KR101636157B1 - Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same - Google Patents

Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same Download PDF

Info

Publication number
KR101636157B1
KR101636157B1 KR1020140148596A KR20140148596A KR101636157B1 KR 101636157 B1 KR101636157 B1 KR 101636157B1 KR 1020140148596 A KR1020140148596 A KR 1020140148596A KR 20140148596 A KR20140148596 A KR 20140148596A KR 101636157 B1 KR101636157 B1 KR 101636157B1
Authority
KR
South Korea
Prior art keywords
gene
rice
loc
os06g20790
blight
Prior art date
Application number
KR1020140148596A
Other languages
Korean (ko)
Other versions
KR20160052960A (en
Inventor
이상원
박종찬
안진흥
Original Assignee
경희대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경희대학교 산학협력단 filed Critical 경희대학교 산학협력단
Priority to KR1020140148596A priority Critical patent/KR101636157B1/en
Publication of KR20160052960A publication Critical patent/KR20160052960A/en
Application granted granted Critical
Publication of KR101636157B1 publication Critical patent/KR101636157B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8281Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1003Transferases (2.) transferring one-carbon groups (2.1)
    • C12N9/1007Methyltransferases (general) (2.1.1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y201/00Transferases transferring one-carbon groups (2.1)
    • C12Y201/01Methyltransferases (2.1.1)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성이 강화된, 식물 형질 전환체, 상기 유전자의 활성을 강화시키는 발현 유도 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터 및 상기 식물 형질 전환체의 제조방법에 관한 것이다. 또한, 상기 LOC_Os06g20790 유전자의 활성을 강화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법에 관한 것이다.
본 발명은 벼에 내재적으로 존재하며 흰잎 마름병에 대한 저항성 유전자, LOC_Os06g20790의 발현 조절 부위에 발현 유도 서열을 삽입함으로써, 흰잎 마름병에 대해 강력한 저항성을 갖는 형질전환 벼에 대한 것으로, 본 발명의 형질전환 벼를 이용하면 병 저항성을 통해 농약사용 절감, 생산성 향상 및 안전한 농산물 공급이 가능하게 되어 널리 이용될 수 있다.
The present invention relates to a plant transformant in which the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase is enhanced, an expression inducing sequence for enhancing the activity of the gene, And a method for producing the plant transformant. Further, the present invention relates to a method for enhancing the disease resistance of a plant, comprising the step of enhancing the activity of the LOC_Os06g20790 gene.
The present invention relates to a transgenic rice plant which is intrinsically present in rice and has a strong resistance to blight of blight by inserting an expression inducing sequence into the expression regulatory region of LOC_Os06g20790, a resistance gene against blight of blight, Can be widely used because it can reduce the use of pesticides, improve productivity, and provide safe agricultural products through disease resistance.

Description

흰잎 마름병 저항성 메틸전이효소 및 이를 이용한 형질 전환 식물체{Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same}{Methyltrasniferase gene resistant to a bacterial blight, and a transgenic plant using the same}

본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성이 강화된, 식물 형질 전환체, 상기 유전자의 활성을 강화시키는 발현 유도 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터 및 상기 식물 형질 전환체의 제조방법에 관한 것이다. 또한, 상기 LOC_Os06g20790 유전자의 활성을 강화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법에 관한 것이다.
The present invention relates to a plant transformant in which the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase is enhanced, an expression inducing sequence for enhancing the activity of the gene, And a method for producing the plant transformant. Further, the present invention relates to a method for enhancing the disease resistance of a plant, comprising the step of enhancing the activity of the LOC_Os06g20790 gene.

벼 흰잎 마름병은 Xanthomonas oryzae pv. oryzae 에 의해서 발생되는 세균성 도관병으로, 발병시기는 7월 초~수확기이나 주로 7월 상순~8월 중순에 발병한다. 중간 기주식물인 줄풀 및 겨풀 등의 땅속줄기 또는 뿌리주위나 병든 볏짚 및 벼 그루터기에서 세균의 월동이 가능하다. 세균이 편모(鞭毛)에 의해 물을 따라 전염하고 벼잎의 물구멍과 공기구멍 부위 및 절단된 뿌리로 침입한다. 병 발생은 해마다 발생이 많은 상습발생지 위주로 발생하나 침관수지역이 아닌 지역에서도 발생이 많다.Rice blight caused by Xanthomonas oryzae pv. It is a bacterial tuberculosis caused by oryzae . Its onset occurs from early July to harvesting season, mainly from early July to mid-August. Bacterial wintering is possible in underground stalks, roots, or diseased rice straw and rice stubble, which are intermediate host plants. Bacteria spread along the water by flagella and invade into the water holes, air holes and cut roots of the leaves. Disease occurs mainly in the area of frequent occurrence of the disease every year, but it also occurs in areas not in the area of the pelvic area.

보통 출수기 전후에 나타나나 상습발생지나 다발생 발생지에는 본답 초기에 발병하며, 드물게는 묘판에서도 발병된다. 국내에서 최초 발병보고는 1930년 전라남도 해남군에서 처음 발견된 이래 1960년까지 남부 일부 지역에 제한적인 발생을 보이다 이병성 품종인 금남풍의 재배 확대로 전국적인 발생을 나타내었으며, 이후 다수계 품종 재배에 의한 밀양 23호에 의해 피해가 확대되어 재배기간 중 후기에 발생되는 잎에서의 발병 뿐만 아니라 이앙 후 분열기까지 주 전체가 발생되는 금성형 증상을 보여 벼의 3대 병해의 하나로 간주된다.Usually it appears before and after the heading period, but the occurrence of the rash or the occurrence of the rash occurs at the beginning of the reply. The first occurrence of the disease in Korea was first reported in 1930 in Haenam, Jeollanam-do. Since 1960, a limited occurrence has been observed in some parts of the southern part of the country. The cultivation of Gyeongnam cultivar showed a nationwide occurrence. 23, and it is considered to be one of the three major diseases of rice, showing not only the onset of leaf in later stage during cultivation period but also the symptom of gold mold in which the whole body occurs until the post-transplantation cleavage stage.

벼 흰잎 마름병균은 그람음성세균으로 분류되고 벼의 세균성 위조병을 유발하는 식물병원세균으로 세계적으로 널리 분포하여 벼에 큰 피해를 주지만, 병원균이 벼의 도관 내에서 증식하므로 약제방제 효과는 매우 낮으며, 현재까지 이 병에 특이적인 살균제 또한 없는 실정이다. The rice blotting bacteria are classified as Gram negative bacteria and are widely distributed throughout the world because of bacterial fungi causing bacterial fake disease of rice. Although they cause great damage to rice, pathogens propagate in the ducts of rice, And there is no specific fungicide to date.

또한, 기존의 작물에 대한 저항성 부여방법은 외래 유전자의 도입을 통해 식물체로 하여금 새로운 형질을 부여하는 기술이 대다수였다.
In addition, the conventional method of imparting resistance to crops is a technique in which plants are given new traits through the introduction of foreign genes.

한편, 동진벼는 내병, 양질, 다수성 신품종육성을 목표로 1975년에 농촌진흥청에서 금남풍과 낙동벼 그리고 사도미노리를 교배하여 개발된 품종으로, 병해 저항성의 경우 줄무늬잎마름병에 강하고, 도열병에는 중간 정도의 저항성을 가지며, 흰잎 마름병과 기타 병충해에는 약한 편이다. 이에, 동진벼의 흰잎 마름병과 도열병에 대한 저항성 연구와 개량된 품종에 대한 육성 전략이 요구되고 있다.
Meanwhile, Dongjinbyeong was developed in 1975 as a cross breed between gold southern wind, Nakdong rice and Sadominori in 1975 with the goal of raising the disease, quality and diversity of new varieties. It is resistant to streak blight in case of disease resistance, , And it is weak against blight of white blotch and other pests. Therefore, it is required to study resistance to blight of white blossom and blast disease in Dongjinbyeong, and to cultivate improved varieties.

이에 본 발명자들은 아직 극복되지 못한 벼 흰잎 마름병에 대한 저항성 유전자를 동정하기 위해 예의 연구 노력한 결과, 천연형 벼 동진의 보유 유전자 중 흰잎 마름병에 저항성을 부여하는 메틸전이효소 유전자 (LOC_Os06g20790)를 동정해내어, 이를 활성화시킨 형질전환체가 흰잎 마름병에 저항성을 나타냄을 확인함으로써 본 발명을 완성하였다.
Accordingly, the present inventors have made intensive researches to identify a resistance gene against the blight of rice blight that has not yet been overcome, and as a result, a methyltransferase gene (LOC_Os06g20790) that confers resistance to blight of blight in the wild type rice paddy gene is identified , And that the transformant activated by the transformant was resistant to blight of blight.

본 발명의 하나의 목적은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성이 강화된, 식물 형질 전환체를 제공하는 것이다.One object of the present invention is to provide a plant transformant in which the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding the methyltransferase is enhanced.

본 발명의 다른 목적은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 발현 유도 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터를 제공하는 것이다.Another object of the present invention is to provide a recombinant vector for promoting the resistance to diseases of plants, comprising an expression inducing sequence for enhancing the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding the methyltransferase.

본 발명의 또 다른 목적은 (a) 상기 재조합 벡터가 도입된 아그로박테리움으로 식물을 감염시키는 단계; 및 (b) 상기 (a) 단계에서 감염된 식물의 세포를 캘러스(callus)화하여 형질전환된 식물의 세포를 수득하는 단계를 포함하는, 병 저항성이 증진된 식물 형질 전환체의 제조방법을 제공하는 것이다.Yet another object of the present invention is to provide a method for producing a recombinant vector comprising: (a) infecting a plant with Agrobacterium to which the recombinant vector is introduced; And (b) callusing the cells of the infected plant in step (a) to obtain cells of the transformed plant. will be.

본 발명의 또 다른 목적은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법을 제공하는 것이다.
It is still another object of the present invention to provide a method for enhancing plant disease resistance, comprising the step of enhancing the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.

상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성이 강화된, 식물 형질 전환체를 제공한다.In one aspect of the present invention, there is provided a plant transformant in which the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase is enhanced.

본 발명에서는 메틸전이효소인 서열번호 1 또는 서열번호 2의 염기서열을 가지는 LOC_Os06g20790 유전자의 활성이 강화되도록, LOC_Os06g20790의 발현 조절 부위에 발현 유도 서열을 삽입함으로써, 해당 유전자를 발현하여 흰잎 마름병에 대해 저항성을 갖춘 형질전환 벼를 제조하였다.In the present invention, an expression induction sequence is inserted into the expression control region of LOC_Os06g20790 so as to enhance the activity of the LOC_Os06g20790 gene having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, which is a methyltransferase, Were prepared.

보다 상세하게는 본 발명자들은 아그로박테리움(Agrobacterium)을 이용한 형질전환 방법을 통해 만들어진 10만 개통의 벼 돌연변이 집단에서 흰잎 마름병에 저항성이 있는 식물 형질 전환체를 관찰하였다. 상기 식물 형질 전환체는 아그로박테리움(Agrobacterium)에 의해 유전자를 발현시키는 발현 유도 서열을 포함하는 T-DNA 가 genome 상에 삽입되어 삽입된 지역의 유전자 기능이 활성화된 식물체로, T-DNA의 삽입 위치는 genome DNA PCR과 염기서열 분석을 통해 확인할 수 있으며, 데이터 베이스에서 유전자 locus id를 찾을 수 있다.More specifically, the present inventors have observed plant transformants resistant to blight of blight in a 100,000 rice mutant population produced by the transformation method using Agrobacterium. The plant transformant is a plant in which a gene function is activated in the region where T-DNA including an expression inducing sequence for expressing a gene by Agrobacterium is inserted into the genome, and insertion of T-DNA The location can be confirmed by genome DNA PCR and sequencing, and the gene locus id can be found in the database.

본 발명에서 용어 "메틸전이효소"는 메틸기전이를 촉매하는 효소의 총칭으로, 메틸기전달효소의 일종으로 기질인 아미노기, 히드록시기, 티올기를 메틸화하여 메틸화효소라고 부르는 경우도 있다The term "methyltransferase" in the present invention is a generic term for an enzyme that catalyzes the methyltransferase, and may be referred to as a methylation enzyme by methylating an amino group, a hydroxyl group or a thiol group, which is a substrate,

본 발명에서 용어, "LOC_Os06g20790"는 Oryza sativa 6번째 유전체 (chromosome)에 존재하는 유전자로, 이의 발현물은 단백질 메틸전이효소의 일종이다. 상기 LOC_Os06g20790 유전자는 서열번호 2의 염기서열을 가지며, 상기 염기서열은 서열번호 3의 아미노산 서열로 코딩된다. The term in the invention, "LOC_Os06g20790" is Oryza Sativa is a gene located in the sixth chromosome, and its expression is a protein methyltransferase. The LOC_Os06g20790 gene has the nucleotide sequence of SEQ ID NO: 2, and the nucleotide sequence is encoded by the amino acid sequence of SEQ ID NO: 3.

본 발명에서 상기 식물 형질 전환체 제조에 사용되는 LOC_Os06g20790 유전자는 서열번호 1 또는 서열번호 2의 염기서열을 가지는 유전자 일 수 있으며, 바람직하게는 서열번호 2의 염기서열을 가지는 유전자 일 수 있으며, 또는 서열번호 3의 아미노산 서열로 코딩되는 유전자 일 수 있다.In the present invention, the LOC_Os06g20790 gene used for preparing the plant transformant may be a gene having the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, preferably the nucleotide sequence of SEQ ID NO: 2, Lt; RTI ID = 0.0 > 3 < / RTI >

상기 LOC_Os06g20790 (TIGR, Os06g0313440 (RAP-DB))의 genome DNA 크기는 8025 bp (서열번호 1)이며 대표 coding sequence (LOC_Os06g20790.1)의 크기는 1113 bp (서열번호 2)로 5개의 exon과 4개의 intron으로 구성되며, 370 개의 아미노산으로 번역되어 단백질 (서열번호 3)이 만들어진다. 이 단백질은 plant methyltransferase domain (Methyltransf_7)을 암호화 한다 (도 1B).The genome DNA size of LOC_Os06g20790 (TIGR, Os06g0313440 (RAP-DB)) is 8025 bp (SEQ ID NO: 1) and the size of the representative coding sequence (LOC_Os06g20790.1) is 1113 bp intron, and translated into 370 amino acids to make a protein (SEQ ID NO: 3). This protein encodes the plant methyltransferase domain (Methyltransf_7) (Fig. 1B).

상기 LOC_Os06g20790 유전자는 벼에 내재적으로 존재하는 유전자로, 본 발명에서 용어, "내재적"이란 생물이 천연의 상태로 가지고 있는 것을 의미하는데, 본 발명에서는 식물, 바람직하게는 벼(Oriza sp .) 유전체(chromosome)가 천연적으로 가지고 있는 유전자를 표시할 때 사용한다.A gene the gene LOC_Os06g20790 is implicitly present in the rice, to mean that the term "intrinsic" is a state of natural organisms have in the present invention, in the present invention, a plant, preferably from rice (Oriza sp . It is used to denote genes that are inherently chromosomes.

본 발명에서 용어, "활성 강화"는 특정 유전자의 활성을 강화시키는 것을 의미하고, 용어 "활성화"와 혼용하여 사용될 수 있다. 또한 불활성화된 유전자를 활성화시키거나 활성이 낮은 유전자의 활성을 높이는 것도 포함한다. 1) 해당하는 유전자를 1 카피 이상 도입, 2) 해당하는 유전자의 발현 조절 부위에 발현을 유도하는 서열을 삽입, 3) 활성이 강화된 형태로 변형시키는 방법으로 강화, 또는 4) 이의 조합에 의해 활성이 강화되도록 변형시킬 수 있다. 본 발명에서는 바람직하게는 LOC_Os06g20790의 발현 조절 부위에 발현을 유도하는 서열 또는 프로모터(promoter)를 삽입할 수 있으며, 더욱 바람직하게는 서열번호 4로 기재되는 발현 유도 서열을 포함하는 서열을 삽입할 수 있다. As used herein, the term "enhanced activity" means enhancing the activity of a particular gene and may be used interchangeably with the term "activation ". It also includes activating inactivated genes or increasing the activity of genes with low activity. 1) introducing more than one copy of the gene of interest, 2) inserting a sequence that induces expression in the regulatory region of the gene of interest, 3) enhancing by transforming the activity into enhanced activity, or 4) The activity can be modified to enhance. In the present invention, it is preferable to insert a sequence or a promoter inducing expression in the expression control region of LOC_Os06g20790, more preferably, a sequence including an expression induction sequence of SEQ ID NO: 4 .

