CN107098974A

CN107098974A - A kind of fusion protein and its application

Info

Publication number: CN107098974A
Application number: CN201610093079.6A
Authority: CN
Inventors: 田克恭; 杨凡力; 胡旭乐; 孙进忠; 张许科
Original assignee: Pulaike Biological Engineering Co Ltd
Current assignee: Pulaike Biological Engineering Co Ltd
Priority date: 2016-02-21
Filing date: 2016-02-21
Publication date: 2017-08-29
Anticipated expiration: 2036-02-21
Also published as: CN107098974B

Abstract

The invention provides a kind of fusion protein, the fusion protein includes the monomer ferritin subunit albumen being connected with Porcine epidemic diarrhea virus antigenic protein, the Porcine epidemic diarrhea virus antigenic protein includes Porcine epidemic diarrhea virus S protein and/or its fragment, can also further comprise S1 albumen, M albumen, N protein and/or its fragment.Present invention also offers the nano particle containing the fusion protein.Present invention also offers the vaccine combination containing the nano particle and/or carrier.Application the invention also discloses the preparation method of the vaccine combination and its in the medicine for preparing prevention and/or treatment Porcine epidemic diarrhea virus.Vaccine combination prepared by the nano particle, it is to avoid totivirus is difficult to the technical barrier for separating, cultivating during preparing traditional inactivated vaccine with Porcine epidemic diarrhea virus totivirus；The nano particle can largely be recombinantly expressed using technique for gene engineering, not only time-consuming short, can also be easy to large-scale production.

Description

A kind of fusion protein and its application

Technical field

The invention belongs to veterinary biologicses technical field, and in particular to a kind of fusion egg of Porcine epidemic diarrhea virus In vain, the nano particle containing the fusion protein, the vaccine combination containing the nano particle and its preparation and application.

Background technology

Pig epidemic diarrhea（porcine epidemic diarrhoea, PED）It is by Porcine epidemic diarrhea virus （porcine epidemic diarrhea virus, PEDV）Cause a kind of important acute, contact, viral of diarrhea of pigs Enteric infectious disease, is characterized with watery diarrhea, vomiting, dehydration and loss of appetite.The disease can betide the pig at any age, age Smaller, symptom is heavier, and the death rate is higher, especially, 3-4 days after newborn piglet is suffered from diarrhoea in 7 ages in days, present serious dehydration and Death, the death rate is up to 50%, and the highest death rate is up to 100%.The disease most occurs in Britain and Billy earlier than the seventies in last century When, priority is separated to PEDV on China Shanghai, Liaoning, Jilin and other places within 1973.PEDV can persistently exist in swinery, various years The age pig of section is susceptible.Suckling pig, feeder pig and the incidence of disease of growing and fattening pigs are especially serious with suckling pig up to 100%, die of illness Rate is up to 100%.At present, also no specific medicament can resist PEDV, and because the disease is fallen ill suddenly, popular fast, swinery once infects, just Huge economic loss can be brought to raiser.

China was separated to PEDV first in 1980, and many areas report there is this disease in succession later, and main in the winter Spring distributes, and the harm caused is huge.From 2010 so far, serious biography has been broken out in China south China, North China part province Metachromia diarrhea disease, the pig more than 1,000,000 is dead（Sun RQ, Cai RJ, Chen YQ, et al. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerging infectious diseases, 2012, 18(1): 161-162）.The disease incidence suddenly, propagates very fast, Epidemic Scope is wide, fashionable colors It is long, prevent and treat invalid using various antibiotic, its incidence and mortality is very high, causes great economic loss, through studying table It is bright：The arch-criminal of the disease is Porcine epidemic diarrhea virus variant（Chen JF, Liu XZ, Shi D, et al. Complete Genome Sequence of a Porcine Epidemic Diarrhea Virus Variant. Journal of Virology, 2012, 86: 3408）.

At present, the prevention and control for the disease mainly take traditional handicraft to prepare inactivated vaccine immunity inoculation, but PEDV is complete Virus is difficult to separate, cultivated.Therefore, the problem of how solving the disease that prevention and control PEDV variants are brought is pig epidemic diarrhea The technical problem of this field urgent need to resolve.

The content of the invention

In order to solve the deficiencies in the prior art, the present inventor passes through repetition test, is prepared for a kind of fusion protein, melts containing this The nano particle of hop protein, and the vaccine combination containing the nano particle and application.The vaccine combination can effectively prevent and/ Or the disease caused by treatment Porcine epidemic diarrhea virus.

