CN112876570A

CN112876570A - African swine fever virus vaccine and preparation method thereof

Info

Publication number: CN112876570A
Application number: CN202110178173.2A
Authority: CN
Inventors: 张志芳; 李轶女; 高新桃; 刘兴健; 易咏竹; 张伟业; 曾振; 王海宁
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2021-02-09
Filing date: 2021-02-09
Publication date: 2021-06-01
Anticipated expiration: 2041-02-09
Also published as: CN112876570B

Abstract

The invention discloses an African swine fever vaccine and a preparation method thereof. According to the invention, the African swine fever virus structural proteins P72, P30, P54 or CD2v-AC are respectively displayed on the surface of the self-assembled ferritin cage structure, so that the humoral immunity efficacy and width of the vaccine are improved, and the immunogenicity of the African swine fever virus structural proteins is improved. The invention also recombines the structural proteins P30, P54 and CD2v to obtain recombinant proteins, and connects the recombinant proteins with ubiquitin to obtain two recombinant proteins, thereby further improving the cellular immune effect of the structural protein of the African swine fever virus and providing better immune protection for animals. The invention also provides a method for preparing the recombinant protein or the African swine fever vaccine. The African swine fever vaccine provided by the invention can initiate a wide-neutralizing anti-African swine fever antibody, not only improves the immune efficacy, but also expands the immune range, provides effective immune protection for virulent infection, and has the potential of becoming a general safe vaccine with multiple protection effects.

Description

African swine fever virus vaccine and preparation method thereof

Technical Field

The invention relates to a swine fever virus vaccine, in particular to an African swine fever virus vaccine based on an African swine fever self-assembly ferritin nano antigen and a preparation method thereof, belonging to the field of African swine fever subunit vaccines.

Background

African Swine Fever (ASF) is a severe infectious disease of pigs caused by African Swine Fever Virus (ASFV), the symptoms are mainly high fever, respiratory disturbance and severe hemorrhage of tissues and organs of the whole body, and the death rate of the patients infected with virulent strains can reach 100 percent. The disease has seriously attacked the pig industry in China since 2018 entered China. The disease course is short, the death rate is high, the harm to the pig industry is huge, the disease is listed as a legal report animal epidemic disease by the world animal health Organization (OIE), and China lists the disease as a type of animal epidemic disease. ASFV is double-strand DNA virus with envelope, the length is 175-193 kb, 151 open reading frames ORFs are provided, about 150-200 proteins are coded, the virus mature particle contains more than 50 main proteins, and the virus has important function in the infection process. Among them, P72 accounts for 1/3 of total amount of virus particles, P72 is the main capsid protein encoded by B646L gene, has conserved sequence and good antigenicity, can produce high titer anti-P72 antibody after infection, and is usually used for serodiagnosis of African swine fever. The CP204L gene is located in the middle stable gene region, the coded phosphoprotein p30 has the function of participating in virus internalization, is an early transcription protein which is continuously expressed from the beginning of virus DNA synthesis to the end of the virus life cycle, has an important function when the virus enters a host cell, and has good antigenicity. P54 along with P30 and P72 represent an ideal set of antigen targets for detection of antibodies to ASFV. It is the product of the viral gene E183L, an envelope protein, located in the inner enveloped virion. Meanwhile, P54 and P30 are jointly involved in binding of viral particles to target cells, and P54 interacts with host proteins, resulting in the transport of virions to the perinuclear region of cells. The CD2v protein is encoded by ASFV EP402R gene, is ASFV late expression protein, exists in the envelope of virion as a transmembrane structural protein, and the extracellular region contains 2 immunoglobulin-like domains. It mediates the binding of red blood cells to infected cells or viral particles, causing the phenomenon of red blood cell adsorption. Studies have shown that recombinant viruses lacking EP402R have delayed viral spread compared to wild-type viruses, although their mortality rate is not reduced, and therefore are strong candidates for deletion vaccines. At present, an effective vaccine for preventing the African swine fever is not developed yet in the world. The research on the interaction mechanism of the African swine fever virus and the host immune system is greatly advanced. However, these vaccines still have the defects of poor safety, failure to provide effective immune protection against virulent challenge, and the like.

The ferritin is similar to a sphere in shape and mainly comprises two parts, namely a protein shell and an iron core rich in iron and phosphorus, wherein the protein shell is of an inner cavity structure formed by 24 subunits in a highly symmetrical mode, and the iron core is of an uneven central core structure formed by more than four thousand iron hydroxide molecules and hundreds of phosphate molecules. The outer diameter of the iron protein shell is about 11-13nm, the inner diameter of the shell is 8-9nm, and the iron core is positioned in the center of the protein shell and has a diameter of about 7-8 nm. In recent years, ferritin cages are used as a diversified nano platform, and can be subjected to surface modification through biological and chemical modification, so that the ferritin cages can be applied to multiple fields. The ferritin shell is self-assembled from 24 ferritin subunits, with each three subunits constituting a trimeric subunit. The N-terminal of ferritin extends to the outer surface, and is easy to carry out gene modification and fuse protein polypeptide. And the ferritin has flexible controllable self-assembly capability, and the self-assembly structure can be controlled by adjusting the size of a construction element and the ionic strength of an assembly system. The ferritin nanoparticles display the antigen, can remarkably enhance the immunogenicity of the antigen, and cause stronger humoral and cellular immune reactions, so ferritin is an ideal nano vaccine platform.

Disclosure of Invention

One of the purposes of the invention is to provide an African swine fever self-assembly ferritin nano-antigen containing fusion protein;

the invention also aims to provide an African swine fever fusion protein antigen;

the invention also aims to provide a method for preparing the African swine fever self-assembly ferritin nano antigen or the African swine fever fusion protein antigen;

the fourth purpose of the invention is to provide an African swine fever vaccine prepared based on the African swine fever self-assembly ferritin nano antigen or the African swine fever fusion protein antigen.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the invention firstly provides an African swine fever self-assembly ferritin nano antigen containing a fusion protein, wherein the fusion protein is selected from a fusion protein obtained by connecting any one of the main capsid protein P72 of the African swine fever virus, the phosphoprotein P30 of the African swine fever virus, the envelope protein P54 of the African swine fever virus or the hemagglutinin protein CD2v-AC of the African swine fever virus with a monomeric ferritin subunit;

preferably, the fusion protein is obtained by connecting any one of African swine fever virus major capsid protein P72, African swine fever virus phosphoprotein P30, African swine fever virus envelope protein P54 or African swine fever virus hemagglutinin protein CD2v-AC with the N end of a monomer ferritin subunit through a connecting peptide SGG;

preferably, the monomeric ferritin subunit is a helicobacter pylori ferritin monomer;

preferably, the African swine fever virus hemagglutinin protein CD2v-AC is a sequence formed by fusing an extracellular domain and an intracellular domain of the African swine fever virus hemagglutinin protein CD2 v.

As a preferred embodiment of the present invention, the fusion protein is selected from any one of the fusion proteins described in the following (1) to (4): (1) the African swine fever virus main capsid protein P72 and the N end of the monomer ferritin subunit are connected through a connecting peptide SGG to obtain a fusion protein, the homologous sequence of the fusion protein is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 5; (2) the African swine fever virus phosphoprotein P30 and the N end of the monomer ferritin subunit are connected through a connecting peptide SGG to obtain a fusion protein, the homologous sequence of the fusion protein is shown as SEQ ID NO.2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6; (3) the African swine fever virus envelope protein P54 and the N end of the monomer ferritin subunit are connected through a connecting peptide SGG to obtain a fusion protein, the homologous sequence of the fusion protein is shown as SEQ ID NO.3, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 7; (4) the African swine fever virus hemagglutinin protein CD2v-AC and the N end of the monomer ferritin subunit are connected through a connecting peptide SGG to obtain a fusion protein, the homologous sequence of the fusion protein is shown as SEQ ID NO.4, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 8.

The invention further provides an African swine fever fusion protein antigen, which comprises a PQ recombinant protein obtained by inserting the sequence of the African swine fever virus phosphoprotein P30 into the recognition enzyme sequence site of Not I in the African swine fever virus envelope protein P54, and an African swine fever fusion protein antigen obtained by connecting the extracellular domain of the African swine fever virus CD2v structural protein at the front end of the PQ recombinant protein; as a preferable specific embodiment of the invention, the amino acid sequence of the homologous sequence of the African swine fever fusion protein antigen is shown as SEQ ID NO.9, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 10.

Preferably, the structural protein of the African swine fever virus CD2v is an extracellular domain sequence of African swine fever virus CD2 v.

The invention further provides an African swine fever fusion protein antigen, which is obtained by connecting the N end of an amino acid sequence shown in SEQ ID NO.9 with the C end of an ubiquitin-linker amino acid sequence; as a preferred embodiment of the invention, the amino acid sequence of the homologous sequence of the fusion protein antigen is shown as SEQ ID NO.11, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 12.

The invention further provides an African swine fever fusion protein antigen, which is obtained by respectively connecting the front end and the rear end of an amino acid sequence shown by SEQ ID NO.9 with

UBITh

1 and 2 amino acid sequences; as a preferred embodiment of the invention, the amino acid sequence of the homologous sequence of the fusion protein antigen is shown as SEQ ID NO.13, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 14.

The invention provides a method for preparing the African swine fever self-assembly ferritin nano antigen containing fusion protein or the African swine fever fusion protein antigen, which comprises the following steps:

expressing the fusion protein coding gene in prokaryotic cells or eukaryotic cells by adopting a prokaryotic expression system or an eukaryotic expression system;

preferably, the fusion protein coding gene is expressed in a silkworm expression system, and the expressed antigen is collected and purified; or the fusion protein coding gene is expressed in an AcMNPV-insect cell eukaryotic expression system, and the expressed antigen is collected and purified;

(II) cloning the fusion protein coding gene to a gene presenting vector to construct a recombinant baculovirus transfer vector presenting exogenous genes to vertebrate cells or individuals, and transfecting silkworm cells with the recombinant baculovirus transfer vector to obtain the recombinant virus.

The invention provides an African swine fever vaccine, which comprises the following components: a prophylactically effective amount of the African swine fever self-assembled ferritin nano-antigen comprising the fusion protein and a pharmaceutically acceptable adjuvant or carrier; preferably, the fusion protein of the African swine fever self-assembly ferritin nano antigen containing the fusion protein is selected from any one of the fusion proteins shown in SEQ ID NO.1-SEQ ID NO. 4.

The invention further provides an African swine fever vaccine, which comprises: a prophylactically effective amount of an African swine fever fusion protein antigen and a pharmaceutically acceptable adjuvant or carrier; preferably, the African swine fever fusion protein antigen is selected from any one of fusion protein antigens shown in SEQ ID NO.9, SEQ ID NO.11 or SEQ ID NO. 13.

The invention further provides an African swine fever mixed vaccine, which comprises the following components: a prophylactically effective amount of the fusion protein-containing nano-antigen particles and African swine fever fusion protein antigen and a pharmaceutically acceptable adjuvant or carrier; wherein, the nano antigen particle containing the fusion protein is a mixed antigen composed of the fusion proteins shown in SEQ ID NO.1-SEQ ID NO. 4; the amino acid sequence of the African swine fever fusion protein antigen is shown in SEQ ID NO. 13.

As a preferred embodiment of the present invention, the adjuvant is preferably a cytokine, more preferably porcine interferon.

Detailed description of the specific embodiments of the invention

13 main capsid protein P72 amino acid sequences, 15 phosphoprotein P30 amino acid sequences, 15 envelope protein P54 amino acid sequences and 14 hemagglutinin protein CD2v-AC amino acid sequences in the latest year are respectively analyzed, 4 structural protein amino acid sequences of ASFV strains which are popular in different regions are respectively compared and analyzed, and the most universal isogenic sequences of 4 structural proteins are found out and are used as antigen genes of corresponding strains so as to obtain the optimal protection effect; on the basis, the invention utilizes OptimumGene^TMThe technology optimizes 4 four structural protein amino acid sequences, modifies the optimized antigen protein amino acid sequence and ferritin monomer subunit amino acid sequence according to the codon preference of escherichia coli, optimizes and designs various related parameters which influence the gene transcription efficiency, the translation efficiency and the GC content of protein folding, the CpG dinucleotide content, the codon preference, the secondary structure of mRNA, the stability of mRNA free energy, the RNA instability gene sequence, the repetitive sequence and the like, and keeps the finally translated protein sequence unchanged. In addition, for iron, the expression level of ferritin is increased and soluble expression is also increasedPoint mutation of protein monomer subunit N19Q; finally, the amino acid sequences of the homologous sequences of the fusion protein formed by combining the C end of the amino acid sequences of the major capsid protein P72, the phosphoprotein P30, the envelope protein P54 and the structural protein of the hemagglutinin protein CD2v-AC with the N end of the ferritin monomer of helicobacter pylori are respectively shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, and correspondingly, the optimized nucleotide sequences of the coding genes of the homologous sequences are respectively shown as SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8.

The invention expresses the optimized homologous sequence in an escherichia coli expression system and a baculovirus expression system.

In order to further improve the immunogenicity of the African swine fever virus recombinant structural protein vaccine and provide better immune protection for animals, the invention uses phosphoprotein P30, envelope protein P54 and hemagglutinin protein CD2v extracellular domain according to Jord: 2012 designs sHAPQ amino acid sequence, inserts the amino acid sequence of African swine fever virus P30 structural protein into the corresponding Not I recognition enzyme sequence in the amino acid sequence of African swine fever virus P54 structural protein, and connects the C end of African swine fever virus CD2v structural protein ectodomain (sHA) amino acid sequence to the N end of the African swine fever virus P54 structural protein amino acid sequence to obtain recombinant protein sHAPQ, the amino acid sequence is shown in SEQ ID NO.9, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 10.

The N end of the sHAPQ amino acid sequence is further connected with the C end of the ubiquitin-linker amino acid sequence to obtain a recombinant protein UBi-sHAPQ, the amino acid sequence of the recombinant protein UBi-sHAPQ is shown in SEQ ID NO.11, and the nucleotide sequence of the coding gene of the recombinant protein UBi-sHAPQ is shown in SEQ ID NO. 12.

The N end and the C end of the amino acid sequence of the recombinant protein sHAPQ are respectively connected with the UBITh 1 and the UBITh 2 amino acid sequence to obtain the recombinant protein Th1-sHAPQ-Th2, the amino acid sequence of the recombinant protein is shown as SEQ ID NO.13, and the nucleotide sequence of the coding gene of the recombinant protein is shown as SEQ ID NO. 14.

The coding genes of the obtained recombinant proteins sHAPQ, UBi-sHAPQ or Th1-sHAPQ-Th2 are expressed in a silkworm expression system respectively, and the detection results show that: compared with the recombinant proteins sHAPQ and UBi-sHAPQ, the immunogenicity and the protective power of the recombinant protein Th1-sHAPQ-Th2 are obviously improved.

The four obtained self-assembly ferritin nanoparticle mixed antigens and the Th1-sHAPQ-Th2 recombinant protein coding gene are cloned into an expression vector of baculovirus mammals to construct recombinant baculovirus presenting genes; the recombinant baculovirus is presented to a mouse, and the result shows that the antibody titer of the mouse immunized by four self-assembled ferritin nanoparticle mixed antigens and the Th1-sHAPQ-Th2 recombinant protein antigen is obviously higher than that of a healthy silkworm pupa control and a traditional antigen, wherein the antibody titer obtained by the immunization of the Th1-sHAPQ-Th2 recombinant protein antigen is the highest.

In addition, the invention also finds that the titer of the antibody generated by immunizing a mouse after emulsifying the porcine interferon serving as an adjuvant and the Th1-sHAPQ-Th2 recombinant protein is obviously improved.

Therefore, the Th1-sHAPQ-Th2 recombinant protein and the four self-assembly ferritin nanoparticle mixture provided by the invention can be applied to the preparation of an African swine fever virus vaccine, and the application method comprises the following steps:

expressing the 4 fusion protein coding genes in prokaryotic cells by adopting a prokaryotic expression system to obtain nano antigen particles, mixing the expressed 4 nano antigen particle products after purification, and mixing the products with medically acceptable immunologic adjuvant or carrier to obtain the African swine fever vaccine;

for reference, the step of expressing the nano-antigen particles in prokaryotic cells using a prokaryotic expression system comprises:

(1) the 4 fusion protein sequences are cloned to an expression vector pET28a to obtain recombinant plasmids pET28a-P72-Ferritin, pET28a-P30-Ferritin, pET28a-P54-Ferritin and pET28a-CD2 v-AC-Ferritin.

(2) The recombinant plasmids pET28a-P72-Ferritin, pET28a-P30-Ferritin, pET28a-P54-Ferritin and pET28a-CD2v-AC-Ferritin are transformed into BL21(DE3) competent cells for expression, and then the recombinant plasmids are purified by a nickel column to obtain the recombinant plasmid.

(II) the 4 fusion protein coding genes are expressed in eukaryotic cells by adopting a eukaryotic expression system, the expressed 4 nano antigen particle products are mixed after purification, and the obtained mixture is mixed with medically acceptable immunologic adjuvant or carrier to obtain the African swine fever vaccine.

For reference, the method for expressing the 4 fusion protein coding genes in eukaryotic cells by respectively adopting a eukaryotic expression system comprises the following steps:

expressing the 4 fusion protein coding genes in a silkworm expression system, and collecting and purifying expressed antigens; respectively constructing the 4 fusion protein coding genes into a silkworm baculovirus expression vector to prepare 4 recombinant silkworm baculovirus; amplifying the 4 recombinant silkworm baculovirus in silkworm cells and expressing in silkworms or silkworm pupas;

or expressing the 4 fusion protein coding genes in an AcMNPV-insect cell eukaryotic expression system, and collecting and purifying the expressed 4 antigens; cloning 4 fusion protein coding genes into baculovirus transfer vectors respectively to construct 4 recombinant baculovirus transfer vectors; respectively cotransfecting the 4 recombinant baculovirus transfer vectors and baculovirus DNA into insect cells to obtain 4 recombinant baculovirus; respectively infecting insect host or insect cell with the recombinant baculovirus, culturing the infected insect cell or insect host to express corresponding 4 antigens, and purifying to obtain the recombinant baculovirus.

(III) expressing the three recombinant protein genes of sHAPQ, UBi-sHAPQ and Th1-sHAPQ-Th2 in eukaryotic cells by adopting a eukaryotic expression system, and mixing the expressed 3 recombinant protein products with medically acceptable immune adjuvant or carrier to obtain the African swine fever vaccine.

For reference, the method for expressing the 3 recombinant protein coding genes in eukaryotic cells by using a eukaryotic expression system respectively comprises the following steps:

the 3 recombinant protein sequences were cloned into a silkworm baculovirus expression vector pCMV, to give recombinant plasmids pCMV-sHAPQ, pCMV-UBi-sHAPQ and pCMV-Th1-sHAPQ-Th 2.

