KR101609946B1 - Foot and mouth disease vectored vaccine - Google Patents

Abstract

The present invention relates to an adenovirus vector-based foot-and-mouth disease serotype vaccine. According to the present invention, it is possible to produce a vaccine which expresses a defense antigen of foot-and-mouth disease virus but does not include foot-and-mouth disease virus RNA, thereby improving safety and improving safety. The vaccine of the present invention does not require the use of an oil adjuvant, thereby avoiding tremendous economic losses due to disposal of the pork neck muscles.

Description

Foot and mouth disease vectored vaccine < RTI ID = 0.0 >

The present invention relates to foot-and-mouth disease vector vaccines using adenoviral vectors.

Foot-and-mouth disease (FMD) is a livestock epidemic that affects the right wing. Infected foot-and-mouth disease causes fever, blisters due to blisters and blisters in the feet and mouth, and bullous lesions in the mouth, tongue, nose, feet and nipple. Foot-and-mouth disease virus (FMDV) is replicated within 12 hours of the host's pharynx, reaching the lungs within 48 hours and subsequently entering the bloodstream, causing lesions in the mouth and feet, direct contact, Lt; / RTI > In some cases, air can also be propagated. It is generally known that air infections occur within the housing within 14 days after the virus enters the farm, followed by air transmission to the surrounding farms. Recent studies have shown that swine plays a major role in disease transmission as a major factor in this disease, as a single infected pig releases 3,000 cows in a short time (Moraes et al., 2002 ).

FMDV is one of the viruses with the highest antigenic variability because of the lack of 3D pol gene proofreading and post-replication repair activity in the replication process. Therefore, the FMD vaccine has seven serotypes including O, A, C, SAT-1, SAT-2, SAT-3 and Asia-1 type and has about 200 subtypes. Of these, type O is the most prevalent in China and its neighboring countries. In Taiwan, too, foot-and-mouth disease viruses that infect only pigs are also prevalent. In addition, foot-and-mouth disease virus has the characteristic that cross-protection does not occur between different serotypes.

As a foot-and-mouth disease vaccine, live monsoon has not been used well, and Sodok Vaccine is now widely used worldwide. Domestic use of Sodok Vaccine of foreign pharmaceutical company exclusively supplied after the foot-and-mouth disease occurred on Nov. 28, 2010, however, this vaccine has a high unit price, which is a burden for farmers. In addition, the Sadox vaccine is generally poor in immunogenicity and uses oil adjuvant, resulting in the side effects of non-purulent lesions in the neck muscles below the vaccine-infused root. However, since this area is a particularly high value for food, it causes a total of 100 billion won in damages per year in Korea. The inoculation protocol of Sadok Vaccine currently in use in Korea is to vaccinate sows at 6-month intervals, and to vaccinate the pigs once the maternal antibody has disappeared. However, due to the high price of existing vaccines and side effects caused by the neck muscles, the outbreak of foot and mouth disease has been avoided and the domestic foot and mouth defense line has been broken down. Therefore, the development of foot-and-mouth disease vaccine, which has improved these disadvantages, is in desperate condition.

The present invention relates to an adenovirus vector-based foot-and-mouth disease virus O-type vaccine in which a recombinant foot-and-mouth disease protective antigen gene is inserted.

In order to achieve the above object, there is provided a recombinant adenovirus vector comprising the foot-and-mouth disease virus P1-2A-3C recombination gene represented by SEQ ID NO: 1.

In the foot-and-mouth disease virus P1-2A-3C recombinant gene described in SEQ ID NO: 1, the capsid protein of FMDV is expressed as a polyprotein by P1 and cleaved by 3C. Proteins expressed by the P1 gene are not infectious, but they form strong particles similar to whole virus particles and exhibit strong immunogenicity. The amino acid sequence of the protein encoded by the modified foot-and-mouth virus gene described in SEQ ID NO: 1 is shown in SEQ ID NO: 2.

In the present invention, the adenovirus vector may be an adenovirus vector corresponding to serotype 5. However, the serotype of the adenoviral vector is not limited thereto.

In addition, the present invention provides a foot-and-mouth vaccine composition comprising, as an active ingredient, a recombinant adenovirus vector comprising the foot-and-mouth disease virus P1-2A-3C recombination gene described in SEQ ID NO: The foot-and-mouth disease serotype O type includes O1 Manisa strain, Andong strain occurring in Korea, and foot-and-mouth mutants showing homology to VP1 of the mutant strain. However, the types of mutants are not limited thereto, and all mutants that can be protected by the present invention are included.

The present invention provides a foot-and-mouth vaccine composition comprising a recombinant adenovirus vector comprising a foot-and-mouth disease virus P1-2A-3C recombinant gene described in SEQ ID NO: 1 and Hydroxypropyl Betacyclodextrin. The hydroxypropylbetacyclodextrin is a polymer that was conventionally used as a solubilizing agent. The inventors of the present invention have confirmed that when used in foot-and-mouth disease vaccines against foot-and-mouth disease, side effects such as oil deposits and purulent lesions are not caused.