The present invention relates to a kind of fusion protein, the fusion protein includes connecting with Porcine epidemic diarrhea virus antigenic protein The monomer ferritin subunit albumen connect；Wherein, the Porcine epidemic diarrhea virus antigenic protein includes Porcine Epidemic Diarrhea Malicious S protein and/or its fragment, can also further comprise S1 albumen, M albumen, N protein and/or its fragment；Wherein, the monomer Ferritin subunit albumen includes bacterial ferritin, phytoferritin, algae ferritin, insect ferritin, fungi ferritin and lactation Animal ferritin；Wherein, the monomer ferritin subunit albumen is helicobacter pylori ferritin；Wherein, the monomer ferritin Protein subunit is the helicobacter pylori ferritin of optimization；Wherein, the helicobacter pylori ferritin nucleotide sequence of the optimization is compiled Code SEQ ID NO.2 amino acid sequences.

The invention further relates to a kind of nano particle for including the fusion protein, wherein, the fusion protein is included and institute State the monomer ferritin subunit albumen of Porcine epidemic diarrhea virus antigenic protein connection so that the nano particle is on its surface It is upper to include 24 Porcine epidemic diarrhea virus antigenic protein monomers.

The invention further relates to a kind of vaccine combination, the vaccine combination includes the nano particle and/or veterinary science Upper acceptable carrier；Wherein, the content of nano particle described in the vaccine combination species is 0.5-200 μ g/ml, preferably 5- 100µg/ml。

The invention further relates to the preparation method of the vaccine combination, wherein, the preparation method includes：Step（1）Gram The grand expression fusion protein, fusion protein itself is assembled into nano particle, and step（2）The nanometer is mixed in proportion Grain and carrier；Wherein, the step in the preparation method（1）Fusion protein described in middle clonal expression is described to clone respectively Porcine epidemic diarrhea virus antigenic protein, the monomer ferritin subunit albumen, then with genetic engineering means by two kinds of albumen Carry out amalgamation and expression.

The invention further relates to the vaccine combination in the medicine for preparing prevention and/or treatment Porcine Epidemic Diarrhea Using.

The invention further relates to the helicobacter pylori ferritin of optimization, wherein, the helicobacter pylori ferritin core of the optimization Nucleotide sequence encodes SEQ ID NO.2 amino acid sequences.

The present invention has the advantages that following prominent：

（1）Vaccine combination prepared by the nano particle, it is to avoid complete with the common strain of Porcine epidemic diarrhea virus and variant Totivirus is difficult to the technical barrier for separating, cultivating during the traditional inactivated vaccine of virus preparation, and better than existing subunit's epidemic disease The immune effect of seedling.

（2）The vaccine combination can be that the fusion protein enters to the component of vaccine combination by genetic engineering means The a large amount of recombination expressions of row, it is not only time-consuming short, it can also be easy to large-scale production.

Embodiment

Term " Porcine epidemic diarrhea virus antigenic protein " refers to the Porcine epidemic diarrhea virus with immunogenicity Albumen or its fragment, including but not limited to Porcine epidemic diarrhea virus S protein, S1 albumen, M albumen, N protein, and/or its piece Section, preferably S protein and/or its fragment.Wherein S protein is one of four structural proteins in Porcine epidemic diarrhea virus, is Spike protein（Spike albumen）, positioned at the Spike Glycoprotein of virion surface, combined in virion with cell surface receptor Neutralizing antibody is mediated to play important biomolecule during producing by film fusion intrusion host cell and in infection host body afterwards Act on, and is divided into 2 functional areas i.e. S1 and S2；S1 albumen is one of functional areas of Porcine epidemic diarrhea virus S protein, one As be made up of 789 amino acid；M albumen is memebrane protein（Membrane albumen）, it is the most envelope protein of content in PEDV, by 226 amino acid encodings are formed, the biological action for having three aspects：Participate in the assembling and budding of virion, stimulate body to produce Raw alpha-interferon, its antibody produced have the ability for neutralizing virus in the presence of not putting forward；N protein is nucleocapsid protein （Nucleocapsid albumen）, it is that PEDV produces most virus proteins in infection cell, structure is very conservative.Preferably, The Porcine epidemic diarrhea virus is Porcine epidemic diarrhea virus variant.