Expressing the 3 recombinant plasmids in a silkworm expression system, and collecting and purifying expressed antigens; constructing the 3 recombinant protein genes into a silkworm baculovirus expression vector to prepare 3 recombinant silkworm baculovirus; the 3 recombinant silkworm baculovirus are amplified in silkworm cells and then expressed in silkworms or silkworm pupas.

(IV) the recombinant protein coding genes of P72-Ferritin, P30-Ferritin, P54-Ferritin, CD2v-AC-Ferritin and Th1-sHAPQ-Th2 can be cloned on a gene presenting vector to construct a recombinant baculovirus transfer vector presenting exogenous genes to vertebrate cells or individuals, and the recombinant baculovirus transfer vector is used for transfecting silkworm cells to obtain recombinant viruses; the obtained recombinant viruses Bm-CAG-P72-Ferritin, Bm-CAG-P30-Ferritin, Bm-CAG-P54-Ferritin and Bm-CAG-CD2v-AC-Ferritin are mixed in equal proportion, and the mixed virus and the recombinant virus Bm-CAG Th1-sHAPQ-Th2 respectively present antigens in animals in an injection or oral mode and induce the animals to produce antibodies.

The invention further provides a mixed vaccine for preventing and treating African swine fever, which comprises the following components: four self-assembly ferritin nano antigens containing fusion protein and Th1-sHAPQ-Th2 recombinant protein antigen with effective dose for prevention or treatment and pharmaceutically acceptable immunological adjuvant or carrier.

The vaccines of the present invention may be formulated with a variety of different pharmaceutical excipients or carriers. They may include salts and buffers to provide physiological ionic strength and pH, surfactants such as polysorbates 20 and 80 to prevent antigen aggregation, stabilizers for antigen stabilization such as PEG, trehalose, and gelatin, and polymers for sustained release such as CMC, HEC, and dextran. Vaccines can also be formulated with controlled release or enhanced display systems such as hydrogels, virosomes, nanoparticles, and emulsions. The vaccine may also be formulated with adjuvants to further increase the cross-reactive immune response and cross-protection, suitable adjuvants may be selected from polysaccharides such AS lipopolysaccharides and saponins, nucleic acids such AS CpG, lipids such AS MPL (monophosphoryl lipid a), proteins such AS bacterial flagellin, inorganic salts such AS aluminium salts and calcium phosphate, emulsions such AS freund's incomplete adjuvant, MF59 and AS03 and various Toll-like receptor ligands. Different adjuvants can be tested with the treated antigen to identify suitable adjuvants that produce higher levels of cross-reactive immune response and cross-protection, including complete or 100% protection, at appropriate adjuvant doses.

As a preferred embodiment, the adjuvant used in the vaccine of the invention is preferably a cytokine, more preferably porcine interferon.

The African swine fever vaccine of the present invention may be administered by various routes, such as intramuscular, subcutaneous, topical, sublingual, or oral.

The self-assembled ferritin nano antigen particle vaccine provided by the invention can display the African swine fever virus protein trimer structure on the surface of a helicobacter pylori ferritin cage structure, so that a widely neutralizing African swine fever antibody can be caused. The vaccine induces a neutralizing antibody generated by an individual to increase the immune efficacy, increase the immune range and immunize homoviruses of different years.

The Th1-sHAPQ-Th2 recombinant protein vaccine provided by the invention is formed by designing three parts of African swine fever virus P30, P54 and CD2v extracellular domains, and additionally adding

UBITh

1 and 2 amino acid sequences, so that the immune efficacy of the vaccine is further improved, the immune range is increased, and better immune protection is provided for animals.

The main capsid protein P72, the phosphoprotein P30, the envelope protein P54 and the hemagglutinin protein CD2v-AC of the African swine fever virus are respectively fused with the N end of the self-assembled ferritin nanoparticle subunit for expression, and the main capsid protein P72, the phosphoprotein P30, the envelope protein P54 and the hemagglutinin protein CD2v-AC of the African swine fever virus are respectively displayed on the surface of a self-assembled ferritin cage structure, so that the humoral immunity efficacy and the width of the vaccine are improved, and the immunogenicity of the structural protein of the African swine fever virus is effectively improved. The invention uses the colibacillus prokaryotic expression system, silkworm and AcMNPV-insect cell eukaryotic expression system to express recombinant protein vaccine, and can also produce antigen induced antibody by gene presentation of recombinant baculovirus in vertebrate tissue. The African swine fever vaccine can initiate a widely neutralizing anti-African swine fever antibody, can improve the immune efficacy and expand the immune range, and has the potential of becoming a universal vaccine with cross immune efficacy.

The invention also designs the phosphate protein P30, the envelope protein P54 and the hemagglutinin protein CD2v extracellular domain of African swine fever virus into sHAPQ recombinant protein, thereby further improving the efficacy and the protection width of the cellular immunity of the vaccine. The invention connects the ubiquitin-linker amino acid sequence and the sHAPQ recombinant protein to construct the UBi-sHAPQ recombinant protein, connects the

UBITh

1 and 2 amino acid sequences to the front and back ends of the sHAPQ recombinant protein to construct the Th1-sHAPQ-Th2 recombinant protein, further improves the cellular immune effect of the African swine fever virus structural protein, and provides better immune protection for animals. The invention also utilizes silkworm and AcMNPV-insect cell eukaryotic expression system to express recombinant protein vaccine, and uses pig interferon as adjuvant to induce antibody production. The present invention generates Th1-sHAPQ-Th2 antigen by gene presentation of recombinant baculovirus in tissues in vertebrate. The African swine fever vaccine can initiate a wide-neutralizing anti-African swine fever antibody, can improve the immunity effect and expand the immunity range, provides effective immune protection for virulent infection (pollution), and has the potential of becoming a universal safe vaccine with multiple protection effects.

Definitions of terms to which the invention relates

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The terms "antigen" and "immunogen" are used interchangeably and refer to a molecule, substance, protein, glycoprotein, or live virus capable of inducing specific humoral (antibody) and cellular immune responses.

The term "antigenicity" refers to the ability of an antigen to specifically bind to the antibody or sensitized lymphocyte it induces; the term "immunogenicity" refers to the ability of an antigen or vaccine to induce a specific immune response; the term "immune response" refers to both humoral or antibody-mediated and cell-mediated immune responses against antigens, vaccines or infectious agents; the term "vaccine" refers to a composition comprising an antigen for the therapeutic treatment or prophylactic immunization against an infectious or non-infectious disease; the term "immunization" refers to an immune response generated by vaccination or infection that provides protection against infectious or foreign agents; the term "recombinant protein or antigen" refers to a protein or antigen produced by recombinant DNA techniques that can be used to clone and express genes to produce proteins in a variety of hosts including bacteria, mammalian cells, insect cells, and plants. The term "potency" refers to the amount of antigen in an antigen preparation or vaccine as measured by a specified potency assay.

The term "host cell" or "recombinant host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome.

Drawings

FIG. 1 is a polyacrylamide gel electrophoresis diagram of induced expression precipitation and supernatant of ASFV P72-Ferritin in an Escherichia coli prokaryotic expression system; 1-7 are ASFV P72-Ferritin prokaryotic expression samples respectively; a prokaryotic expression sample with no load as a pET-28a carrier; the ASFV P72-Ferritin prokaryotic expression sample is not induced to be non-induced.

FIG. 2 is a Western blotting detection chart of an expression product of ASFV P72-Ferritin in a silkworm expression system; 1 is ASFV P72-Ferritin silkworm expression product; and 2 is a negative control.

FIG. 3 is a polyacrylamide gel electrophoresis diagram of the induced expression precipitation and supernatant of ASFV P30-Ferritin in an Escherichia coli prokaryotic expression system; 1-7 are ASFV P30-Ferritin prokaryotic expression samples respectively; a prokaryotic expression sample with no load as a pET-28a carrier; the ASFV P30-Ferritin prokaryotic expression sample is not induced to be non-induced.

FIG. 4 is a Western blotting detection chart of an expression product of ASFV P30-Ferritin in a silkworm expression system; 1 is ASFV P30-Ferritin silkworm expression product; and 2 is a negative control.

FIG. 5 is a polyacrylamide gel electrophoresis diagram of the induced expression precipitation and supernatant of ASFV P54-Ferritin in a prokaryotic expression system of Escherichia coli; 1.2 are ASFV P54-Ferritin prokaryotic expression samples respectively; a prokaryotic expression sample with no load as a pET-28a carrier; the ASFV P54-Ferritin prokaryotic expression sample is not induced to be non-induced.

FIG. 6 is a Western blotting detection chart of an expression product of ASFV P54-Ferritin in a silkworm expression system; 1 is ASFV P54-Ferritin silkworm expression product; and 2 is a negative control.

FIG. 7 is a polyacrylamide gel electrophoresis diagram of the induced expression precipitation and supernatant of ASFV CD2v-AC-Ferritin in an E.coli prokaryotic expression system; 1-5 are ASFV CD2v-AC-Ferritin prokaryotic expression samples respectively; a prokaryotic expression sample with no load as a pET-28a carrier; the ASFV CD2v-AC-Ferritin prokaryotic expression sample is not induced to be non-induced.

FIG. 8 is a Western blotting detection chart of an expression product of ASFV CD2v-AC-Ferritin in a silkworm expression system; 1 is ASFV P72-Ferritin silkworm expression product; and 2 is a negative control.

FIG. 9 is a transmission electron microscope and an immunoelectron microscope image of nanoparticles of silkworm-expressed P30-ferritin; a, transmission electron microscope, B: gold-labeled immunoelectron microscope.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. It is to be understood that the described embodiments are exemplary only and are not limiting upon the scope of the invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

1. Test materials and reagents

(1) Strains, strains and vectors: prokaryotic expression vector pET-28a (+), Escherichia coli TOP10 strain, transfer vector pVL1393-CMV, prokaryotic expression strain BL21(DE3), silkworm cell BmN, Sf-9 cell, Hi5 insect cell, silkworm nuclear polyhedrosis virus parent strain BmBacmid, alfalfa prodenia litura polyhedrosis virus parent strain AcBacmid and silkworm variety JY1 are all preserved in the molecular microorganism laboratory of the institute of biotechnology of the national academy of agricultural sciences;

(2) ferritin sequence and gene sequence of African swine fever virus P72, P30, P54 and CD2v-AC 4 proteins: the consensus sequence obtained by analysis was sent to the Kisry company for synthesis and cloning into the prokaryotic expression vector pUC57 vector.

(3) sHAPQ, UbsHAPQ and Th1-sHAPQ-Th2 protein gene sequences: the consensus sequence obtained by analysis was sent to the Kisry company for synthesis and cloned into the prokaryotic expression vector pUC 57.

(4) Enzymes and reagents: restriction enzyme, T₄The DNA ligase and the corresponding buffer solution are purchased from Promega corporation; LA Taq polymerase and buffer were purchased from TaKaRa; DNA and protein molecular weight standards of various specifications are products of TranGen Biotech company; 2K Plus II DNA Marker was purchased from Beijing Quanjin Biotechnology Ltd; goat anti-rabbit IgG secondary antibody labeled by horseradish peroxidase was purchased from MBL company; DEPC, M-MLV-Rtase (reverse transcriptase) was purchased from Promega;

(5) biochemical reagents: tris, Ampicillin, Kanamycin, IPTG, SDS, urea, imidazole, TritonX-100, TEMED (N, N, N ', N' -tetramethylenediamine), Ammonium Persulfate (Ammonium Persulfate), Kanamycin (Kanamycin) were purchased from Sigma; bisacrylamide, acrylamide, IPTG, X-Gal were purchased from Promega; agarose is a product of Sunbiotech company; yeast Extract (Yeast Extract), tryptone were purchased from OXOID, UK; 0.2um, 0.45um filters were purchased from Gelman Sciences; ethidium Bromide (EB), Coomassie Brilliant blue R-250 from Fluka; Ni-NTA Agarose, Proteinase K, fetal bovine serum were purchased from Invitrogen; bovine serum albumin was purchased from roche; the others are all domestic or imported analytical pure reagents.

(6) Culture medium: the Escherichia coli culture medium is LB culture medium; the silkworm insect cell culture medium is TC-100 purchased from Applichem company;

(7) animal experiments of the nano vaccine constructed by fusing the African swine fever virus and the ferritin are carried out in an isolation laboratory.

2. Fusion PCR method for site-directed mutagenesis in experimental methods

Refer to Kuang Jatin et al (a new method for vector construction: recombinant fusion PCR method, genomics and applied biology, 2012, volume 31, phase 6, page 634-639).

Example 1 preparation and potency assay of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin optimized sequence nanoparticle vaccine

Preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nanoparticle vaccine

1 arrangement of solutions and culture media

Reference is made to the relevant tool book for the preparation of solutions and media (Joseph et al, third edition of the molecular cloning guidelines, 2002; Oseber, et al, eds. molecular biology guidelines, 1998).

Synthesis of 2ASFV major capsid protein P72 gene sequence and ferritin gene sequence

In the invention, 13 ASFV main capsid protein P72 amino acid sequences are obtained from NCBI and compared to obtain a homologous sequence, in order to ensure that the main capsid protein P72 homologous sequence and ferritin are better fused and expressed, the amino acid sequence of the ASFV main capsid protein P72 is respectively analyzed by using signal peptide analysis software (SignalP) and transmembrane domain analysis software (TMHMM), so that the amino acid sequence of the ASFV main capsid protein P72 has no signal peptide and transmembrane region, and the total length of the protein is 646 amino acids.

In order to promote the expression efficiency of the major capsid protein P72 and ferritin fusion nanoparticles and improve soluble expression, asparagine (N) at position 19 in the amino acid sequence of helicobacter pylori ferritin (GenBank sequence No: WP _000949190 at NCBI) was mutated to glutamine (Q) to eliminate glycosylation sites. Wherein the ASFV main capsid protein P72 sequence is connected with the ferritin sequence by a connecting peptide (SGG), the first 4 amino acids of the ferritin amino acid sequence are removed, and then the connecting peptide is connected with the 5 th amino acid at the N end of the ferritin.

Further utilizing OptimumGene^TMThe technology optimizes the amino acid sequence of the antigen protein of the ASFV virusThe optimized amino acid sequence of the antigen protein and the amino acid sequence of the ferritin monomer subunit are modified according to the codon preference of silkworm, and various related parameters influencing the gene transcription efficiency, the translation efficiency, the GC content of protein folding, the CpG dinucleotide content, the codon preference, the secondary structure of mRNA, the free energy stability of mRNA, the RNA instability gene sequence, the repetitive sequence and the like are optimized and designed, and the finally translated protein sequence is kept unchanged. In order to improve the translation initiation efficiency of a target gene in a silkworm baculovirus eukaryotic expression system, a Kozak sequence AAC is added in front of the gene, and in order to improve the translation termination efficiency, a termination codon is changed into TAA. In addition, restriction sites for BamHI, EcoRI and the like within the gene sequence were removed, BamHI was added upstream of the gene, and EcoRI restriction sites were added downstream of the gene, for subsequent cloning into the eukaryotic transfer vector pVL 1393. Translation initiation was initiated using ATG on the pET-28a (+) vector. In addition, restriction sites for BamHI, EcoRI and the like within the gene sequence were removed, BamHI was added upstream of the gene, and EcoRI restriction sites were added downstream of the gene, for subsequent cloning into the prokaryotic vector pET-28a (+). The designed ASFV major capsid protein P72 gene sequence and ferritin sequence were synthesized by related Biotech Ltd.

Plasmid construction of 3 African swine fever virus antigen and ferritin fusion protein

3.1 PCR amplification of African Swine fever Virus antigen and ferritin fusion proteins

The African swine fever virus and the ferritin are fused together by a fusion PCR technology. The specific experimental method is shown in the experimental method 2.

3.1.1 PCR amplification of E.coli expression plasmids

PCR amplification of ASFV P72 sequence: the plasmid pUC57-ASFV P72 is taken as a template, and the primer sequence is as follows:

F1	5’-CGGGATCCATGGCTAGCGGTGGA-3’
		R1	5’-CAGCTTGATGATGTCGCCACCGGAAGTGGAGTATCTCAACACAGCGCT-3’

PCR amplification of Ferritin sequence: the primer sequences are as follows by taking pUC57-Ferritin as a template:

F2	5’-AGCGCTGTGTTGAGATACTCCACTTCCGGTGGCGACATCATCAAGCTG-3’
		R2	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

taking PCR products ASFV P72 and Ferritin as templates, amplifying ASFV P72-Ferritin by using Overlap-PCR, wherein the primer sequences are as follows:

F1	5’-CGGGATCCATGGCTAGCGGTGGA-3’
		R2	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1.2 PCR amplification of expression plasmids in silkworm expression systems

F3	5’-CGGGATCCAACATGGCTAGCGGTGGA-3’
		R3	5’-CAGCTTGATGATGTCGCCACCGGAAGTGGAGTATCTCAACACAGCGCT-3’

F4	5’-AGCGCTGTGTTGAGATACTCCACTTCCGGTGGCGACATCATCAAGCTG-3’
		R4	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

F3	5’-CGGGATCCAACATGGCTAGCGGTGGA-3’
		R4	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

the PCR reaction system is shown in table 1:

TABLE 1 PCR reaction System

Setting PCR parameters:

3.2 purification and recovery of DNA fragments from glass milk

Preparing 1% (w/v) agarose gel, and carrying out electrophoresis on the PCR amplification product; placing the agarose gel under an ultraviolet lamp, quickly cutting the gel containing a single target nucleic acid strip, placing the gel into a centrifugal tube of 1.5mL, weighing, adding 6M NaI with three times of volume, and placing the gel in a constant-temperature incubator at 37 ℃ for melting; adding 8 μ L of Glassmik into the completely melted solution, mixing, ice-cooling for 5min, and shaking twice; centrifuging at 8000rpm for 10s, and discarding the supernatant; adding 800 mu L of New Wash to Wash, slightly bouncing, centrifuging, and repeating for 2 times; removing the supernatant, and drying the centrifuge tube in a constant-temperature incubator at 37 ℃ for 2-3 min; after drying, 20. mu.L of 0.1 XTE was added to dissolve, the DNA was mixed and dissolved thoroughly, centrifuged at 12000rpm for 5min, the supernatant was immediately used for ligation, and the rest was stored at-20 ℃.

3.3 cleavage of the target Gene PCR product

Performing gel running on the PCR product, performing double enzyme digestion reaction on the product with correct gel recovery by using restriction enzymes BamH I and EcoR I to obtain a target fragment ASFV P72-Ferritin, wherein the enzyme digestion system is shown in the following table 2:

TABLE 2 enzyme digestion System

3.4 Mini-Production of competent cells

Coli Top10 competent cells were prepared and stored at-80 ℃.

3.5 ligation and transformation of the Gene of interest to pET-28a (+) vector and pVL1393 vector

3.5.1 enzymatic digestion of pET-28a (+) and pVL1393 vectors

The transferred transformants pVL1393 and pET-28a (+) were digested simultaneously with restriction enzymes BamH I and EcoRI, inactivated at 65 ℃ for 20min and stored at-20 ℃ for further use.

