | |
CN114507276B (en) | Application of cucumber CsANT gene in regulation and control of split leaf formation | |
KR102675540B1 (en) | Method for producing tomato plant having controlled disease-resistance using gene editing and tomato plant produced by the same method | |
CN112126710B (en) | Rice source insect-resistant related gene OsLRR6 and encoding product and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AMND | Amendment | ||
E601 | Decision to refuse application | ||
X091 | Application refused [patent] | ||
AMND | Amendment | ||
X701 | Decision to grant (after re-examination) | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20190402 Year of fee payment: 4 |