Term " Porcine epidemic diarrhea virus variant " is also known as highly pathogenic Porcine epidemic diarrhea virus, includes but is not limited to Its S protein has the PEDV of the nucleotide sequence essentially identical with SEQ ID No.3；Preferably, Porcine epidemic diarrhea virus becomes Its S protein of different strain has the PEDV of the nucleotide sequence essentially identical with SEQ ID No. 3.It is essentially identical with SEQ ID No.3 Refer to that PEDV nucleotide sequence preferably comprises and there are 85%-100% identical sequences with SEQ ID No.3, it is preferably popular in pig Under conditions of diarrhea virus variant PEDV not described herein, such as with the CH/YNKM/2012 as reference virus isolate Compare, the nucleotide homology of its S protein is less than 91%, preferably shorter than 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.Pig Epidemic diarrhea virus variant nucleotide sequence preferably have more than 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89%, it is identical with SEQ ID No.3, also, it is preferred that in Porcine epidemic diarrhea virus variant PEDV not described herein condition Under, such as compared with as the CH/YNKM/2012 of reference virus isolate, the nucleotide homology of its S protein is excellent less than 91% Choosing is less than 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

Term " homology " refers to the similarity degree of two amino acid sequences or two nucleotide sequences.Amino acid sequence or The homology of nucleotide sequence can be calculated by any appropriate method well known in the art and obtained, for example, can be by target Amino acid（Or nucleotides）Sequence and reference amino acid（Or nucleotides）Sequence carries out sequence alignment, it may be necessary to introduce empty Lack so that identical amino acid between the sequence of two comparisons（Or nucleotides）Being optimal of number, and calculate on this basis Two amino acid（Or nucleotides）Same amino acid between sequence（Or nucleotides）Percentage.Amino acid（Or nucleotides）Sequence Comparison and the calculating of homology can be realized by software well known in the art, such as, but not limited to, Blast softwares（In U.S. It can be obtained in National Biotechnology information centre of state NCBI network address：http://blast.ncbi.nlm.nih.gov/ Blast.cgi, Huo Zhejian, for example, Altschul S.F.et al, J.Mol.Biol., 215：403-410(1990)； Stephen F.et al, Nucleic Acids Res., 25：3389-3402(1997)）, ClustalW2 softwares（It is raw in Europe It can be obtained in thing information research institute network address：http://www.eji.ac.uk/Toolsa/clustalw2/, see also, for example, Higgins D.G.et al, Methods in Enzymology, 266: 383-402(1996); Larkin M.A. et Al, Bioinformatics (Oxford, England), 23 (21): 2947-8(2007)）；With TCoffee softwares etc.（ It can be obtained on the website of bioinformatics research institute of Sweden：http://tcoffee.vital-it.ch/cgi-bin/ Tcoffee/tcoffee_cgi/index.cgi, see also, for example, Poirot O.et al, Nucleic Acids Res., 31 (13): 3503-6(2003)；Notredame C.et al, J.Mol.Boil., 302(1): 205-17(2000)）.Use When software carries out sequence alignment, the default parameters that software can be used to provide, or software can also be carried according to actual conditions The parameter of confession is adjusted, and these are all in the knowledge of those skilled in the range.

Term " nano particle " can form octahedron, and the octahedron can have 432 symmetrical monomer iron by 24 Protein subunit protein is constituted.

Term " monomer ferritin subunit albumen " is Ferritin albumen（Abbreviation ferri albumen）, it is ferritin protein Total length, single polypeptide, or can instruct monomer ferritin subunit itself be assembled into protein balled form its is any Part, the amino acid sequence of the monomer ferritin subunit albumen from any known ferritin protein can be used for generating this hair Bright fusion protein, as long as monomer ferritin subunit albumen itself can be assembled into shows Porcine Epidemic Diarrhea in its surface The nano particle of malicious antigenic protein, or monomer ferritin subunit albumen can include and allow that fusion protein itself is assembled into nanometer The domain of particle.Fusion protein in the present invention need not include the full length sequence of monomer ferritin subunit polypeptide, Ke Yili With the part or region of monomer ferritin subunit albumen, monomer ferritin subunit albumen itself is instructed to assemble as long as the part is included Into protein balled form（It is octahedra as described）Amino acid sequence.One example in such region is located at helicobacter pylori iron Between albumen 5-167 amino acids, another example is recorded in Zhang Y. Self-assembly in the ferritin Nano-Cage protein super family. Int. J. Mol. Sci., 2011(12): 5406- 5421.In one embodiment, monomer ferritin subunit albumen may be selected from bacterial ferritin, phytoferritin, algae ferritin, Insect ferritin, fungi ferritin and mammalian ferritin.In one embodiment, monomer ferritin subunit albumen comes from Helicobacter pylori（Helicobacter pylori）Ferritin.

Term " fusion protein (fusion protein) " has two kinds of different implications, and one kind is by DNA recombinant techniques Two different protein are linked to be a macromolecular by the expression product after two obtained genetic recombination；It is another to lead to Chemical method connection is crossed, can also be realized by the fusion of gene.Also, fusion protein itself can be assembled into nano particle.

The present invention relates to a kind of fusion protein, the fusion protein includes connecting with Porcine epidemic diarrhea virus antigenic protein The monomer ferritin subunit albumen connect.