3.5.2 joining

The target fragment recovered by enzyme digestion is connected with the transfer vector pVL1393 and pET-28a (+) after double enzyme digestion treatment by BamHI/EcoRI. By T₄DNA ligase, 16 ℃ and ligation overnight. The attachment system is shown in table 3 below:

TABLE 3 connection System

3.5.3 transformation

Taking competent cells stored at-80 ℃, rapidly melting half, adding 3 mu L of the ligation product, and standing on ice for half an hour; placing the mixture in a constant-temperature water bath kettle at 42 ℃ for 90s, and quickly placing the mixture on ice for 3-5 min; adding a proper amount of 1mL LB culture medium into the tube, and standing and culturing for 60min in a constant temperature incubator at 37 ℃; after centrifugation, most of the supernatant was discarded, and 200. mu.L of the supernatant was applied to LB plates (100. mu.g/mL Amp), and cultured in a 37 ℃ incubator for 30min in the upright position and then in the inverted position overnight.

3.6 Rapid extraction of nucleic acids Positive clones

Picking a single colony on an LB plate, inoculating the single colony in an LB liquid culture medium (100 mu g/mL Amp), placing the single colony in a constant-temperature shaking incubator at 37 ℃, setting the rotating speed to be 220rpm, and culturing overnight; taking 500 mu L of bacterial liquid in a centrifugal tube, and collecting thalli; adding 30 mu L of Loading Buffer and 20 mu L of phenol/chloroform (1:1), and fully mixing by using a vortex shaker to resuspend the thalli; centrifugation was carried out at 12000rpm for 3min, and 8. mu.L of the supernatant was subjected to agarose gel electrophoresis, while an empty vector treated in the same manner was used as a control. Observing the band under an ultraviolet lamp of the gel imaging system, and selecting bacterial liquid with the plasmid band obviously retreated to extract the plasmid.

3.7 SDS alkaline lysis method for extracting plasmid DNA

3mL of bacterial liquid is collected in a centrifuge tube, plasmid DNA is extracted by an SDS alkaline lysis method, and the plasmid DNA is stored at the temperature of minus 20 ℃ for standby.

3.8 restriction enzyme digestion and sequencing identification of Positive clones

The cleavage system is shown in Table 4 below:

TABLE 4 enzyme digestion System

After reaction at 37 ℃ for 2 hours, 7. mu.L of the reaction mixture was subjected to electrophoresis using 1% agarose. And (3) carrying out DNA sequencing on the plasmid with correct restriction enzyme digestion detection, wherein the result is consistent with the target gene, and the obtained recombinant plasmid is named as pET28a-ASFV P72-Ferritin and pVL1393-ASFV P72-Ferritin.

4 expression and purification of recombinant plasmids

4.1 inducible expression of recombinant plasmids in E.coli

The correctly identified recombinant expression plasmid pET28a-ASFV P72-Ferritin is transformed into BL21 competent cells, under the conditions of 37 ℃ and IPTG final concentration of 0.5mM, bacterial liquid is collected after 1h, 2h, 3h, 4h and 5h are respectively induced, SDS-PAGE electrophoresis is used for analyzing the expression condition, a specific band appears at about 96kD of pET28a-ASFV P72-Ferritin, which is consistent with the size of the expected recombinant protein with His, but the non-induced recombinant expression vector does not produce the specific band, which indicates that the fusion protein is successfully expressed in escherichia coli, and the expression quantity is gradually increased 1-4 h after IPTG is added, and the multi-accumulated recombinant proteins of 5h and 4h are induced are almost as much. The bacterial cells are broken by ultrasonic waves, the supernatant is found to have a part of target protein, and a clear target band is in the precipitate, which indicates that the recombinant protein His-ASFV P72-Ferritin mainly exists in the form of insoluble inclusion body, and a polypropylene gel electrophoresis chart is shown in figure 1.

4.2 Mass expression of recombinant proteins and treatment of Inclusion body protein samples

Streaking the strain with high expression quantity stored at-80 ℃, culturing overnight at 37 ℃, selecting a single colony, inoculating the single colony in 4mL LB liquid medium (50 mu g/mL Kan), and culturing overnight at 37 ℃; transferring 1% of the bacterial solution into 200mL LB liquid medium (50. mu.g/mL Kan), shaking and culturing at 37 ℃ until OD value reaches about 0.6, adding IPTG (final concentration of 0.5mM), and continuously culturing at 37 ℃ for 4 h; centrifuging at 4 deg.C and 5000rpm for 10min to collect thallus, and sterilizing with sterile ddH₂O washing for 2 times, and centrifuging to collect thalli. Resuspending the thallus with lysis buffer solution with dosage of 100 μ L lysate/mL bacterial solution, ice-bathing for 30min, and breaking the thallus with ultrasonic wave on ice; centrifuging at 4 ℃ and 12000rpm for 10min, removing supernatant, and obtaining a precipitate as a recombinant protein inclusion body; resuspending and washing the precipitate with a proper amount of inclusion body washing solution I and an appropriate amount of inclusion body washing solution II, and discarding the supernatant; the pellet was resuspended in the appropriate amount of urea NTA-0 Buffer and dissolved overnight at 4 ℃.

4.3 Nickel column affinity chromatography purification of recombinant proteins

Centrifuging the overnight dissolved inclusion body solution at 4 ℃ and 12000rpm for 15min, taking the supernatant, and filtering with a 0.45 mu m membrane; purifying the expressed protein by using a Ni-NTA resin chromatographic column, collecting eluent in 5 gradients of urea NTA-25, urea NTA-50, urea NTA-100, urea NTA-250 and urea NTA-500, collecting penetration liquid and eluent, collecting an NTA volume in each tube, and determining the binding condition of the protein and the distribution condition of the target protein in the eluent by SDS-PAGE analysis. Protein electrophoresis showed that the protein eluted most at 50mM imidazole, also at 100mM and very little at 250 mM. After SDS-PAGE electrophoresis, the purified recombinant protein is observed to have correct size and single protein band, and the content of the purified protein is 4.8 mg/mL.

4.4 preparation of polyclonal antibodies

Quantifying the purified His-Ferritin protein, collecting 1.5mg protein, cutting off gel containing target protein after SDS-PAGE electrophoresis, cutting up the gel as much as possible, drying at 37 ℃, grinding into powder, diluting the antigen protein to 2 times of final concentration by using normal saline, fully mixing the adjuvant, taking out the required dosage under aseptic condition, and mixing the required dosage with the antigen protein according to the volume ratio of 1:1, mixing the mixture quickly, injecting the mixture into an immune mouse through hind leg and calf muscles, collecting all serum after two immunizations, and measuring the antibody titer of the serum.

5 recombinant plasmid is expressed and purified in silkworm expression system and AcMNPV-insect cell expression system

5.1 propagation of parent strains of Virus and preparation of viral DNA

5.1.1 reproduction of parent strain BmBacmid of Bombyx mori nuclear polyhedrosis virus and preparation of virus DNA

Preparing a 1 XTC-100 culture medium according to the product specification of Applichem company, adjusting the pH to 6.22 by using 2M NaOH, supplementing 10 percent fetal bovine serum to the culture medium after filtration sterilization, and culturing the bombyx mori cell BmN at 27 ℃. Infecting about 50mL of BmN cells in logarithmic growth phase with a parent strain BmBacmid of bombyx mori nuclear polyhedrosis virus, collecting virus infection liquid after 3-4 d, centrifuging at 10000rpm for 10min, removing precipitate, centrifuging the supernatant at 25000rpm for 1 hour, removing the supernatant, suspending virus particles with 1mL of virus DNA extract (1L contains 12.1g of Tris, 33.6g of EDTA, 14.1g of KCl and pH 7.5), transferring to a 1.5mL centrifuge tube, adding protease K to a final concentration of 50 mu g/mL, keeping the temperature at 50 ℃ for 2 hours, adding 35% of Sarkorsel to a final concentration of 1%, continuing to keep the temperature at 50 ℃ for 2 hours, sequentially extracting with saturated phenol, chloroform (1:1) and chloroform with equal volumes, transferring the upper aqueous phase to a new tube, adding 1/10 volume of 3M NaCl, adding 2 times of absolute ethanol, standing at-20 ℃ for more than 2 hours to precipitate virus DNA, centrifuging at 5000rpm for 10min, washing the precipitate with 75% ethanol, and freeze drying. Dissolved in 100. mu.L of TE Buffer and stored at 4 ℃ until use.

5.1.2 preparation reference of AcBacmid DNA (Zhangyifang, Lianecdotal, Yi Yong bamboo, etc.. insect bioreactor expressing multiple exogenous genes and its construction method and application [ P ]. China: CN102286534A,2011.)

A1 XTC-100 medium was prepared according to the instructions of Applichem, pH was adjusted to 6.22 with 2M NaOH, 10% fetal bovine serum was supplemented to the filter-sterilized medium, and Sf-9 cells were cultured at 27 ℃. Infecting about 50mL of cells in logarithmic growth phase with AcBacmid virus parent strain, collecting virus infection liquid after 3-4 d, centrifuging at 10000rpm for 10min, removing precipitate, centrifuging the supernatant at 25000rpm for 1h, removing the supernatant, suspending the virus particles with 1mL of virus DNA extract (1L containing Tris 12.1g, EDTA 33.6g, KCl 14.1g and pH 7.5) for precipitation, transferring to a 1.5mL centrifuge tube, adding protease K to a final concentration of 50 mu g/mL, keeping the temperature at 50 ℃ for 2h, adding 35% of Sarkorsel to a final concentration of 1%, keeping the temperature at 50 ℃ for 2h, extracting with saturated phenol, chloroform (1:1) and chloroform respectively, transferring the upper aqueous phase to a new tube, adding 1/10 volume of 3M NaCl, adding 2 times volume of absolute ethyl alcohol, standing at-20 ℃ for more than 2h, centrifuging at 5000rpm for 10min, the precipitate was washed once with 75% ethanol and freeze-dried. Dissolved in 100. mu.l of TE Buffer and stored at 4 ℃ until use.

5.2 construction and acquisition of recombinant Bombyx mori baculovirus rBmBacmid and rAcBacmid

Inoculation of about 1X 10⁶BmN and Sf-9 cells at 15cm²After the cells were attached to the wall in the flask, the Fetal Bovine Serum (FBS) -containing medium was removed, washed three times with FBS-free medium, and 1.5mL FBS-free medium was added. 1 mu g of bombyx mori baculovirus parent strain BmBcimid DNA (patent number: ZL201110142492.4) and AcBcimid DNA, 2 mu g of recombinant transfer plasmid pVL1393-ASFV P72-Ferritin and 5 mu L of liposome are respectively added into a sterilizing tube in sequence, the volume is complemented to 60 mu L by two systems of sterile double distilled water, the mixture is gently mixed, the mixture is kept stand for 15min and then is added into a corresponding cell culture bottle drop by drop for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu.L FBS were supplemented. Culturing at 27 ℃ for 4-5 days at constant temperature, collecting supernatant for recombinant virus rBmBacmid (P)_PHASFV P72-Ferritin) and AcMNPV (P)_PHASFV P72-Ferritin). Inoculating appropriate amount of corresponding cells (about 70-80%) in a35 mm small plate, sucking out the culture medium after the cells adhere to the wall, diluting the co-transfection supernatant with different concentrations,1mL of cotransfection solution is added into adherent cells and is uniformly distributed. After infection for 1h at 27 ℃, absorbing infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of the gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, and observing by using a microscope. Selecting out the plaques without polyhedra, repeating the steps, and obtaining the pure recombinant silkworm baculovirus rBmBacmid (P) through 2-3 rounds of purification_PHASFV P72-Ferritin) and insect baculovirus AcMNPV-ASFV P72-Ferritin.

5.3 amplification of recombinant viruses in cells

5.3.1 recombinant Virus rBmBacmid (P)_PHASFV P72-Ferritin) amplification in Bombyx mori cells

Recombinant bombyx mori baculovirus rBmBacmid (P)_PHASFV P72-Ferritin) to infect normal growth BmN cells, and after culturing for 3 days, the supernatant, which contains a large amount of recombinant virus rBmBacmid (P)_PH-ASFV P72-Ferritin)。

5.3.2 amplification of recombinant Virus rAcBacmid-ASFV P72-Ferritin in insect Sf-9 cells

Infecting Sf-9 cells growing normally with the recombinant silkworm baculovirus rAcBacmid-ASFV P72-Ferritin, culturing for 96 hours, collecting infected cells, and collecting supernatant fluid containing a large amount of recombinant virus rAcBacmid-ASFV P72-Ferritin.

5.4 identification of recombinant viruses

Exogenous gene integration was analyzed by PCR. The extraction method of free virus genome DNA is as follows: collecting virus supernatant 150 μ L, adding 150 μ L (0.5mol/L) NaOH, mixing, adding 20 μ L (8mol/L) ammonium acetate, mixing, extracting with equal volume of phenol and chloroform, precipitating with ethanol, and dissolving DNA with 20 μ L TE.

Taking 1 mu L of the virus genome DNA for PCR amplification, wherein the reaction conditions are as follows: denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 1min, denaturation at 58 deg.C for 1min, and denaturation at 72 deg.C for 3min for 30 cycles, and final extension at 72 deg.C for 10 min. Electrophoresis analysis was performed on 15. mu.L of the reaction product, and the result confirmed that the recombinant virus was obtained.

5.5 recombinant Virus rBmBacmid (P)_PHExpression of ASFV P72-Ferritin) in silkworm bodies and pupae

The silkworm pupae used are high-expression variety JY1 (stored in the laboratory). The breeding of JY1 silkworm is carried out according to the conventional method of China sericulture (Shanghai science and technology Press, 1991) compiled by Luhong Yin. Selecting silkworm with the same average weight 48h after the food in the area and selecting 15 silkworm pupas with the same average weight seven days after cocooning, wherein each silkworm pupa and silkworm are inoculated with about 1.0 multiplied by 10⁵pfu rBmBacmid(P_PHASFV P72-Ferritin), collecting the silkworm pupae with disease and silkworm blood after 4-5 days, and freezing and storing at-20 ℃ for ELISA detection.

5.6 identification and expression of recombinant virus rAcBacmid-ASFV P72-Ferritin in insect Hi 5-cell

Exogenous gene integration was analyzed by PCR. Extracting virus genome DNA.

Taking 1 mul of the virus genome DNA for PCR amplification, taking 15 mul of reaction products for electrophoretic analysis, and the result proves that the recombinant virus rAcBacmid (P) is obtained_PH-ASFV P72-Ferritin)。

The recombinant virus rAcBacmid (P) is used_PHASFV P72-Ferritin) culture solution according to 10⁵pfu infected Hi5 cells, 96 hours later the infected cells were harvested and frozen at-20 ℃ for ELISA detection.

5.7 Collection and purification of Virus-like particles of expression product of interest

Silkworm pupae containing the gene of interest were ground with precooled PBS (1: 9 ratio) in a homogenizer and then filtered through a 0.45um filter. In 30% sucrose solution, 1.5X 10⁵g ultra-high speed centrifugation for 2 h. The pellet was reconstituted to volume with 0.1M NaCl in Tris-HCl (pH 7.0) and eluted through cation exchange chromatography packing SP (GE Inc.), 0.5M NaCl in Tris-HCl (pH 7.0). Then, the mixture was subjected to molecular sieve chromatography S200 (GE). The purity can reach 95%, and the yield can reach more than 40%. It was also demonstrated that the target protein expressed in Bombyx mori could self-assemble into viroid particles at high concentration.

6 Western blotting detection

Diluting a silkworm hemolymph sample infected by a recombinant virus by PBS (pH 7.4) for 10 times, carrying out ultrasonic crushing, carrying out SDS-PAGE gel electrophoresis, carrying out gel concentration of 5%, separating gel concentration of 15%, transferring protein to a polyvinylidene fluoride (PVDF) membrane by a semi-dry transfer method, preparing 3% BSA (bovine serum albumin) with PBST for blocking, taking serum obtained after a prokaryotic expression His-Ferritin and His-Ferritin protein immunization mouse as a primary antibody (self-made by an inventor laboratory and prepared by the above polyclonal antibody; 1:1000 for dilution), taking HRP-labeled goat anti-mouse IgG as a secondary antibody (1:5000 for dilution), developing by DAB (diaminobenzidine), terminating by deionized water, and detecting a result. Western blotting results showed that a specific band of 92kDa (ASFV P72-Ferritin) was detectable in the supernatant of silkworm hemolymph sample after infection with the recombinant virus, as shown in FIG. 2.

7 ELISA detection

Diluting the silkworm hemolymph sample to be detected and the Hi 5-cell expression sample by using a coating solution in a proper multiple ratio, taking a parent virus infected silkworm blood sample as a negative control, only adding the coating solution as a blank control, adding 100 mu L of the coating solution into each hole of an enzyme label plate, and standing overnight at 4 ℃. The well was quickly drained and washed 3 times with PBST. mu.L of 3% BSA blocking solution was added to each well, acted on at 37 ℃ for 3h, and washed 3 times with PBST. Diluting a His-Ferritin polyclonal antibody prepared in a laboratory by 1:1000, 100. mu.L per well, 1.5h at 37 ℃ and 4 washes with PBST. 100 μ LHRP-labeled goat anti-mouse (1: 5000) was added to each well, incubated at 37 ℃ for 45-60 min, and washed 4 times with PBST. Then adding 100 mu L of freshly prepared OPD (o-phenylenediamine) color developing solution, and developing for 10-30 min at room temperature in a dark place. The reaction was terminated by adding 50. mu.L of 2M sulfuric acid to each reaction well. The OD value is measured by the wavelength at 492nm on a microplate reader, the OD value of each well is measured after the blank control well is zeroed, and the positive is determined by the P/N value (the OD value of the positive well minus the OD value of the blank control well/the OD value of the negative well minus the OD value of the blank control well) being more than or equal to 2.1.

TABLE 5 ELISA Titers of ASFV P72-Ferritin original sequence expression products

Group of	Potency of the drug
		Silkworm blood sample infected with parental virus (negative control)	1：4
ASFV P72-Ferritin (silkworm)	1：4096
		ASFV P72-Ferritin (AcMNPV-insect cell)	1：2048

And (3) judging an ELISA result: if the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole minus the OD value of the blank control hole) is greater than or equal to 2.1, the result shows that the ELISA titer of the ASFV P72-Ferritin (recombinant virus rBmBacmid) gene expression product can reach 1: 4096 and the ELISA titer of the expression product of ASFV P72-Ferritin (recombinant virus AcMNPV) gene in an AcMNPV-insect cell expression system can reach 1: 2048.

preparation and efficacy detection of ASFV P30-Ferritin original sequence nanoparticle vaccine

1 arrangement of solutions and culture media

The preparation method of the specific solution and the preparation method of the culture medium are shown in the preparation and the efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine.