&Quot; Adjuvant " in a vaccine means an additive substance for enhancing the immune response. The oil adjuvant, which was conventionally used in foot and mouth vaccines, served as a principle to delay the release of antigens and to induce a kind of stimulation at the inoculation site so that the immune cells were called. However, the hydroxypropylbetacyclodextrin adjuvant contained in the vaccine composition of the present invention plays a role in helping the delivery of the virus antigen to be recognized by the dendritic cells by causing the virus antigen to be appropriately dispersed in the vaccine composition without forming a particle, Therefore, the immune response is enhanced by a mechanism different from that of the conventional oil adjuvant. Therefore, unlike conventional oil oesulfame, which causes side effects such as purulent lesions at the inoculation site, it does not exhibit such side effects while enhancing the immune response.

In one embodiment of the present invention, the composition may contain 10 to 20% (w / v), preferably 13 to 17% (w / v) of hydroxypropyl betacyclodextrin. However, the content of hydroxypropylbetacyclodextrin is not limited thereto.

In one embodiment of the invention, the composition comprises 10 ⁵ TCID50 / ㎖ to 10 ¹⁰ TCID50 / ㎖, preferably 10 ⁷ TCID50 / ㎖ to 10 ¹⁰ TCID50 / ㎖, more preferably 10 ⁹ The recombinant of TCID50 / ㎖ Adenovirus vectors. The composition may include hydroxypropyl betacyclodextrin at 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20% (w / v). The composition is prepared by dissolving the hydroxypropyl betacyclodextrin at 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7,10.8,10.9,11.0,11.1,11.2,11.3,11.4,11.5,11.6,11.7,11.8,11.9,12.0, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14.0, 14.1, 14.2, 14.3, 14.4, 14.5, 13.2, 13.3, 14.6, 14.7, 14.8, 14.9, 15.0, 15.1, 15.2, 15.3, 15.4, 15.5, 15.6, 15.7, 15.8, 15.9, 16.0, 16.1, 16.2, 16.3, 16.4, 16.5, 16.6, 16.7, 16.8, 16.9, 17.0, 17.1, 17.2, 17.3, 17.4, 17.5, 17.6, 17.7, 17.8, 17.9, 18.0, 18.1, 18.2, 18.3, 18.4, 18.5, 18.6, 18.7, 18.8, 18.9, 19.0, 19.1, 19.2, 19.3, 19.4, 19.5, 19.6, 19.7, 19.8, 19.9, 20% (w / v). However, the content is not limited thereto, and may be varied depending on the subject, serotype of foot-and-mouth disease, and various other factors.

The vaccine of the present invention may be an animal, preferably an animal of the goat, more preferably a cow or a pig. Most preferably for pigs. However, the type of animal is not limited thereto, and it can be used for all animals infected with foot-and-mouth disease.

The present invention provides a cell comprising a recombinant adenovirus vector comprising the foot-and-mouth disease virus P1-2A-3C recombination gene set forth in SEQ ID NO: 1. The cell may be any competent cell, and may be, for example, an E. Coli cell. The cell may be a cell with accession number KCCM11561P.

The present invention also provides a method for producing a foot-and-mouth disease vaccine composition using cells comprising a recombinant adenovirus vector comprising the foot-and-mouth disease virus P1-2A-3C recombination gene described in SEQ ID NO: 1.

1) synthesizing a gene consisting of genes corresponding to parts (VP2, VP3, VP4), 2A, and 3C except for VP1 at P1 in GenBank accession No. HM229661;

2) Synthesizing a gene whose nucleotide sequence is adjusted (codon optimized) so that amino acid substitution of A4T, Q28H, T56I, S134C, T140P, A142T, A158P, D197S and L212F occurs in the gene corresponding to VP1 of foot-and-mouth disease virus O1 Manisa step; And

3) a method for producing P1-2A-3C recombinant gene of foot-and-mouth disease virus according to SEQ ID NO: 1, comprising the step of ligating the gene synthesized in step 2) and the gene synthesized in step 1) do.

1) inserting the foot-and-mouth disease virus P1-2A-3C recombinant gene described in SEQ ID NO: 1 into an adenovirus vector; and

2) mixing the vector with a hydroxypropyl betacyclodextrin.

In one embodiment of the present invention, after performing the step 1) in the above method, the step of concentrating the vector may be performed, and then the step 2) may be performed.

In one embodiment of the present invention, the step of concentrating the vector comprises performing at least one of the following steps i) to iv):

I) tissue culture said vector;

Ii) centrifuging the vector to precipitate, freezing and thawing;

Iii) concentrating the vector with ammonium sulfate; and

Iv) concentrating the vector using the 1 MDS filter method.

The vector may be concentrated by performing one or more steps in steps i) to iv) above. As an example, after performing the step i), the step ii) may be performed, and then the step iv) may be performed. The steps i), ii), and iv) may be performed sequentially.

The steps i) to iv) may be performed one or more times each. As an example, step iv) may be performed one to five times.

The tissue culture of step (i) may be a flat tissue culture or a rotary tissue culture.

The ammonium sulfate in step iii) may be diluted with 10 to 60%, preferably 40% (w / v). However, the concentration method is not limited to those mentioned above.