As one embodiment of the present invention, the Porcine epidemic diarrhea virus antigenic protein includes pig epidemic Diarrhea virus S protein and/or its fragment.

As one embodiment of the present invention, the Porcine epidemic diarrhea virus antigenic protein can also further comprise Porcine epidemic diarrhea virus S1 albumen, M albumen, N protein and/or its fragment.

As one embodiment of the present invention, the monomer ferritin subunit albumen includes bacterial ferritin, plant iron Albumen, algae ferritin, insect ferritin, fungi ferritin and mammalian ferritin.

As one embodiment of the present invention, the monomer ferritin subunit albumen is helicobacter pylori ferritin；Its In, the monomer ferritin subunit albumen is the helicobacter pylori ferritin of optimization；Wherein, the helicobacter pylori iron of the optimization Protein nucleotide sequence encodes SEQ ID NO.2 amino acid sequences.

As one embodiment of the present invention, the monomer ferritin subunit albumen, which is included, allows the fusion protein certainly Body is assembled into the domain of nano particle.

As one embodiment of the present invention, the fusion protein itself can be assembled into nano particle.

As one embodiment of the present invention, Porcine epidemic diarrhea virus antigenic protein described in the fusion protein With being connected with elastin in the middle of the monomer ferritin subunit albumen；Wherein, the elastin is amino acid sequence GGSGG, GGSGGGGSGG, GGSGGGGSGGGGSGG, GGSG, GGSGGGSG, GGSGGGSGGGSG, SGG, GSG, GG or The albumen of NGTGGSG codings.

The invention further relates to a kind of nano particle for including the fusion protein, wherein, the fusion protein is included and institute At least 25 continuous amino acids from monomer ferritin subunit albumen of Porcine epidemic diarrhea virus antigenic protein connection are stated, So that the nano particle is in its surface comprising 24 Porcine epidemic diarrhea virus antigenic protein monomers.

Term " adjuvant " may include aluminium glue adjuvant；Saponin(e（saponin）, such as Quil A, QS-21（Cambridge Biotech Incorporation, Cambridge MA）、GPI-0100（Galenica Pharmaceuticals Incorporation, Birmingham AL）；Water-in-oil emulsion；Oil in water emulsion；W/O/W emulsion；Acrylic acid or first The polymer of base acrylic acid；Maleic anhydride and alkenyl（alkenyl）The compound that the copolymer of derivative is selected.Term " emulsion " can be particularly based on light liquid paraffin oil（European Pharmacopea types）；The class isoamyl produced by olefin oligomerisation Diene oil（isoprenoid oil）, such as saualane（squalane）Or squalene oil（squalene oil）, especially isobutene Or certain herbaceous plants with big flowers alkene；Acid or alcohol the ester containing linear alkyl, more specifically vegetable oil, ethyl oleate, propane diols two-（Caprylate/certain herbaceous plants with big flowers acid esters）、 Glycerine three-（Caprylate/certain herbaceous plants with big flowers acid esters）Or Rikemal PO 200；The ester of branched chain fatty acid or alcohol, especially isostearate.Oil with Emulsifier combination uses to form emulsion.The ester of emulsifying agent preferred nonionic surfactants, especially sorbitan, two contractings are sweet Reveal alcohol（mannide）Ester（Such as anhydrous mannitol oleate）, aliphatic dihydroxy alcohol（glycol）Ester, polyglycereol （polyglycerol）Ester, the ester of the ester of propane diols and oleic acid, the ester of isostearic acid, the ester or hydroxy stearate of castor oil acid The ester of acid, their optional ethoxylations, also Pluronic L121, especially Pluronic products, especially It is L121.Write referring to Hunter etc.《The theory and practical application of adjuvants》（Ed. by DES Stewart-Tull, John Wiley and Sons, New York, 1995: 51-94）With Todd etc. Write《Vaccine》（1997, 15: 564-570）.For example, can be used what Powell M and Newman M write 《Vaccine design, the Subunit and adiuvant approach》（Plenum Press, 1995）147th The SPT emulsions of page description and the MF59 emulsions of the description of page 183.The term polymer of acid " acrylic or methacrylic " is preferably The acrylic or methacrylic acid polymer of crosslinking, especially with sugar（sugar）Poly alkenyl ether or polyalcohols crosslinking, these change Compound is known as carbomer（Carbomer, trade name Carbopol）（Phameuropa, 1996, 8(2)）.This area Technical staff is referring also to United States Patent (USP) US2909462, and which depict this kind of acrylate copolymer, it is with gathering hydroxylated chemical combination Thing is crosslinked, and the compound has at least three hydroxyl, preferably more than 8, the hydrogen atoms of 3 hydroxyls of wherein at least by with The unsaturated lipid alkyl of at least two carbon atom（aliphatic radical）Substitution.It is preferred that group be that those contain 2-4 The group of carbon atom, such as vinyl, pi-allyl and other ethylenically unsaturated groups（ethylenically unsaturated group）.The unsaturated group itself can include other substituents, such as methyl.These products are sold with the name of carbopol, （BF Goodrich, Ohio, USA）It is especially suitable.They are with allyl sucrose or and Allyl pentaerythritol（allyl pentaerythritol）Crosslinking.Carbopol 974P, 934P and 971P, most preferably with carbopol 971P are can be mentioned that among these. Term " copolymer of maleic anhydride and alkenyl derivative " also contemplates for the copolymer EMA of maleic anhydride and ethene （Monsanto）, these polymer dissolve generation acid solution in water, neutralized, physiological pH are preferably neutralized to, to produce Assist agent solution, immunogenicity, immunogenicity or vaccinal composition can be mixed thereto in itself.Term " adjuvant " also includes, but It is not limited to, RIBI adjuvant systems（Ribi Incorporation）、 Block co-polymer（CytRx, Atlanta GA）、 SAF-M（Chiron, Emeryville CA）, monophosphoryl lipid A（monophosphoryl lipid A）, Avridine fat Matter-amine adjuvant, E.coli LT（Restructuring is other）, cholera toxin, IMS 1314, muramyl dipeptide, Gel assistant Agent etc..