2ASFV phosphoprotein P30 gene sequence and ferritin gene sequence.

The invention obtains 15 ASFV phosphoprotein P30 amino acid sequences from NCBI for comparison to obtain a homologous sequence, in order to ensure better fusion expression of the phosphoprotein P30 homologous sequence and ferritin, the invention respectively analyzes the amino acid sequence of the ASFV phosphoprotein P30 by using signal peptide analysis software (SignalP) and transmembrane domain analysis software (TMHMM), and obtains that the amino acid sequence of the ASFV phosphoprotein P30 has no signal peptide and transmembrane region, and the total length of the protein is 204 amino acids.

The specific design scheme is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine.

Plasmid construction of 3 African swine fever virus and ferritin fusion protein

The specific experimental method is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine. PCR amplification of ASFV P30 sequence: plasmid pUC57-ASFV P30 was used as a template, and the amplification primers were as follows:

PCR amplification of Ferritin sequence: using pUC57-Ferritin as a template, the amplification primers were as follows:

F6	5’-CTCAGCCACCTGCACTTGATGTTCTCCGGTGGCGACATCATCAAGCTG-3’
		R6	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

taking PCR products ASFV P30 and Ferritin as templates, performing Overlap-PCR amplification to obtain ASFV P30-Ferritin, wherein amplification primers are as follows:

F5	5’-CGGGATCCATGGACTTCATCTTG-3’
		R6	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1.2 PCR amplification of expression plasmids in silkworm expression systems

PCR amplification of ASFV P30 sequence: plasmid pUC57-ASFV P30 was used as a template, and the amplification primers were as follows:

F7	5’-CGGGATCCAACATGGACTTCATCTTG-3’
		R7	5’-CAGCTTGATGATGTCGCCACCGGAGAACATCAAGTGCAGGTGGCTGAG-3’

F8	5’-CTCAGCCACCTGCACTTGATGTTCTCCGGTGGCGACATCATCAAGCTG-3’
		R8	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

F7	5’-CGGGATCCAACATGGACTTCATCTTG-3’
		R8	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1 ligation and transformation of the target Gene with the pVL1393 vector

The specific experimental method is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine.

3.2 Rapid extraction of nucleic acids Positive clones

3.3SDS alkaline lysis method for extracting plasmid DNA

3.4 enzyme digestion and sequencing identification of Positive clones

4 expression and purification of recombinant plasmids

4.1 inducible expression of recombinant plasmids in E.coli

SDS-PAGE analysis shows that pET28a-ASFV P30-Ferritin has a specific band at about 46kD, which is consistent with the expected size of recombinant protein with His, and the non-induced recombinant expression vector does not produce the specific band, which indicates that the fusion protein is successfully expressed in Escherichia coli. There was a clear band in the pellet indicating that the recombinant protein His-ASFV P30-Ferritin exists mainly in the form of insoluble inclusion bodies, and the polypropylene gel electrophoresis pattern is shown in FIG. 3.

4.3 Nickel column affinity chromatography purification of recombinant proteins

4.4 preparation of polyclonal antibodies

5.1 propagation of parent strains of Virus and preparation of viral DNA

5.3 amplification of recombinant viruses in cells

5.4 identification of recombinant viruses

5.5 recombinant Virus rBmBacmid (P)_PHExpression of ASFV P30-Ferritin) in silkworm bodies and pupae

The specific experimental method is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine. The self-assembled nanoparticle image of the expression product is taken as a representative, and the transmission electron microscope and the immuno-electron microscope images are listed in FIG. 9.

5.6 identification and expression of recombinant virus rAcBacmid-ASFV P30-Ferritin in insect Hi 5-cell

6 Western blotting detection

Western blotting results showed that a specific band of 43kD (ASFV P30-Ferritin) size was detectable in the supernatant of silkworm hemolymph samples after recombinant virus infection, as shown in FIG. 4.

7 ELISA detection

TABLE 6 ELISA Titers of ASFV P30-Ferritin Gene expression products

Group of	Potency of the drug
		Silkworm blood sample infected by parental virus(negative control)	1：4
ASFV P30-Ferritin (silkworm)	1：2048
		ASFV P30-Ferritin (AcMNPV-insect cell)	1：1024

And (3) judging an ELISA result: the positive result is that the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole) is more than or equal to 2.1, and the result shows that the ELISA titer of the ASFV P30-Ferritin (silkworm) gene expression product can reach 1: 2048, and the ELISA titer of an expression product of ASFV P30-Ferritin (AcMNPV-insect cell) gene in an AcMNPV-insect cell expression system can reach 1: 1024.

preparation and efficacy detection of ASFV P54-Ferritin original sequence nanoparticle vaccine

1 arrangement of solutions and culture media

2, synthesis of an ASFV envelope protein P54 gene sequence and a ferritin gene sequence.

In the invention, 15 ASFV envelope protein P54 amino acid sequences are obtained from NCBI and compared to obtain a homologous sequence, in order to ensure that the envelope protein P54 homologous sequence and ferritin are better fused and expressed, a signal peptide analysis software (SignalP) and a transmembrane domain analysis software (TMHMM) are utilized to respectively analyze the amino acid sequence of the ASFV envelope protein P54, so that the amino acid sequence of the ASFV envelope protein P54 has no signal peptide, the extracellular region has only 29 amino acids, and as the full length of the ASFV envelope protein P54 has only 184 amino acids, the complete ASFV envelope protein P54 and ferritin gene sequence are fused and expressed; the specific design scheme is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine.

Plasmid construction of 3 African swine fever virus and ferritin fusion protein

PCR amplification of ASFV P54 sequence: plasmid pUC57-ASFV P54 was used as a template, and the amplification primers were as follows:

F9	5’-CGGGATCCATGGACAGCGAGTTC-3’
		R9	5’-CAGCTTGATGATGTCGCCACCGGACAGTGAGTTTTCCAGGTCTTTGTG-3’

F10	5’-CACAAAGACCTGGAAAACTCACTGTCCGGTGGCGACATCATCAAGCTG-3’
		R10	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

taking PCR products ASFV P54 and Ferritin as templates, performing Overlap-PCR amplification to obtain ASFV P54-Ferritin, wherein amplification primers are as follows:

F9	5’-CGGGATCCATGGACAGCGAGTTC-3’
		R10	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1.2 PCR amplification of expression plasmids in silkworm expression systems

F11	5’-CGGGATCCAACATGGACAGCGAGTTC-3’
		R11	5’-CAGCTTGATGATGTCGCCACCGGACAGTGAGTTTTCCAGGTCTTTGTG-3’

F12	5’-CACAAAGACCTGGAAAACTCACTGTCCGGTGGCGACATCATCAAGCTG-3’
		R12	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

F11	5’-CGGGATCCAACATGGACAGCGAGTTC-3’
		R12	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1 ligation and transformation of the target Gene with the pVL1393 vector

3.2 Rapid extraction of nucleic acids Positive clones

3.3SDS alkaline lysis method for extracting plasmid DNA

3.4 enzyme digestion and sequencing identification of Positive clones

4 expression and purification of recombinant plasmids

4.1 inducible expression of recombinant plasmids in E.coli

The specific experimental method is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine. SDS-PAGE analysis shows that pET28a-ASFV P54-Ferritin has a specific band at about 43kD, which is consistent with the expected size of recombinant protein with His, while the non-induced recombinant expression vector does not produce the specific band, indicating that the fusion protein is successfully expressed in Escherichia coli. There was a clear band in the pellet indicating that the recombinant protein His-ASFV P54-Ferritin exists mainly in the form of insoluble inclusion bodies, and the polypropylene gel electrophoresis pattern is shown in FIG. 5.

4.3 Nickel column affinity chromatography purification of recombinant proteins

4.4 preparation of polyclonal antibodies

5.1 propagation of parent strains of Virus and preparation of viral DNA

5.3 amplification of recombinant viruses in cells

5.4 identification of recombinant viruses

5.5 recombinant Virus rBmBacmid (P)_PHExpression of ASFV P54-Ferritin) in silkworm bodies and pupae

5.6 identification and expression of recombinant virus rAcBacmid-ASFV P54-Ferritin in insect Hi 5-cell

6 Western blotting detection

The specific experimental method is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine. Western blotting results showed that a specific band of 43kD (ASFV P54-Ferritin) size was detectable in the supernatant of silkworm hemolymph samples after recombinant virus infection, as shown in FIG. 6.

7 ELISA detection

TABLE 6 ELISA Titers of ASFV P54-Ferritin Gene expression products

Group of	Potency of the drug
		Silkworm blood sample infected with parental virus (negative control)	1：4
ASFV P54-Ferritin (silkworm)	1：2048
		ASFV P54-Ferritin (AcMNPV-insect cell)	1：1024

And (3) judging an ELISA result: the positive result is that the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole) is more than or equal to 2.1, and the result shows that the ELISA titer of the ASFV P54-Ferritin (silkworm) gene expression product can reach 1: 2048, and the ELISA titer of an expression product of ASFV P54-Ferritin (AcMNPV-insect cell) gene in an AcMNPV-insect cell expression system can reach 1: 1024.

preparation and efficacy detection of ASFV CD2v-AC-Ferritin original sequence nanoparticle vaccine

1 arrangement of solutions and culture media

2ASFV CD2v-AC gene sequence and ferritin gene sequence.

The invention obtains 14 ASFV CD2v-AC amino acid sequences from NCBI to compare and obtain a homologous sequence, in order to ensure that the CD2v-AC homologous sequence and ferritin are better fused and expressed, the invention respectively analyzes the amino acid sequence of ASFV CD2v (SEQ ID NO.3) by using signal peptide analysis software (SignalP) and transmembrane domain analysis software (TMHMM), and obtains the ASFV CD2v protein, wherein the signal peptide is the first 15 amino acids, the extracellular domain is the first 206 amino acids (named as A region), and the intracellular domain is the last 130 amino acids (named as C region). According to the analysis result, the 2-23 th amino acid and 207-229 th amino acid (named as B region) of the sequence are removed and fused into the ASFV CD2v-AC gene sequence which is 336 amino acids long. The specific design scheme is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine.

Plasmid construction of 3 African swine fever virus and ferritin fusion protein

PCR amplification of ASFV CD2v-A sequence: plasmid pUC57-ASFV CD2v is taken as a template, and amplification primers are as follows:

F13	5’-CGGGATCCATGATCATTCTGATC-3’
		R13	5’-GTGTTTCTTTCTCTTTCTGAGGGAGTAGAGTTTGAAGAAAGTGTAGAA-3’

PCR amplification of ASFV CD2v-C sequence: plasmid pUC57-ASFV CD2v is taken as a template, and amplification primers are as follows:

F14	5’-TTCTACACTTTCTTCAAACTCTACTCCCTCAGAAAGAGAAAGAAACAC-3’
		R14	5’-CAGCTTGATGATGTCGCCACCGGAGATGATTCTATCCACGTGGATCAA-3’

ASFV CD2v-AC is amplified by using PCR products ASFV CD2v-A and ASFV CD2v-C as templates and performing Overlap-PCR, wherein amplification primers are as follows:

F13	5’-CGGGATCCATGATCATTCTGATC-3’
		R14	5’-CAGCTTGATGATGTCGCCACCGGAGATGATTCTATCCACGTGGATCAA-3’

F15	5’-TTGATCCACGTGGATAGAATCATCTCCGGTGGCGACATCATCAAGCTG-3’
		R15	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

the PCR products ASFV CD2v-AC and Ferritin are taken as templates, and the amplification primers are as follows:

F13	5’-CGGGATCCATGATCATTCTGATC-3’
		R15	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1.2 PCR amplification of expression plasmids in silkworm expression systems

PCR amplification of ASFV CD2v-AC sequence: plasmid pUC57-ASFV CD2v is taken as a template, and amplification primers are as follows:

F16	5’-CGGGATCCAACATGATCATTCTGATC-3’
		R16	5’-GTGTTTCTTTCTCTTTCTGAGGGAGTAGAGTTTGAAGAAAGTGTAGAA-3’

F17	5’-TTCTACACTTTCTTCAAACTCTACTCCCTCAGAAAGAGAAAGAAACAC-3’
		R17	5’-CAGCTTGATGATGTCGCCACCGGAGATGATTCTATCCACGTGGATCAA-3’

F16	5’-CGGGATCCATGATCATTCTGATC-3’
		R17	5’-CAGCTTGATGATGTCGCCACCGGAGATGATTCTATCCACGTGGATCAA-3’

F18	5’-TTGATCCACGTGGATAGAATCATCTCCGGTGGCGACATCATCAAGCTG-3’
		R18	5’-GCGAATTCTTAGCTCTTGCGGGACTTGGCGAT-3’

3.1 ligation and transformation of the target Gene with the pVL1393 vector

3.2 Rapid extraction of nucleic acids Positive clones

3.3SDS alkaline lysis method for extracting plasmid DNA

3.4 enzyme digestion and sequencing identification of Positive clones

4 expression and purification of recombinant plasmids

4.1 inducible expression of recombinant plasmids in E.coli

The specific experimental method is shown in the preparation and efficacy detection of ASFV P72-Ferritin optimized sequence nano-particle vaccine. SDS-PAGE analysis shows that pET28a-ASFV CD2v-AC-Ferritin presents a specific band at about 58kD, which is consistent with the expected size of recombinant protein with His, while the non-induced recombinant expression vector does not produce the specific band, which indicates that the fusion protein is successfully expressed in Escherichia coli. There was a clear band in the pellet indicating that the recombinant protein His-ASFV CD2v-AC-Ferritin exists mainly in the form of insoluble inclusion bodies, and the polypropylene gel electrophoresis pattern is shown in FIG. 7.

4.3 Nickel column affinity chromatography purification of recombinant proteins

4.4 preparation of polyclonal antibodies

5.1 propagation of parent strains of Virus and preparation of viral DNA

5.3 amplification of recombinant viruses in cells

5.4 identification of recombinant viruses

5.5 recombinant Virus rBmBacmid (P)_PHExpression of ASFV CD2v-AC-Ferritin) in silkworm and silkworm pupae

5.6 identification and expression of recombinant virus rAcBacmid-ASFV CD2v-AC-Ferritin in insect Hi 5-cell

6 Western blotting detection

Western blotting results showed that a specific band of 43kD (ASFV CD2v-AC-Ferritin) size was detectable in the supernatant of silkworm hemolymph samples after recombinant virus infection, as shown in FIG. 8.

7 ELISA detection

TABLE 6 ELISA Titers of ASFV CD2v-AC-Ferritin Gene expression products

Group of	Potency of the drug
		Silkworm blood sample infected with parental virus (negative control)	1：4
ASFV CD2v-AC-Ferritin (silkworm)	1：4096
		ASFV CD2v-AC-Ferritin (AcMNPV-insect cell)	1：2048

And (3) judging an ELISA result: the positive result is that the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole) is more than or equal to 2.1, and the result shows that the ELISA titer of the ASFV CD2v-AC-Ferritin (silkworm) gene expression product can reach 1: 4096 and the ELISA titer of the expression product of ASFV CD2v-AC-Ferritin (AcMNPV-insect cell) gene in an AcMNPV-insect cell expression system can reach 1: 2048.

example 2 preparation and potency assay of three presented viral constructs, pCMV-sHAPQ, pCMV-UbsHAPQ and pCMV-Th1-sHAPQ-Th2

Firstly, preparation and efficacy detection of pCMV-sHAPQ presenting virus structure

1 arrangement of solutions and culture media

Synthesis of 2 sHAPQ Gene sequence.

The invention will utilize the consensus sequences of ASFV phosphoprotein P30, envelope protein P54 and CD2v (hemagglutinin, HA) in example 1. According to Jord: 2012 plasmid construction scheme designs sHAPQ amino acid sequence, inserts ASFV phosphoprotein P30 amino acid sequence into the corresponding Not I recognition enzyme sequence in the ASFV envelope protein P54 amino acid sequence, and connects the N-terminal of ASFV envelope protein P54 amino acid sequence to the C-terminal of ASFV CD2v structural protein extracellular domain (sHA) amino acid sequence, and the total length of the recombinant protein is 595 amino acids.

Further utilizing OptimumGene^TMThe technology optimizes the amino acid sequence of the antigen protein of the ASFV virus, modifies the amino acid sequence of the optimized antigen protein and the amino acid sequence of ferritin monomer subunit according to the preference of mammal codons, optimizes and designs a plurality of related parameters which affect the transcription efficiency and the translation efficiency of genes and the GC content, the CpG dinucleotide content, the preference of codons, the secondary structure of mRNA, the stability of free energy of mRNA, the gene sequence with RNA instability, the repetitive sequence and the like of protein folding, and keeps the translated protein sequence unchanged.

In order to improve the translation initiation efficiency of the target gene in mammals, a Kozak sequence GCCACC is added in front of the gene. In addition, restriction sites for BamHI, EcoRI and the like within the gene sequence were removed, BamHI was added upstream of the gene, and EcoRI restriction sites were added downstream of the gene for subsequent cloning into pCMV plasmid. The designed sHAPQ gene sequence was synthesized by related Biotechnology Inc.

Plasmid construction of 3 pCMV-sHAPQ

3.1 digestion of the synthetic plasmid pUC-57 sHAPQ

The synthetic plasmid pUC-57 sHAPQ was subjected to double digestion with restriction enzymes BamH I and EcoR I to obtain the desired fragment sHAPQ. The cleavage system is shown in Table 9 below:

TABLE 9 enzyme digestion System

3.2 purification and recovery of DNA fragments from glass milk

Preparing 1% (w/v) agarose gel, and carrying out electrophoresis on the enzyme-digested product; the agarose gel was placed under an ultraviolet lamp, and the gel of the corresponding target nucleic acid band was cut off rapidly and weighed in a 1.5mL centrifuge tube.

The specific experimental method is shown in the preparation and the efficacy detection of the ASFV P72-Ferritin optimized sequence nanoparticle vaccine in the example 1.

3.3 Mini-Production of competent cells

3.4 ligation and transformation of the target Gene with the pCMV vector

3.5 Rapid extraction of nucleic acids Positive clones were coarse screened

3.6 SDS alkaline lysis method for extracting plasmid DNA

3.7 enzyme digestion and sequencing identification of Positive clones

4 recombinant plasmid is expressed and purified in a silkworm eukaryotic expression system

4.1 reproduction of parent strain BmBacmid of Bombyx mori nuclear polyhedrosis virus and preparation of virus DNA

4.2 recombinant Bombyx mori baculovirus rBmBacmid (P)_PHConstruction and obtaining of pCMV-sHAPQ)

4.3 recombinant Virus rBmBacmid (P)_PH-pCMV-sHAPQ) amplification in Bombyx mori cells

4.4 identification of recombinant viruses

4.5 expression of pCMV-sHAPQ in silkworm bodies and pupae

4.6 Collection and purification of pCMV-sHAPQ recombinant viral particles

The specific baculovirus purification experiment method is shown in the baculovirus operation manual of Summers (1982) and the insect virus molecular biology of Mr. Luhong (1998), and the like.