본 발명에서 용어, "활성이 낮은 유전자"는 DNA, 즉 유전자 상으로는 존재하나 RNA로 전사(transcription)되는 비율이 낮거나, 단백질로 번역(translation) 되는 비율이 낮아서 본연의 기능을 발휘하지 못하는 것을 의미하고, 본 발명에서는 벼가 내재적으로 가지고 있는 유전자가 전사 또는 번역이 되는 비율이 낮아서 그 기능을 제대로 발현하지 못하는 것을 의미하고, 특히, LOC_Os06g20790 유전자가 그 기능을 제대로 발현하지 못하는 것을 의미한다. In the present invention, the term "low-activity gene" means that DNA is present in the gene, that is, in the gene, but the rate of transcription into RNA is low or that the protein is not translated. In the present invention, it is meant that the gene in which rice is inherently possessed by the rice is low in transcription or translation, and thus can not express its function properly. In particular, LOC_Os06g20790 gene does not express its function properly.

본 발명의 구체적인 일 실시예에서는 LOC_Os06g20790 유전자의 발현 조절 부위에 발현 유도 서열(서열번호 4)을 삽입함으로써, LOC_Os06g20790 유전자의 발현이 증가되는 것을 확인하였다(도 4). 또한, 본 발명의 구체적인 일 실시예에서 상기 LOC_Os06g20790 유전자의 활성이 강화되도록 형질전환된 식물 형질 전환체가 흰잎 마름병에 대해 병 저항성을 가지는 것을 확인하였다(도 5). In a specific embodiment of the present invention, the expression of the LOC_Os06g20790 gene was increased by inserting an expression inducing sequence (SEQ ID NO: 4) in the expression control region of the LOC_Os06g20790 gene (FIG. 4). In addition, in a specific example of the present invention, it was confirmed that the plant transformant transformed to enhance the activity of the LOC_Os06g20790 gene has disease resistance against blight of blight (FIG. 5).

본 발명에서 용어, "발현 유도 서열"은 유전자의 발현 조절 부위에 존재할 때 발현을 촉진하는 기능을 하는 서열을 제한없이 포함하며, 전사인자 결합 부위, 인핸서(enhancer), 조효소 결합 부위(co-factor binding region) 등을 포함한다. 본 발명에서 상기 유전자의 발현 조절 부위에 삽입되는 서열은 서열번호 4로 기재되는 발현 유도 서열을 포함하는 것이 바람직하다. The term "expression inducing sequence" as used herein includes, without limitation, a sequence which functions to promote expression when it is present in a gene expression regulatory region and includes a transcription factor binding site, an enhancer, a co- binding region). In the present invention, it is preferable that the sequence inserted into the expression control region of the gene comprises the expression induction sequence of SEQ ID NO: 4.

본 발명에서 용어, "형질전환"은 DNA 염기서열 상의 삽입, 결실 또는 대체 등의 변이를 통해 특정 형질이 발생하거나 사라지거나 조절되는 모든 행위를 의미하며, 특히 본 발명에서는 외부로부터 주어진 DNA에 의하여 생물의 유전적인 성질이 변하는 것을 의미한다. 본 발명에서 용어, "형질 전환체"는 형질전환으로 인해 생성된 형질전환 식물을 의미하며, 유전자 재조합 기술을 이용하여 특정 유전자의 변형 또는 활성의 변이가 유발되어 생성된 유전자 재조합체를 포함한다.The term "transformed" in the present invention means all the activities in which a specific trait occurs, disappears or is controlled through mutation such as insertion, deletion or substitution on the DNA base sequence. In particular, in the present invention, Which means that the genetic properties of In the present invention, the term "transformant" refers to a transgenic plant produced by transformation, and includes genetic recombinants produced by mutation of a specific gene or activation of an activity using genetic recombination technology.

본 발명에서 용어, "식물 형질 전환체"는 형질전환의 대상이 될 수 있는 모든 식물을 포함하며, 특히, LOC_Os06g20790 유전자 또는 이에 해당하는 유전자가 불활성되거나 활성이 낮은 식물은 모두 제한없이 포함한다. 바람직하게는 상기 식물 형질 전환체는 벼(Oryza sp .)일 수 있으며, 더욱 바람직하게는 동진벼일 수 있다. In the present invention, the term "plant transformant" includes all plants that can be subjected to transformation, and in particular, all plants in which the LOC_Os06g20790 gene or a gene having the inactivated or inactivated gene are included without limitation. Preferably, the plant transformant is rice ( Oryza < RTI ID = 0.0 > sp . ), And more preferably, it may be a Dongjin rice.

본 발명에서 상기 식물 형질 전환체는 흰잎 마름병에 대한 저항성을 가질 수 있다. In the present invention, the plant transformant may have resistance to blight of blight.

본 발명의 구체적인 일 실시예에서는 동진벼에 상기 내재적 유전자인 LOC_Os06g20790의 발현 조절 부위에 서열번호 4의 발현 유도 서열을 삽입하는 형질전환을 통하여 LOC_Os06g20790에 해당하는 유전자의 활성이 강화되는 형질전환체를 제조하였으며, 이를 SAMT 14라고 명명하였다.
In a specific embodiment of the present invention, a transformant was prepared by inserting an expression-inducing sequence of SEQ ID NO: 4 into the regulatory region of LOC_Os06g20790, which is an endogenous gene of the present invention, in Dongjinbyeong to enhance the activity of the gene corresponding to LOC_Os06g20790 , And named it SAMT 14.

또 하나의 양태로서, 본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 발현 유도 서열을 포함하는, 식물의 병 저항성 증진용 재조합 벡터를 제공한다.In another aspect, the present invention provides a recombinant vector for enhancing disease resistance of a plant, comprising an expression inducing sequence for enhancing the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.

상기 메틸전이효소, LOC_Os06g20790 및 발현 유도 서열은 상기 설명한 바와 같다.The methyltransferase, LOC_Os06g20790 and the expression inducing sequence are as described above.

본 발명에서 용어, "병 저항성"은 각종 질병에 대해 발병이 잘 일어나지 않거나, 발병되더라도 병 진행의 속도가 현저히 느리거나, 회복이 되는 능력이 뛰어난 것을 의미한다. 본 발명에서 병 저항성은 흰잎 마름병에 대한 저항성을 의미할 수 있다.In the present invention, the term "disease resistance" means that the onset of disease does not occur well, or that the disease progression rate is significantly slower or recoverable. In the present invention, disease resistance may mean resistance to blight of blight.

본 발명에서 용어, "재조합 벡터"는 특정 서열이 변이, 삽입 또는 제거되는 유전자 재조합 과정을 거친 벡터를 의미하며, 바람직하게는 발현 유도 서열이 삽입된 벡터를 의미하고, 더욱 바람직하게는 해당 발현 유도 서열을 LOC_Os06g20790의 발현 조절 부위에 삽입할 수 있는 기능을 하는 재조합 벡터를 의미한다. In the present invention, the term "recombinant vector" means a vector that has undergone a gene recombination process in which a specific sequence is mutated, inserted or deleted, preferably a vector into which an expression inducing sequence is inserted, Means a recombinant vector capable of inserting the sequence into the expression control region of LOC_Os06g20790.

상기 재조합 벡터는 LOC_Os06g20790 유전자가 발현될 수 있도록, 발현조절 서열과 기능적으로 연결되어 있다. 예를 들어, 벡터는 프로모터, 오퍼레이터, 개시코돈, 종결코돈, 폴리아데닐화 시그널, 인핸서 같은 발현 조절 요소 외에도 막 표적화 또는 분비를 위한 신호 서열 또는 리더 서열을 포함하며 목적에 따라 다양하게 제조될 수 있다. 또한, 벡터는 선택성 마커를 포함할 수 있으며, 벡터는 자가 복제하거나 숙주 DNA에 통합될 수 있다. 본 발명의 벡터는 당해 기술 분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용한다The recombinant vector is functionally linked to an expression control sequence so that the LOC_Os06g20790 gene can be expressed. For example, the vector may comprise a signal sequence or leader sequence for membrane targeting or secretion in addition to an expression regulatory element such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, an enhancer, . In addition, the vector may comprise a selectable marker, and the vector may be self-replicating or integrated into the host DNA. The vector of the present invention can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage are performed using enzymes generally known in the art

본 발명의 일 실시예에서는, LOC_Os06g20790 유전자의 발현 조절 부위에 서열번호 4의 발현 유도 서열 포함하는 재조합 벡터를 제조하였으며, 이를 아그로박테리움을 통해 벼 세포에 도입하여, 내재적 유전자였던 LOC_Os06g20790 유전자의 발현을 증가하였다.
In one embodiment of the present invention, a recombinant vector comprising the expression-inducing sequence of SEQ ID NO: 4 was prepared at the LOC_Os06g20790 gene expression regulatory region and introduced into rice cells through Agrobacterium to express the LOC_Os06g20790 gene, Respectively.

또 하나의 양태로서, 본 발명은 (a) 상기 재조합 벡터가 도입된 아그로박테리움으로 식물을 감염시키는 단계; 및 (b) 상기 (a) 단계에서 감염된 식물의 세포를 캘러스(callus)화하여 형질전환된 식물의 세포를 수득하는 단계를 포함하는, 병 저항성이 증진된 식물 형질 전환체의 제조방법을 제공한다.In another embodiment, the present invention provides a method for producing a recombinant vector comprising: (a) infecting a plant with Agrobacterium to which the recombinant vector is introduced; And (b) callusing cells of the infected plant in step (a) to obtain cells of the transformed plant, wherein the method comprises the steps of: .

본 발명에서 용어, "아그로박테리움"은 그람양성의 세균으로, 식물의 뿌리나 줄기의 상처를 통해 식물세포에 감염되어, 자신이 가지고 있는 유전자를 식물 세포의 유전체에 삽입하여 식물세포의 형질전환을 일으키는 암종세균의 일종이다. 본 발명에서 상기 아그로박테리움은 바람직하게는 아그로박테리움 투메파키엔스(Agrobacterium tumefaciens)일 수 있다. The term "Agrobacterium" in the present invention refers to a gram-positive bacterium, which is infected with plant cells through scars of the roots or stems of plants, and inserts the gene of interest into the genome of the plant cell to transform the plant cell Is a kind of carcinoma bacteria that causes cancer. In the present invention, the Agrobacterium may be Agrobacterium tumefaciens.

본 발명에서 용어, "캘러스(callus)"란, 식물에 상처가 났을 때 생기는 분화되지 않은 부정형의 세포덩어리로 즉, 미분화세포를 의미하며, 특히, 본 발명에서는 식물의 잘린 부위에 아그로박테리움 등 형질전환용 암종세균을 감염시켰을 때 감염된 세포가 미분화상태로 상처부위에 덩어리진 것을 의미한다. 즉, 본 발명에서는 암종세균에 감염되어 형질전환된 세포만이 암종 덩어리를 생성하는 특징을 이용하여 형질전환된 미분화세포를 얻을 수 있는데 이것이 캘러스 형태로 생성되게 된다.The term "callus " in the present invention means an undifferentiated amorphous cell mass produced when a plant is injured, that is, undifferentiated cell. Particularly, in the present invention, Agrobacterium When the transforming carcinoma bacterium is infected, it means that the infected cells are undifferentiated and lump on the wound site. That is, in the present invention, transformed undifferentiated cells can be obtained using only the cells transformed by infection with carcinoma bacteria to produce a mass of carcinoma, which is produced as a callus.

상기 병 저항성이 증진된 형질전환체의 제조방법은, 바람직하게는 수득된 캘러스를 뿌리 및 성체로 분화시키는 단계를 추가로 포함할 수 있다. 캘러스는 상기 설명한대로 미분화된 상태의 세포 덩어리에 불과하기 때문에, 이를 온전한 종자로 수득하기 위해서는 뿌리 및 성체로 분화하는 것을 유도하는 것이 필요할 수 있다.The method for producing a transformant having enhanced disease resistance may further include the step of differentiating the obtained callus into root and adult. Since the callus is only a cell mass in an undifferentiated state as described above, it may be necessary to induce differentiation into roots and adults in order to obtain it as a whole seed.

본 발명의 구체적인 일 실시예에서는, 수득된 캘러스를 루트-인덕션 배지에서 배양하여 뿌리 및 성체로 분화하는 것을 유도하였다(실시예 2).
In one specific embodiment of the present invention, the obtained callus was cultured in root-induction medium to induce differentiation into root and adult (Example 2).

또 하나의 양태로, 본 발명은 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 단계를 포함하는, 식물의 병 저항성의 증진방법을 제공한다.In another aspect, the present invention provides a method for enhancing plant disease resistance comprising the step of enhancing the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.

본 발명의 LOC_Os06g20790 유전자, 활성 강화 및 병 저항성 등은 상기 설명한 바와 같다.The LOC_Os06g20790 gene, activity enhancement and disease resistance of the present invention are as described above.

본 발명에서, 상기 용어 "증진"은 본 발명에서 대조군 벼와 비교하여 적어도 5% 또는 10%, 바람직하게는 적어도 20% 또는 40%, 더욱 바람직하게는 50%, 60%, 70% 또는 80% 이상의 병 저항성을 의미하며, 벼가 원래 가지고 있는 병 저항성에 비해 상기 유전자를 도입하여 병 저항성이 증가되는 것을 의미한다.
In the present invention, the term " promotion "is used herein to refer to at least 5% or 10%, preferably at least 20% or 40%, more preferably 50%, 60%, 70% Means that the disease resistance is increased by introducing the gene as compared to the inherent disease resistance of the rice.

본 발명은 벼에 내재적으로 존재하는 흰잎 마름병에 대한 저항성 유전자, LOC_Os06g20790의 발현 조절 부위에 발현 유도 서열을 삽입함으로써, 흰잎 마름병에 대해 강력한 저항성을 갖는 형질전환 벼에 대한 것으로, 본 발명의 형질전환 벼를 이용하면 병 저항성을 통해 농약사용 절감, 생산성 향상 및 안전한 농산물 공급이 가능하게 되어 널리 이용될 수 있다.
The present invention relates to transgenic rice plants having strong resistance against blight of blight by inserting an expression inducing sequence into the expression regulatory region of LOC_Os06g20790, a resistance gene against blight of blight present intrinsically in rice, Can be widely used because it can reduce the use of pesticides, improve productivity, and provide safe agricultural products through disease resistance.