According to the present invention, it is possible to produce a vaccine which expresses a defense antigen of foot-and-mouth disease virus but does not include foot-and-mouth disease virus RNA, thereby improving safety and improving safety. The vaccine of the present invention does not require the use of an oil adjuvant, thereby avoiding tremendous economic losses due to disposal of the pork neck muscles.

FIG. 1 is a diagram showing that a structural protein of foot-and-mouth disease virus is formed in a Hex cell line transfected with Ad5FMD by immunofluorescence staining.
FIG. 2 is a graph showing the effect of the content of hydroxypropylbetacyclodextrin in the foot-and-mouth disease vaccine composition containing Ad5FMD of the present invention.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

Example  1. Recombination Adenovirus  Vector production

1-1. P1 -2A-3C gene fragment production

FMDV is a non-enveloped, icosahedral capsid virus, which is found in Pricornaviridae And belongs to the genus Aphthovirus . The genome of FMDV is a compact positive-strand RNA and is approximately 8300 nucleotides in length and consists of one ORF. The genome of FMDV is translated into a single ORF to generate a precursor polyprotein, which is cleaved by the protease encoded by the virus into the intermediate and mature structural proteins and non-structural proteins. Based on the original cleavage product, the genomic ORF is divided into four regions, each containing L, P1, P2 and P3 regions. The P1 region of the genome encodes four viral structural proteins (VP4, VP2, VP3 and VP1). The P1 region is followed by the P2 region, which encodes the three virus-free structural proteins 2A, 2B and 2C. The P3 region encodes the nonstructural protein 3A, three copies of VPg (3B1, 3B2 and 3B3), 3Cpro and 3Dpol . Protease 3C plays an important role in the cleavage of viral structural proteins and enables proper folding and viral assembly in infected cells (Belsham, 1993; GRUBMAN et al., 1995; Pariente et al., 2005).

The remainder of P1 except for VP1, 2A, and 3C genes were synthesized from Hong Kong mutant of FMDV serotype O (Genbank accession No HM229661).

FMDV O1 Synthesized in 639 bases corresponding to VP1 in Manisa state by substituting 9 amino acids for easy expression in pigs (A4T, Q28H, T56I, S134C, T140P, A142T, A158P D197S, L212F) Respectively.

The P1-2A-3C gene (SEQ ID NO: 1) synthesized by ligating the genes synthesized above was cloned into pCDNA. Using 5'- GTAACTATAACGGTC ATGGGCGCCGGCCAATC CAGCCCCG-3 (SEQ ID NO: 4) (SEQ ID NO: 3), and 5'- ATTACCTCTTTCTCC TCATTCATTCAGGCGCGGGTC CTTG-3 as a reverse primer in primer-fusion ', including in-fusion primer of 15base to Forward primer PCR was carried out according to the conditions shown in Table 1 below.

[Table 1]

1-2. P1 -2A-3C Adenovirus  Introduction into vectors

The P1-2A-3C recombinant gene prepared in 1-1 above was ligated to Adeno X liner vector in AdenoX Adenoviral 3 system purchased from Clontech. The Adeno X liner vector has an in-fusion site of 15 bp at each end, so when in-fusion with P1-2A-3C, it becomes a plasmid in the form of a cycler DNA. This plasmid DNA was named Ad5FMD (adenovirus serotype 5 vector inserted with P1-2A-3C gene of FMDV). The Ad5FMD was transformed into competent cells purchased from Contech and mass-produced. Plasmid DNA was extracted from the proliferating competent cells and cut into a linear form by cutting with PacI. This linear DNA was purified using CalPhos ^TM from Clontech Adeno X 293 cells were transfected using a Mammalian Transfection kit.

The transfected cells were deposited at the Korean Microorganism Conservation Center on Aug. 19, 201 and received the accession number KCCM11561P.

Example  2. Identification of Transformation

Ad5FMD prepared in Example 1 was transfected into a monolayer Hex cell line at 0.001 TCID50 / ml on a plate. The transfected cell line was fixed with an alcohol: acetone solution for 3 hours to 48 hours after infection, monoclonal antibody specific for FMDV structural protein (VP1 protein) was treated on a fixed plate, and FITC-labeled anti-mouse anti- -IgG for 30 min to immunostain. The reaction solution was then removed, washed three times with PBS, and observed under a dark field microscope.

The results are shown in Fig. 1 and Table 2 below. In Table 2, fluorescence is observed up to 12 hours after transfection.

[Table 2]

On the other hand, the transfection rate of the adenovirus in the 0.001 TCID50 / ml transfected Hex cell line exhibited a potency from 2 to 10 ⁸ TCID50. Thus, the adenovirus was kept as an immune master seed.

Example  3. Ad5FMD Culturing conditions and concentration

Known methods for transfecting adenovirus vectors include flat tissue culture and rotary tissue culture. It is also known to concentrate the adenoviral vector by centrifugation followed by repeated freezing and thawing.

When 0.001 TCID50 / ml of Ad5MD was transfected into a Hex cell line by plastic flat tissue culture, a titer of 10 ^7.0 TCID50 / ml was observed 3-4 days after infection. In addition, the activity of 10 ^7.25 TCID50 / ㎖ was obtained by the rotary culture method. Tissue culture supernatants were centrifuged at 3,000 rpm for 30 min. After the cells were settled and frozen and thawed 3 times, Ad5MD could be concentrated to 10 ^9.4 TCID50 / ㎖.