5 IFNγ-ELISPOT

By carbonic acidSaline buffer (pH9.6) diluted 8.3mg/ml IFN gamma capture antibody, added to 96 hole plate coating overnight. The plates were then washed and blocked with 0.5% BSA at 37 ℃ for 1 h. About 5X 10 to each well⁵PBMCs of animals were immunized with baculovirus presenting the corresponding foreign gene for presentation and incubated at 37 ℃ for 20h in an atmosphere of 5% CO2 with the addition of 100. mu.L/well of 6mg/ml of the relevant protein as a stimulator. Cells were discarded, 200. mu.L/well of deionized water was added, and the cells were lysed by placing in a freezer at 4 ℃ for 10 min. Washed 5 times with 1 × Washing buffer, 200 μ L/well, and finally dried with absorbent paper. mu.L/well was added 2.5mg/ml biotin-labeled antibody and incubated at 37 ℃ for 1 h. Washed 5 times with 1 × Washing buffer, 200 μ L/well, and finally dried with absorbent paper. Incubation was continued for 1h with 100. mu.L/well of enzyme-labeled avidin. Washed 5 times with 1 × Washing buffer, 200 μ L/well, and finally dried with absorbent paper. Adding AEC color developing solution into the well at a concentration of 100. mu.L, and standing in dark at 25 ℃ for 30 min. Discarding the liquid in the hole, adding deionized water, washing for 5 times, stopping displaying, and air drying in shade. Meanwhile, unstimulated cells are used as a blank control, and a silkworm blood sample infected by the parental virus stimulates cells of an animal to be used as a negative control. Spots were counted using an ELISPOT meter and analyzed.

TABLE 10 results of IFN γ -ELISPOT as an expression product of sHAPQ Gene

Group of	Dot counts (cells/million PBMC)
		Silkworm blood sample infected with parental virus (negative control)	12
After sHAPQ presentation	76

And (3) judging IFN gamma-ELISPOT results: in general, the normal result is a spot count of ≦ 20 for the negative control (N) well, while the spots for the positive control (P) well are spread throughout the well. The result shows that the result of sHAPQ gene expression product IFN gamma-ELISPOT can reach 76.

Second, preparation and efficacy test of pCMV-UbsHAPQ presenting virus construct

1 arrangement of solutions and culture media

Synthesis of 2 UbsHAPQ Gene sequence.

According to the invention, a Ubiquitin 76 amino acid conserved sequence (> ABO84843.1 Ubiquitin B [ Sus scrofa ] and > CAA35999.1ubiquitin [ Mus mulus ]) is selected as the Ubiquitin amino acid sequence, and the Ubiquitin amino acid mutation G76A (GGC-CGC) is subjected to enhanced presentation according to the method of Rodriguez and the like. According to the DNA vaccine construction method of PRRSV in 2004 of agricultural university in China, a pcDNA vector ubiquitin-linker (GGTGGCGGCGGATCC) -GP5 protein sequence is used. According to Jord: 2012 plasmid construction scheme sHAPQ amino acid sequence is designed by linking the C-terminus of ubiquitin-linker to the N-terminus of sHAPQ sequence. The total length of the recombinant protein is 679 amino acids.

The specific experimental method is shown in the preparation and the efficacy detection of the pCMV-sHAPQ presenting virus structure in example 2.

Plasmid construction of 3 pCMV-UbsHAPQ

3.1 digestion of the synthetic plasmid pUC-57UbsHAPQ

3.2 purification and recovery of DNA fragments from glass milk

3.3 Mini-Production of competent cells

3.4 ligation and transformation of the target Gene with the pCMV vector

3.5 Rapid extraction of nucleic acids Positive clones were coarse screened

3.6 SDS alkaline lysis method for extracting plasmid DNA

3.7 enzyme digestion and sequencing identification of Positive clones

4 recombinant plasmid pCMV-UbsHAPQ is expressed and purified in a silkworm eukaryotic expression system

4.2 recombinant Bombyx mori baculovirus rBmBacmid (P)_PHConstruction and obtaining of pCMV-UbsHAPQ)

4.3 recombinant Virus rBmBacmid (P)_PHpCMV-UbsHAPQ) amplification in Bombyx mori cells

4.4 identification of recombinant viruses

4.5 expression of pCMV-UbsHAPQ in silkworm bodies and pupae

4.6 Collection and purification of pCMV-UbsHAPQ recombinant viral particles

5 IFNγ-ELISPOT

TABLE 11 sHAPQ Gene expression product IFN γ -ELISPOT results

Group of	Dot counts (cells/million PBMC)
		Silkworm blood sample infected with parental virus (negative control)	12
After UbisHAPQ presentation	102

And (3) judging IFN gamma-ELISPOT results: in general, the normal result is a spot count of ≦ 20 for the negative control (N) well, while the spots for the positive control (P) well are spread throughout the well. The result shows that the result of the sHAPQ gene expression product IFN gamma-ELISPOT can reach 102.

Third, preparation and efficacy test of pCMV-Th1-sHAPQ-Th2 presentation virus construct

1 arrangement of solutions and culture media

Synthesis of 2 Th1-sHAPQ-Th2 gene sequence.

The recombinant protein has the total length of 633 amino acids, wherein the C-terminal of UBITh 1 is connected with the N-terminal of an sHAPQ amino acid sequence, the N-terminal of UBITh 2 is connected with the C-terminal of the sHAPQ amino acid sequence, and the total length of the recombinant protein is 633 amino acids.

Plasmid construction of 3 pCMV-UbsHAPQ

3.1 digestion of the synthetic plasmid pUC-57UbsHAPQ

3.2 purification and recovery of DNA fragments from glass milk

3.3 Mini-Production of competent cells

3.4 ligation and transformation of the target Gene with the pCMV vector

3.5 Rapid extraction of nucleic acids Positive clones were coarse screened

3.6 SDS alkaline lysis method for extracting plasmid DNA

3.7 enzyme digestion and sequencing identification of Positive clones

4.4 identification of recombinant viruses

4.5 expression of pCMV-UbsHAPQ in silkworm bodies and pupae

4.6 Collection and purification of pCMV-UbsHAPQ recombinant viral particles

5 IFNγ-ELISPOT

TABLE 12 results of IFN γ -ELISPOT as an expression product of sHAPQ gene

Group of	Dot counts (cells/million PBMC)
		Silkworm blood sample infected with parental virus (negative control)	12
After UbisHAPQ presentation	136

And (3) judging IFN gamma-ELISPOT results: in general, the normal result is a spot count of ≦ 20 for the negative control (N) well, while the spots for the positive control (P) well are spread throughout the well. The result shows that the result of sHAPQ gene expression product IFN gamma-ELISPOT can reach 136.

Example 3 construction of recombinant viruses for mammalian expression of pVL-CAG-Th1-sHAPQ-Th2 baculovirus and animal experiments

1. Construction of pVL-CAG vector

Specific experimental methods were performed with reference to the method of expressing an exogenous gene in animal cells or animal tissues [ P ]. china: ZL 201210408558.4 ], by zhangshihan, yabin, anecdotal et al, to construct recombinant baculovirus transfer vectors that present the exogenous gene in vertebrate cells or individuals.

2. Construction of recombinant viruses presenting reporter genes

2.1 cloning ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin, ASFV CD2v-AC-Ferritin and Th1-sHAPQ-Th2 genes to gene presentation transfer vector

ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin, ASFV CD2v-AC-Ferritin and Th1-sHAPQ-Th2 gene fragments with enzyme cutting sites are cut and recycled to be connected with pVLCAG vector which is cut by the same enzyme, and pVL-CAG-P72-Ferritin, pVL-CAG-P30-Ferritin, pVL-CAG-P54-Ferritin, pVL-CAG-CD2v-AC-Ferritin and pVL-CAG-Th1-sHAPQ-Th2 are obtained after the identification is correct.

2.2 construction of recombinant viruses for Gene presentation and preparation thereof in Large quantities

Recombinant viruses Bm-CAG-P72-Ferritin, Bm-CAG-P30-Ferritin, Bm-CAG-P54-Ferritin, Bm-CAG-CD2v-AC-Ferritin and Bm-CAG 1-sHAPQ-Th2 were obtained by co-transfecting BmN cells with pVL-CAG-P72-Ferritin, pVL-CAG-P30-Ferritin, pVL-CAG-P54-sHAPQ-Th 2 transfer vectors, respectively, and BmBac was used to determine the success of co-transfection by using pVL1393-Luc as a control during co-transfection, and virus purification was as above. Infecting larva of a 5-year-old silkworm with the recombinant virus, and harvesting silkworm hemolymph after 4-5 days, wherein the silkworm hemolymph contains a large amount of amplified recombinant virus.

Silkworm hemolymph was diluted with PBS and sonicated (10 s.times.10 times), and then centrifuged at 12000rpm for 10 minutes to remove cell debris, followed by 1.5X 10⁵g centrifuging for 3h, removing supernatant, and resuspending the precipitate with appropriate amount of PBS to obtain virus particles of primarily purified recombinant baculovirus, wherein the recombinant virus of 10mL silkworm blood is resuspended with 2mL LPBS after centrifugation, and the amount of the recombinant virus after resuspension is about 2.5 × 10¹²PFU/mL (about 5X 10)¹²viral genes (vg)/mL, viral copy number was calculated by fluorescent quantitative PCR using BmNPV viral DNA backbone sequence primers, GJ-1F (CGAACGGAGACGATGGATGGATGGGATC) and GJ-1R (GTGCCGAGCGATTGTAAGGGATC).

3 expression of recombinant viruses in mammalian cells

Using VERO cells as the target of gene presentation, the recombinant viruses Bm-CAG-P72-Ferritin, Bm-CAG-P30-Ferritin, Bm-CAG-P54-Ferritin, Bm-CAG-CD2v-AC-Ferritin and Bm-CAG Th1-sHAPQ-Th2 were each subjected to a study using 100MOI of the virus. The method comprises the following steps:

1) six well plates were seeded with VERO cells (1X 10)⁶cell/well), adherent culture at 37 ℃ for 8-12h

2) Take 1X 10⁸PFU purified recombinant virus Bm-CAG-P72-Ferritin, Bm-CAG-P30-Ferritin, Bm-CAG-P54-Ferritin, Bm-CAG-CD2v-AC-Ferritin and Bm-CAG Th1-sHAPQ-Th2 are added to cells of a six-well plate respectivelyAnd incubating at 37 ℃ for 1 h.

3) And (3) removing a culture medium containing viruses after incubation, replacing a normal DMEM serum-containing culture medium, treating cells for about 42 hours, collecting expression products, and detecting the titer of each expression product by ELISA (enzyme-Linked immuno sorbent assay) until the titer is not lower than 1: 512.

4 animal test

4.1 immunizing animal with ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin expression product expressed by Escherichia coli

Expressing the gene sequences of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin which are obtained by analysis in an escherichia coli expression system respectively, obtaining corresponding fusion proteins after purification, mixing the 4 fusion proteins according to a proportion until the total protein is 24mg/ml, and immunizing animals according to 24 mu g of the total protein of 4 proteins.

The preparation method comprises the following steps: the mixture of 4 fusion proteins was aspirated by 100. mu.L, added to 9.9mL of PBS buffer, mixed well to prepare a mother solution, and the mother solution was put into a sterile vial. The 206 adjuvant is sterilized in advance and then is put into an incubator at 30 ℃ for heat preservation. An appropriate amount of mother liquor is put on ice and adjusted, 3mL of adjuvant is added into a 15mL centrifuge tube when the mother liquor is mixed with the adjuvant, 3mL of mother liquor is slowly dropped, and a homogenizer is used for homogenizing for 3 min. Adding ciprofloxacin hydrochloride, wherein the using amount is 30-50 mg/1kg of mouse weight. The vaccine is milk white, a small amount of the vaccine can be taken out when the quality of the vaccine is detected, the vaccine is centrifuged at 3000rpm for 15min, and the vaccine is qualified if the vaccine is not layered. The empty pET-28a vector sample was treated in the same manner to prepare a vaccine control.

After 40 SPF mice were taken and acclimatized for one week, they were randomly divided into 4 groups of 10 mice each, of which 1 part (0.2mL) of vaccine prepared by mixing 4 fusion proteins expressed in an escherichia coli expression system was perfused into 1 group of mice. 10 vaccines prepared by inoculating empty pET-28a vector are used as a negative immune group, 10 vaccines are used as a normal control group without immune treatment, and 10 vaccines are used as a negative control group by inoculating prokaryotic expression products. After 15 days of inoculation, blood is collected from the orbit, about 1mL of blood is collected, the blood is placed in a test tube in an inclined mode, the test tube is placed at 37 ℃ for 2 hours, and then the test tube is turned to the room temperature to be overnight. Transferring the serum into a centrifugal tube for 2000rpmin and 10min, collecting the serum, and detecting the antibody titer in the serum by using mixed protein of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin expressed by silkworm eukaryotic nucleus as antigen. The antibody titer of the negative immunization group should not be higher than 1: 4, the antibody titer of the vaccine strains of the prokaryotic expression products is 1: 128 or more, the antibody titer of the same sample group but expressed by the silkworm eukaryotic expression system is 1: more than 256.

4.2 immunizing animals with baculovirus-expressed ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin expression products

Selecting a silkworm eukaryotic expression system for expression, expressing and quantifying the analyzed ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin gene sequences in the silkworm eukaryotic expression system respectively, preparing 4 silkworm pupa samples into mother liquor, mixing the mother liquor according to a proper proportion, immunizing animals according to the amount of 24 mu g/silkworm pupa, and preparing 25 doses/g silkworm pupa titer vaccines according to the ELISA of a quantitative experiment.

The preparation method comprises the following steps: weighing 10g of silkworm pupas expressing ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin nanoparticle antigen, adding 90mL of PBS buffer solution, stirring for 5-10 min by a stirrer to fully mix, and preparing into mother liquor to be put into a sterilization bottle. The 206 adjuvant is sterilized in advance and then is put into an incubator at 30 ℃ for heat preservation. Putting a proper amount of mother liquor on ice, adjusting, adding 4mL of adjuvant into a 15mL centrifuge tube when mixing with the adjuvant, mixing 4 kinds of nanoparticle antigens in equal volume, slowly dropping 4mL of mixed liquor, and homogenizing for 3min by a homogenizer. Adding ciprofloxacin hydrochloride, wherein the using amount is 30-50 mg/1kg of mouse weight. The vaccine is milk white, a small amount of the vaccine can be taken out when the quality of the vaccine is detected, the vaccine is centrifuged at 3000rpm for 15min, and the vaccine is qualified if the vaccine is not layered. The same method is used to treat healthy pupa Bombycis to obtain vaccine as control.

Expressing the analyzed ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin gene sequences in an AcBacmid-insect cell eukaryotic expression system to obtain cell precipitates, mixing 4 expression products in equal proportion, and injecting the animal according to the amount of 24 mu g of total protein per animal.

The preparation method comprises the following steps: the antigen expressed by insect cells is prepared by mixing corresponding adjuvant after the cell precipitation amount of protein content required by the vaccine preparation is determined and is subjected to ultrasonic disruption.

After 50 SPF mice are taken and adaptively fed for one week, the SPF mice are randomly divided into 5 groups of 10 mice, wherein the two groups of mice are respectively perfused with 1 part (0.2mL) of vaccine prepared by expression products of mixed protein in a silkworm eukaryotic expression system and an AcMNPV-insect cell expression system. The vaccine prepared by inoculating 10 healthy silkworm pupas is used as a negative silkworm pupa immune group, 10 silkworm pupas are used as a normal control group without immune treatment, and 10 inoculated prokaryotic expression products are used as antigens as negative controls. After 15 days of inoculation, blood is collected from the orbit, about 1mL of blood is collected, the blood is placed in a test tube in an inclined mode, the test tube is placed at 37 ℃ for 2 hours, and then the test tube is turned to the room temperature to be overnight. Transferring the serum into a centrifugal tube for 2000rpmin and 10min, collecting the serum, and detecting the antibody titer in the serum by using mixed protein of prokaryotic expression ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin as antigen. The antibody titer of the negative silkworm pupa immune group should be not higher than 1: 4, the antibody titer of the prokaryotic expression product as an antigen is 1: 128, and the antibody titer of the sample group expressed by the silkworm eukaryotic expression system is 1: 256 or more, the antibody titer of the sample set expressed by the AcMNPV-insect cell expression system was 1: above 128.

4.3 presentation of Th1-sHAPQ-Th2 Gene boosting Effect in mice Using recombinant viruses

The ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin gene sequences are respectively expressed in an escherichia coli expression system, and corresponding fusion proteins are obtained after purification, (see the above specific operation) the 4 fusion proteins are mixed to total protein 24mg/ml according to a proportion, and animals are immunized according to the total amount of the 4 proteins 24 mu g/animal, see the above specific experiment. Immunization experiments were performed by tail vein injection (1X 10) of Bm-CAG Th1-sHAPQ-Th2 and purified recombinant virus, respectively¹²vg/v) or perfusion (1X 10)¹²vg/mouse) are sent into a mouse body, and prokaryotic expression of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and A is respectively usedSFV CD2v-AC-Ferritin mixed protein, corresponding antigen is used to detect antibody titer, and whether immune effect is enhanced after presentation of cell factor Th1-sHAPQ-Th2, etc. is determined.

The gene sequences of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin obtained by analysis are respectively expressed and quantified in a silkworm eukaryotic expression system, the obtained 4 silkworm pupa samples are prepared into mother liquor and then mixed according to a proper proportion, animals are immunized according to the amount of 24 mu g/silkworm, and 25 doses/g silkworm pupa vaccine is prepared according to the ELISA titer of a quantitative experiment (see the above specific operation). Immunization experiments were performed by tail vein injection (1X 10) of Bm-CAG Th1-sHAPQ-Th2 and purified recombinant virus, respectively¹²vg/v) or perfusion (1X 10)¹²vg/mouse) into a mouse body; similarly, the mixed protein of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin which are respectively expressed by pronucleus is used for detecting the antibody titer by using corresponding antigens, and whether the immune effect is enhanced after presentation by the cell factor Th1-sHAPQ-Th2 and the like is checked.

Mixing purified recombinant viruses Bm-CAG-P72-Ferritin, Bm-CAG-P30-Ferritin, Bm-CAG-P54-Ferritin and Bm-CAG-CD2v-AC-Ferritin for immune experiment, and injecting the mixture with purified recombinant virus Bm-CAG Th1-sHAPQ-Th2 through tail vein (1 × 10)¹²vg/v) or perfusion (1X 10)¹²vg/mouse) into a mouse body; similarly, the mixed protein of ASFV P72-Ferritin, ASFV P30-Ferritin, ASFV P54-Ferritin and ASFV CD2v-AC-Ferritin which are respectively expressed by pronucleus is used for detecting the antibody titer by using corresponding antigens, and whether the immune effect is enhanced after presentation by the cell factor Th1-sHAPQ-Th2 and the like is checked.