도 1은 흰잎 마름병에 대한 저항성과 관련된 유전자로 선별된 LOC_Os06g20790의 구조에 대한 개요도로, 도 1의 A는 유전자 상의 구조를 나타내며, 도 1의 B는 유전자가 발현된 단백질의 구조를 나타낸다. 이에 표시된 Methyltransf_7은 메틸전이효소 활성 부분 (methyltransferase domain)을 의미한다.
도 2는 LOC_Os06g20790의 발현을 조절하는 부위에 T-DNA를 포함한 유전자 발현 유도 서열이 삽입된 SAMT 14 유전자 변형 벼의 게놈 DNA의 일부분을 나타내는 구조도이다.
도 3은 SAMT 14 유전자 변형 벼에서 T-DNA 삽입위치를 PCR로 확인한 도면이다.
도 4는 SAMT 14 유전자 변형 벼에서 LOC_Os06g20790의 발현을 확인하는 RT-PCR 결과를 보여주는 도면이다.
도 5는 SAMT 14 유전자 변형 벼의 흰잎 마름병에 대한 저항성을 실험한 결과를 보여주는 도면으로, 도 5의 A는 천연형 벼 및 SAMT 14 유전자 변형 벼의 흰잎 마름병균을 가위 접종법으로 접종한 결과를 보여주는 사진이고, 도 5의 B는 이의 감염에 의해 파괴된 벼 잎의 길이를 측정하여 평균 낸 결과를 나타낸 그래프이다.
Fig. 1 is an outline of the structure of LOC_Os06g20790 selected as a gene related to resistance to blight of blight. Fig. 1 (A) shows the structure of the gene phase. Fig. 1 (B) shows the structure of the gene-expressing protein. Methyltransf_7, as shown, is a methyltransferase domain.
FIG. 2 is a structural diagram showing a part of genomic DNA of SAMT 14 transgenic rice in which a gene expression induction sequence including T-DNA is inserted in a region regulating LOC_Os06g20790 expression.
FIG. 3 is a diagram showing PCR-confirmed positions of T-DNA insertion in SAMT 14 transgenic rice.
FIG. 4 is a graph showing the results of RT-PCR to confirm the expression of LOC_Os06g20790 in SAMT 14 transgenic rice.
FIG. 5 is a graph showing the results of an experiment for resistance to blight of blight of SAMT 14 genetically modified rice, and FIG. 5A shows the results of inoculation of blotch blight of native-type rice and SAMT 14 genetically modified rice with scissors And FIG. 5B is a graph showing the results of measuring the lengths of rice leaves that were destroyed by infection thereof.

이하, 하기 실시예에 의하여 본 발명을 보다 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들로 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited thereto.

실시예 1. Bioinformatics를 통한 형질전환 타겟 유전자 선별Example 1. Screening of Transgenic Target Gene through Bioinformatics

동진벼의 유전체가 보유한 식물체의 질환 저항성과 밀접한 관련이 있을 것으로 예측되는 메틸전이효소 230개를 동정하였다. 이 중, microarray data를 바탕으로 MeV v2.0 프로그램을 이용하여 흰잎 마름병에 저항성을 가질 확률이 높은 유전자를 108개 선별하였다. 선별된 유전자에 대하여 형질전환체를 제조하여 병 저항성을 갖는 유전자를 동정해 내는 과정에서, 본 발명의 LOC_Os06g20790이 흰잎 마름병에 저항성을 갖는 유전자로 선별되었다.
We identified 230 methyltransferases that are expected to be closely related to the disease resistance of the plants possessed by the genomes of Dongjinbara. Based on the microarray data, 108 genes were selected for MeV v2.0 program. In the process of isolating genes having disease resistance by preparing transformants for selected genes, LOC_Os06g20790 of the present invention was selected as a gene resistant to blight of blight.

실시예 2. 발현 유도체 삽입된 형질전환 벼 제조Example 2. Preparation of transgenic rice with expression derivatives

2-1. 벼 형질전환용 재조합 벡터 제조2-1. Production of recombinant vector for rice transformation

타겟 유전자의 발현 조절 부위의 염기서열에 발현 유도 서열을 삽입하기 위해 벡터를 제작하였다. 먼저, 유전체 삽입을 위한 T-DNA, 삽입위치의 왼쪽 유전자 서열을 확인하기 위한 N-GUS, 서열번호 4의 유전자의 발현 유도 서열을 포함하는 재조합 벡터를 제조하기 위한, 담배 잎 모자이크바이러스 35S 프로모터 유래 DNA, 삽입위치의 오른쪽 유전자 서열을 확인하기 위한 L-0.5/1.5를 가지는 벡터를 제작하였다. 삽입된 유전체로부터 타겟 유전자의 확인과 증폭을 위한 프라이머는 아래와 같다.A vector was constructed to insert an expression inducing sequence into the nucleotide sequence of the expression control region of the target gene. First, the T-DNA for inserting the genome, N-GUS for identifying the left gene sequence at the insertion site, and the recombinant vector containing the expression induction sequence of the gene of SEQ ID NO: 4 were obtained from Tobacco Leaf Mosaic Virus 35S promoter DNA and a vector having L-0.5 / 1.5 to identify the right gene sequence at the insertion site. The primers for identification and amplification of the target gene from the inserted genome are as follows.

Enhancer-F (정방향, 서열번호 9)Enhancer-F (forward, SEQ ID NO: 9)

5'- gatccccaacatggtggagc -3'Gt;

Enhancer-R (역방향, 서열번호 10)Enhancer-R (reverse, SEQ ID NO: 10)

5'- ggatctagatatcacatcaa -3'
5'-ggatctagatatacacatca-3 '

PCR 증폭 조건은 처음 DNA의 열변성을 위하여 94℃에서 3분간 1 cycle, 그리고 94℃ 1분, 58℃에서 1분, 72℃에서 2분간으로 총 35 cycle을 실시하였으며, 최종 DNA 합성은 7분으로 하였다. The PCR amplification conditions were 1 cycle at 94 ° C for 3 minutes, 1 cycle at 94 ° C for 1 minute, 1 minute at 58 ° C and 2 minutes at 72 ° C for thermal denaturation of DNA for the first time, Respectively.

해당 증폭된 PCR 산물을 1.0%의 아가로즈겔(agarose gel)로 전기영동 한 후 EtBr(ethidium bromide) 용액에 염색하여 UV lamp하에서 염기 크기에 해당하는 band를 절단하여 아가로즈겔(agarose gel) 정제법으로 정제하였다. The amplified PCR product was electrophoresed with 1.0% agarose gel, stained with EtBr (ethidium bromide) solution, and the band corresponding to the base size was cut under UV lamp to obtain agarose gel purified ≪ / RTI >

추출한 PCR 산물을 상기 제한효소 BamHⅠ/KpnⅠ으로 절단하였다. 또한, 재조합 벡터인 pGA2772 벡터를 제한효소 BamHⅠ/KpnⅠ로 절단하여, 절단된 벡터를 상기 아가로즈겔 정제법으로 정제하였다. 상기 PCR 산물에 의한 DNA 단편을 절단된 재조합 벡터에 삽입하여, 조절부위 발현 유도체 서열 (Enhance sequence, 서열번호 4)이 삽입된 재조합 벡터 pGA2772 vector를 제조하였다.
The extracted PCR product was digested with the restriction enzyme BamHI / KpnI. Further, the recombinant vector pGA2772 vector was digested with restriction enzyme BamHI / KpnI, and the digested vector was purified by the above agarose gel purification method. The DNA fragment from the PCR product was inserted into the cleaved recombinant vector to prepare a recombinant vector pGA2772 vector into which the enhancer sequence (Enhance sequence, SEQ ID NO: 4) was inserted.

2-2. 형질전환체 제조 2-2. Transformant production

상기 제조된 벡터를 전기충격 방법(electroporation)을 이용하여 아그로박테리움 투메파키엔스(Agrobacterium tumefaciens)에 도입하였다. 배양실에서 무균상태로 자란 동진벼에 리프 디스트(leaf disc)법으로 형질전환하였다. 구체적으로는 벼잎을 대략 5 x 5 mm 크기로 잘라서 200 ㎕의 아그로박테리움이 포함된 MSO 액체 배지(MS 염 4.3g, 수크로스 30g/L, pH 5.6 내지 5.8)에 넣었다가 암조건에서 2 내지 3일 동안 배양하고, 배양된 잎 절편을 캘러스-슈트(callus-shoot) 유도 배지(MSO배지에 100㎍ NAA, 1mg BA, 500㎍ 세포탁심, 1mg 포스피노트리신(phospinothricin), 0.7% 피토 한천(phyto agar), pH 5.6)으로 옮기고, 새로운 배지로 옮겨 주었다. 유도된 발아는 1.5 내지 2 cm 정도 자라면 루트-인덕션 배지(MSO배지에 250㎍ 세포탁심, 10mg 포스피노트리신, 0.7% 피토 한천, pH 5.6)로 옮겨 주었다. The prepared vector was introduced into Agrobacterium tumefaciens using electroporation. The cells were transformed into the aseptic state of Dongjinbyeon in the culture room by leaf disc method. Specifically, the rice leaves were cut into approximately 5 x 5 mm size and placed in an MSO liquid medium (4.3 g of MS salt, 30 g / L of sucrose, pH 5.6 to 5.8) containing 200 μl of Agrobacterium, The cells were cultured for 3 days and the cultured leaf slices were treated with callus-shoot induction medium (100 쨉 g NAA, 1 mg BA, 500 쨉 g cell suspension, 1 mg phospinothricin, 0.7% (phyto agar, pH 5.6) and transferred to fresh medium. Induced germination was transferred to root-induction medium (250 μg of cell suspension, 10 mg phosphinotricin, 0.7% phyto-agar, pH 5.6) in MSO medium if it grew to about 1.5 to 2 cm.

발현 유도체가 삽입된 상기 유전자 형질전환 벼를 SAMT 14로 명명하였으며, 이의 유전자 구조는 도 2에 개시된 바와 같다. 구체적으로는, 동진 벼의 첫 번째 유도체에 존재하는 LOC_Os06g20790의 발현 조절 부위로 예측되는 상류부분 (upstream region)에 T-DNA 서열 (서열번호 5)을 삽입하여, 도 2와 같은 유전체 구조를 가진 형질전환체를 제작하였다.
The gene transgenic rice in which the expression derivative was inserted was named SAMT 14, and its gene structure is as shown in Fig. Specifically, a T-DNA sequence (SEQ ID NO: 5) was inserted into an upstream region predicted to be an expression-regulating region of LOC_Os06g20790 present in the first derivative of Dongjin rice, To prepare a conversion body.

2-3. 재조합 벡터의 벼 유전체 삽입위치 확인2-3. Identification of rice embryo insertion position of recombinant vector

T-DNA 삽입에 의해 만들어진 SAMT 14에 대한 inverse-PCR 및 염기 서열 분석을 통해 T-DNA가 삽입된 염색체를 분석하였다.T-DNA inserted chromosomes were analyzed by inverse-PCR and sequencing of SAMT 14 made by T-DNA insertion.

상기 선발된 계통의 벼 종자를 MSO 배지에 28℃에서 10일간 배양하였다. 이렇게 배양한 개체들의 잎 100mg을 채취하여 액체질소를 이용하여 급냉각한 후 분쇄하였다. 분쇄된 잎에서 one step buffer (1M Tris (pH9.5) 5ml, 0.5M EDTA 1ml, KCl 3.73g을 넣고 물로 50ml을 맞춰 조제)을 이용하여 DNA를 추출하였다. The selected lineage rice seeds were cultured in MSO medium at 28 ° C for 10 days. 100 mg of the leaves of the cultivated individuals were sampled and pulverized by rapid cooling using liquid nitrogen. DNA was extracted from the pulverized leaves using one step buffer (5 ml of 1 M Tris (pH 9.5), 1 ml of 0.5 M EDTA, and 3.73 g of KCl, followed by 50 ml of water).

SAMT 14는 LOC_Os06g20790 유전자의 발현조절 상류부분에 T-DNA가 삽입된 계통으로 T-DNA 삽입위치에서 앞뒤에서 만들어진 프라이머 (서열번호 6 및 서열번호 7)와 T-DNA 삽입서열 중 NGUS1 프라이머 (서열번호 8)를 이용하여 PCR로 유전형 분석을 하였다.SAMT 14 is a system in which T-DNA is inserted upstream of the LOC_Os06g20790 gene expression regulatory gene. The primer (SEQ ID NO: 6 and SEQ ID NO: 7) created at the T-DNA insertion site and the NGUS1 primer 8) were used for genotyping analysis.

PCR 반응은 95℃에서 5분 후; 95℃에서 1분, 57℃에서 1분, 72℃에서 1분 을 38회 반복하고, 마지막으로 72℃에서 7분을 진행하였다. PCR 산물은 agarose gel을 이용하여 전기영동으로 확인하였다(도 3). 이를 통해 유전형을 선발하였다.
PCR reactions were performed after 5 minutes at 95 ° C; Repeating 38 times at 95 ° C for 1 minute, at 57 ° C for 1 minute, and 72 ° C for 1 minute, and finally at 72 ° C for 7 minutes. PCR products were confirmed by electrophoresis using agarose gel (Fig. 3). The genotype was selected through this.

이에 사용된 프라이머 서열은 다음과 같다.The primer sequences used here are as follows.

SAMT 14_F (서열번호 6)SAMT 14_F (SEQ ID NO: 6)

5'-GTCAACATTCGCAGTCAACA- 3' 5'-GTCAACATTCGCAGTCAACA- 3 '

SAMT 14_R (서열번호 7)SAMT 14_R (SEQ ID NO: 7)

5'-GTGGGTATGTGCAGGGATTA- 3' Gt;

NGUS1 (서열번호 8)NGUS1 (SEQ ID NO: 8)

5'-AACGCTGATCAATTCCACAG- 3'
5'-AACGCTGATCAATTCCACAG-3 '

실시예Example 3. 형질전환 벼의 유전자 활성 검증 3. Verification of genetic activity of transgenic rice

LOC_Os06g20790 유전자의 발현 조절 부위에 발현 유도체를 삽입한 형질전환 벼 (SAMT 14)에서 LOC_Os06g20790 유전자 활성을 역전사 효소 PCR (RT-PCR, reverse transcriptase-PCR)로 확인 하였다. LOC_Os06g20790 gene activity was confirmed by reverse transcriptase-PCR (RT-PCR) in transgenic rice plants (SAMT 14) in which expression derivatives were inserted into the expression regulatory region of LOC_Os06g20790 gene.

구체적으로는, 형질전환 벼 (SAMT 14)의 잎 0.1g에서 total RNA를 추출하였다. 이를 주형으로 하여 LOC_Os06g20790의 발현을 확인할 수 있는 RNA 역전사용 프라이머와 역전사 효소 (reverse transcriptase DNA polymerase)를 이용하여 역전사 효소 PCR을 수행하였다. Specifically, total RNA was extracted from 0.1 g leaf of transformed rice (SAMT 14). Reverse transcriptase PCR was performed using reverse transcription primers and reverse transcriptase DNA polymerase, which can confirm the expression of LOC_Os06g20790 using this as a template.

도3 에서 확인할 수 있듯이, 천연형 동진벼에 비하여 본 발명의 형질전환 벼에서는 유전자 LOC_Os06g20790의 발현이 높아졌다는 것을 확인할 수 있었다.
As can be seen from FIG. 3, it was confirmed that the expression of the gene LOC_Os06g20790 was increased in the transgenic rice of the present invention, as compared with the wild type Dongjin pine.

RT-SAMT 14_F (정방향, 서열번호 11)RT-SAMT 14_F (forward, SEQ ID NO: 11)

5'- CAGCTTGCATTGGTTATCCG -3'5'-CAGCTTGCATTGGTTATCCG-3 '

RT-SAMT 14_R (역방향, 서열번호 12)RT-SAMT 14_R (reverse, SEQ ID NO: 12)

5'- CAACTCACCCTTAATGCCA -3'
5'-CAACTCACCCTTAATGCCA -3 '

실시예Example 4. 형질전환 벼( 4. Transgenic rice ( SAMTSAMT 14)의 벼  14) rice 흰잎 마름병에To blight of blight 대한 저항성 검정 Resistance test for

상기 실시예 2에서 제조된 형질전환 벼가 흰잎 마름병에 대해 저항성을 보이는지 확인하기 위해, LOC_Os06g20790 발현 조절부위에 발현 유도체가 삽입된 형질전환 벼인 SAMT 14와 대조군으로 천연형 동진벼를 6주간 생장시켜 흰잎 마름병을 유발하는 균주인 Xanthomonas oryzae pv . oryzae (strain : PXO99Az)를 가위에 묻혀 접종한 2주 후 병증을 측정하였다 (도 5). 병증 측정은 접종한 부위로부터 감염되어 파괴된 상처 길이(Lesion Lengths)를 측정하여 천연형 동진벼와 비교하였다.In order to confirm whether the transgenic rice produced in Example 2 showed resistance to blight of blight, SAMT 14, a transgenic rice in which an expression derivative was inserted into the LOC_Os06g20790 expression regulatory region, was grown as a control, Gt ; Xanthomonas < / RTI > oryzae pv . oryzae (strain: PXO99Az) scissors were inoculated at 2 weeks after inoculation (Fig. 5). Lesion lengths were measured and compared with the wild type Dongjinbyeo.