The invention further relates to a kind of vaccine combination, the vaccine combination includes the nano particle and/or veterinary science Upper acceptable carrier.

As one embodiment of the present invention, wherein, the content of nano particle is described in the vaccine combination species 0.5-200 μ g/ml, preferably 5-100 μ g/ml.

As one embodiment of the present invention, the carrier includes adjuvant；Wherein, the adjuvant include aluminium glue adjuvant, Saponin(e, water-in-oil emulsion, oil in water emulsion, W/O/W emulsion, polymer, the maleic two of acrylic or methacrylic acid Acid anhydrides and alkenyl（alkenyl）Copolymer, RIBI adjuvant systems, Block co-polymer, SAF-M, the single phosphorus of derivative Acyl lipid A, Avridine lipids-amine adjuvant, E.coli LT, cholera toxin, IMS 1314, muramyl dipeptide Or the one or more in Gel adjuvants；Wherein, the adjuvant is aluminium glue adjuvant.

As one embodiment of the present invention, the volume ratio of adjuvant described in the vaccine combination is 5%-30%, excellent Elect 20% as.

As a kind of preferred embodiment of the present invention, the vaccine combination also includes other antigens, and described other resist Original includes transmissible gastro-enteritis virus antigen, porcine rotavirus antigen, pig circular ring virus antigen, porcine reproductive and respiratory syndrome Viral antigen, haemophilus parasuis antigen, PPV Antigen Using, Actinobacillus pleuropneumoniae antigen, bacillus coli antigen, Atrophic rhinitis antigen, porcine pseudorabies virus antigen, hog cholera pathogen antigen, one kind in swine flue antigen or many Kind；Preferably, other described antigens are transmissible gastro-enteritis virus antigen.

The invention further relates to the preparation method of the vaccine combination, wherein, the preparation method includes：Step（1）Gram The grand expression fusion protein, fusion protein itself is assembled into nano particle, and step（2）The nanometer is mixed in proportion Grain and carrier.

As one embodiment of the present invention, the step in the preparation method（1）Melt described in middle clonal expression Hop protein is to clone the Porcine epidemic diarrhea virus antigenic protein, the monomer ferritin subunit albumen respectively, then uses base Because two kinds of albumen are carried out amalgamation and expressions by engineering means.

As one embodiment of the present invention, the Porcine epidemic diarrhea virus antigenic protein is pig epidemic diarrhea Virus S protein and/or its fragment, can also further comprise S1 albumen, M albumen, N protein and/or its fragment；Wherein, the pig Epidemic diarrhea virus antigenic protein includes Porcine epidemic diarrhea virus S protein and/or its fragment.

As one embodiment of the present invention, the monomer ferritin subunit albumen includes bacterial ferritin, plant iron Albumen, algae ferritin, insect ferritin, fungi ferritin and mammalian ferritin；Wherein, the monomer ferritin subunit egg It is helicobacter pylori ferritin in vain；Wherein, the monomer ferritin subunit albumen is the helicobacter pylori ferritin of optimization；Its In, the nucleotide sequence coded SEQ ID NO.2 amino acid sequences of helicobacter pylori ferritin of the optimization.