4.4 antibody titer determination

See above for the specific experimental procedures, the antibody titer was highest at day 21, and the specific results are shown in table 13.

TABLE 13 Th1-sHAPQ-Th2 mouse serum antibody titers (day 21)

As can be seen from the data in Table 13, when Th1-sHAPQ-Th2 is presented in animals, the mixed antigen of P72-Ferritin, P30-Ferritin, P54-Ferritin and CD2v-AC-Ferritin genes can significantly improve the immune effect whether it is a eukaryotic expression product, a prokaryotic expression product or presented in animals as antigen expression. Wherein, the mice are immunized by a mixed sample of eukaryon expressed P72-Ferritin, P30-Ferritin, P54-Ferritin and CD2v-AC-Ferritin, and the animal generates the highest antibody titer under the condition that Th1-sHAPQ-Th2 exists as a cell factor, and the titer generated by the cell factor is the most obvious.

5. Sentinel pig monitoring test after pig immunization

The average weight of a litter of piglets is about 15-20 kg, and 16 piglets are taken as experimental materials. According to the results of mouse experiments, the immune dose is adjusted, the injection method of eukaryotic expression P72-Ferritin, P30-Ferritin, P54-Ferritin and CD2v-AC-Ferritin mixed samples is adopted to immunize piglets to be immunized with a vaccination mode of enhancing the immune effect of the piglets by the cell factor presenting cell of Th1-sHAPQ-Th2, 6 piglets are treated with negative expression silkworm pupa products according to the same mode as a control, the antibody change rule of corresponding experimental animals is detected, and the method is carried out according to a normal feeding process. In the experiment process, in addition, the epidemic of African swine fever occurs in a feeding farm, and the farm side carries out corresponding sick pig and environment disinfection treatment according to the national regulation. The experimental pigs are used as sentinel pigs and are fed in the same environment of the pig farm, and the monitoring experiment result shows that: 10 immune pigs have no disease, and the sample is detected by a PCR detection kit and has no positive; and 6 pigs serving as controls show a typical African swine fever disease in a short period of time during the monitoring and feeding process, and the sampling and PCR detection are carried out when the 6 pigs are raised, so that the virus is positive. All experimental pigs were treated according to the requirements set by the state. The results show that the disinfection of a certain pig farm is not thorough, and the disinfection mode needs to be improved.

SEQUENCE LISTING

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> African swine fever vaccine and preparation method thereof