도 5의 B에서 확인할 수 있듯이 SAMT 14 형질전환체는 평균 병증의 길이가 천연형 동진벼의 반 정도에 불과하여 (천연형 vs. SAMT 14 : 24.2cm vs. 10.6cm), 흰잎 마름병에 대한 강력한 저항성을 가짐을 확인할 수 있었다.As can be seen from FIG. 5B, the average pathogenicity of SAMT 14 transformants was only about half of that of wild-type Dong Jinbin (natural type vs. SAMT 14: 24.2 cm vs. 10.6 cm) As shown in Fig.

이와 같은 결과를 통하여, 본 발명의 형질전환 벼 SAMT 14는 내재적 유전자 LOC_Os06g20790를 활성화시킴으로써 흰잎 마름병에 대한 저항성을 가질 수 있음을 확인하였다.From these results, it was confirmed that the transgenic rice SAMT 14 of the present invention can be resistant to blight of leaf blight by activating the inherent gene LOC_Os06g20790.

이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same <130> KPA141024-KR <160> 12 <170> KopatentIn 2.0 <210> 1 <211> 8025 <212> DNA <213> Oryza sativa <400> 1 aaactgaatc atggccacca actccaaaca gagtgtgcat atgaatccag ggcaaggtga 60 aacgagctat gctcagaact cagcacttca ggtatgcttg tgtttaactc ttaaatgcac 120 aaacttaggc tatgcatgat cacctaattt ctcttatgtg gaatttattg gtgtactgac 180 tagatgaaga aaccatatgg tcgccttaga tgcgtcggta cggtgttgta aggcaccggt 240 tatgaagatc accgtgcggc gacggcgatg ggaattcgcc attcgttccc cttcaacaca 300 ccttaagatc gaaagtctga gagttttggt tttggctaag ccgtaaatcg atcgtcgcca 360 atgaacgggt aacgttccct ttatatgttt gtgcattgag gggatcgtgg gcgagtccgt 420 tacgtagata gcgcgtccga tcatcgcaca agagagagag caatgtgcac tcgagaccga 480 gggaatcggt tctcatcgtt aggcgcgagt gggagtgggg tggaccaagc ccattggcgc 540 aaatctctga ctcggtggcc agagatgctt gctctttctt caaagtgcta taccggcttc 600 ttatgattgt cgaaagttga gggcgttgcc tcatttctga gtattacatg ccttgtacta 660 attcgtcatc tgaaggaact gacagtagca gattataaat gaattgaatc attgaaataa 720 gaaccagtca aggcagaatt tgtactgatc agatattttt gtttttataa aaggtctatt 780 gtacaaaaat tgatgacagt ttgatatttg ccaaaaaaca gagaaatgga tttattttgg 840 tcataatgca atcttattca cctgtttttg acaaaataag gaaaggaatt gccattaata 900 tggtggaagc taattttaat ggcctaaatg tttatataaa aatgatcggc tgaatagcta 960 atatggtctc tgaagttttg cttgggctca gtttagtcct cggagtttca aatcattcaa 1020 aaaagttctc caaattaatc atttgggtta atatagtcct tgaactcaaa aaagtgtccc 1080 ttgagcatgc catgccaagt catcctgcca tgcagcggta tgaatgaaat gaccattcta 1140 tccttatata ccatataaaa aagaaagaaa agaaaagaag acaaatgttt cacaggtgta 1200 tgatcgtttt agaattgtca cttacgattg ctgtagtcaa gcaccgatcg ttgggcctcg 1260 gctagcctgt tatttttttc tatttgtgtt ttttctttct tttctatata ttatataagg 1320 ttagaatggt cattttattc ataccgctac atgcgaggat aacttggcat gctcacgtga 1380 tatttttttg gtccaaggat tatattaacc caaataatta atttggagga ctcgtttgaa 1440 cgatttgaaa cattgaggac taaattgagt ccgaagtgaa acttaaggga ccgtattggc 1500 tatttaccca aaatgatcat ataactatgt ttacttggga caattttttt aagaactagg 1560 tgaaaccccg cgcattgctg cgggaattta gtatgaagat atacattgaa acattatgtg 1620 aattatgtta gatgataatt taacatattt gtgtttgaaa agctcttaaa ttataaaaac 1680 tataaagata tagcatgctt gcatgatgtt taaatgtgat gattgttagt ggatgatgat 1740 gtggcatctt gttaattagt ggatgattat atggcatctt gttagtggat gattatgtgg 1800 catctttgca tattaagctt aaggagttag tgggggataa gtttatagta agctaggata 1860 tgctcacttg ttcaaattaa atactccaat tttaatgtaa cggaatattg caccattttt 1920 tcgaactatg atactagatg catcgaggta tgttcgagat aggagaattt ttacaatact 1980 taagagatac caagagatat taaaattttt agttgaaatt tgatacctct tgctactgga 2040 agtattgaga ggaccaaatt ttatataaaa aatatgatac ttgcaggtac cttctcaagt 2100 attataaaat cactcgctaa atagagtcag cttgaaggtt gtgtaaaaaa aatgggtttc 2160 acatggaacc aatctaccta gttgtctgac ttgagcgcat ataaatttta taattttgat 2220 gtttgacagt ttaacttggt gcattcatat tttgggtgtg tttagttcac gctaaaattg 2280 aaagtttggt tgaaattgaa gcgatgtgac ggaaaagttg gaagtttgtg tgtgtagaaa 2340 agttttgatg tgatagaaaa gttggaagtt tgaagaaaac ttttggaact aaactcggcc 2400 ttcatcatat tcccagttgg taactctatc cattgacggc tgtgttttgt tccacgctaa 2460 aattggaagt ttgactaaaa ttagaagttt aaaggaaaaa gttggaagtt tatgtgtgta 2520 ggaaagtttt gatgtgatgg aaaagttgca agtttgaaga aaagttttgg aactaaactc 2580 tgccttcatc atattcccag ctggtaactc tatccattga cggctgtgtt tagtttcaca 2640 ttaaaattag aagtttgaca aaaattagaa gtttgaagga aaaagttgga agtttatgag 2700 tgtagaaaag ttttgatgtg atggaaaagt tgaaagtttg aagtaaactc ggccttcatc 2760 atattcccag ctggtaactc tatccattga cgattgtgtt tagttccaca ccaaaattag 2820 aagtttgact aaaattagaa tttcagagaa aaaagttgaa agtttaatta tgtgtgtaaa 2880 aaaagtttta atctgatgga aaaattggaa gtttgaagaa aaaattgaaa actaaacccc 2940 gccgtaatct gaaaatcatc atactacacc caccctgcat tgtgtggcca aaaaagccaa 3000 ctatttcaat gtttactttg cttgcttgca agatctgatt gagacatatc tgaaaataat 3060 ttgcacgcag aaaacagccc aggataggat gaagactctg atagaggagg cagtcacagg 3120 cttatgcaca agctcatgtc ctcacccaaa gaacatggtg atcgcggact tgggctgctc 3180 ctccggacca aacgcgctca cgctcgtctc tgccgccgtc gacgccatcc accgctactg 3240 cgcgcagcac gagcagctgc cgccggagat gtgcgtgctc ctgaacgatc tgcctgacaa 3300 cgatttcaac gccgtggcga agagcttgga cacactgaag cacagtggtg atgaagcgct 3360 cgctcgccct actgctgtga tcaccggtat ggtacctggg tcgttctacg agaggctatt 3420 cgctcgtggc tccttgcatt tggtttgctc ggctaacagc ttgcattggt tatccgaggt 3480 aagtactgcc tccgtttttt aaatatatga tactgttgac tttttaacaa acgttcgatc 3540 attcgtctta tttaaaattt ttatgtaaat ataaaaaaaa ttaagtaata cttaaaaaaa 3600 catttaatga taaatcaagt cacaatataa taaatgataa ttacataatt ttttttaata 3660 agatgaattg tcaaatgaat ctcaaaagtc aaatggcgtc gtatattaaa aaatggagag 3720 agtaactaat tgtgttgatt acccatccat gtatggaggg ggtatgtttt gatttctgta 3780 agtagtgtgc attgtaactg caggcacctg aagatctcaa gaagagtaga atcccgatgc 3840 atgatagtga tgaacagttg agatcatcaa ggcatcaaat tgtcgcggat tcttatgctc 3900 ggcagtttag gaaggatttc atgcgattct tgagcttgag ggcacaggag attgtccctg 3960 gaggccgaat ggttgtctca ctgttggtca agcgctcgga caaacctgac actgagttaa 4020 ttcaaccatg gacgccggcg gtgacggctt taagtgacat ggcattaagg gtgagttgac 4080 caatttcggc acataccaat tcagtcttat gttcgtgttt tccaatcaca tatgacacaa 4140 gcacacacat aatctctttg gactgctgtt cccttgttgc ttctgattca tctacctttt 4200 tcttcaagct cttattcgca aaaaaacaaa aacaaaaaca aaaacaaaag gacacaagca 4260 cacacaagat gtctttgcac acgtcaactc tttaattacg acctacatga ttaattaaag 4320 aggtttttac ctgtatgcca ttaagaaaga tgatgcatgt ctctgtacca cttaaaagtt 4380 cgagccttcc tatatgccat cggcgagctt tattgcgccc tccacaccat tctgtcgcta 4440 ttctgtgtgg gtttaaccgt ttggcaaatc tgacatatgg gcccgggtag gaaaaatgtc 4500 gctcttgccc tttcaaaaga ggacaggcgg cacggcggac aagcggccag gcgcggcgct 4560 gagtcaggcg accggcgcgg cggaaaagcg gccagccaca atgctgaggc aggcgaccgc 4620 gcgaggcggc caggcggcgc cagcggccag gcggcgtcgg cagccagccg aggcggcgcg 4680 gcgcggcgac caggaggggt ggggtggcgc ggcggcaagg ccgccgccgt agggaatgat 4740 ggccaccgcc acctccatcc acgccgccca ccacactcaa tccactccac agccaaatcg 4800 aaatctcacc ccgtcctcca agccgacgac tccctccccg tccgcccgtg gcatcggcgg 4860 catccgccac ctacaactcc ctccgcgcca ccatcgagct ccacttccgc aagctcaacg 4920 ccatgaaggc cggctcctcc tcctcctcct ttgccggcga cggcgcctcc ggatcatccc 4980 agcccacggg ctcctcctcg tcgcggacca agaagatgga cgaggagcgg cggcgtccgg 5040 ggagggatcc ctcctcccgc cgatccgggt gtcagagtgg gctggcgggt aagagatgag 5100 gaggagcagc ggtggcggcg gcggccgcac ggcagctacc tcctcctctc cttctccgtg 5160 ctcgccatcg tggaccggct cgtcgacttc ccactgctct cgttcactat ccagacggac 5220 gccctcgagc acgccaccat gtacctccac ctagccatgt acgcgtccgt ggcgctcgcc 5280 gccgacagtg ttgcgtcctc ccacaacatc ggcgcgcagg cgctgcttgt ggacgtggtg 5340 gccgcgctcg tcacgtcggt gctcggccag gagctgttcc cctcctcccc cttcctcggc 5400 gccttgggga cgaacgaacg aacacgttgg caagaacgcc taatggcaac taagtcattt 5460 agatgcgctg ttttctaccg ttaggacaaa aaggacggaa tggtgtgtag ggcgctataa 5520 agttcgacga tggcatagag ggaggctcga acttttcagt ggcacagagg ccagcatcat 5580 ctttcttaat ggcatacggg taataacctc ttaattaaat tctgaaaata attttcatat 5640 gtacaacgtg cgttcatcta ctgtcccaca aaatttccag tccagtgaca gttggatgtt 5700 gagtgacaga acatgtgctg caaaactttt caggcgtcct ccctttaggg attaaaagag 5760 tttcgaaata aatcagctca taggggtact tgcacaagtg catatgtagg caccaaacta 5820 ggttaattta ttacctgaat tactctacaa cttatatgta ttttatacaa agcagctaca 5880 ctgatacaaa tctactctgt tatactgaat tttcttcaat tcaatgccag ggtgttatca 5940 gcaaagaaaa gcttgactcc ttctacattc ccttgtgctg ccctatggac agtgaagtta 6000 acaacatcat agaggaggag ggttcatttg aggtcaacaa gatgatgatg cacgatccgt 6060 atgacggcac gggcaaagcc ttgctcgatc tgaagatggt agccttgcgc gtaagagctg 6120 tatttgagcc aataatagtg cagcattttg cagcgtcaga tgaaatcatg gacgacttcg 6180 tcagagcagt ggagcggcac ttgatcagtt caggggctct ggaagctagg ctgtccggcc 6240 aacacccatt tgccttcttg tgtttgtctc ttactagagc gatgtgatga gacagacggg 6300 tgatagataa tacggtgata ccctgcacct tacggtagga ttgctatgta atgtactact 6360 aacttttact ttttccatct cacaaagact ctatttttta gttttttaat ataaggtttg 6420 actcttcatc ttatttaaaa ttttatatgg ttagcacttt tattattatt agatgataaa 6480 acattaatag tactttgttt gtgtgtattt attttttatt tttttaaata agacgtgcag 6540 tcaaaaattg gacataaaac tcaaaggtaa agtctttgtg ggacggaggg tgtaatacga 6600 aactctctgt gaacaatgga gcaagagaaa aagggatatt aattattgac aactatataa 6660 gatcacgcaa caggtttgcc aataaatcag tagtggagag atcaagtaat caagtttcag 6720 tggagagata aatctgatgg acaatgtaaa gaacagataa aattattggc caagatttac 6780 agtgtcaaaa gtacaaggct gcaggataat tgatcgaaaa gccgggttta ttattacata 6840 tttatcaagg aacaaaattg ttggttatta ttatcaaacg agaggaaggg aatcgagaag 6900 aggaaggagc tccccatcca tggttcgata gactcgagtg agtcaaggaa atagaactgg 6960 ttaattaatt ggattcatgc cattataaat ttgctagttc gaaaaaatac cattattatt 7020 atttgtacaa ctgtaacatt tttaaaattg gatccataac atgccgtaca cttgatacac 7080 attttgaatc atttcttatc cactgtattt atatatggac ccaaatatcc gtatcttcta 7140 cagctcaaaa actgtggtta aatttcggta aacatagtta tacatacaag ggaaaaaggg 7200 ggaaattggt aaaagaaatt tagaaaatgg aaaaataata aaaaagaaag ggcggtggag 7260 cggtcgctat ccatgatgac tacccgagcc ggccatccca tccccaccgt cgttggcatc 7320 gacggctttt aactatttac cacttttaga tttggcaaac aactatttgc catctctatc 7380 tcaatgacat gtgggtccac atgtatttat tacatgtggc ttcagtggca aaaagttaat 7440 tgtcacatct aaatgtggca aatggttaaa tatttctctc tgctaagctc attgttgttg 7500 tcggaccatg cagtgcagct acgcttcttg tcaccgttgg ccatgtcacc tctgtcagac 7560 cgcacgtcgt agctcaacac cagacccgat accgtcgtct ccactagatc tgcttgagct 7620 gagctcaccg ccaccggtgc tggatcagct cggatagcac gcaagttggc gctaaggtca 7680 tcgtcgtcgc caggccgcgc atcgctactg ccgggatttg gggaatttgg agcttcggtt 7740 gctgggattt gggtctatgg ttaagagagg attggcagga gtacaaaaaa aaatattaca 7800 caaaaaagat tcaaaacatg tatcaagtgt ataacatggc atagatctaa tttcacgagt 7860 gttgcaatgg aatggttata aatagagaat tgtaactagt aagctatatt ttccaaagta 7920 gtaaatttat tgtggcatgt atccaataat cttttttttt tgagacgatg tatccaataa 7980 tctgattcac ttgagatggc caaaactgtc ctgattatgt tgctc 8025 <210> 2 <211> 1113 <212> DNA <213> Oryza sativa <400> 2 atggccacca actccaaaca gagtgtgcat atgaatccag ggcaaggtga aacgagctat 60 gctcagaact cagcacttca gaaaacagcc caggatagga tgaagactct gatagaggag 120 gcagtcacag gcttatgcac aagctcatgt cctcacccaa agaacatggt gatcgcggac 180 ttgggctgct cctccggacc aaacgcgctc acgctcgtct ctgccgccgt cgacgccatc 240 caccgctact gcgcgcagca cgagcagctg ccgccggaga tgtgcgtgct cctgaacgat 300 ctgcctgaca acgatttcaa cgccgtggcg aagagcttgg acacactgaa gcacagtggt 360 gatgaagcgc tcgctcgccc tactgctgtg atcaccggta tggtacctgg gtcgttctac 420 gagaggctat tcgctcgtgg ctccttgcat ttggtttgct cggctaacag cttgcattgg 480 ttatccgagg cacctgaaga tctcaagaag agtagaatcc cgatgcatga tagtgatgaa 540 cagttgagat catcaaggca tcaaattgtc gcggattctt atgctcggca gtttaggaag 600 gatttcatgc gattcttgag cttgagggca caggagattg tccctggagg ccgaatggtt 660 gtctcactgt tggtcaagcg ctcggacaaa cctgacactg agttaattca accatggacg 720 ccggcggtga cggctttaag tgacatggca ttaaggggtg ttatcagcaa agaaaagctt 780 gactccttct acattccctt gtgctgccct atggacagtg aagttaacaa catcatagag 840 gaggagggtt catttgaggt caacaagatg atgatgcacg atccgtatga cggcacgggc 900 aaagccttgc tcgatctgaa gatggtagcc ttgcgcgtaa gagctgtatt tgagccaata 960 atagtgcagc attttgcagc gtcagatgaa atcatggacg acttcgtcag agcagtggag 1020 cggcacttga tcagttcagg ggctctggaa gctaggctgt ccggccaaca cccatttgcc 1080 ttcttgtgtt tgtctcttac tagagcgatg tga 1113 <210> 3 <211> 370 <212> PRT <213> Oryza sativa <400> 3 Met Ala Thr Asn Ser Lys Gln Ser Val His Met Asn Pro Gly Gln Gly 1 5 10 15 Glu Thr Ser Tyr Ala Gln Asn Ser Ala Leu Gln Lys Thr Ala Gln Asp 20 25 30 Arg Met Lys Thr Leu Ile Glu Glu Ala Val Thr Gly Leu Cys Thr Ser 35 40 45 Ser Cys Pro His Pro Lys Asn Met Val Ile Ala Asp Leu Gly Cys Ser 50 55 60 Ser Gly Pro Asn Ala Leu Thr Leu Val Ser Ala Ala Val Asp Ala Ile 65 70 75 80 His Arg Tyr Cys Ala Gln His Glu Gln Leu Pro Pro Glu Met Cys Val 85 90 95 Leu Leu Asn Asp Leu Pro Asp Asn Asp Phe Asn Ala Val Ala Lys Ser 100 105 110 Leu Asp Thr Leu Lys His Ser Gly Asp Glu Ala Leu Ala Arg Pro Thr 115 120 125 Ala Val Ile Thr Gly Met Val Pro Gly Ser Phe Tyr Glu Arg Leu Phe 130 135 140 Ala Arg Gly Ser Leu His Leu Val Cys Ser Ala Asn Ser Leu His Trp 145 150 155 160 Leu Ser Glu Ala Pro Glu Asp Leu Lys Lys Ser Arg Ile Pro Met His 165 170 175 Asp Ser Asp Glu Gln Leu Arg Ser Ser Arg His Gln Ile Val Ala Asp 180 185 190 Ser Tyr Ala Arg Gln Phe Arg Lys Asp Phe Met Arg Phe Leu Ser Leu 195 200 205 Arg Ala Gln Glu Ile Val Pro Gly Gly Arg Met Val Val Ser Leu Leu 210 215 220 Val Lys Arg Ser Asp Lys Pro Asp Thr Glu Leu Ile Gln Pro Trp Thr 225 230 235 240 Pro Ala Val Thr Ala Leu Ser Asp Met Ala Leu Arg Gly Val Ile Ser 245 250 255 Lys Glu Lys Leu Asp Ser Phe Tyr Ile Pro Leu Cys Cys Pro Met Asp 260 265 270 Ser Glu Val Asn Asn Ile Ile Glu Glu Glu Gly Ser Phe Glu Val Asn 275 280 285 Lys Met Met Met His Asp Pro Tyr Asp Gly Thr Gly Lys Ala Leu Leu 290 295 300 Asp Leu Lys Met Val Ala Leu Arg Val Arg Ala Val Phe Glu Pro Ile 305 310 315 320 Ile Val Gln His Phe Ala Ala Ser Asp Glu Ile Met Asp Asp Phe Val 325 330 335 Arg Ala Val Glu Arg His Leu Ile Ser Ser Gly Ala Leu Glu Ala Arg 340 345 350 Leu Ser Gly Gln His Pro Phe Ala Phe Leu Cys Leu Ser Leu Thr Arg 355 360 365 Ala Met 370 <210> 4 <211> 1361 <212> DNA <213> Artificial Sequence <220> <223> promoter <400> 4 gatccccaac atggtggagc acgacactct cgtctactcc aagaatatca aagatacagt 60 ctcagaagac cagagggcta ttgagacttt tcaacaaagg gtaatatcgg gaaacctcct 120 cggattccat tgcccagcta tctgtcactt catcgaaagg acagtagaaa aggaagatgg 180 cttctacaaa tgccatcatt gcgataaagg aaaggctatc gttcaagatg cctctaccga 240 cagtggtccc aaagatggac ccccacccac gaggaacatc gtggaaaaag aagacgttcc 300 aaccacgtct tcaaagcaag tggattgatg tgatatctag atccccaaca tggtggagca 360 cgacactctc gtctactcca agaatatcaa agatacagtc tcagaagacc agagggctat 420 tgagactttt caacaaaggg taatatcggg aaacctcctc ggattccatt gcccagctat 480 ctgtcacttc atcgaaagga cagtagaaaa ggaagatggc ttctacaaat gccatcattg 540 cgataaagga aaggctatcg ttcaagatgc ctctaccgac agtggtccca aagatggacc 600 cccacccacg aggaacatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt 660 ggattgatgt gatatctaga tccccaacat ggtggagcac gacactctcg tctactccaa 720 gaatatcaaa gatacagtct cagaagacca gagggctatt gagacttttc aacaaagggt 780 aatatcggga aacctcctcg gattccattg cccagctatc tgtcacttca tcgaaaggac 840 agtagaaaag gaagatggct tctacaaatg ccatcattgc gataaaggaa aggctatcgt 900 tcaagatgcc tctaccgaca gtggtcccaa agatggaccc ccacccacga ggaacatcgt 960 ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg atatctagat 1020 ccccaacatg gtggagcacg acactctcgt ctactccaag aatatcaaag atacagtctc 1080 agaagaccag agggctattg agacttttca acaaagggta atatcgggaa acctcctcgg 1140 attccattgc ccagctatct gtcacttcat cgaaaggaca gtagaaaagg aagatggctt 1200 ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt caagatgcct ctaccgacag 1260 tggtcccaaa gatggacccc cacccacgag gaacatcgtg gaaaaagaag acgttccaac 1320 cacgtcttca aagcaagtgg attgatgtga tatctagatc c 1361 <210> 5 <211> 8275 <212> DNA <213> Artificial Sequence <220> <223> T-DNA <400> 5 gtttacccgc caatatatcc tgtcaaacac ggatccgagg taccaggtac caggtgagtt 60 ccattcttac taccacggtg ctattttttt tgctatgtgg ctaattacat gactaacttg 120 gggtgctaaa tcttacaggt tatatgcagg ttatatgcag gtcccgggta ggtcagtccc 180 ttatgttacg tcctgtagaa accccaaccc gtgaaatcaa aaaactcgac ggcctgtggg 240 cattcagtct ggatcgcgaa aactgtggaa ttgatcagcg ttggtgggaa agcgcgttac 300 aagaaagccg ggcaattgct gtgccaggca gttttaacga tcagttcgcc gatgcagata 360 ttcgtaatta tgcgggcaac gtctggtatc agcgcgaagt ctttataccg aaaggttggg 420 caggccagcg tatcgtgctg cgtttcgatg cggtcactca ttacggcaaa gtgtgggtca 480 ataatcagga agtgatggag catcagggcg gctatacgcc atttgaagcc gatgtcacgc 540 cgtatgttat tgccgggaaa agtgtacgta tcaccgtttg tgtgaacaac gaactgaact 600 ggcagactat cccgccggga atggtgatta ccgacgaaaa cggcaagaaa aagcagtctt 660 acttccatga tttctttaac tatgccggaa tccatcgcag cgtaatgctc tacaccacgc 720 cgaacacctg ggtggacgat atcaccgtgg tgacgcatgt cgcgcaagac tgtaaccacg 780 cgtctgttga ctggcaggtg gtggccaatg gtgatgtcag cgttgaactg cgtgatgcgg 840 atcaacaggt ggttgcaact ggacaaggca ctagcgggac tttgcaagtg gtgaatccgc 900 acctctggca accgggtgaa ggttatctct atgaactgtg cgtcacagcc aaaagccaga 960 cagagtgtga tatctacccg cttcgcgtcg gcatccggtc agtggcagtg aagggccaac 1020 agttcctgat taaccacaaa ccgttctact ttactggctt tggtcgtcat gaagatgcgg 1080 acttacgtgg caaaggattc gataacgtgc tgatggtgca cgaccacgca ttaatggact 1140 ggattggggc caactcctac cgtacctcgc attaccctta cgctgaagag atgctcgact 1200 gggcagatga acatggcatc gtggtgattg atgaaactgc tgctgtcggc tttaacctct 1260 ctttaggcat tggtttcgaa gcgggcaaca agccgaaaga actgtacagc gaagaggcag 1320 tcaacgggga aactcagcaa gcgcacttac aggcgattaa agagctgata gcgcgtgaca 1380 aaaaccaccc aagcgtggtg atgtggagta ttgccaacga accggatacc cgtccgcaag 1440 tgcacgggaa tatttcgcca ctggcggaag caacgcgtaa