Term " prevention and/or treatment " refers to suppress pig popularity when being related to the infection of Porcine epidemic diarrhea virus variant The duplication of diarrhea virus, the propagation for suppressing Porcine epidemic diarrhea virus prevent the common strain of Porcine epidemic diarrhea virus and variant Settled down in its host, and mitigate the disease of Porcine epidemic diarrhea virus infection or the symptom of illness.If viral loads Reduce, illness mitigates and/or food ration and/or growth increase, then just it is considered that the treatment has reached therapeutic effect.

Term used herein " pig " refers to any belong to Suidae（Suidae）The animal of member, such as pig.

The invention will now be further described with reference to specific embodiments, and advantages of the present invention and feature will be with describing more clear Chu.But these embodiments are only exemplary, do not constitute any limitation to the scope of the present invention.Those skilled in the art should Understand, the details and form of technical solution of the present invention can be modified without departing from the spirit and scope of the invention Or replace, but these modifications and replacement are each fallen within protection scope of the present invention.

Pig epidemic diarrhea attacks poison strain for Shanghai strain or HN1301 plants employed in the embodiment of the present invention（Porcine epidemic diarrhea virus, strain HN1301）, wherein, Shanghai strain is in Chinese patent CN101117627A It is open, the Ministry of Agriculture announce in No. 270 files using the strain as common strain CV777 plant of pig epidemic diarrhea effect inspection with strong malicious Strain；HN1301 plants of preserving number is CCTCC NO. V201341, and depositary institution is China typical culture collection center, preservation Address is Wuhan University of Wuhan, China city, and preservation date is September in 2013 16, referring to Chinese patent CN104513827A, but No matter the embodiment does not constitute limitation of the invention under any circumstance.

Phosphate buffer used is pH7.4 PBS solutions in the embodiment of the present invention, and its formula is：1000 mL distill NaCl 8.0 g, KCl 0.2g, Na are added in water₂HPO₄·12H₂O 2.9 g、KH₂PO₄0.24 g, but the embodiment no matter Do not constitute limitation of the invention under any circumstance.

Used chemical reagent is that analysis is pure in the present invention, and purchased from Chinese medicines group, but no matter in office the embodiment is What does not constitute limitation of the invention in the case of.

The embodiment of the present invention is carried out so that volume ratio prepares pig epidemic diarrhea vaccine combination for 20% aluminium glue adjuvant as an example Illustrate, but no matter the embodiment does not constitute limitation of the invention under any circumstance.

The criterion of pig epidemic diarrhea morbidity is in the present embodiment：Apocleisis, usual yellow or light yellow watery diarrhea, Part piglet is with vomitting, the symptom such as shiver, be dehydrated, and may have dead after the piglet dehydration of part within the 5-6 days of clinical observation Die.The possible weight of occurring degree is different, but it is diarrhoea to judge that morbidity is most basic, be also indispensable condition.

To make the present invention easier to understand, with reference to specific embodiment, the present invention is expanded on further.It is of the present invention Experimental method, if being conventional method without specified otherwise；Described biomaterial, if without specified otherwise, can be from business way Footpath is obtained.

The preparation of the fusion protein of embodiment 1 and nano particle containing fusion protein

The preparation of 1.1Ferritin albumen

Ferritin albumen is directly directly synthesized according to SEQ ID NO.1 by Suzhou Jin Weizhi bio tech ltd.

The structure of 1.2 pCDNA-ferri plasmids

Synthesize the sense primer FerriFP of Ferritin albumen：5'ACGAATTCGGTGGTTC

TGGTGGTGAGTCTCAGGTC3', anti-sense primer FerriRP：5'GCTCTAGAT

CAGCTCTTCCTGCTCTTGGC3'。

The Ferritin albumen for being prepared embodiment 1.1 with the upstream and downstream primer of synthesis Ferritin albumen is as template Enter performing PCR amplification.PCR reaction conditions are 94 DEG C of 2min- of pre-degeneration（94 DEG C of 30s- annealing of denaturation, 56 DEG C of 30s- extend 72 DEG C 1min）30 circulations -- 72 DEG C of 7min of extension.The PCR primer of acquisition contains Ferritin GFPs and has merged one section GGSGG（Gene order is GGTGGTTCTGGTGGT）Elastin linker.