<130> BJ-2002-210114A

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 812

<212> PRT

<213> Artifical sequence

<400> 1

Met Ala Ser Gly Gly Ala Phe Cys Leu Ile Ala Asn Asp Gly Lys Ala

1 5 10 15

Asp Lys Ile Ile Leu Ala Gln Asp Leu Leu Asn Ser Arg Ile Ser Asn

20 25 30

Ile Lys Asn Val Asn Lys Ser Tyr Gly Lys Pro Asp Pro Glu Pro Thr

35 40 45

Leu Ser Gln Ile Glu Glu Thr His Leu Val His Phe Asn Ala His Phe

50 55 60

Lys Pro Tyr Val Pro Val Gly Phe Glu Tyr Asn Lys Val Arg Pro His

65 70 75 80

Thr Gly Thr Pro Thr Leu Gly Asn Lys Leu Thr Phe Gly Ile Pro Gln

85 90 95

Tyr Gly Asp Phe Phe His Asp Met Val Gly His His Ile Leu Gly Ala

100 105 110

Cys His Ser Ser Trp Gln Asp Ala Pro Ile Gln Gly Thr Ser Gln Met

115 120 125

Gly Ala His Gly Gln Leu Gln Thr Phe Pro Arg Asn Gly Tyr Asp Trp

130 135 140

Asp Asn Gln Thr Pro Leu Glu Gly Ala Val Tyr Thr Leu Val Asp Pro

145 150 155 160

Phe Gly Arg Pro Ile Val Pro Gly Thr Lys Asn Ala Tyr Arg Asn Leu

165 170 175

Val Tyr Tyr Cys Glu Tyr Pro Gly Glu Arg Leu Tyr Glu Asn Val Arg

180 185 190

Phe Asp Val Asn Gly Asn Ser Leu Asp Glu Tyr Ser Ser Asp Val Thr

195 200 205

Thr Leu Val Arg Lys Phe Cys Ile Pro Gly Asp Lys Met Thr Gly Tyr

210 215 220

Lys His Leu Val Gly Gln Glu Val Ser Val Glu Gly Thr Ser Gly Pro

225 230 235 240

Leu Leu Cys Asn Ile His Asp Leu His Lys Pro His Gln Ser Lys Pro

245 250 255

Ile Leu Thr Asp Glu Asn Asp Thr Gln Arg Thr Cys Ser His Thr Asn

260 265 270

Pro Lys Phe Leu Ser Gln His Phe Pro Glu Asn Ser His Asn Ile Gln

275 280 285

Thr Ala Gly Lys Gln Asp Ile Thr Pro Ile Thr Asp Ala Thr Tyr Leu

290 295 300

Asp Ile Arg Arg Asn Val His Tyr Ser Cys Asn Gly Pro Gln Thr Pro

305 310 315 320

Lys Tyr Tyr Gln Pro Pro Leu Ala Leu Trp Ile Lys Leu Arg Phe Trp

325 330 335

Phe Asn Glu Asn Val Asn Leu Ala Ile Pro Ser Val Ser Ile Pro Phe

340 345 350

Gly Glu Arg Phe Ile Thr Ile Lys Leu Ala Ser Gln Lys Asp Leu Val

355 360 365

Asn Glu Phe Pro Gly Leu Phe Val Arg Gln Ser Arg Phe Ile Ala Gly

370 375 380

Arg Pro Ser Arg Arg Asn Ile Arg Phe Lys Pro Trp Phe Ile Pro Gly

385 390 395 400

Val Ile Asn Glu Ile Ser Leu Thr Asn Asn Glu Leu Tyr Ile Asn Asn

405 410 415

Leu Phe Val Thr Pro Glu Ile His Asn Leu Phe Val Lys Arg Val Arg

420 425 430

Phe Ser Leu Ile Arg Val His Lys Thr Gln Val Thr His Thr Asn Asn

435 440 445

Asn His His Asp Glu Lys Leu Met Ser Ala Leu Lys Trp Pro Ile Glu

450 455 460

Tyr Met Phe Ile Gly Leu Lys Pro Thr Trp Asn Ile Ser Asp Gln Asn

465 470 475 480

Pro His Gln His Arg Asp Trp His Lys Phe Gly His Val Val Asn Ala

485 490 495

Ile Met Gln Pro Thr His His Ala Glu Ile Ser Phe Gln Asp Arg Asp

500 505 510

Thr Ala Leu Pro Asp Ala Cys Ser Ser Ile Ser Asp Ile Ser Pro Val

515 520 525

Thr Tyr Pro Ile Thr Leu Pro Ile Ile Lys Asn Ile Ser Val Thr Ala

530 535 540

His Gly Ile Asn Leu Ile Asp Lys Phe Pro Ser Lys Phe Cys Ser Ser

545 550 555 560

Tyr Ile Pro Phe His Tyr Gly Gly Asn Ala Ile Lys Thr Pro Asp Asp

565 570 575

Pro Gly Ala Met Met Ile Thr Phe Ala Leu Lys Pro Arg Glu Glu Tyr

580 585 590

Gln Pro Ser Gly His Ile Asn Val Ser Arg Ala Arg Glu Phe Tyr Ile

595 600 605

Ser Trp Asp Thr Asp Tyr Val Gly Ser Ile Thr Thr Ala Asp Leu Val

610 615 620

Val Ser Ala Ser Ala Ile Asn Phe Leu Leu Leu Gln Asn Gly Ser Ala

625 630 635 640

Val Leu Arg Tyr Ser Thr Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn

645 650 655

Glu Gln Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met

660 665 670

Ser Ser Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu

675 680 685

Phe Asp His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile

690 695 700

Phe Leu Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala

705 710 715 720

Pro Glu His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr

725 730 735

Glu His Glu Gln His Ile Ser Glu Ser Ile Asn Asn Ile Val Asp His

740 745 750

Ala Ile Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr

755 760 765

Val Ala Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp

770 775 780

Lys Ile Glu Leu Ile Gly Asn Glu Asn His Gly Leu Tyr Leu Ala Asp

785 790 795 800

Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg Lys Ser

805 810

<210> 2

<211> 370

<212> PRT

<213> Artifical sequence

<400> 2

Met Asp Phe Ile Leu Asn Ile Ser Met Lys Met Glu Val Ile Phe Lys

1 5 10 15

Thr Asp Leu Arg Ser Ser Ser Gln Val Val Phe His Ala Gly Ser Leu

20 25 30

Tyr Asn Trp Phe Ser Val Glu Ile Ile Asn Ser Gly Arg Ile Val Thr

35 40 45

Thr Ala Ile Lys Thr Leu Leu Ser Thr Val Lys Tyr Asp Ile Val Lys

50 55 60

Ser Ala Arg Ile Tyr Ala Gly Gln Gly Tyr Thr Glu His Gln Ala Gln

65 70 75 80

Glu Glu Trp Asn Met Ile Leu His Val Leu Phe Glu Glu Glu Thr Glu

85 90 95

Ser Ser Ala Ser Ser Glu Asn Ile His Glu Lys Asn Asp Asn Glu Thr

100 105 110

Asn Glu Cys Thr Ser Ser Phe Glu Thr Leu Phe Glu Gln Glu Pro Ser

115 120 125

Ser Glu Val Pro Lys Asp Ser Lys Leu Tyr Met Leu Ala Gln Lys Thr

130 135 140

Val Gln His Ile Glu Gln Tyr Gly Lys Ala Pro Asp Phe Asn Lys Val

145 150 155 160

Ile Arg Ala His Asn Phe Ile Gln Thr Ile Tyr Gly Thr Pro Leu Lys

165 170 175

Glu Glu Glu Lys Glu Val Val Arg Leu Met Val Ile Lys Leu Leu Lys

180 185 190

Lys Asn Lys Leu Leu Ser His Leu His Leu Met Phe Ser Gly Gly Asp

195 200 205

Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser

210 215 220

Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp

225 230 235 240

Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His

245 250 255

Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln

260 265 270

Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln

275 280 285

Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile

290 295 300

Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe

305 310 315 320

Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu

325 330 335

Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His

340 345 350

Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg

355 360 365

Lys Ser

370

<210> 3

<211> 350

<212> PRT

<213> Artifical sequence

<400> 3

Met Asp Ser Glu Phe Phe Gln Pro Val Tyr Pro Arg His Tyr Gly Glu

1 5 10 15

Cys Leu Ser Pro Val Thr Thr Pro Ser Phe Phe Ser Thr His Met Tyr

20 25 30

Thr Ile Leu Ile Ala Ile Val Val Leu Val Ile Ile Ile Ile Val Leu

35 40 45

Ile Tyr Leu Phe Ser Ser Arg Lys Lys Lys Ala Ala Ala Ile Glu Glu

50 55 60

Glu Asp Ile Gln Phe Ile Asn Pro Tyr Gln Asp Gln Gln Trp Val Glu

65 70 75 80

Val Thr Pro Gln Pro Gly Thr Ser Lys Pro Ala Gly Ala Thr Thr Ala

85 90 95

Ser Val Gly Lys Pro Val Thr Gly Arg Pro Ala Thr Asn Arg Pro Ala

100 105 110

Thr Asn Lys Pro Val Thr Asp Asn Pro Val Thr Asp Arg Leu Val Met

115 120 125

Ala Thr Gly Gly Pro Ala Ala Ala Pro Ala Ala Ala Ser Ala Pro Ala

130 135 140

His Pro Ala Glu Pro Tyr Thr Thr Val Thr Thr Gln Asn Thr Ala Ser

145 150 155 160

Gln Thr Met Ser Ala Ile Glu Asn Leu Arg Gln Arg Asn Thr Tyr Thr

165 170 175

His Lys Asp Leu Glu Asn Ser Leu Ser Gly Gly Asp Ile Ile Lys Leu

180 185 190

Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met

195 200 205

Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu

210 215 220

Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu

225 230 235 240

Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile

245 250 255

Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys

260 265 270

Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile Asn Asn Ile Val

275 280 285

Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe Asn Phe Leu Gln

290 295 300

Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile

305 310 315 320

Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His Gly Leu Tyr Leu

325 330 335

Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg Lys Ser

340 345 350

<210> 4

<211> 481

<212> PRT

<213> Artifical sequence

<400> 4

Met Lys Thr Ile Ile Leu Asp Ser Asn Ile Thr Asn Asp Asn Asn Asp

1 5 10 15

Ile Asn Gly Val Ser Trp Asn Phe Phe Asn Asn Ser Phe Asn Thr Leu

20 25 30

Ala Thr Cys Gly Lys Ala Gly Asn Phe Cys Glu Cys Ser Asn Tyr Ser

35 40 45

Thr Ser Ile Tyr Asn Ile Thr Asn Asn Cys Ser Leu Thr Ile Phe Pro

50 55 60

His Asn Asp Val Phe Asp Thr Thr Tyr Gln Val Val Trp Asn Gln Ile

65 70 75 80

Ile Asn Tyr Thr Ile Lys Leu Leu Thr Pro Ala Thr Pro Pro Asn Ile

85 90 95

Thr Tyr Asn Cys Thr Asn Phe Leu Ile Thr Cys Lys Lys Asn Asn Gly

100 105 110

Thr Asn Thr Asn Ile Tyr Leu Asn Ile Asn Asp Thr Phe Val Lys Tyr

115 120 125

Thr Asn Glu Ser Ile Leu Glu Tyr Asn Trp Asn Asn Ser Asn Ile Asn

130 135 140

Asn Phe Thr Ala Thr Cys Ile Ile Asn Asn Thr Ile Ser Thr Ser Asn

145 150 155 160

Glu Thr Thr Leu Ile Asn Cys Thr Tyr Leu Thr Leu Ser Ser Asn Tyr

165 170 175

Phe Tyr Thr Phe Phe Lys Leu Tyr Ser Leu Arg Lys Arg Lys Lys His

180 185 190

Val Glu Glu Ile Glu Ser Pro Pro Pro Glu Ser Asn Glu Glu Glu Gln

195 200 205

Cys Gln His Asp Asp Thr Thr Ser Ile His Glu Pro Ser Pro Arg Glu

210 215 220

Pro Leu Leu Pro Lys Pro Tyr Ser Arg Tyr Gln Tyr Asn Thr Pro Ile

225 230 235 240

Tyr Tyr Met Arg Pro Ser Thr Gln Pro Leu Asn Pro Phe Pro Leu Pro

245 250 255

Lys Pro Cys Pro Pro Pro Lys Pro Cys Pro Pro Pro Lys Pro Cys Pro

260 265 270

Pro Pro Lys Pro Cys Pro Ser Ala Glu Ser Tyr Ser Pro Pro Lys Pro

275 280 285

Leu Pro Ser Ile Pro Leu Leu Pro Asn Ile Pro Pro Leu Ser Thr Gln

290 295 300

Asn Ile Ser Leu Ile His Val Asp Arg Ile Ile Ser Gly Gly Asp Ile

305 310 315 320

Ile Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser Asn

325 330 335

Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp Gly

340 345 350

Ala Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His Ala

355 360 365

Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln Leu

370 375 380

Thr Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln Ile

385 390 395 400

Phe Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile Asn

405 410 415

Asn Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe Asn

420 425 430

Phe Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu Phe

435 440 445

Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His Gly

450 455 460

Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg Lys

465 470 475 480

Ser

<210> 5

<211> 2439

<212> DNA

<213> Artifical sequence

<400> 5

atggctagcg gtggagcctt ctgcctcata gctaacgacg gcaaagccga taagatcatt 60

ctggctcaag acctgttgaa ctcaagaatc tctaacataa agaacgtcaa caagtcgtac 120

ggtaaacctg accctgaacc tactctcagt cagatcgaag aaacccacct ggtgcacttc 180

aatgcccact tcaagccata cgttccggtc ggtttcgaat acaacaaagt tagaccgcac 240

actggcaccc ccacactggg taataaattg accttcggta tccctcaata cggcgacttc 300

ttccacgata tggtgggtca ccacatactc ggagcttgtc actcatcttg gcaggacgcc 360

ccgatccaag gaacttcgca gatgggagct cacggccaac tgcaaacctt ccctagaaac 420

ggttacgact gggataatca aacaccactg gaaggagctg tttacacttt ggtcgatccg 480

ttcggaagac ccatcgttcc tggcacaaag aacgcctaca gaaatctggt ctactactgc 540

gaatacccag gagaaagatt gtacgaaaac gtgagattcg acgttaatgg caactctctg 600

gacgaataca gctccgatgt cacaactctt gtgagaaaat tctgtattcc cggcgataag 660

atgacaggtt acaaacacct cgttggccaa gaagtgtcgg ttgaaggtac tagtggacct 720

ctcctgtgca atatccacga cctccacaag cctcaccaaa gcaaaccaat tctgacagac 780

gaaaacgata cacagagaac ttgttcccac actaatccga agttcttgtc gcagcacttc 840

cccgaaaaca gtcacaatat tcaaaccgct ggtaaacagg atataacccc tatcacagac 900

gccacttacc tcgatataag aagaaacgtg cactacagct gcaatggacc acaaacaccg 960

aagtactacc agcctccatt ggctctctgg atcaaattga gattctggtt caatgaaaac 1020

gtgaatctcg ccattccgag cgtttccata cccttcggag aaagattcat tactataaag 1080

ttggcttccc aaaaagacct cgtcaacgag ttccccggct tgttcgtgag acagtcaaga 1140

ttcatcgccg gtagaccttc aagaagaaac ataagattca agccttggtt catcccgggc 1200

gttataaacg aaatatcatt gaccaacaac gaactctaca tcaacaatct gttcgtcaca 1260

cccgaaattc acaacttgtt cgtcaagaga gtgagattct ctctcatcag agttcacaaa 1320

actcaggtca ctcacaccaa caataaccac cacgacgaaa agctcatgtc ggctctgaaa 1380

tggccgatcg aatacatgtt cattggcctg aagcctacct ggaacattag tgaccaaaat 1440

ccacaccagc acagagattg gcacaaattc ggtcacgtgg ttaacgctat aatgcaacca 1500

actcaccacg ccgaaatctc attccaggac agagataccg ctttgccgga cgcttgctca 1560

tcaatcagcg atatttcccc cgtgacctac cctataacat tgccaatcat caagaacatc 1620

tcagttaccg ctcacggaat aaatctcatc gacaagttcc cgtctaaatt ctgttcatct 1680

tacattccct tccactacgg cggtaacgcc ataaagaccc ccgacgatcc tggtgctatg 1740

atgataacat tcgccctgaa acctagagaa gaataccaac catcaggaca catcaatgtg 1800

tcaagagcta gagagttcta cattagctgg gacacagatt acgtgggttc aataaccaca 1860

gccgatctgg tcgtgtcggc tagtgccatt aacttcttgc tcctgcaaaa tggcagcgct 1920

gtgttgagat actccacttc cggtggcgac atcatcaagc tgctgaacga acaggtgaac 1980

aaggagatgc agtccagcaa cctgtacatg tctatgtctt catggtgcta cacccactca 2040

ctggacggag ctggtctgtt cctgttcgac cacgctgccg aggaatacga acacgccaag 2100

aagctgatca tcttcctgaa cgagaacaac gtgcctgtcc agctgacctc catcagcgct 2160

cccgaacaca agttcgaggg tctgactcaa atcttccaga aggcctacga acacgagcag 2220

cacatctctg aatcaatcaa caacatcgtg gaccacgcta tcaagagcaa ggaccacgcc 2280

actttcaact tcctgcaatg gtacgtggct gagcagcacg aggaagaggt cctgttcaag 2340

gacatcctgg acaagatcga actgatcggc aacgagaacc acggactgta cctggctgac 2400

cagtacgtca agggcatcgc caagtcccgc aagagctaa 2439

<210> 6

<211> 1113

<212> DNA

<213> Artifical sequence

<400> 6

atggacttca tcttgaacat ctcaatgaag atggaagtga tattcaagac agacctgaga 60

tcatctagcc aggtggtttt ccacgctggc agtctgtaca actggttctc agtggaaatc 120

ataaactctg gtagaatcgt tacaactgcc attaaaaccc tgttgagcac agttaaatac 180

gacatagtca agtccgctag aatctacgcc ggtcaaggat acaccgaaca ccaagctcag 240

gaagaatgga atatgatcct ccacgttctg ttcgaagaag aaacagaatc ctcggccagt 300

tcagaaaaca tccacgaaaa gaacgataac gaaactaacg aatgcacctc tagcttcgaa 360

actctgttcg aacaggaacc ttcctcggaa gtcccaaaag actcgaagtt gtacatgctc 420

gctcaaaaga ccgtgcagca cattgaacaa tacggaaaag ctccggattt caacaaggtt 480

ataagagccc acaatttcat tcaaacaata tacggcactc ctctgaaaga agaagaaaag 540

gaagtcgtga gattgatggt cattaaactc ctgaaaaaga acaagttgct cagccacctg 600

cacttgatgt tctccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 660

atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 720

ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 780

atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 840

cacaagttcg agggtctgac tcaaatcttc cagaaggcct acgaacacga gcagcacatc 900

tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 960

aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 1020

ctggacaaga tcgaactgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 1080

gtcaagggca tcgccaagtc ccgcaagagc taa 1113

<210> 7

<211> 1053

<212> DNA

<213> Artifical sequence

<400> 7

atggacagcg agttcttcca accggtctac cccagacact acggtgaatg cctgtccccc 60

gtgacaactc ctagcttctt ctccactcac atgtacacca ttttgatagc catcgtggtt 120

ctcgtgatca ttataatcgt tctgatctac ctgttctcat caagaaagaa gaaagctgct 180

gctatagaag aagaagacat acaattcatc aacccttacc aggatcaaca gtgggtcgaa 240

gtgacccctc agccaggaac atcaaagcct gctggtgcta ccacagcttc tgttggcaaa 300

cccgtcactg gtagacctgc caccaacaga ccagctacaa ataagccggt cactgacaat 360

cccgtgaccg atagactggt tatggccact ggtggaccag ccgctgcccc ggctgccgct 420

tctgctcctg ctcacccagc tgaaccgtac actaccgtta caactcaaaa cacagcctcg 480

cagactatga gtgctatcga aaacttgaga caaagaaaca cctacacaca caaagacctg 540

gaaaactcac tgtccggtgg cgacatcatc aagctgctga acgaacaggt gaacaaggag 600

atgcagtcca gcaacctgta catgtctatg tcttcatggt gctacaccca ctcactggac 660

ggagctggtc tgttcctgtt cgaccacgct gccgaggaat acgaacacgc caagaagctg 720

atcatcttcc tgaacgagaa caacgtgcct gtccagctga cctccatcag cgctcccgaa 780

cacaagttcg agggtctgac tcaaatcttc cagaaggcct acgaacacga gcagcacatc 840

tctgaatcaa tcaacaacat cgtggaccac gctatcaaga gcaaggacca cgccactttc 900

aacttcctgc aatggtacgt ggctgagcag cacgaggaag aggtcctgtt caaggacatc 960

ctggacaaga tcgaactgat cggcaacgag aaccacggac tgtacctggc tgaccagtac 1020

gtcaagggca tcgccaagtc ccgcaagagc taa 1053

<210> 8

<211> 1446

<212> DNA

<213> Artifical sequence

<400> 8

atgaaaacca ttattttaga cagcaatatt acaaatgata acaatgatat taacggcgtg 60

agctggaact tttttaataa tagctttaat actttagcca cttgtggcaa agccggtaac 120

ttctgcgaat gcagcaacta cagcaccagc atttacaata tcaccaataa ttgctcttta 180

accatttttc cgcacaacga tgtgttcgac acaacctacc aagttgtgtg gaaccagatc 240

atcaactata ccattaaact gctgaccccg gcaaccccgc cgaatatcac ctacaattgc 300

acaaattttt taatcacttg taagaaaaat aatggcacaa acaccaatat ttatctgaat 360

attaacgata catttgttaa atataccaat gaaagtattc tggaatataa ctggaacaat 420

agcaacatta ataattttac agcaacatgc attattaata ataccattag caccagcaat 480

gagaccactt taatcaactg cacctatctg actttaagca gcaattattt ctataccttc 540

tttaaactgt actctttacg caagcgcaaa aaacacgtgg aggaaatcga gagcccgccg 600

ccggagagta acgaggaaga acagtgccag catgacgaca ccacaagcat tcacgagccg 660

agcccgcgtg agccgctgtt accgaagccg tatagccgct accagtacaa caccccgatc 720

tactatatgc gcccgagtac acaaccgctg aatccgtttc cgctgccgaa accttgcccg 780

ccgcctaaac cttgtccgcc gccgaagcct tgtcctccgc cgaaaccgtg cccgagcgca 840

gaaagctaca gccctccgaa accgctgccg agcattccgc tgctgccgaa cattccgccg 900

ctgagcaccc agaatatctc tttaatccac gtggaccgta tcatctccgg tggcgacatc 960

atcaagctgc tgaacgaaca ggtgaacaag gagatgcagt ccagcaacct gtacatgtct 1020

atgtcttcat ggtgctacac ccactcactg gacggagctg gtctgttcct gttcgaccac 1080

gctgccgagg aatacgaaca cgccaagaag ctgatcatct tcctgaacga gaacaacgtg 1140

cctgtccagc tgacctccat cagcgctccc gaacacaagt tcgagggtct gactcaaatc 1200

ttccagaagg cctacgaaca cgagcagcac atctctgaat caatcaacaa catcgtggac 1260

cacgctatca agagcaagga ccacgccact ttcaacttcc tgcaatggta cgtggctgag 1320

cagcacgagg aagaggtcct gttcaaggac atcctggaca agatcgaact gatcggcaac 1380

gagaaccacg gactgtacct ggctgaccag tacgtcaagg gcatcgccaa gtcccgcaag 1440

agctaa 1446

<210> 9

<211> 595

<212> PRT

<213> Artifical sequence

<400> 9

Met Ile Ile Leu Ile Phe Leu Ile Phe Ser Asn Ile Val Leu Ser Ile

1 5 10 15

Asp Tyr Trp Val Ser Phe Asn Lys Thr Ile Ile Leu Asp Ser Asn Ile

20 25 30

Thr Asn Asp Asn Asn Asp Ile Asn Gly Val Ser Trp Asn Phe Phe Asn

35 40 45

Asn Ser Phe Asn Thr Leu Ala Thr Cys Gly Lys Ala Gly Asn Phe Cys

50 55 60

Glu Cys Ser Asn Tyr Ser Thr Ser Ile Tyr Asn Ile Thr Asn Asn Cys

65 70 75 80

Ser Leu Thr Ile Phe Pro His Asn Asp Val Phe Asp Thr Thr Tyr Gln

85 90 95

Val Val Trp Asn Gln Ile Ile Asn Tyr Thr Ile Lys Leu Leu Thr Pro

100 105 110

Ala Thr Pro Pro Asn Ile Thr Tyr Asn Cys Thr Asn Phe Leu Ile Thr

115 120 125

Cys Lys Lys Asn Asn Gly Thr Asn Thr Asn Ile Tyr Leu Asn Ile Asn

130 135 140

Asp Thr Phe Val Lys Tyr Thr Asn Glu Ser Ile Leu Glu Tyr Asn Trp

145 150 155 160

Asn Asn Ser Asn Ile Asn Asn Phe Thr Ala Thr Cys Ile Ile Asn Asn

165 170 175

Thr Ile Ser Thr Ser Asn Glu Thr Thr Leu Ile Asn Cys Thr Tyr Leu

180 185 190

Thr Leu Ser Ser Asn Tyr Phe Tyr Thr Phe Phe Lys Leu Tyr Arg Ser

195 200 205

Met Asp Ser Glu Phe Phe Gln Pro Val Tyr Pro Arg His Tyr Gly Glu

210 215 220

Cys Leu Ser Pro Val Thr Thr Pro Ser Phe Phe Ser Thr His Met Tyr

225 230 235 240

Thr Ile Leu Ile Ala Ile Val Val Leu Val Ile Ile Ile Ile Val Leu

245 250 255

Ile Tyr Leu Phe Ser Ser Arg Lys Lys Lys Ala Ala Ala Ile Glu Glu

260 265 270

Glu Asp Ile Gln Phe Ile Asn Pro Tyr Gln Asp Gln Gln Trp Val Glu

275 280 285

Val Thr Pro Gln Pro Gly Thr Ser Lys Pro Ala Gly Ala Thr Thr Ala

290 295 300

Ser Val Gly Lys Pro Val Thr Gly Arg Pro Ala Thr Asn Arg Pro Ala

305 310 315 320

Thr Asn Lys Pro Val Thr Asp Asn Pro Val Thr Asp Arg Leu Val Met

325 330 335

Ala Thr Gly Gly Pro Ala Ala Ala Met Asp Phe Ile Leu Asn Ile Ser

340 345 350

Met Lys Met Glu Val Ile Phe Lys Thr Asp Leu Arg Ser Ser Ser Gln

355 360 365

Val Val Phe His Ala Gly Ser Leu Tyr Asn Trp Phe Ser Val Glu Ile

370 375 380

Ile Asn Ser Gly Arg Ile Val Thr Thr Ala Ile Lys Thr Leu Leu Ser

385 390 395 400

Thr Val Lys Tyr Asp Ile Val Lys Ser Ala Arg Ile Tyr Ala Gly Gln