actcgacccg acgcgtccga 1500 tcacctgcgt caatgtaatg ttctgcgacg ctcacaccga taccatcagc gatctctttg 1560 atgtgctgtg cctgaaccgt tattacggat ggtatgtcca aagcggcgat ttggaaacgg 1620 cagagaaggt actggaaaaa gaacttctgg cctggcagga gaaactgcat cagccgatta 1680 tcatcaccga atacggcgtg gatacgttag ccgggctgca ctcaatgtac accgacatgt 1740 ggagtgaaga gtatcagtgt gcatggctgg atatgtatca ccgcgtcttt gatcgcgtca 1800 gcgccgtcgt cggtgaacag gtatggaatt tcgccgattt tgcgacctcg caaggcatat 1860 tgcgcgttgg cggtaacaag aaagggatct tcactcgcga ccgcaaaccg aagtcggcgg 1920 cttttctgct gcaaaaacgc tggactggca tgaacttcgg tgaaaaaccg cagcagggag 1980 gcaaacaatg aatcaacaac tctcctggcg caccatcgtc ggctacagcc tcgggaattg 2040 ctaccgagct cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg 2100 aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat 2160 gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc 2220 ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa 2280 ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat taattcatcg ataggctagt 2340 catggtgact gtacgttgta agtgcagcaa actgccgacg cgatgcaaac tgtacacgtt 2400 aacatgccac tcacctggaa cgcacaatgg ccactaggtg cggccgtagt gtggatttca 2460 aagagagaga gagagagaga gagctaatca cgtaaacgta aacacagcag atagcagaga 2520 tgttgattag gcaaaacagt ataaaagcca atccaataaa ctacatttag cgaagtgcta 2580 tactaatgca ctaataacga actgttcttt tcttaagatc ggagccagta atgggttgtc 2640 agcaggagaa gcacgtaaac cttgaaacat actaagttcc acagtcgaga gtaaaccgta 2700 atcaacacaa gaaacaaaca taaaattgaa caaacgcgca tattataagt gacgaagcgg 2760 tctcacataa aacagggcac acaggttaca acaacgaggg ttgtaagccc attaagcccc 2820 aaacatcaga tcaccacaag caaatgtctc gaagacacac gcacacggca acaggataac 2880 tccacactgg cagatcatgg gatagcagca gttatcaatc aggccttgac acacagaaca 2940 tcaagccccc agacgacgac gactcctcta gatcccggtc ggcatctact ctattccttt 3000 gccctcggac gagtgctggg gcgtcggttt ccactatcgg cgagtacttc tacacagcca 3060 tcggtccaga cggccgcgct tctgcgggcg atttgtgtac gcccgacagt cccggctccg 3120 gatcggacga ttgcgtcgca tcgaccctgc gcccaagctg catcatcgaa attgccgtca 3180 accaagctct gatagagttg gtcaagacca atgcggagca tatacgcccg gagccgcggc 3240 gatcctgcaa gctccggatg cctccgctcg aagtagcgcg tctgctgctc catacaagcc 3300 aaccacggcc tccagaagaa gatgttggcg acctcgtatt gggaatcccc gaacatcgcc 3360 tcgctccagt caatgaccgc tgttatgcgg ccattgtccg tcaggacatt gttggagccg 3420 aaatccgcgt gcacgaggtg ccggacttcg gggcagtcct cggcccaaag catcagctca 3480 tcgagagcct gcgcgacgga cgcactgacg gtgtcgtcca tcacagtttg ccagtgatac 3540 acatggggat cagcaatcgc gcatatgaaa tcacgccatg tagtgtattg accgattcct 3600 tgcggtccga atgggccgaa cccgctcgtc tggctaagat cggccgcagc gatcgcatcc 3660 atggcctccg cgaccggctg cagaacagcg ggcagttcgg tttcaggcag gtcttgcaac 3720 gtgacaccct gtgcacggcg ggagatgcaa taggtcaggc tctcgctgaa ttccccaatg 3780 tcaagcactt ccggaatcgg gagcgcggcc gatgcaaagt gccgataaac ataacgatct 3840 ttgtagaaac catcggcgca gctatttacc cgcaggacat atccacgccc tcctacatcg 3900 aagctgaaag cacgagattc ttcgccctcc gagagctgca tcaggtcgga gacgctgtcg 3960 aacttttcga tcagaaactt ctcgacagac gtcgcggtga gttcaggctt tttcatatct 4020 cattgccccc cgggatccgt cgagtcagcc tgaaaggaca aaatacatgt tagcgcctta 4080 gtggtacatt attatttcag tacagcaaga taacacaatt caaaagactg acccataata 4140 aataactagt cctcaattta aaatttgagt tcctaaatag acatctatga atatgctgta 4200 catcggcact acagaaaata cgattcccaa taattgaaca attgtacttt atttagttgt 4260 tactacaaca atggaagata caagatcgtt tcaaaactac catacatgca tggagtattt 4320 gttccacaga tctggaaaaa acagatctga cgggcagtgt caccaaacac tagacatatg 4380 tatttgtatt aggtggatga cgtgtacaaa catgactacc agatctagaa ttagaacgcg 4440 gcgtgctttg gaaatgttaa gtagatccaa atacatcggt aacaaatgaa catattcata 4500 tgacatagct gtaaaacatc atgatctatc atatcaacta gaggggatct cggcatgtat 4560 cattctattg catctagaac catagcattt ccatgtgaca aacaattttg aaacatacat 4620 tgctcagatc taccataaga acaccatgtt catgacagca tcgaccatga tttccacatt 4680 taacagcatc ccgaggtcag atccagtgtt tagaactatc atttcagcaa aattcacaaa 4740 ataaatcctc caattcgcct acatatatcc attccacgca tcctaggacc agatccacca 4800 taccagtata cacgaacact aaacatttca tcagatccgc taactacgac agagaaaacg 4860 cagatccaga caaccagatc caccgacaaa taaacacagc cccccacatc caacaaccgc 4920 gaatccaccc agatctgacc cagaagcagg cacgaagaac acggggggtg agggagatgg 4980 gacgcggatc caagcttggc ggcggattgg gttgatgctg cgacggcggc ggagaaggga 5040 gagaggggag aggaggaaaa gcgcggaggc gcggagagag gcgagtacga agacgccttt 5100 ctctgcgttg tctcggctta gggtttgcga tccccgcact ccgcccgttt tatagggcca 5160 gacagcctgg acctctcagg agcggaagcg aagggatggg ggagtttttc gttttacccc 5220 ctttgacgtc ttcaaaattc actcgcatct cacatcgtgc ctgcaaaggt cgggtggttg 5280 gatcatatcg agaatattta ataagttagg gagctttctg ataatatcca ccgcaaggag 5340 gccatttcgt ttgcactcgg ttgaagtcca tacccgcctc tcgttagttt cactgacagg 5400 tgggtccaga ggcttccttc gtgtgcggtt agcgagtgca cgcgtcgctc caagaaaaag 5460 cagtaggtga cctggccacc tcgttgtagg tgcgaccgat gcagacgtcc cgcttgccgg 5520 tgggcccacg ttacagctgg gtcccacata tcggtgggtg cgatgagttg ttcggtgcgt 5580 aggagtagat tggatcccaa cgggtggttg cgtcgtcggc ggccctgccg attttatttt 5640 cgatttttga aatgcgagag cgggagaacg gcaccgttgg cttggctgtg gatgccgtta 5700 gccgcaccgg actattcggc ccagttccat tttggcccaa cttgaaacag cgcggagcac 5760 aagacggggg agcccattta ggcccgtaat ctcagccctg tagaaagtcc gtgtcgttgc 5820 gatggaccag aaagcccata aaccttggag gcgttctctg ctgggaataa aataagttca 5880 cactctgtcc ctcaacttta cgtcgagttt gtttgacatc gctaatgccc agtaccagaa 5940 atcttggata caaataaggt ttgatataaa gtggcacgtg gtgaatggca tcgtttgaaa 6000 aatcttcaga tcgagcgggc ttcacaagcc gtaagtgcaa gtgccaaaat ttgtgaagaa 6060 aattacttcc ttcatttcac aatgtaagtt attttagcat tttccacatt catattgata 6120 tcaataaatt tagatagata tatatgtctg aattcgtacc gttaacgagc tctagaagct 6180 tcagtactac gcgtctcgag gcctattatt gaagcattta tcagggttat tgtctcatga 6240 gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc 6300 cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa 6360 ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 6420 gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 6480 aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 6540 catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg 6600 taaggagaaa ataccgcatc aggcgccatt cgccattcag gctgcgcaac tgttgggaag 6660 ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 6720 ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 6780 gtgaattcac tagtgattgc tctagacact gatagtttcg gatctagata tcacatcaat 6840 ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgttc ctcgtgggtg 6900 ggggtccatc tttgggacca ctgtcggtag aggcatcttg aacgatagcc tttcctttat 6960 cgcaatgatg gcatttgtag aagccatctt ccttttctac tgtcctttcg atgaagtgac 7020 agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 7080 caatagccct ctggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 7140 cgtgctccac catgttgggg atctagatat cacatcaatc cacttgcttt gaagacgtgg 7200 ttggaacgtc ttctttttcc acgatgttcc tcgtgggtgg gggtccatct ttgggaccac 7260 tgtcggtaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 7320 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 7380 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 7440 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgggga 7500 tctagatatc acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca 7560 cgatgttcct cgtgggtggg ggtccatctt tgggaccact gtcggtagag gcatcttgaa 7620 cgatagcctt tcctttatcg caatgatggc atttgtagaa gccatcttcc ttttctactg 7680 tcctttcgat gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta 7740 ccctttgttg aaaagtctca atagccctct ggtcttctga gactgtatct ttgatattct 7800 tggagtagac gagagtgtcg tgctccacca tgttggggat ctagatatca catcaatcca 7860 cttgctttga agacgtggtt ggaacgtctt ctttttccac gatgttcctc gtgggtgggg 7920 gtccatcttt gggaccactg tcggtagagg catcttgaac gatagccttt cctttatcgc 7980 aatgatggca tttgtagaag ccatcttcct tttctactgt cctttcgatg aagtgacaga 8040 tagctgggca atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa 8100 tagccctctg gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt 8160 gctccaccat gttggggatc ctctagagtc gagaattcag tacattaaaa acgtccgcaa 8220 tgtgttatta agttgtctaa gcgtcaattt gtttacacca caatatatcc tgcca 8275 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 14_F primer <400> 6 gtcaacattc gcagtcaaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 14_R primer <400> 7 gtgggtatgt gcagggatta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NGUS1 primer <400> 8 aacgctgatc aattccacag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enhancer-F <400> 9 gatccccaac atggtggagc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enhancer-R <400> 10 ggatctagat atcacatcaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 14_F <400> 11 cagcttgcat tggttatccg 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 14_R <400> 12 caactcaccc ttaatgcca 19 <110> University-Industry Cooperation Group of Kyung Hee University <120> Methyltrasniferase gene resistant to a bacterial blight, and the          transgenic plant using the same <130> KPA141024-KR <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 8025 <212> DNA <213> Oryza sativa <400> 1 aaactgaatc atggccacca actccaaaca gagtgtgcat atgaatccag ggcaaggtga 60 aacgagctat gctcagaact cagcacttca ggtatgcttg tgtttaactc ttaaatgcac 120 aaacttaggc tatgcatgat cacctaattt ctcttatgtg gaatttattg gtgtactgac 180 tagatgaaga aaccatatgg tcgccttaga tgcgtcggta cggtgttgta aggcaccggt 240 tatgaagatc accgtgcggc gacggcgatg ggaattcgcc attcgttccc cttcaacaca 300 ccttaagatc gaaagtctga gagttttggt tttggctaag ccgtaaatcg atcgtcgcca 360 atgaacgggt aacgttccct ttatatgttt gtgcattgag gggatcgtgg gcgagtccgt 420 tacgtagata gcgcgtccga tcatcgcaca agagagagag caatgtgcac tcgagaccga 480 gggaatcggt tctcatcgtt aggcgcgagt gggagtgggg tggaccaagc ccattggcgc 540 aaatctctga ctcggtggcc agagatgctt gctctttctt caaagtgcta taccggcttc 600 ttatgattgt cgaaagttga gggcgttgcc tcatttctga gtattacatg ccttgtacta 660 attcgtcatc tgaaggaact gacagtagca gattataaat gaattgaatc attgaaataa 720 gaaccagtca aggcagaatt tgtactgatc agatattttt gtttttataa aaggtctatt 780 gtacaaaaat tgatgacagt ttgatatttg ccaaaaaaca gagaaatgga tttattttgg 840 tcataatgca atcttattca cctgtttttg acaaaataag gaaaggaatt gccattaata 900 tggtggaagc taattttaat ggcctaaatg tttatataaa aatgatcggc tgaatagcta 960 atatggtctc tgaagttttg cttgggctca gtttagtcct cggagtttca aatcattcaa 1020 aaaagttctc caaattaatc atttgggtta atatagtcct tgaactcaaa aaagtgtccc 1080 ttgagcatgc catgccaagt catcctgcca tgcagcggta tgaatgaaat gaccattcta 1140 tccttatata ccatataaaa aagaaagaaa agaaaagaag acaaatgttt cacaggtgta 1200 tgatcgtttt agaattgtca cttacgattg ctgtagtcaa gcaccgatcg ttgggcctcg 1260 gctagcctgt tatttttttc tatttgtgtt ttttctttct tttctatata ttatataagg 1320 ttagaatggt cattttattc ataccgctac atgcgaggat aacttggcat gctcacgtga 1380 tatttttttg gtccaaggat tatattaacc caaataatta atttggagga ctcgtttgaa 1440 cgatttgaaa cattgaggac taaattgagt ccgaagtgaa acttaaggga ccgtattggc 1500 tatttaccca aaatgatcat ataactatgt ttacttggga caattttttt aagaactagg 1560 tgaaaccccg cgcattgctg cgggaattta gtatgaagat atacattgaa acattatgtg 1620 aattatgtta gatgataatt taacatattt gtgtttgaaa agctcttaaa ttataaaaac 1680 tataaagata tagcatgctt gcatgatgtt taaatgtgat gattgttagt ggatgatgat 1740 gtggcatctt gttaattagt ggatgattat atggcatctt gttagtggat gattatgtgg 1800 catctttgca tattaagctt aaggagttag tgggggataa gtttatagta agctaggata 1860 tgctcacttg ttcaaattaa atactccaat tttaatgtaa cggaatattg caccattttt 1920 tcgaactatg atactagatg catcgaggta tgttcgagat aggagaattt ttacaatact 1980 taagagatac caagagatat taaaattttt agttgaaatt tgatacctct tgctactgga 2040 agtattgaga ggaccaaatt ttatataaaa aatatgatac ttgcaggtac cttctcaagt 2100 attataaaat cactcgctaa atagagtcag cttgaaggtt gtgtaaaaaa aatgggtttc 2160 acatggaacc aatctaccta gttgtctgac ttgagcgcat ataaatttta taattttgat 2220 gtttgacagt ttaacttggt gcattcatat tttgggtgtg tttagttcac gctaaaattg 2280 aaagtttggt tgaaattgaa gcgatgtgac ggaaaagttg gaagtttgtg tgtgtagaaa 2340 agttttgatg tgatagaaaa gttggaagtt tgaagaaaac ttttggaact aaactcggcc 2400 ttcatcatat tcccagttgg taactctatc cattgacggc tgtgttttgt tccacgctaa 2460 aattggaagt ttgactaaaa ttagaagttt aaaggaaaaa gttggaagtt tatgtgtgta 2520 ggaaagtttt gatgtgatgg aaaagttgca agtttgaaga aaagttttgg aactaaactc 2580 tgccttcatc atattcccag ctggtaactc tatccattga cggctgtgtt tagtttcaca 2640 ttaaaattag aagtttgaca aaaattagaa gtttgaagga aaaagttgga agtttatgag 2700 tgtagaaaag ttttgatgtg atggaaaagt tgaaagtttg aagtaaactc ggccttcatc 2760 atattcccag ctggtaactc tatccattga cgattgtgtt tagttccaca ccaaaattag 2820 aagtttgact aaaattagaa tttcagagaa aaaagttgaa agtttaatta tgtgtgtaaa 2880 aaaagtttta atctgatgga aaaattggaa gtttgaagaa aaaattgaaa actaaacccc 2940 gccgtaatct gaaaatcatc atactacacc caccctgcat tgtgtggcca aaaaagccaa 3000 ctatttcaat gtttactttg cttgcttgca agatctgatt gagacatatc tgaaaataat 3060 ttgcacgcag aaaacagccc aggataggat gaagactctg atagaggagg cagtcacagg 3120 cttatgcaca agctcatgtc ctcacccaaa gaacatggtg atcgcggact tgggctgctc 3180 ctccggacca aacgcgctca cgctcgtctc tgccgccgtc gacgccatcc accgctactg 3240 cgcgcagcac gagcagctgc cgccggagat gtgcgtgctc ctgaacgatc tgcctgacaa 3300 cgatttcaac gccgtggcga agagcttgga cacactgaag cacagtggtg atgaagcgct 3360 cgctcgccct actgctgtga tcaccggtat ggtacctggg tcgttctacg agaggctatt 3420 cgctcgtggc tccttgcatt tggtttgctc ggctaacagc ttgcattggt tatccgaggt 3480 aagtactgcc tccgtttttt aaatatatga tactgttgac tttttaacaa acgttcgatc 3540 attcgtctta tttaaaattt ttatgtaaat ataaaaaaaa ttaagtaata cttaaaaaaa 3600 catttaatga taaatcaagt cacaatataa taaatgataa ttacataatt ttttttaata 3660 agatgaattg tcaaatgaat ctcaaaagtc aaatggcgtc gtatattaaa aaatggagag 3720 agtaactaat tgtgttgatt acccatccat gtatggaggg ggtatgtttt gatttctgta 3780 agtagtgtgc attgtaactg caggcacctg aagatctcaa gaagagtaga atcccgatgc 3840 atgatagtga tgaacagttg agatcatcaa ggcatcaaat tgtcgcggat tcttatgctc 3900 ggcagtttag gaaggatttc atgcgattct tgagcttgag ggcacaggag attgtccctg 3960 gggccgaat ggttgtctca ctgttggtca agcgctcgga caaacctgac actgagttaa 4020 ttcaaccatg gacgccggcg gtgacggctt taagtgacat ggcattaagg gtgagttgac 4080 caatttcggc acataccaat tcagtcttat gttcgtgttt tccaatcaca tatgacacaa 4140 gcacacacat aatctctttg gactgctgtt cccttgttgc ttctgattca tctacctttt 4200 tcttcaagct cttattcgca aaaaaacaaa aacaaaaaca aaaacaaaag gacacaagca 4260 cacacaagat gtctttgcac acgtcaactc tttaattacg acctacatga ttaattaaag 4320 aggtttttac ctgtatgcca ttaagaaaga tgatgcatgt ctctgtacca cttaaaagtt 4380 cgagccttcc tatatgccat cggcgagctt tattgcgccc tccacaccat tctgtcgcta 4440 ttctgtgtgg gtttaaccgt ttggcaaatc tgacatatgg gcccgggtag gaaaaatgtc 4500 gctcttgccc tttcaaaaga ggacaggcgg cacggcggac aagcggccag gcgcggcgct 4560 gagtcaggcg accggcgcgg cggaaaagcg gccagccaca atgctgaggc aggcgaccgc 4620 gcgaggcggc caggcggcgc cagcggccag gcggcgtcgg cagccagccg aggcggcgcg 4680 gcgcggcgac caggaggggt ggggtggcgc ggcggcaagg ccgccgccgt agggaatgat 4740 ggccaccgcc acctccatcc acgccgccca ccacactcaa tccactccac agccaaatcg 4800 aaatctcacc ccgtcctcca agccgacgac tccctccccg tccgcccgtg gcatcggcgg 4860 catccgccac ctacaactcc ctccgcgcca ccatcgagct ccacttccgc aagctcaacg 4920 ccatgaaggc cggctcctcc tcctcctcct ttgccggcga cggcgcctcc ggatcatccc 4980 agcccacggg ctcctcctcg tcgcggacca agaagatgga cgaggagcgg cggcgtccgg 5040 ggagggatcc ctcctcccgc cgatccgggt gtcagagtgg gctggcgggt aagagatgag 5100 gaggagcagc ggtggcggcg gcggccgcac ggcagctacc tcctcctctc cttctccgtg 5160 ctcgccatcg tggaccggct cgtcgacttc ccactgctct cgttcactat ccagacggac 5220 gccctcgagc acgccaccat gtacctccac ctagccatgt acgcgtccgt ggcgctcgcc 5280 gccgacagtg ttgcgtcctc ccacaacatc ggcgcgcagg cgctgcttgt ggacgtggtg 5340 gccgcgctcg tcacgtcggt gctcggccag gagctgttcc cctcctcccc cttcctcggc 5400 gccttgggga cgaacgaacg aacacgttgg caagaacgcc taatggcaac taagtcattt 5460 agatgcgctg ttttctaccg ttaggacaaa aaggacggaa tggtgtgtag ggcgctataa 5520 agttcgacga tggcatagag ggaggctcga acttttcagt ggcacagagg ccagcatcat 5580 ctttcttaat ggcatacggg taataacctc ttaattaaat tctgaaaata attttcatat 5640 gtacaacgtg cgttcatcta ctgtcccaca aaatttccag tccagtgaca gttggatgtt 5700 gagtgacaga acatgtgctg caaaactttt caggcgtcct ccctttaggg attaaaagag 5760 tttcgaaata aatcagctca taggggtact tgcacaagtg catatgtagg caccaaacta 5820 ggttaattta ttacctgaat tactctacaa cttatatgta ttttatacaa agcagctaca 5880 ctgatacaaa tctactctgt tatactgaat tttcttcaat tcaatgccag ggtgttatca 5940 gcaaagaaaa gcttgactcc ttctacattc ccttgtgctg ccctatggac agtgaagtta 6000 acaacatcat agaggaggag ggttcatttg aggtcaacaa gatgatgatg cacgatccgt 6060 atgacggcac gggcaaagcc ttgctcgatc tgaagatggt agccttgcgc gtaagagctg 6120 tatttgagcc aataatagtg cagcattttg cagcgtcaga tgaaatcatg gacgacttcg 6180 tcagagcagt ggagcggcac ttgatcagtt caggggctct ggaagctagg ctgtccggcc 6240 aacacccatt tgccttcttg tgtttgtctc ttactagagc gatgtgatga gacagacggg 6300 tgatagataa tacggtgata ccctgcacct tacggtagga ttgctatgta atgtactact 6360 aacttttact ttttccatct cacaaagact ctatttttta gttttttaat ataaggtttg 6420 actcttcatc ttatttaaaa ttttatatgg ttagcacttt tattattatt agatgataaa 6480 acattaatag tactttgttt gtgtgtattt attttttatt tttttaaata agacgtgcag 6540 tcaaaaattg gacataaaac tcaaaggtaa agtctttgtg ggacggaggg tgtaatacga 6600 aactctctgt gaacaatgga gcaagagaaa aagggatatt aattattgac aactatataa 6660 gatcacgcaa caggtttgcc aataaatcag tagtggagag atcaagtaat caagtttcag 6720 tggagagata aatctgatgg acaatgtaaa gaacagataa aattattggc caagatttac 6780 agtgtcaaaa gtacaaggct gcaggataat tgatcgaaaa gccgggttta ttattacata 6840 tttatcaagg