The following procedure was performed to more efficiently concentrate the concentrated culture through centrifugation, freezing and thawing of the cells. In other words, since the concentration efficiency would be lowered if only the cells were used and the supernatant was removed, the virus remaining in the supernatant after the supernatant was concentrated. To this end, a concentration method using a previously known supernatant concentration method (40% ammonium sulfate) (purchased from Sigma Aldrich) and a 1MDS filter method (desorption method) (manufactured by 3M Company, purchased from Cenogen Corporation) were applied respectively.

The results are shown in Table 3 below. As shown in Table 3, when the transfected cells were repeatedly frozen and thawed after initial decantation and when the supernatant was subjected to 1MDS filter twice, three times, and four times repeatedly, as compared with the case where ammonium sulfate was applied to the supernatant, It can be seen that the Ad5FMD titer of the supernatant is increasing more and more.

[Table 3]

Example  4. Ad5FMD ≪ RTI ID = 0.0 >

A pharmaceutical grade Hydroxypropyl Betacyclodextrin purchased from Zibo Zimao Trade Co., LTD was included as an adjuvant in the vaccine composition of the present invention. Hydroxypropylbetacyclodextrin corresponds to a polymer that has been conventionally used as a solubilizer.

Viruses have the property of aggregating with each other. Especially, when enriched, viruses tend to aggregate in the form of particles in the order of tens to hundreds. The present inventors confirmed that the hydroxypropylbetacyclodextrin in the foot-and-mouth disease vaccine composition containing Ad5FMD of the present invention excellently performs its role as a dispersant. In addition, the hydroxypropylbeta cyclodextrin also induces Ad5FMD to be attached to pattern recognition receptors (PRRs) of dendritic cells of pigs.

The following experiment was conducted to confirm the mixing ratio of Ad5FMD and hydroxypropylbeta cyclodextrin in the foot-and-mouth disease vaccine composition of the present invention.

A foot-and-mouth vaccine composition comprising Ad5FMD 10 ⁹ TCID50 / ml and hydroxypropyl betacyclodextrin at 10% (w / v) and 20% (w / v), respectively, and 1 ml of the composition After inoculation, the immune response was examined. A composition comprising a foot-and-mouth disease vaccine composition comprising Ad5FMD 10 ⁹ TCID50 / ml as a control and 1 ml of mineral oil (purchased from Seppic) or 1 ml of Ad5FMD 10 ⁹ TCID 50 / ml and PBS was prepared, And then the immune response was examined. The pigs correspond to piglets weaned from Darby's breeding stocks.

The results are shown in Fig. The abscissa of FIG. 2 represents time (week) after inoculation, and the ordinate represents neutralizing antibody. In FIG. 2, the immune response was better in the early stage when 20% (w / v) of hydroxypropylbetacyclodextrin was included, but the difference was not significant at the fourth day after inoculation.

Example  5. ELISA Antibody production using

Fourteen piglets were purchased from Dabi breeding center and transferred to laboratory animal room of Konkuk University for 4 weeks. The piglet had a maternal antibody in the body because the sow was inoculated with Mary's 6PD50 Zadox foot-and-mouth vaccine. Therefore, weaning pigs were purchased for 4 weeks to eliminate the maternal antibody.

The Ad5FMD foot-and-mouth vaccine composition was prepared by mixing 10 ⁹ TCID50 / ml Ad5FMD with 10% or 20% hydroxypropyl betacyclodextrin, respectively. The composition was inoculated at 1 ㎖ into the goat part of the 4th day of weaning.

In the positive control group, 1 ml of the 6PD50 sadox vaccine (Aftofor), a foot-and-mouth vaccine of Merial Animal Health Ltd. (hereinafter "Merial"), which is currently used in Korea, was inoculated into the goat and 1 ml of PBS was inoculated only in the negative control .

Blood was collected from the day of vaccination (day 0) to day 36, and antibody production was confirmed by 3ABC ELISA (PrioCHECK FMDV type O (Prionics AG, Schlieren-Zurich, Swizland)) to determine whether antibodies against FMDV were formed .

The results are shown in Table 4 below. As shown in Table 4, when the Ad5FMD foot-and mouth vaccine composition comprising 20% (w / v) and 10 ⁹ TCID50 / ml was applied, the ELISA antibody was consistently positive from the start of the experiment, Similar to the case of inoculation with the Maryall vaccine. On the other hand, in the negative control group, the ELISA antibody tended to decrease with time.

[Table 4]

Example  6. FMDV Confirmation of protective antibody formation against

Inoculation of Ad5FMD vaccine containing 10 ⁹ TCID50 / ㎖ and 20% (w / v) at 8 weeks of age, when the maternal antibody was lost, in pigs born from sows that had been previously vaccinated with 6PD50 Sadok Vaccine The degree of defensive antibody formation was confirmed. From the piglets inoculated with 1 ml of the vaccine into the goat portion, blood was collected from the date shown in Table 4 below, and the serum was separated and subjected to a neutralization test in the shielding laboratory of the Ministry of Agriculture, Forestry and Fisheries Quarantine Division, Foot and Mouth Disease Department. The neutralization test was performed by mixing 1000 μl of O1 Manisa FMDV 100 TCID 50 / ml with 100 μl of stair-diluted serum in duplicate and incubating for 1 hour in a 37 ° C incubator. After 3 to 4 days of inoculation with IBRS2 monolayers, Respectively. This was repeated three times and the mean value was finally determined as neutralizing antibody value. When the value was 45 times or more, it was judged as positive. On the other hand, the positive control group and the negative control group are the same as in Example 5 above.