405 410 415

Gly Tyr Thr Glu His Gln Ala Gln Glu Glu Trp Asn Met Ile Leu His

420 425 430

Val Leu Phe Glu Glu Glu Thr Glu Ser Ser Ala Ser Ser Glu Asn Ile

435 440 445

His Glu Lys Asn Asp Asn Glu Thr Asn Glu Cys Thr Ser Ser Phe Glu

450 455 460

Thr Leu Phe Glu Gln Glu Pro Ser Ser Glu Val Pro Lys Asp Ser Lys

465 470 475 480

Leu Tyr Met Leu Ala Gln Lys Thr Val Gln His Ile Glu Gln Tyr Gly

485 490 495

Lys Ala Pro Asp Phe Asn Lys Val Ile Arg Ala His Asn Phe Ile Gln

500 505 510

Thr Ile Tyr Gly Thr Pro Leu Lys Glu Glu Glu Lys Glu Val Val Arg

515 520 525

Leu Met Val Ile Lys Leu Leu Lys Lys Asn Lys Leu Leu Ser His Leu

530 535 540

His Leu Met Phe Ala Ala Ala Ser Ala Pro Ala His Pro Ala Glu Pro

545 550 555 560

Tyr Thr Thr Val Thr Thr Gln Asn Thr Ala Ser Gln Thr Met Ser Ala

565 570 575

Ile Glu Asn Leu Arg Gln Arg Asn Thr Tyr Thr His Lys Asp Leu Glu

580 585 590

Asn Ser Leu

595

<210> 10

<211> 1788

<212> DNA

<213> Artifical sequence

<400> 10

atgatcattc tgattttcct gatcttctca aacattgtgc tgtcaatcga ctactgggtg 60

tcattcaaca agacaatcat tctggactca aacattacaa atgacaacaa cgacatcaac 120

ggagtgtcat ggaacttctt caacaactca ttcaacacac tggcaacatg cggaaaagca 180

ggaaacttct gcgaatgctc aaactactca acatcaatct acaacatcac aaacaactgc 240

tcactgacaa tcttccccca caacgacgtg ttcgacacaa cataccaggt ggtgtggaac 300

cagatcatta actacacaat caagctgctg acacccgcaa caccccccaa cattacatac 360

aactgcacaa acttcctgat cacatgcaag aaaaacaacg gaacaaacac aaacatctac 420

ctgaacatca acgacacatt cgtgaaatac acaaacgaat caattctgga atacaactgg 480

aacaactcaa acatcaacaa cttcacagca acatgcatca ttaacaacac aatttcaaca 540

tcaaacgaaa caacactgat caactgcaca tacctgacac tgtcatcaaa ctacttctac 600

acattcttca agctgtacag atcaatggac tcagagttct tccagcccgt gtaccccaga 660

cactacggag aatgcctgtc acccgtgaca acaccctcat tcttctcaac acacatgtac 720

acaatcctga ttgcaatcgt ggtgctggtc atcattatca ttgtgctgat ctacctgttc 780

tcatcaagaa agaaaaaggc agcagcaatc gaagaagaag acattcagtt catcaacccc 840

taccaggacc agcagtgggt ggaagtgaca ccccagcccg gaacatcaaa gcccgcagga 900

gcaacaacag catcagtggg aaaacccgtg acaggaagac ccgcaacaaa cagacccgca 960

acaaacaagc ccgtgacaga caaccccgtg acagacagac tggtcatggc aacaggagga 1020

cccgcagcag caatggactt cattctgaac atctcaatga agatggaagt gatcttcaaa 1080

acagacctga gatcatcatc acaggtggtg ttccacgcag gatcactgta caactggttc 1140

tcagtggaaa tcattaactc aggaagaatt gtgacaacag caatcaaaac actgctgtca 1200

acagtgaagt acgacattgt gaaatcagca agaatctacg caggacaggg atacacagaa 1260

caccaggcac aggaagaatg gaacatgatt ctgcacgtgc tgttcgaaga agaaacagaa 1320

tcatcagcat catcagaaaa catccacgaa aagaacgaca acgaaacaaa cgaatgcaca 1380

tcatcattcg aaacactgtt cgaacaggaa ccctcatcag aagtgcccaa ggactcaaaa 1440

ctgtacatgc tggcacagaa aacagtgcag cacattgaac agtacggaaa ggcacccgac 1500

ttcaacaaag tgatcagagc acacaacttc attcagacaa tctacggaac acccctgaag 1560

gaagaagaaa aagaagtggt gagactgatg gtcatcaagc tgctgaagaa gaacaagctg 1620

ctgtcacacc tgcacctgat gttcgcagca gcatcagcac cagcacaccc cgcagaaccc 1680

tacacaacag tgacaacaca gaacacagca tcacagacaa tgtcagcaat cgaaaacctg 1740

agacagagaa acacatacac acacaaggac ctggaaaact cactgtga 1788

<210> 11

<211> 679

<212> PRT

<213> Artifical sequence

<400> 11

Met Gln Ile Phe Val Lys Thr Leu Thr Gly Lys Thr Ile Thr Leu Glu

1 5 10 15

Val Glu Pro Ser Asp Thr Ile Glu Asn Val Lys Ala Lys Ile Gln Asp

20 25 30

Lys Glu Gly Ile Pro Pro Asp Gln Gln Arg Leu Ile Phe Ala Gly Lys

35 40 45

Gln Leu Glu Asp Gly Arg Thr Leu Ser Asp Tyr Asn Ile Gln Lys Glu

50 55 60

Ser Thr Leu His Leu Val Leu Arg Leu Arg Gly Ala Ser Ala Pro Gly

65 70 75 80

Thr Pro Ser Arg Met Ile Ile Leu Ile Phe Leu Ile Phe Ser Asn Ile

85 90 95

Val Leu Ser Ile Asp Tyr Trp Val Ser Phe Asn Lys Thr Ile Ile Leu

100 105 110

Asp Ser Asn Ile Thr Asn Asp Asn Asn Asp Ile Asn Gly Val Ser Trp

115 120 125

Asn Phe Phe Asn Asn Ser Phe Asn Thr Leu Ala Thr Cys Gly Lys Ala

130 135 140

Gly Asn Phe Cys Glu Cys Ser Asn Tyr Ser Thr Ser Ile Tyr Asn Ile

145 150 155 160

Thr Asn Asn Cys Ser Leu Thr Ile Phe Pro His Asn Asp Val Phe Asp

165 170 175

Thr Thr Tyr Gln Val Val Trp Asn Gln Ile Ile Asn Tyr Thr Ile Lys

180 185 190

Leu Leu Thr Pro Ala Thr Pro Pro Asn Ile Thr Tyr Asn Cys Thr Asn

195 200 205

Phe Leu Ile Thr Cys Lys Lys Asn Asn Gly Thr Asn Thr Asn Ile Tyr

210 215 220

Leu Asn Ile Asn Asp Thr Phe Val Lys Tyr Thr Asn Glu Ser Ile Leu

225 230 235 240

Glu Tyr Asn Trp Asn Asn Ser Asn Ile Asn Asn Phe Thr Ala Thr Cys

245 250 255

Ile Ile Asn Asn Thr Ile Ser Thr Ser Asn Glu Thr Thr Leu Ile Asn

260 265 270

Cys Thr Tyr Leu Thr Leu Ser Ser Asn Tyr Phe Tyr Thr Phe Phe Lys

275 280 285

Leu Tyr Arg Ser Met Asp Ser Glu Phe Phe Gln Pro Val Tyr Pro Arg

290 295 300

His Tyr Gly Glu Cys Leu Ser Pro Val Thr Thr Pro Ser Phe Phe Ser

305 310 315 320

Thr His Met Tyr Thr Ile Leu Ile Ala Ile Val Val Leu Val Ile Ile

325 330 335

Ile Ile Val Leu Ile Tyr Leu Phe Ser Ser Arg Lys Lys Lys Ala Ala

340 345 350

Ala Ile Glu Glu Glu Asp Ile Gln Phe Ile Asn Pro Tyr Gln Asp Gln

355 360 365

Gln Trp Val Glu Val Thr Pro Gln Pro Gly Thr Ser Lys Pro Ala Gly

370 375 380

Ala Thr Thr Ala Ser Val Gly Lys Pro Val Thr Gly Arg Pro Ala Thr

385 390 395 400

Asn Arg Pro Ala Thr Asn Lys Pro Val Thr Asp Asn Pro Val Thr Asp

405 410 415

Arg Leu Val Met Ala Thr Gly Gly Pro Ala Ala Ala Met Asp Phe Ile

420 425 430

Leu Asn Ile Ser Met Lys Met Glu Val Ile Phe Lys Thr Asp Leu Arg

435 440 445

Ser Ser Ser Gln Val Val Phe His Ala Gly Ser Leu Tyr Asn Trp Phe

450 455 460

Ser Val Glu Ile Ile Asn Ser Gly Arg Ile Val Thr Thr Ala Ile Lys

465 470 475 480

Thr Leu Leu Ser Thr Val Lys Tyr Asp Ile Val Lys Ser Ala Arg Ile

485 490 495

Tyr Ala Gly Gln Gly Tyr Thr Glu His Gln Ala Gln Glu Glu Trp Asn

500 505 510

Met Ile Leu His Val Leu Phe Glu Glu Glu Thr Glu Ser Ser Ala Ser

515 520 525

Ser Glu Asn Ile His Glu Lys Asn Asp Asn Glu Thr Asn Glu Cys Thr

530 535 540

Ser Ser Phe Glu Thr Leu Phe Glu Gln Glu Pro Ser Ser Glu Val Pro

545 550 555 560

Lys Asp Ser Lys Leu Tyr Met Leu Ala Gln Lys Thr Val Gln His Ile

565 570 575

Glu Gln Tyr Gly Lys Ala Pro Asp Phe Asn Lys Val Ile Arg Ala His

580 585 590

Asn Phe Ile Gln Thr Ile Tyr Gly Thr Pro Leu Lys Glu Glu Glu Lys

595 600 605

Glu Val Val Arg Leu Met Val Ile Lys Leu Leu Lys Lys Asn Lys Leu

610 615 620

Leu Ser His Leu His Leu Met Phe Ala Ala Ala Ser Ala Pro Ala His

625 630 635 640

Pro Ala Glu Pro Tyr Thr Thr Val Thr Thr Gln Asn Thr Ala Ser Gln

645 650 655

Thr Met Ser Ala Ile Glu Asn Leu Arg Gln Arg Asn Thr Tyr Thr His

660 665 670

Lys Asp Leu Glu Asn Ser Leu

675

<210> 12

<211> 2040

<212> DNA

<213> Artifical sequence

<400> 12

atgcagattt tcgtgaagac actgacagga aaaacaatta cactggaagt ggaaccctca 60

gacacaatcg aaaacgtgaa ggcaaaaatc caggacaagg aaggaatccc ccccgaccag 120

cagagactga ttttcgcagg aaaacagctg gaagacggaa gaacactgtc agactacaac 180

atccagaagg aatcaacact gcacctggtg ctgagactga gaggagcatc agcacccgga 240

acaccctcaa gaatgatcat tctgattttc ctgatcttct caaacattgt gctgtcaatc 300

gactactggg tgtcattcaa caagacaatc attctggact caaacattac aaatgacaac 360

aacgacatca acggagtgtc atggaacttc ttcaacaact cattcaacac actggcaaca 420

tgcggaaaag caggaaactt ctgcgaatgc tcaaactact caacatcaat ctacaacatc 480

acaaacaact gctcactgac aatcttcccc cacaacgacg tgttcgacac aacataccag 540

gtggtgtgga accagatcat taactacaca atcaagctgc tgacacccgc aacacccccc 600

aacattacat acaactgcac aaacttcctg atcacatgca agaaaaacaa cggaacaaac 660

acaaacatct acctgaacat caacgacaca ttcgtgaaat acacaaacga atcaattctg 720

gaatacaact ggaacaactc aaacatcaac aacttcacag caacatgcat cattaacaac 780

acaatttcaa catcaaacga aacaacactg atcaactgca catacctgac actgtcatca 840

aactacttct acacattctt caagctgtac agatcaatgg actcagagtt cttccagccc 900

gtgtacccca gacactacgg agaatgcctg tcacccgtga caacaccctc attcttctca 960

acacacatgt acacaatcct gattgcaatc gtggtgctgg tcatcattat cattgtgctg 1020

atctacctgt tctcatcaag aaagaaaaag gcagcagcaa tcgaagaaga agacattcag 1080

ttcatcaacc cctaccagga ccagcagtgg gtggaagtga caccccagcc cggaacatca 1140

aagcccgcag gagcaacaac agcatcagtg ggaaaacccg tgacaggaag acccgcaaca 1200

aacagacccg caacaaacaa gcccgtgaca gacaaccccg tgacagacag actggtcatg 1260

gcaacaggag gacccgcagc agcaatggac ttcattctga acatctcaat gaagatggaa 1320

gtgatcttca aaacagacct gagatcatca tcacaggtgg tgttccacgc aggatcactg 1380

tacaactggt tctcagtgga aatcattaac tcaggaagaa ttgtgacaac agcaatcaaa 1440

acactgctgt caacagtgaa gtacgacatt gtgaaatcag caagaatcta cgcaggacag 1500

ggatacacag aacaccaggc acaggaagaa tggaacatga ttctgcacgt gctgttcgaa 1560

gaagaaacag aatcatcagc atcatcagaa aacatccacg aaaagaacga caacgaaaca 1620

aacgaatgca catcatcatt cgaaacactg ttcgaacagg aaccctcatc agaagtgccc 1680

aaggactcaa aactgtacat gctggcacag aaaacagtgc agcacattga acagtacgga 1740

aaggcacccg acttcaacaa agtgatcaga gcacacaact tcattcagac aatctacgga 1800

acacccctga aggaagaaga aaaagaagtg gtgagactga tggtcatcaa gctgctgaag 1860

aagaacaagc tgctgtcaca cctgcacctg atgttcgcag cagcatcagc accagcacac 1920

cccgcagaac cctacacaac agtgacaaca cagaacacag catcacagac aatgtcagca 1980

atcgaaaacc tgagacagag aaacacatac acacacaagg acctggaaaa ctcactgtga 2040

<210> 13

<211> 633

<212> PRT

<213> Artifical sequence

<400> 13

Met Ile Ser Ile Thr Glu Ile Lys Gly Val Ile Val His Arg Ile Glu

1 5 10 15

Thr Ile Leu Phe Met Ile Ile Leu Ile Phe Leu Ile Phe Ser Asn Ile

20 25 30

Val Leu Ser Ile Asp Tyr Trp Val Ser Phe Asn Lys Thr Ile Ile Leu

35 40 45

Asp Ser Asn Ile Thr Asn Asp Asn Asn Asp Ile Asn Gly Val Ser Trp

50 55 60

Asn Phe Phe Asn Asn Ser Phe Asn Thr Leu Ala Thr Cys Gly Lys Ala

65 70 75 80

Gly Asn Phe Cys Glu Cys Ser Asn Tyr Ser Thr Ser Ile Tyr Asn Ile

85 90 95

Thr Asn Asn Cys Ser Leu Thr Ile Phe Pro His Asn Asp Val Phe Asp

100 105 110

Thr Thr Tyr Gln Val Val Trp Asn Gln Ile Ile Asn Tyr Thr Ile Lys

115 120 125

Leu Leu Thr Pro Ala Thr Pro Pro Asn Ile Thr Tyr Asn Cys Thr Asn

130 135 140

Phe Leu Ile Thr Cys Lys Lys Asn Asn Gly Thr Asn Thr Asn Ile Tyr

145 150 155 160

Leu Asn Ile Asn Asp Thr Phe Val Lys Tyr Thr Asn Glu Ser Ile Leu

165 170 175

Glu Tyr Asn Trp Asn Asn Ser Asn Ile Asn Asn Phe Thr Ala Thr Cys

180 185 190

Ile Ile Asn Asn Thr Ile Ser Thr Ser Asn Glu Thr Thr Leu Ile Asn

195 200 205

Cys Thr Tyr Leu Thr Leu Ser Ser Asn Tyr Phe Tyr Thr Phe Phe Lys

210 215 220

Leu Tyr Arg Ser Met Asp Ser Glu Phe Phe Gln Pro Val Tyr Pro Arg

225 230 235 240

His Tyr Gly Glu Cys Leu Ser Pro Val Thr Thr Pro Ser Phe Phe Ser

245 250 255

Thr His Met Tyr Thr Ile Leu Ile Ala Ile Val Val Leu Val Ile Ile

260 265 270

Ile Ile Val Leu Ile Tyr Leu Phe Ser Ser Arg Lys Lys Lys Ala Ala

275 280 285

Ala Ile Glu Glu Glu Asp Ile Gln Phe Ile Asn Pro Tyr Gln Asp Gln

290 295 300

Gln Trp Val Glu Val Thr Pro Gln Pro Gly Thr Ser Lys Pro Ala Gly

305 310 315 320

Ala Thr Thr Ala Ser Val Gly Lys Pro Val Thr Gly Arg Pro Ala Thr

325 330 335

Asn Arg Pro Ala Thr Asn Lys Pro Val Thr Asp Asn Pro Val Thr Asp

340 345 350

Arg Leu Val Met Ala Thr Gly Gly Pro Ala Ala Ala Met Asp Phe Ile

355 360 365

Leu Asn Ile Ser Met Lys Met Glu Val Ile Phe Lys Thr Asp Leu Arg

370 375 380

Ser Ser Ser Gln Val Val Phe His Ala Gly Ser Leu Tyr Asn Trp Phe

385 390 395 400

Ser Val Glu Ile Ile Asn Ser Gly Arg Ile Val Thr Thr Ala Ile Lys

405 410 415

Thr Leu Leu Ser Thr Val Lys Tyr Asp Ile Val Lys Ser Ala Arg Ile

420 425 430

Tyr Ala Gly Gln Gly Tyr Thr Glu His Gln Ala Gln Glu Glu Trp Asn

435 440 445

Met Ile Leu His Val Leu Phe Glu Glu Glu Thr Glu Ser Ser Ala Ser

450 455 460

Ser Glu Asn Ile His Glu Lys Asn Asp Asn Glu Thr Asn Glu Cys Thr

465 470 475 480

Ser Ser Phe Glu Thr Leu Phe Glu Gln Glu Pro Ser Ser Glu Val Pro

485 490 495

Lys Asp Ser Lys Leu Tyr Met Leu Ala Gln Lys Thr Val Gln His Ile

500 505 510

Glu Gln Tyr Gly Lys Ala Pro Asp Phe Asn Lys Val Ile Arg Ala His

515 520 525

Asn Phe Ile Gln Thr Ile Tyr Gly Thr Pro Leu Lys Glu Glu Glu Lys

530 535 540

Glu Val Val Arg Leu Met Val Ile Lys Leu Leu Lys Lys Asn Lys Leu

545 550 555 560

Leu Ser His Leu His Leu Met Phe Ala Ala Ala Ser Ala Pro Ala His

565 570 575

Pro Ala Glu Pro Tyr Thr Thr Val Thr Thr Gln Asn Thr Ala Ser Gln

580 585 590

Thr Met Ser Ala Ile Glu Asn Leu Arg Gln Arg Asn Thr Tyr Thr His

595 600 605

Lys Asp Leu Glu Asn Ser Leu Lys Lys Lys Ile Ile Thr Ile Thr Arg

610 615 620

Ile Ile Thr Ile Ile Thr Thr Ile Asp

625 630

<210> 14

<211> 1902

<212> DNA

<213> Artifical sequence

<400> 14

atgatctcaa ttacagaaat taagggagtg atcgtgcaca gaattgaaac aatcctgttc 60

atgatcattc tgattttcct gatcttctca aacattgtgc tgtcaatcga ctactgggtg 120

tcattcaaca agacaatcat tctggactca aacattacaa atgacaacaa cgacatcaac 180

ggagtgtcat ggaacttctt caacaactca ttcaacacac tggcaacatg cggaaaagca 240

ggaaacttct gcgaatgctc aaactactca acatcaatct acaacatcac aaacaactgc 300

tcactgacaa tcttccccca caacgacgtg ttcgacacaa cataccaggt ggtgtggaac 360

cagatcatta actacacaat caagctgctg acacccgcaa caccccccaa cattacatac 420

aactgcacaa acttcctgat cacatgcaag aaaaacaacg gaacaaacac aaacatctac 480

ctgaacatca acgacacatt cgtgaaatac acaaacgaat caattctgga atacaactgg 540

aacaactcaa acatcaacaa cttcacagca acatgcatca ttaacaacac aatttcaaca 600

tcaaacgaaa caacactgat caactgcaca tacctgacac tgtcatcaaa ctacttctac 660

acattcttca agctgtacag atcaatggac tcagagttct tccagcccgt gtaccccaga 720

cactacggag aatgcctgtc acccgtgaca acaccctcat tcttctcaac acacatgtac 780

acaatcctga ttgcaatcgt ggtgctggtc atcattatca ttgtgctgat ctacctgttc 840

tcatcaagaa agaaaaaggc agcagcaatc gaagaagaag acattcagtt catcaacccc 900

taccaggacc agcagtgggt ggaagtgaca ccccagcccg gaacatcaaa gcccgcagga 960

gcaacaacag catcagtggg aaaacccgtg acaggaagac ccgcaacaaa cagacccgca 1020

acaaacaagc ccgtgacaga caaccccgtg acagacagac tggtcatggc aacaggagga 1080

cccgcagcag caatggactt cattctgaac atctcaatga agatggaagt gatcttcaaa 1140

acagacctga gatcatcatc acaggtggtg ttccacgcag gatcactgta caactggttc 1200

tcagtggaaa tcattaactc aggaagaatt gtgacaacag caatcaaaac actgctgtca 1260

acagtgaagt acgacattgt gaaatcagca agaatctacg caggacaggg atacacagaa 1320

caccaggcac aggaagaatg gaacatgatt ctgcacgtgc tgttcgaaga agaaacagaa 1380

tcatcagcat catcagaaaa catccacgaa aagaacgaca acgaaacaaa cgaatgcaca 1440

tcatcattcg aaacactgtt cgaacaggaa ccctcatcag aagtgcccaa ggactcaaaa 1500

ctgtacatgc tggcacagaa aacagtgcag cacattgaac agtacggaaa ggcacccgac 1560

ttcaacaaag tgatcagagc acacaacttc attcagacaa tctacggaac acccctgaag 1620

gaagaagaaa aagaagtggt gagactgatg gtcatcaagc tgctgaagaa gaacaagctg 1680

ctgtcacacc tgcacctgat gttcgcagca gcatcagcac cagcacaccc cgcagaaccc 1740

tacacaacag tgacaacaca gaacacagca tcacagacaa tgtcagcaat cgaaaacctg 1800

agacagagaa acacatacac acacaaggac ctggaaaact cactgaaaaa gaaaatcatc 1860

acaatcacaa gaatcatcac aatcatcaca acaatcgact ga 1902

Claims

1. An African swine fever self-assembly ferritin nano-antigen comprising a fusion protein, wherein the fusion protein is selected from a fusion protein formed by connecting any one of African swine fever virus major capsid protein P72, African swine fever virus phosphoprotein P30, African swine fever virus envelope protein P54 or African swine fever virus hemagglutinin protein CD2v-AC and a monomer ferritin subunit;

preferably, the monomeric ferritin subunit is a helicobacter pylori ferritin monomeric subunit;

2. The self-assembled ferritin nano antigen for African swine fever according to claim 1, wherein the fusion protein is selected from any one of the following (1) - (4): (1) the homologous sequence of the fusion protein obtained by connecting the main capsid protein P72 of the African swine fever virus and the N end of the monomeric ferritin subunit through a connecting peptide SGG is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 5; (2) the homologous sequence of the fusion protein obtained by connecting the African swine fever virus phosphoprotein P30 and the N end of the monomer ferritin subunit through a connecting peptide SGG is shown as SEQ ID NO.2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6; (3) the homologous sequence of the fusion protein obtained by connecting the African swine fever virus envelope protein P54 and the N end of the monomer ferritin subunit through a connecting peptide SGG is shown as SEQ ID NO.3, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 7; (4) the homologous sequence of the fusion protein obtained by connecting the African swine fever virus hemagglutinin protein CD2v-AC and the N end of the monomer ferritin subunit through connecting peptide SGG is shown as SEQ ID NO.4, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 8.

3. An African swine fever fusion protein antigen is characterized in that an African swine fever virus phosphorus protein P30 sequence is inserted into a recognition enzyme sequence site of NotI in an African swine fever virus envelope protein P54 to obtain a PQ recombinant protein, and the front end of the PQ recombinant protein is connected with an extracellular domain of an African swine fever virus CD2v structural protein to obtain a fusion protein;

preferably, the structural protein of the African swine fever virus CD2v is an extracellular domain sequence of the African swine fever virus hemagglutinin protein CD2 v.

Preferably, the amino acid sequence of the homologous sequence of the African swine fever fusion protein antigen is shown as SEQ ID NO.9, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 10.

4. An African swine fever fusion protein antigen is characterized in that the N end of an amino acid sequence shown in SEQ ID NO.9 is connected with the C end of an ubiquitin-linker amino acid sequence to obtain a fusion protein antigen; preferably, the amino acid sequence of the homologous sequence of the fusion protein antigen is shown as SEQ ID NO.11, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 12.

5. An African swine fever fusion protein antigen is characterized in that the front end and the rear end of an amino acid sequence shown by SEQ ID NO.9 are respectively connected with UBITh 1 and 2 amino acid sequences to obtain a fusion protein antigen; preferably, the amino acid sequence of the homologous sequence of the fusion protein antigen is shown as SEQ ID NO.13, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 14.

6. A method for preparing the self-assembled ferritin nano-antigen of the african swine fever according to claim 1 or 2 or the african swine fever fusion protein antigen according to any one of claims 3 to 5, comprising:

or (II) cloning the fusion protein coding gene to a gene presenting vector to construct a recombinant baculovirus transfer vector presenting exogenous genes to vertebrate cells or individuals, and transfecting the recombinant baculovirus transfer vector to silkworm cells to obtain the recombinant virus.

7. An African swine fever vaccine, comprising: a prophylactically effective amount of the african swine fever self-assembled ferritin nano-antigen of claim 1 or 2 and a pharmaceutically acceptable adjuvant or carrier.

8. An African swine fever vaccine, comprising: a prophylactically effective amount of the african swine fever fusion protein antigen of any one of claims 3-5 and a pharmaceutically acceptable adjuvant or carrier.

9. An African swine fever mixed vaccine, which is characterized by comprising: antigen I, antigen II and pharmaceutically acceptable adjuvant or carrier; the antigen I is a mixed antigen composed of African swine fever self-assembly ferritin nano antigens shown by SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 with a preventive effective amount, and the antigen II is an African swine fever fusion protein antigen shown by SEQ ID NO.13 with a preventive effective amount.

10. An African swine fever vaccine according to any one of claims 7-9, wherein the adjuvant is a cytokine, preferably wherein the cytokine is porcine interferon.