aacaaaattg ttggttatta ttatcaaacg agaggaaggg aatcgagaag 6900 aggaaggagc tccccatcca tggttcgata gactcgagtg agtcaaggaa atagaactgg 6960 ttaattaatt ggattcatgc cattataaat ttgctagttc gaaaaaatac cattattatt 7020 atttgtacaa ctgtaacatt tttaaaattg gatccataac atgccgtaca cttgatacac 7080 attttgaatc atttcttatc cactgtattt atatatggac ccaaatatcc gtatcttcta 7140 cagctcaaaa actgtggtta aatttcggta aacatagtta tacatacaag ggaaaaaggg 7200 ggaaattggt aaaagaaatt tagaaaatgg aaaaataata aaaaagaaag ggcggtggag 7260 cggtcgctat ccatgatgac tacccgagcc ggccatccca tccccaccgt cgttggcatc 7320 gacggctttt aactatttac cacttttaga tttggcaaac aactatttgc catctctatc 7380 tcaatgacat gtgggtccac atgtatttat tacatgtggc ttcagtggca aaaagttaat 7440 tgtcacatct aaatgtggca aatggttaaa tatttctctc tgctaagctc attgttgttg 7500 tcggaccatg cagtgcagct acgcttcttg tcaccgttgg ccatgtcacc tctgtcagac 7560 cgcacgtcgt agctcaacac cagacccgat accgtcgtct ccactagatc tgcttgagct 7620 gagctcaccg ccaccggtgc tggatcagct cggatagcac gcaagttggc gctaaggtca 7680 tcgtcgtcgc caggccgcgc atcgctactg ccgggatttg gggaatttgg agcttcggtt 7740 gctgggattt gggtctatgg ttaagagagg attggcagga gtacaaaaaa aaatattaca 7800 caaaaaagat tcaaaacatg tatcaagtgt ataacatggc atagatctaa tttcacgagt 7860 gttgcaatgg aatggttata aatagagaat tgtaactagt aagctatatt ttccaaagta 7920 gtaaatttat tgtggcatgt atccaataat cttttttttt tgagacgatg tatccaataa 7980 tctgattcac ttgagatggc caaaactgtc ctgattatgt tgctc 8025 <210> 2 <211> 1113 <212> DNA <213> Oryza sativa <400> 2 atggccacca actccaaaca gagtgtgcat atgaatccag ggcaaggtga aacgagctat 60 gctcagaact cagcacttca gaaaacagcc caggatagga tgaagactct gatagaggag 120 gcagtcacag gcttatgcac aagctcatgt cctcacccaa agaacatggt gatcgcggac 180 ttgggctgct cctccggacc aaacgcgctc acgctcgtct ctgccgccgt cgacgccatc 240 caccgctact gcgcgcagca cgagcagctg ccgccggaga tgtgcgtgct cctgaacgat 300 ctgcctgaca acgatttcaa cgccgtggcg aagagcttgg acacactgaa gcacagtggt 360 gatgaagcgc tcgctcgccc tactgctgtg atcaccggta tggtacctgg gtcgttctac 420 gagaggctat tcgctcgtgg ctccttgcat ttggtttgct cggctaacag cttgcattgg 480 ttatccgagg cacctgaaga tctcaagaag agtagaatcc cgatgcatga tagtgatgaa 540 cagttgagat catcaaggca tcaaattgtc gcggattctt atgctcggca gtttaggaag 600 gatttcatgc gattcttgag cttgagggca caggagattg tccctggagg ccgaatggtt 660 gtctcactgt tggtcaagcg ctcggacaaa cctgacactg agttaattca accatggacg 720 ccggcggtga cggctttaag tgacatggca ttaaggggtg ttatcagcaa agaaaagctt 780 gactccttct acattccctt gtgctgccct atggacagtg aagttaacaa catcatagag 840 gaggagggtt catttgaggt caacaagatg atgatgcacg atccgtatga cggcacgggc 900 aaagccttgc tcgatctgaa gatggtagcc ttgcgcgtaa gagctgtatt tgagccaata 960 atagtgcagc attttgcagc gtcagatgaa atcatggacg acttcgtcag agcagtggag 1020 cggcacttga tcagttcagg ggctctggaa gctaggctgt ccggccaaca cccatttgcc 1080 ttcttgtgtt tgtctcttac tagagcgatg tga 1113 <210> 3 <211> 370 <212> PRT <213> Oryza sativa <400> 3 Met Ala Thr Asn Ser Lys Gln Ser Val His Met Asn Pro Gly Gln Gly   1 5 10 15 Glu Thr Ser Tyr Ala Gln Asn Ser Ala Leu Gln Lys Thr Ala Gln Asp              20 25 30 Arg Met Lys Thr Leu Ile Glu Glu Ala Val Thr Gly Leu Cys Thr Ser          35 40 45 Ser Cys Pro His Pro Lys Asn Met Val Ile Ala Asp Leu Gly Cys Ser      50 55 60 Ser Gly Pro Asn Ala Leu Thr Leu Val Ser Ala Ala Val Asp Ala Ile  65 70 75 80 His Arg Tyr Cys Ala Gln His Glu Gln Leu Pro Pro Glu Met Cys Val                  85 90 95 Leu Leu Asn Asp Leu Pro Asp Asn Asp Phe Asn Ala Val Ala Lys Ser             100 105 110 Leu Asp Thr Leu Lys His Ser Gly Asp Glu Ala Leu Ala Arg Pro Thr         115 120 125 Ala Val Ile Thr Gly Met Val Pro Gly Ser Phe Tyr Glu Arg Leu Phe     130 135 140 Ala Arg Gly Ser Leu His Leu Val Cys Ser Ala Asn Ser Leu His Trp 145 150 155 160 Leu Ser Glu Ala Pro Glu Asp Leu Lys Lys Ser Arg Ile Pro Met His                 165 170 175 Asp Ser Asp Glu Gln Leu Arg Ser Ser Arg His Gln Ile Val Ala Asp             180 185 190 Ser Tyr Ala Arg Gln Phe Arg Lys Asp Phe Met Arg Phe Leu Ser Leu         195 200 205 Arg Ala Gln Glu Ile Val Gly Gly Arg Met Val Val Ser Leu Leu     210 215 220 Val Lys Arg Ser Asp Lys Pro Asp Thr Glu Leu Ile Gln Pro Trp Thr 225 230 235 240 Pro Ala Val Thr Ala Leu Ser Asp Met Ala Leu Arg Gly Val Ile Ser                 245 250 255 Lys Glu Lys Leu Asp Ser Phe Tyr Ile Pro Leu Cys Cys Pro Met Asp             260 265 270 Ser Glu Val Asn Asn Ile Ile Glu Glu Glu Gly Ser Ser Phe Glu Val Asn         275 280 285 Lys Met Met Met His Asp Pro Tyr Asp Gly Thr Gly Lys Ala Leu Leu     290 295 300 Asp Leu Lys Met Val Ala Leu Arg Val Val Ala Val Phe Glu Pro Ile 305 310 315 320 Ile Val Gln His Phe Ala Ala Ser Asp Glu Ile Met Asp Asp Phe Val                 325 330 335 Arg Ala Val Glu Arg His Leu Ile Ser Ser Gly Ala Leu Glu Ala Arg             340 345 350 Leu Ser Gly Gln His Pro Phe Ala Phe Leu Cys Leu Ser Leu Thr Arg         355 360 365 Ala Met     370 <210> 4 <211> 1361 <212> DNA <213> Artificial Sequence <220> <223> promoter <400> 4 gatccccaac atggtggagc acgacactct cgtctactcc aagaatatca aagatacagt 60 ctcagaagac cagagggcta ttgagacttt tcaacaaagg gtaatatcgg gaaacctcct 120 cggattccat tgcccagcta tctgtcactt catcgaaagg acagtagaaa aggaagatgg 180 cttctacaaa tgccatcatt gcgataaagg aaaggctatc gttcaagatg cctctaccga 240 cagtggtccc aaagatggac ccccacccac gaggaacatc gtggaaaaag aagacgttcc 300 aaccacgtct tcaaagcaag tggattgatg tgatatctag atccccaaca tggtggagca 360 cgacactctc gtctactcca agaatatcaa agatacagtc tcagaagacc agagggctat 420 tgagactttt caacaaaggg taatatcggg aaacctcctc ggattccatt gcccagctat 480 ctgtcacttc atcgaaagga cagtagaaaa ggaagatggc ttctacaaat gccatcattg 540 cgataaagga aaggctatcg ttcaagatgc ctctaccgac agtggtccca aagatggacc 600 cccacccacg aggaacatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt 660 ggattgatgt gatatctaga tccccaacat ggtggagcac gacactctcg tctactccaa 720 gaatatcaaa gatacagtct cagaagacca gagggctatt gagacttttc aacaaagggt 780 aatatcggga aacctcctcg gattccattg cccagctatc tgtcacttca tcgaaaggac 840 agtagaaaag gaagatggct tctacaaatg ccatcattgc gataaaggaa aggctatcgt 900 tcaagatgcc tctaccgaca gtggtcccaa agatggaccc ccacccacga ggaacatcgt 960 ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtg gattgatgtg atatctagat 1020 ccccaacatg gtggagcacg acactctcgt ctactccaag aatatcaaag atacagtctc 1080 agaagaccag agggctattg agacttttca acaaagggta atatcgggaa acctcctcgg 1140 attccattgc ccagctatct gtcacttcat cgaaaggaca gtagaaaagg aagatggctt 1200 ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt caagatgcct ctaccgacag 1260 tggtcccaaa gatggacccc cacccacgag gaacatcgtg gaaaaagaag acgttccaac 1320 cacgtcttca aagcaagtgg attgatgtga tatctagatc c 1361 <210> 5 <211> 8275 <212> DNA <213> Artificial Sequence <220> <223> T-DNA <400> 5 gtttacccgc caatatatcc tgtcaaacac ggatccgagg taccaggtac caggtgagtt 60 ccattcttac taccacggtg ctattttttt tgctatgtgg ctaattacat gactaacttg 120 gggtgctaaa tcttacaggt tatatgcagg ttatatgcag gtcccgggta ggtcagtccc 180 ttatgttacg tcctgtagaa accccaaccc gtgaaatcaa aaaactcgac ggcctgtggg 240 cattcagtct ggatcgcgaa aactgtggaa ttgatcagcg ttggtgggaa agcgcgttac 300 aagaaagccg ggcaattgct gtgccaggca gttttaacga tcagttcgcc gatgcagata 360 ttcgtaatta tgcgggcaac gtctggtatc agcgcgaagt ctttataccg aaaggttggg 420 caggccagcg tatcgtgctg cgtttcgatg cggtcactca ttacggcaaa gtgtgggtca 480 ataatcagga agtgatggag catcagggcg gctatacgcc atttgaagcc gatgtcacgc 540 cgtatgttat tgccgggaaa agtgtacgta tcaccgtttg tgtgaacaac gaactgaact 600 ggcagactat cccgccggga atggtgatta ccgacgaaaa cggcaagaaa aagcagtctt 660 acttccatga tttctttaac tatgccggaa tccatcgcag cgtaatgctc tacaccacgc 720 cgaacacctg ggtggacgat atcaccgtgg tgacgcatgt cgcgcaagac tgtaaccacg 780 cgtctgttga ctggcaggtg gtggccaatg gtgatgtcag cgttgaactg cgtgatgcgg 840 atcaacaggt ggttgcaact ggacaaggca ctagcgggac tttgcaagtg gtgaatccgc 900 acctctggca accgggtgaa ggttatctct atgaactgtg cgtcacagcc aaaagccaga 960 cagagtgtga tatctacccg cttcgcgtcg gcatccggtc agtggcagtg aagggccaac 1020 agttcctgat taaccacaaa ccgttctact ttactggctt tggtcgtcat gaagatgcgg 1080 acttacgtgg caaaggattc gataacgtgc tgatggtgca cgaccacgca ttaatggact 1140 ggattggggc caactcctac cgtacctcgc attaccctta cgctgaagag atgctcgact 1200 gggcagatga acatggcatc gtggtgattg atgaaactgc tgctgtcggc tttaacctct 1260 ctttaggcat tggtttcgaa gcgggcaaca agccgaaaga actgtacagc gaagaggcag 1320 tcaacgggga aactcagcaa gcgcacttac aggcgattaa agagctgata gcgcgtgaca 1380 aaaaccaccc aagcgtggtg atgtggagta ttgccaacga accggatacc cgtccgcaag 1440 tgcacgggaa tatttcgcca ctggcggaag caacgcgtaa actcgacccg acgcgtccga 1500 tcacctgcgt caatgtaatg ttctgcgacg ctcacaccga taccatcagc gatctctttg 1560 atgtgctgtg cctgaaccgt tattacggat ggtatgtcca aagcggcgat ttggaaacgg 1620 caggaaggt actggaaaaa gaacttctgg cctggcagga gaaactgcat cagccgatta 1680 tcatcaccga atacggcgtg gatacgttag ccgggctgca ctcaatgtac accgacatgt 1740 ggagtgaaga gtatcagtgt gcatggctgg atatgtatca ccgcgtcttt gatcgcgtca 1800 gcgccgtcgt cggtgaacag gtatggaatt tcgccgattt tgcgacctcg caaggcatat 1860 tgcgcgttgg cggtaacaag aaagggatct tcactcgcga ccgcaaaccg aagtcggcgg 1920 cttttctgct gcaaaaacgc tggactggca tgaacttcgg tgaaaaaccg cagcagggag 1980 gcaaacaatg aatcaacaac tctcctggcg caccatcgtc ggctacagcc tcgggaattg 2040 ctaccgagct cgaatttccc cgatcgttca aacatttggc aataaagttt cttaagattg 2100 aatcctgttg ccggtcttgc gatgattatc atataatttc tgttgaatta cgttaagcat 2160 gtaataatta acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc 2220 ccgcaattat acatttaata cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa 2280 ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat taattcatcg ataggctagt 2340 catggtgact gtacgttgta agtgcagcaa actgccgacg cgatgcaaac tgtacacgtt 2400 aacatgccac tcacctggaa cgcacaatgg ccactaggtg cggccgtagt gtggatttca 2460 aagagagaga gagagagaga gagctaatca cgtaaacgta aacacagcag atagcagaga 2520 tgttgattag gcaaaacagt ataaaagcca atccaataaa ctacatttag cgaagtgcta 2580 tactaatgca ctaataacga actgttcttt tcttaagatc ggagccagta atgggttgtc 2640 agcaggagaa gcacgtaaac cttgaaacat actaagttcc acagtcgaga gtaaaccgta 2700 atcaacacaa gaaacaaaca taaaattgaa caaacgcgca tattataagt gacgaagcgg 2760 tctcacataa aacagggcac acaggttaca acaacgaggg ttgtaagccc attaagcccc 2820 aaacatcaga tcaccacaag caaatgtctc gaagacacac gcacacggca acaggataac 2880 tccacactgg cagatcatgg gatagcagca gttatcaatc aggccttgac acacagaaca 2940 tcaagccccc agacgacgac gactcctcta gatcccggtc ggcatctact ctattccttt 3000 gccctcggac gagtgctggg gcgtcggttt ccactatcgg cgagtacttc tacacagcca 3060 tcggtccaga cggccgcgct tctgcgggcg atttgtgtac gcccgacagt cccggctccg 3120 gatcggacga ttgcgtcgca tcgaccctgc gcccaagctg catcatcgaa attgccgtca 3180 accaagctct gatagagttg gtcaagacca atgcggagca tatacgcccg gagccgcggc 3240 gatcctgcaa gctccggatg cctccgctcg aagtagcgcg tctgctgctc catacaagcc 3300 aaccacggcc tccagaagaa gatgttggcg acctcgtatt gggaatcccc gaacatcgcc 3360 tcgctccagt caatgaccgc tgttatgcgg ccattgtccg tcaggacatt gttggagccg 3420 aaatccgcgt gcacgaggtg ccggacttcg gggcagtcct cggcccaaag catcagctca 3480 tcgagagcct gcgcgacgga cgcactgacg gtgtcgtcca tcacagtttg ccagtgatac 3540 acatggggat cagcaatcgc gcatatgaaa tcacgccatg tagtgtattg accgattcct 3600 tgcggtccga atgggccgaa cccgctcgtc tggctaagat cggccgcagc gatcgcatcc 3660 atggcctccg cgaccggctg cagaacagcg ggcagttcgg tttcaggcag gtcttgcaac 3720 gtgacaccct gtgcacggcg ggagatgcaa taggtcaggc tctcgctgaa ttccccaatg 3780 tcaagcactt ccggaatcgg gagcgcggcc gatgcaaagt gccgataaac ataacgatct 3840 ttgtagaaac catcggcgca gctatttacc cgcaggacat atccacgccc tcctacatcg 3900 aagctgaaag cacgagattc ttcgccctcc gagagctgca tcaggtcgga gacgctgtcg 3960 aacttttcga tcagaaactt ctcgacagac gtcgcggtga gttcaggctt tttcatatct 4020 cattgccccc cgggatccgt cgagtcagcc tgaaaggaca aaatacatgt tagcgcctta 4080 gtggtacatt attatttcag tacagcaaga taacacaatt caaaagactg acccataata 4140 aataactagt cctcaattta aaatttgagt tcctaaatag acatctatga atatgctgta 4200 catcggcact acagaaaata cgattcccaa taattgaaca attgtacttt atttagttgt 4260 tactacaaca atggaagata caagatcgtt tcaaaactac catacatgca tggagtattt 4320 gttccacaga tctggaaaaa acagatctga cgggcagtgt caccaaacac tagacatatg 4380 tatttgtatt aggtggatga cgtgtacaaa catgactacc agatctagaa ttagaacgcg 4440 gcgtgctttg gaaatgttaa gtagatccaa atacatcggt aacaaatgaa catattcata 4500 tgacatagct gtaaaacatc atgatctatc atatcaacta gaggggatct cggcatgtat 4560 cattctattg catctagaac catagcattt ccatgtgaca aacaattttg aaacatacat 4620 tgctcagatc taccataaga acaccatgtt catgacagca tcgaccatga tttccacatt 4680 taacagcatc ccgaggtcag atccagtgtt tagaactatc atttcagcaa aattcacaaa 4740 ataaatcctc caattcgcct acatatatcc attccacgca tcctaggacc agatccacca 4800 taccagtata cacgaacact aaacatttca tcagatccgc taactacgac agagaaaacg 4860 cagatccaga caaccagatc caccgacaaa taaacacagc cccccacatc caacaaccgc 4920 gaatccaccc agatctgacc cagaagcagg cacgaagaac acggggggtg agggagatgg 4980 gacgcggatc caagcttggc ggcggattgg gttgatgctg cgacggcggc ggagaaggga 5040 gagaggggag aggaggaaaa gcgcggaggc gcggagagag gcgagtacga agacgccttt 5100 ctctgcgttg tctcggctta gggtttgcga tccccgcact ccgcccgttt tatagggcca 5160 gacagcctgg acctctcagg agcggaagcg aagggatggg ggagtttttc gttttacccc 5220 ctttgacgtc ttcaaaattc actcgcatct cacatcgtgc ctgcaaaggt cgggtggttg 5280 gatcatatcg agaatattta ataagttagg gagctttctg ataatatcca ccgcaaggag 5340 gccatttcgt ttgcactcgg ttgaagtcca tacccgcctc tcgttagttt cactgacagg 5400 tgggtccaga ggcttccttc gtgtgcggtt agcgagtgca cgcgtcgctc caagaaaaag 5460 cagtaggtga cctggccacc tcgttgtagg tgcgaccgat gcagacgtcc cgcttgccgg 5520 tgggcccacg ttacagctgg gtcccacata tcggtgggtg cgatgagttg ttcggtgcgt 5580 aggagtagat tggatcccaa cgggtggttg cgtcgtcggc ggccctgccg attttatttt 5640 cgatttttga aatgcgagag cgggagaacg gcaccgttgg cttggctgtg gatgccgtta 5700 gccgcaccgg actattcggc ccagttccat tttggcccaa cttgaaacag cgcggagcac 5760 aagacggggg agcccattta ggcccgtaat ctcagccctg tagaaagtcc gtgtcgttgc 5820 gatggaccag aaagcccata aaccttggag gcgttctctg ctgggaataa aataagttca 5880 cactctgtcc ctcaacttta cgtcgagttt gtttgacatc gctaatgccc agtaccagaa 5940 atcttggata caaataaggt ttgatataaa gtggcacgtg gtgaatggca tcgtttgaaa 6000 aatcttcaga tcgagcgggc ttcacaagcc gtaagtgcaa gtgccaaaat ttgtgaagaa 6060 aattacttcc ttcatttcac aatgtaagtt attttagcat tttccacatt catattgata 6120 tcaataaatt tagatagata tatatgtctg aattcgtacc gttaacgagc tctagaagct 6180 tcagtactac gcgtctcgag gcctattatt gaagcattta tcagggttat tgtctcatga 6240 gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc 6300 cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta acctataaaa 6360 ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 6420 gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 6480 aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 6540 catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg 6600 taaggagaaa ataccgcatc aggcgccatt cgccattcag gctgcgcaac tgttgggaag 6660 ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 6720 ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 6780 gtgaattcac tagtgattgc tctagacact gatagtttcg gatctagata tcacatcaat 6840 ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgttc ctcgtgggtg 6900 ggggtccatc tttgggacca ctgtcggtag aggcatcttg aacgatagcc tttcctttat 6960 cgcaatgatg gcatttgtag aagccatctt ccttttctac tgtcctttcg atgaagtgac 7020 agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 7080 caatagccct ctggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 7140 cgtgctccac catgttgggg atctagatat cacatcaatc cacttgcttt gaagacgtgg 7200 ttggaacgtc ttctttttcc acgatgttcc tcgtgggtgg gggtccatct ttgggaccac 7260 tgtcggtaga ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtaga 7320 agccatcttc cttttctact gtcctttcga tgaagtgaca gatagctggg caatggaatc 7380 cgaggaggtt tcccgatatt accctttgtt gaaaagtctc aatagccctc tggtcttctg 7440 agactgtatc tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttgggga 7500 tctagatatc acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca 7560 cgatgttcct cgtgggtggg ggtccatctt tgggaccact gtcggtagag gcatcttgaa 7620 cgatagcctt tcctttatcg caatgatggc atttgtagaa gccatcttcc ttttctactg 7680 tcctttcgat gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta 7740 ccctttgttg aaaagtctca atagccctct ggtcttctga gactgtatct ttgatattct 7800 tggagtagac gagagtgtcg tgctccacca tgttggggat ctagatatca catcaatcca 7860 cttgctttga agacgtggtt ggaacgtctt ctttttccac gatgttcctc gtgggtgggg 7920 gtccatcttt gggaccactg tcggtagagg catcttgaac gatagccttt cctttatcgc 7980 aatgatggca tttgtagaag ccatcttcct tttctactgt cctttcgatg aagtgacaga 8040 tagctgggca atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa 8100 tagccctctg gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt 8160 gctccaccat gttggggatc ctctagagtc gagaattcag tacattaaaa acgtccgcaa 8220 tgtgttatta agttgtctaa gcgtcaattt gtttacacca caatatatcc tgcca 8275 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 14_F primer <400> 6 gtcaacattc gcagtcaaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SAMT 14_R primer <400> 7 gtgggtatgt gcagggatta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NGUS1 primer <400> 8 aacgctgatc aattccacag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enhancer-F <400> 9 gatccccaac atggtggagc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Enhancer-R <400> 10 ggatctagat atcacatcaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 14_F <400> 11 cagcttgcat tggttatccg 20 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RT-SAMT 14_R <400> 12 caactcaccc ttaatgcca 19