The results are shown in Table 5 below. In Table 5, when the Ad5FMD vaccine was inoculated, the positive rate of the neutralizing antibody became 100% after 3 weeks.

[Table 5]

Example  7. Korean separatist Andong, Korean isolate Andong strain ) Crossed guard rate

1000 μl of FMDV 100 TCID 50 / ml was mixed with the same amount of 100 μl of serially diluted sera in duplicate with 120 μl of FMDV 100 (Genbank Accession No. KC503937) androgenic isolate O-Andong / SKR / 2010 The cells were allowed to sit for a period of time and then inoculated onto IBRS2 monolayer cells and observed for CPE formation after 3-4 days. This was repeated three times and the mean value was finally determined as the neutralizing antibody value. When the value was 64 times or more, it was judged as positive. On the other hand, the positive control group and the negative control group are the same as in Example 5 above.

As shown in Table 6 below, it can be seen that the antibody titer is 64 times or more higher in the Ad5FMD foot-and-mouth disease vaccine composition inoculation group.

[Table 6]

Example  8. Viremia , Clinical symptoms, More than six  Confirmation of occurrence

In the above example, the piglets inoculated with the Ad5FMD foot-and-mouth disease vaccine composition were collected by CPR every 3 days for 5 weeks, but no positive individuals could be observed. The incidence of nonsuppuratous inflammation in the postvaccinated site was also investigated. No viraemia or other clinical symptoms were seen.