With pCDNA4.0 plasmids（Purchased from Invitrogen companies）PCDNA-ferri is built into by elastin GGSGG Plasmid.PCR primer containing elastin linker is connected with pCDNA4.0 plasmids, comprised the following steps that：Use DNA glue reclaims Kit（Tiangeng biochemical technology Co., Ltd）PCR primer is reclaimed, EcoR I and Xbal I digestions are used；PCDNA4.0 is simultaneously Use EcoR I and Xbal I digestions；Digestion post-fragment is reclaimed with DNA glue reclaims kit；Add and carry in 10 μ L linked systems Body 2 μ L, PCR reclaim μ L and the T4 ligases of fragment 7（Thermo）The μ L of 1 10 × buffer of μ L and T4 1, room temperature connection 30min； Connection product is added to 1 DH5 α competent cell, 30min, 42 DEG C of heat shock 90s are incubated on ice, 5min is then incubated on ice, 500 μ L 37 DEG C of 200rpm 1h of LB culture mediums are added, 300 μ L culture mediums, remaining painting LB flat boards are removed in centrifugation；Overnight incubation Picking colony is cultivated in ammonia benzyl resistance LB.Use plasmid extraction kit（Tiangeng biochemical technology Co., Ltd）Extract plasmid, you can Obtain pCDNA-ferri plasmids.

The plasmid extracted uses EcoR I and Xbal I digestions, and digestion products do agarose gel electrophoresis identification.Identification As a result：Two band are shown as, the target DNA fragment stripe size about 2500bp under being digested is consistent with expected theoretical value, Show that pCDNA-ferri plasmid constructions are correct.

The preparation and identification of 1.3 PEDV S-ferri fusion proteins and the nano particle containing fusion protein

PEDV S proteins sequence and primer sequence used in the PEDV fusion proteins of table 1 and correspondence nano particle

1.3.1 the preparation and identification of fusion protein S a-ferri and correspondence nano particle

（1）The structure of fusion protein S a-ferri expression plasmids

Sense primer SaF, the anti-sense primer SaR designed according to table 1, and Porcine epidemic diarrhea virus S protein gene order（In detail Feelings SEQ ID No.3）1-1914 gene orders expand S protein fragment with PCR method（It is named as Sa albumen）.Wherein, PCR Reaction condition be 94 DEG C of 2min- of pre-degeneration（94 DEG C of 30s- annealing of denaturation, 56 DEG C of 30s- extend 72 DEG C of 1min）30 are followed 72 DEG C of 7min of ring-extension.

PCR primer is reclaimed, Kpn I and EcoR I digestions is used.Simultaneously with Kpn I and EcoR I digestions embodiment 1.2 The plasmid pCDNA-ferri of preparation, reclaims linearized vector afterwards.Added in 10 μ l linked systems linearized vector 2 μ l, PCR reclaims μ l and the T4 ligases of fragment 7（Thermo）11 μ l of μ l and 10 × buffer, room temperature connection 30min.According to embodiment Method in 1.2 carries out plasmid conversion DH5 α competent cells, and extracts plasmid pCDNA-Sa-ferri.

Identified using Kpn I and EcoR I digestions, be shown as two band, the target DNA fragment band under being digested is big Small about 2500bp, is consistent with expected theoretical value, shows that plasmid has been correctly inserted into fragment.

Plasmid pCDNA-Sa-ferri is converted into DH5 α competent cells according to the method for embodiment 1.2.Bacterium is grown overnight Fall behind, picking single bacterium colony, be seeded to 200ml LB cultures.Using carrying plasmid kit greatly（Tiangeng biochemical technology Co., Ltd） Extract, obtain plasmid pCDNA-Sa-ferri.

（2）Recombinate nano particle Sa-Nano preparation

With the DMEM culture mediums of the hyclone containing 10%V/V by 293T cells with 8 × 10⁵Cell/cm²Density plated cells in On 60mm tissue culture dishes, in 5%CO₂37 DEG C of incubators in be incubated 24 hours, can start after cell attachment is complete transfection. The serum free medium of change preheating before transfection.

Transfected plasmids and fusion protein self assembly：Prepare two 1.5ml centrifuge tubes, a pipe adds 240 μ l HBS solution（Will 8.76g NaCl are dissolved in 900ml ultra-pure waters, add 20ml 1M HEPES, adjust pH value to 7.4, are settled to 1L, with 0.2 μm of filter Be stored in after membrane filtration 4 DEG C it is standby）Mixed with 6 μ g pCDNA-Sa-ferri；Then 100 μM of 18 μ l PEI is added in another pipe In the HBS solution for entering 162 μ l, 10 μM of final concentration.Two pipe 1.5ml centrifugation liquid in pipe is mixed, incubation at room temperature 20min formation turns Contaminate compound.Transfection composite is added in cell culture medium afterwards, in 5%CO₂37 DEG C of incubator cultures 72 hours, melt Hop protein self-assembles during expression turn into restructuring nano particle Sa-Nano.