Claims (19)

벼의 흰잎 마름병 저항성 증진용 재조합 벡터를 포함하는 형질전환 벼로서,
상기 재조합 벡터는 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 발현 유도 서열을 포함하는 것인,
형질전환 벼.
As a transgenic rice containing a recombinant vector for promoting blight resistance to rice blast,
Wherein the recombinant vector comprises an expression inducing sequence that enhances the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.
Transgenic rice.
제1항에 있어서, 상기 LOC_Os06g20790 유전자는 서열번호 1의 염기서열로 이루어진 것인, 형질전환 벼.
The transgenic rice of claim 1, wherein the LOC_Os06g20790 gene comprises the nucleotide sequence of SEQ ID NO: 1.
제1항에 있어서, 상기 LOC_Os06g20790 유전자는 서열번호 3의 아미노산 서열을 포함하는 메틸전이효소로 코딩되는 것인, 형질전환 벼.
2. The transgenic rice of claim 1, wherein the LOC_Os06g20790 gene is encoded by a methyltransferase comprising the amino acid sequence of SEQ ID NO: 3.
삭제delete 제1항에 있어서, 상기 벼는 동진벼인 형질전환 벼.
The transgenic rice plant according to claim 1, wherein the rice is Dongjin rice.
삭제delete 제1항에 있어서, 상기 발현 유도 서열은 서열번호 4의 염기서열로 이루어진 것인, 형질전환 벼.
2. The transformed rice according to claim 1, wherein the expression inducing sequence consists of the nucleotide sequence of SEQ ID NO: 4.
삭제delete 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 발현 유도 서열을 포함하는, 벼의 흰잎 마름병 저항성 증진용 재조합 벡터.
A recombinant vector for promoting resistance to blight of blight of rice blast in rice comprising an expression inducing sequence for enhancing the activity of LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.
제9항에 있어서, 상기 LOC_Os06g20790 유전자는 서열번호 1의 염기서열로 이루어진 것인, 재조합 벡터.
10. The recombinant vector according to claim 9, wherein the LOC_Os06g20790 gene comprises the nucleotide sequence of SEQ ID NO: 1.
제9항에 있어서, 상기 LOC_Os06g20790 유전자는 서열번호 3의 아미노산 서열을 포함하는 메틸전이효소로 코딩되는 것인, 재조합 벡터.
10. The recombinant vector according to claim 9, wherein the LOC_Os06g20790 gene is encoded by a methyltransferase comprising the amino acid sequence of SEQ ID NO: 3.
제9항에 있어서, 상기 발현 유도 서열은 서열번호 4의 염기서열로 이루어진 것인, 재조합 벡터.
10. The recombinant vector according to claim 9, wherein the expression inducing sequence comprises the nucleotide sequence of SEQ ID NO: 4.
삭제delete 삭제delete (a) 제9항 내지 제12항 중 어느 한 항의 재조합 벡터가 도입된 아그로박테리움으로 벼를 감염시키는 단계; 및
(b) 상기 (a) 단계에서 감염된 벼의 세포를 캘러스(callus)화하여 형질전환된 벼의 세포를 수득하는 단계를 포함하는,
흰잎 마름병 저항성이 증진된 형질전환 벼의 제조방법.
(a) infecting rice with Agrobacterium to which the recombinant vector of any one of claims 9 to 12 has been introduced; And
(b) callusing cells of infected rice in step (a) to obtain cells of transformed rice,
A method for producing transgenic rice with improved blight resistance to blight.
제15항에 있어서, (c) 상기 (b) 단계에서 제조한 캘러스를 뿌리 및 성체로 분화 유도하는 단계를 추가로 포함하는, 제조방법.
The method according to claim 15, further comprising (c) inducing differentiation of the callus produced in step (b) into root and adult.
삭제delete 삭제delete 메틸전이효소를 코딩하는 서열번호 2의 염기서열을 포함하는 LOC_Os06g20790 유전자의 활성을 강화시키는 단계를 포함하는, 벼의 흰잎 마름병 저항성의 증진방법.
1. A method for promoting resistance to blight of blight of rice blast, comprising the step of enhancing the activity of the LOC_Os06g20790 gene comprising the nucleotide sequence of SEQ ID NO: 2 encoding a methyltransferase.
KR1020140148596A 2014-10-29 2014-10-29 Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same KR101636157B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140148596A KR101636157B1 (en) 2014-10-29 2014-10-29 Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140148596A KR101636157B1 (en) 2014-10-29 2014-10-29 Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same