Korea Microorganism Conservation Center (overseas) KCCM11561P 20140819

<110> Konkuk University Industrial Cooperation Corp <120> Foot and mouth disease vectored vaccine <130> P14-082-KKU <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 3420 <212> DNA <213> Artificial Sequence <220> <223> FMDV P1-2A-3C <400> 1 atgggcgccg gccaatccag ccccgcgact gggtcacaga atcaatcagg caacactggg 60 agcattatca ataattacta catgcagcag taccagaaca gcatggatac ccaacttgga 120 gacaacgcta ttagtggagg ctccaatgag ggatccacgg acacaacatc cacccacaca 180 acaaacactc agaacaatga ctggttttca aagctggcct cctccgcttt cagcggtctc 240 ttcggcgctc ttctagcaga caagaagacc gaggaaacca ctcttctcga ggaccgcatc 300 ctcaccaccc gaaacggaca tacgacctct accacccaga gttccgttgg cgtaacctac 360 gggtacgcaa cagctgagga ctttgtgagc gggccaaaca cctctggact cgaaaccaga 420 gttgtccagg ctgaacggtt ctttaaaacc cacctgttcg actgggtcac cagtgaccct 480 ttcggacggt gctacctgtt ggagctccca acggaccata aaggggtcta tggcagcctg 540 accgacagtt atgcctacat gagaaacggt tgggacgttg aagtcacagc agtggggaac 600 cagtttaatg gaggctgttt gctggtggca atggtgcctg agctttgttc tatcgacaag 660 agagagctgt accagcttac gctgttcccc caccagttca tcaaccccag gactaacatg 720 acggcccata tcacggtgcc ctttgttggc gtcaaccgat acgatcagta taaggtacat 780 aagccgtgga ccctcgtggt catggttgtg gccccactga ctgtaaatac cgaaggcgcc 840 ccgcagatca aggtgtatgc caacatcgcc cccaccaacg tgcacgtcgc aggcgaactc 900 ccttctaaag aggggatatt cccagtggcc tgtagcgatg gctacggtgg tctagtgacc 960 actgatccaa agacggctga ccccgtctat gggaaggtgt tcaacccacc acgcaacatg 1020 ttacctgggc ggtttaccaa tctcctggac gtggctgagg cgtgcccgac gttcctgcac 1080 ttcgatggtg atgtacccta tgtgaccact aagaccgatt ccgacagggt gctcgcccag 1140 tttgacttgt ctctggcagc aaaacatatg agcaacacct tcttggccgg ccttgcccag 1200 tattatacac agtacagcgg caccatcaac ctgcacttca tgttcacagg acccactgac 1260 gctaaagcgc gttatatgat tgcatacgca cctcctggca tggagccgcc caaaacacct 1320 gaggcggccg ctcactgcat tcacgcagag tgggacacag ggctgaattc aaagttcact 1380 ttttcaatcc cctaccttag cgcggccgat tacgcctata ccgcttctga tgctgctgag 1440 acgacaaatg tgcaaggatg ggtctgctta ttccagataa ctcacgggaa agctgacgga 1500 gatgctctgg tcgttctagc tagtgctggc aaggattttg agctgaggct gcctgtggat 1560 gctcggacac agactacatc gacaggtgaa tccgcggatc ccgtgactgc caccgttgaa 1620 aattacggtg gcgaaacaca agtccagagg cgccaccata ctgatgtctc gttcatattg 1680 gatagatttg tgaaggtcac accaaaagac cagattaatg tgctggacct gatgcagatc 1740 cctgcccata ccctggtagg ggcgctcctc cgtactgcca catactattt cgctgatctg 1800 gaggtcgcag tgaagcacga gggggatctc acctgggtgc cgaatggggc tcccgaggca 1860 gccttggaca acaccaccaa cccaacggcg tatcacaagg cgccactcac tcggctggca 1920 ctgccctaca ctgcaccaca tagggttctt gctacggtgt ataacggcaa ctgcaagtac 1980 ggcgaggggc ccctgaccaa cgtgcgcggt gatctccaag tgttggctca gaaggcggca 2040 aggccactgc ctacctcttt caattacggc gccataaagg ccactcgggt gacagaactg 2100 ctgtaccgga tgaagagggc cgagacatac tgtcctcggc ctcttttggc tgttcaccca 2160 tcggaggcta gacacaagca gaagattgtg gcacctgtga aacagttttt gaatttcgat 2220 ttacttaagt tagctggaga tgtggaatcc aaccctgggc cctttttttt ctctgatgta 2280 aggagcaatt tcacgaagtt ggtggaaaca gtcaaccaga tgcaggagga catgtcaaca 2340 aaacatggac ccgactttaa tcggttggtg tccgcttttg aggaattggc cactggggtg 2400 aaggccatca ggaccggtct ggatgaggcc aaaccctggt acaagctcat caaatggtta 2460 ctgagccgcc tgagctgcat ggctgctgtg ggaccttacg ccggtccaat ggaaagacag 2520 aaaccactaa aagttaaagc gaaagccccg gtggtcaagg aaggacctta tgagggaccg 2580 gtgaagaaac cagtcgcttt gaaagtgaaa gcaaagaatt tgattgtcac tgagagtggc 2640 gcccccccca ccgatttgca aaaaatggtc atgggcaaca ccaagccagt ggagctaatc 2700 cttgacggaa agacggtagc catctgttgt gctaccggag tgtttggtac tgcctacctc 2760 gtccctaggc atctgttcgc tgagaagtac gacaaaatta tgttggatgg gcgagccatg 2820 acagacagtg actatcgggt ttttgaattt gagattaaag taaaaggaca ggacatgctc 2880 agcgacgccg cactcatggt gctgcacaga ggcaatcgcg tgcgagacat cacgaaacac 2940 tttcgtgacg tagcaagaat gaagaaaggc acccccgtcg tcggcgtgat caacaacgct 3000 gacgtcggga gactgatctt ctctggtgaa gcccttacat ataaggacat tgtggtgtgc 3060 atggatggcg ataccatgcc gggcctattc gcctataagg ccgccaccaa ggctggctac 3120 tgtggcggcg ccgtccttgc aaaagacggg gccgacacat tcatcgttgg cactcacagc 3180 gctggtggca atggtgttgg atattgctca tgcgtttccc gatccatgct gctgaagatg 3240 aaggcacaca tcgaccccga accacaccac gaaggattga tagttgatac cagagatgtc 3300 gaggagcgcg tgcatgtcat gcgcaaaaca aagctcgccc ccaccgtggc acatggagtg 3360 ttcaaccctg agttcgggcc tgccgccttg agcaacaagg acccgcgcct gaatgaatga 3420                                                                         3420 <210> 2 <211> 1140 <212> PRT <213> Artificial Sequence <220> <223> FMDV P1-2A-3C protein <400> 2 Met Gly Ala Gly Gln Ser Ser Pro Ala Thr Gly Ser Gln Asn Gln Ser   1 5 10 15 Gly Asn Thr Gly Ser Ile Ile Asn Asn Tyr Tyr Met Gln Gln Tyr Gln              20 25 30 Asn Ser Met Asp Thr Gln Leu Gly Asp Asn Ala Ile Ser Gly Gly Ser          35 40 45 Asn Glu Gly Ser Thr Asp Thr Thr Ser Thr His Thr Thr Asn Thr Gln      50 55 60 Asn Asn Trp Phe Ser Lys Leu Ala Ser Ser Ala Phe Ser Gly Leu  65 70 75 80 Phe Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu                  85 90 95 Glu Asp Arg Ile Leu Thr Thr Arg Asn Gly His Thr Thr Ser Thr Thr             100 105 110 Gln Ser Ser Val Gly Val Thr Tyr Gly Tyr Ala Thr Ala Glu Asp Phe         115 120 125 Val Ser Gly Pro Asn Thr Ser Gly Leu Glu Thr Arg Val Val Gln Ala     130 135 140 Glu Arg Phe Phe Lys Thr His Leu Phe Asp Trp Val Thr Ser Asp Pro 145 150 155 160 Phe Gly Arg Cys Tyr Leu Leu Glu Leu Pro Thr Asp