Publications (2)

Publication Number Publication Date
KR20160052960A KR20160052960A (en) 2016-05-13
KR101636157B1 true KR101636157B1 (en) 2016-07-05

Family

ID=56022904

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140148596A KR101636157B1 (en) 2014-10-29 2014-10-29 Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same

Country Status (1)

Country Link
KR (1) KR101636157B1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
The Plant Journal (2006) 45, 123-132

Also Published As

Publication number Publication date
KR20160052960A (en) 2016-05-13

Similar Documents

Publication Publication Date Title
Čermák et al. High-frequency, precise modification of the tomato genome
CN101405394B (en) D-amino acid selection for soybean
WO2016057515A9 (en) Genetic control of axillary bud growth in tobacco plants
CN111233991B (en) Rice OsNBARC1 protein and application of encoding gene thereof in regulation and control of rice bacterial leaf blight resistance
CN113801891B (en) Construction method and application of beet BvCENH3 gene haploid induction line
CN115894646B (en) OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight
KR101636155B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
CN110592134A (en) Application of SDG40 gene or coding protein thereof
CN112646011A (en) Protein PHD-Finger17 related to plant stress resistance and coding gene and application thereof
KR101640278B1 (en) Kinase gene resistant to a bacterial blight and blast, and the transgenic plant using the same
KR101636160B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
CN115976071B (en) Application of PAP10a gene in regulation and control of rice blast resistance of rice
KR101636157B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
CN107058324B (en) Rice root specific expression promoter POsRO4 and corresponding rice cultivation method
KR101636161B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
KR101636156B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
KR101636158B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
KR101636159B1 (en) Methyltrasnferase gene resistant to a bacterial blight, and the transgenic plant using the same
KR101639102B1 (en) Kinase gene resistant to a bacterial blight, and the transgenic plant using the same
KR102675540B1 (en) Method for producing tomato plant having controlled disease-resistance using gene editing and tomato plant produced by the same method
KR102550308B1 (en) Method for producing genome-edited tomato plant with increased salt tolerance by SlHKT1;2 gene editing and genome-edited tomato plant with increased salt tolerance produced by the same method
CN116535478B (en) Swallow flower MYB4 protein and application thereof in color regulation and control
CN118812681A (en) Protein GmLTPP for regulating and controlling soybean plant type and improving yield, and coding gene and application thereof
CN117384917A (en) Tobacco pectin methylesterase inhibitor gene NtPMEI and application and method thereof
CN118620049A (en) Protein GmZG2 for regulating and controlling soybean plant type and improving yield, and coding gene and application thereof

Legal Events

Date Code Title Description
AMND Amendment
E601 Decision to refuse application
X091 Application refused [patent]
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20190402

Year of fee payment: 4