His Lys Gly Val                 165 170 175 Tyr Gly Ser Leu Thr Asp Ser Tyr Ala Tyr Met Arg Asn Gly Trp Asp             180 185 190 Val Glu Val Thr Ala Val Gly Asn Gln Phe Asn Gly Gly Cys Leu Leu         195 200 205 Val Ala Met Val Pro Glu Leu Cys Ser Ile Asp Lys Arg Glu Leu Tyr     210 215 220 Gln Leu Thr Leu Phe Pro His Gln Phe Ile Asn Pro Arg Thr Asn Met 225 230 235 240 Thr Ala His Ile Thr Val Pro Phe Val Gly Val Asn Arg Tyr Asp Gln                 245 250 255 Tyr Lys Val His Lys Pro Trp Thr Leu Val Val Met Val Val Ala Pro             260 265 270 Leu Thr Val Asn Thr Glu Gly Ala Pro Gln Ile Lys Val Tyr Ala Asn         275 280 285 Ile Ala Pro Thr Asn Val His Val Ala Gly Glu Leu Pro Ser Lys Glu     290 295 300 Gly Ile Phe Pro Val Ala Cys Ser Asp Gly Tyr Gly Gly Leu Val Thr 305 310 315 320 Thr Asp Pro Lys Thr Ala Asp Pro Val Tyr Gly Lys Val Phe Asn Pro                 325 330 335 Pro Arg Asn Met Leu Pro Gly Arg Phe Thr Asn Leu Leu Asp Val Ala             340 345 350 Glu Ala Cys Pro Thr Phe Leu His Phe Asp Gly Asp Val Pro Tyr Val         355 360 365 Thr Thr Lys Thr Asp Ser Asp Arg Val Leu Ala Gln Phe Asp Leu Ser     370 375 380 Leu Ala Ala Lys His Met Ser Asn Thr Phe Leu Ala Gly Leu Ala Gln 385 390 395 400 Tyr Tyr Thr Gln Tyr Ser Gly Thr Ile Asn Leu His Phe Met Phe Thr                 405 410 415 Gly Pro Thr Asp Ala Lys Ala Arg Tyr Met Ile Ala Tyr Ala Pro Pro             420 425 430 Gly Met Glu Pro Pro Lys Thr Pro Glu Ala Ala Ala His Cys Ile His         435 440 445 Ala Glu Trp Asp Thr Gly Leu Asn Ser Lys Phe Thr Phe Ser Ile Pro     450 455 460 Tyr Leu Ser Ala Asp Tyr Ala Tyr Thr Ala Ser Asp Ala Ala Glu 465 470 475 480 Thr Asn Val Gln Gly Trp Val Cys Leu Phe Gln Ile Thr His Gly                 485 490 495 Lys Ala Asp Gly Asp Ala Leu Val Val Leu Ala Ser Ala Gly Lys Asp             500 505 510 Phe Glu Leu Arg Leu Pro Val Asp Ala Arg Thr Gln Thr Thr Ser Thr         515 520 525 Gly Glu Ser Ala Asp Pro Val Thr Ala Thr Val Glu Asn Tyr Gly Gly     530 535 540 Glu Thr Gln Val Gln Arg Arg His His Thr Asp Val Ser Phe Ile Leu 545 550 555 560 Asp Arg Phe Val Lys Val Thr Pro Lys Asp Gln Ile Asn Val Leu Asp                 565 570 575 Leu Met Gln Ile Pro Ala His Thr Leu Val Gly Ala Leu Leu Arg Thr             580 585 590 Ala Thr Tyr Tyr Phe Ala Asp Leu Glu Val Ala Val Lys His Glu Gly         595 600 605 Asp Leu Thr Trp Val Pro Asn Gly Ala Pro Glu Ala Ala Leu Asp Asn     610 615 620 Thr Thr Asn Pro Thr Ala Tyr His Lys Ala Pro Leu Thr Arg Leu Ala 625 630 635 640 Leu Pro Tyr Thr Ala Pro His Arg Val Leu Ala Thr Val Tyr Asn Gly                 645 650 655 Asn Cys Lys Tyr Gly Glu Gly Pro Leu Thr Asn Val Arg Gly Asp Leu             660 665 670 Gln Val Leu Ala Gln Lys Ala Ala Arg Pro Leu Pro Thr Ser Phe Asn         675 680 685 Tyr Gly Ala Ile Lys Ala Thr Arg Val Thr Glu Leu Leu Tyr Arg Met     690 695 700 Lys Arg Ala Glu Thr Tyr Cys Pro Arg Pro Leu Leu Ala Val His Pro 705 710 715 720 Ser Glu Ala Arg His Lys Gln Lys Ile Val Ala Pro Val Lys Gln Phe                 725 730 735 Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu Ser Asn Pro             740 745 750 Gly Pro Phe Phe Phe Ser Asp Val Arg Ser Asn Phe Thr Lys Leu Val         755 760 765 Glu Thr Val Asn Gln Met Gln Glu Asp Met Ser Thr Lys His Gly Pro     770 775 780 Asp Phe Asn Arg Leu Val Ser Ala Phe Glu Glu Leu Ala Thr Gly Val 785 790 795 800 Lys Ala Ile Arg Thr Gly Leu Asp Glu Ala Lys Pro Trp Tyr Lys Leu                 805 810 815 Ile Lys Trp Leu Leu Ser Arg Leu Ser Cys Met Ala Ala Val Gly Pro             820 825 830 Tyr Ala Gly Pro Met Glu Arg Gln Lys Pro Leu Lys Val Lys Ala Lys         835 840 845 Ala Pro Val Val Lys Glu Gly Pro Tyr Glu Gly Pro Val Lys Lys Pro     850 855 860 Val Ala Leu Lys Val Lys Ala Lys Asn Leu Ile Val Thr Glu Ser Gly 865 870 875 880 Ala Pro Pro Thr Asp Leu Gln Lys Met Val Met Gly Asn Thr Lys Pro                 885 890 895 Val Glu Leu Ile Leu Asp Gly Lys Thr Val Ala Ile Cys Cys Ala Thr             900 905 910 Gly Val Phe Gly Thr Ala Tyr Leu Val Pro Arg His Leu Phe Ala Glu         915 920 925 Lys Tyr Asp Lys Ile Met Leu Asp Gly Arg Ala Met Thr Asp Ser Asp     930 935 940 Tyr Arg Val Phe Glu Phe Glu Ile Lys Val Lys Gly Gln Asp Met Leu 945 950 955 960 Ser Asp Ala Ala Leu Met Val Leu His Arg Gly Asn Arg Val Arg Asp                 965 970 975 Ile Thr Lys His Phe Arg Asp Val Ala Arg Met Lys Lys Gly Thr Pro             980 985 990 Val Val Gly Val Ile Asn Asn Ala Asp Val Gly Arg Leu Ile Phe Ser         995 1000 1005 Gly Glu Ala Leu Thr Tyr Lys Asp Ile Val Val Cys Met Asp Gly Asp    1010 1015 1020 Thr Met Pro Gly Leu Phe Ala Tyr Lys Ala Ala Thr Lys Ala Gly Tyr 1025 1030 1035 1040 Cys Gly Gly Ala Val Leu Ala Lys Asp Gly Ala Asp Thr Phe Ile Val                1045 1050 1055 Gly Thr His Ser Ala Gly Gly Asn Gly Val Gly Tyr Cys Ser Cys Val            1060 1065 1070 Ser Arg Ser Met Leu Leu Lys Met Lys Ala His Ile Asp Pro Glu Pro        1075 1080 1085 His His Glu Gly Leu Ile Val Asp Thr Arg Asp Val Glu Glu Arg Val    1090 1095 1100 His Val Met Arg Lys Thr Lys Leu Ala Pro Thr Val Ala His Gly Val 1105 1110 1115 1120 Phe Asn Pro Glu Phe Gly Pro Ala Ala Leu Ser Asn Lys Asp Pro Arg                1125 1130 1135 Leu Asn Glu ***            1140 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 gtaactataa cggtcatggg cgccggccaa tccagccccg 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 attacctctt tctcctcatt cattcaggcg cgggtccttg 40

Claims (15)

A recombinant adenovirus vector comprising a foot-and-mouth disease virus P1-2A-3C recombinant gene represented by SEQ ID NO: 1. A recombinant adenovirus vector comprising a foot-and-mouth disease virus P1-2A-3C recombinant gene represented by SEQ ID NO: 1 as an active ingredient. A recombinant adenovirus vector comprising a foot-and-mouth disease virus P1-2A-3C recombinant gene represented by SEQ ID NO: 1; and hydroxypropyl betacyclodextrin. 4. The composition of claim 3, wherein the composition comprises 10-20% (w / v) of hydroxypropyl betacyclodextrin. The method of claim 4, wherein the composition is the recombinant adenoviral vector 10 ⁸ TCID50 / ㎖ - composition comprising ¹⁰ 10 TCID50 / ㎖. 6. The composition according to any one of claims 2 to 5, wherein the composition is for artiodactyla. 7. The composition of claim 6, wherein the vaccine composition is bovine or porcine. 8. The composition of claim 7, wherein said vaccine composition is for swine. A cell comprising a recombinant adenovirus vector comprising the foot-and-mouth disease virus P1-2A-3C recombinant gene set forth in SEQ ID NO: 1. 10. The cell of claim 9, wherein the cell is deposited under accession number KCCM11561P. 10. A method for producing a foot-and-mouth disease vaccine composition using the cells of claim 9 or 10. 1) synthesizing a gene consisting of the parts of P1, VP1, 2A, and 3C genes in P1 from GenBank accession No. HM229661;
2) synthesizing a gene whose nucleotide sequence is adjusted so that amino acid substitution of A4T, Q28H, T56I, S134C, T140P, A142T, A158P, D197S and L212F occurs in the VP1 gene of foot-and-mouth disease virus O1 Manisa; And
3) A method for producing the recombinant P1-2A-3C gene of foot-and-mouth disease virus according to SEQ ID NO: 1, which comprises ligating the gene synthesized in the step 2) and the gene synthesized in the step 1). 1) inserting the foot-and-mouth disease virus P1-2A-3C recombinant gene described in SEQ ID NO: 1 into an adenovirus vector; and
2) mixing the vector with hydroxypropylbetacyclodextrin. &Lt; RTI ID = 0.0 &gt; 2. &lt; / RTI &gt; 14. The method of claim 13, wherein after performing step 1), the step of concentrating the vector is performed, and then step 2) is performed. delete

Images