（3）Nano particle Sa-Nano purifying and identification

Collect 293T cell culture medium supernatants, 8000 × g centrifuge 1 hour after with 0.45 μm of aperture membrane filtration.Supernatant ultrafiltration Liquid is changed in concentration, changes the Buffer A of agglutinin chromatograph into.With ConA lectin affinity chromatography posts（GE）Purify 293T cell culture Supernatant, is then purified using anion-exchange chromatography（GE）, and it is continuing with molecular sieve HiLoad Superdex 200 16/600 GL is purified, and obtains purity>80% nano particle Sa-Nano.

The μ g/ml of final concentration 1 after nano particle Sa-Nano carbonate buffer solutions dilute, 100 μ are added per hole in elisa plate L, 4 DEG C of coatings discard coating buffer after overnight, are washed with PBST 3 times；Then the PBST of the defatted milk containing 10%m/V is added by 100 μ l/ holes Solution is closed, and 37 DEG C are closed 1 hour；3 times, 3min/ times are washed after closing with PBST；Add and diluted with PBS by 100 μ l/ holes And its final concentration is contained 1:5000V/V Monoclonal Antibodies against Porcine Epidemic Diarrhea Virus 8A3A10（Referring to Chinese patent CN104694480A）, it is incubated at room temperature 1 hour.PBST washes 3 times to remove non-specific binding, 3min/ times；With sheep anti mouse secondary antibody volume Than 1:5000 dilutions, 100 μ l are added per hole, are incubated at room temperature 40min；PBST washes 5 times to remove non-specific binding, 3min/ times；With ELISA nitrite ions develop the color；Add 50 μ l 2M H₂SO₄With terminating reaction.The result of ELISA identifications, details are determined with ELIASA It is shown in Table 2.As a result：Coated nano particle can react with monoclonal antibody specific, show the restructuring nanometer that purifying is obtained Grain Sa-Nano contains PEDV antigenic components.

ELISA testing results after the different nano particle coatings of table 2

Nano particle Sa-Nano samples are incubated 1min by transmission electron microscope negative staining to 0.01mg nano particle Sa-Nano in copper mesh, 45s is dyed with 1% acetic acid uranium, sample observation is carried out with transmission electron microscope.As a result show：Electron microscopic observation is to be substantial amounts of straight Footpath 45nm or so particle, shows that fusion protein S a-ferri is self-assembled into nano particle Sa-Nano.

（4）The measure of nano particle Sa-Nano contents

With BCA protein quantification kits（Purchased from Pierce companies）To specifications to nano particle Sa-nano after purifying concentration Quantitative analysis is carried out, measurement result shows：Nano particle Sa-ferri content is 2.3mg/ml.

1.4 fusion protein S b-ferri and correspondence nano particle preparation and identification

According to the sense primer SbF shown in table 1, anti-sense primer SbR and Porcine epidemic diarrhea virus S protein gene order（Details SEQ ID No.3）1-2370 gene orders, and method shown in embodiment 1.3 prepare fusion protein S b-ferri, with And the nano particle Sb-Nano of the b-ferri containing fusion protein S, and it is identified, as a result it is consistent with expection；Then to it Purified, and ELISA identifications are carried out to nano particle Sb-Nano after purification, qualification result shows：Purify the restructuring obtained Nano particle Sb-Nano contains PEDV antigenic components.

With BCA protein quantification kits（Purchased from Pierce companies）To specifications to nano particle Sb-Nano after purification Quantitative analysis is carried out, measurement result shows：Nano particle Sb-Nano content is 3.1mg/ml.

1.5 fusion protein S c-ferri and correspondence nano particle preparation and identification

First using with the plasmid pCDNA-ferri constructed by embodiment 1.2, carry out transformation and build plasmid pCDNA-SP-ferri. Build the fusion protein ferri expression plasmids with PEDV signal peptides.One section of synthesis is with Kpn I and BamH I restriction enzyme sites PEDV signal peptide sequences：5'AAGGTACCATGAAGTCTTTAACCTACTTCTGGTTGTTCTTACCAGTACTTTCAACACTTA GCCTACCACAAGATGTCACCAGGGGATCCAA3'.Carry out digestion with Kpn I and BamHI, and with DNA glue reclaim kits Reclaim the signal fragments of peptides after digestion.The plasmid pCDNA-ferri constructed by digestion embodiment 1.2, is then returned with DNA glue simultaneously Receive kit and reclaim linearized vector.Plasmid is attached, converts and extracts according to the method described in embodiment 1.3.And use Kpn I are identified with BamH digestions.

According to the sense primer ScF shown in table 1, anti-sense primer ScR and Porcine epidemic diarrhea virus S protein gene order （Details SEQ ID No.3）1381-1914 gene orders, and the method shown in embodiment 1.3（Plasmid used is pCDNA-SP-ferri）Prepare fusion protein S c-ferri, and the c-ferri containing fusion protein S nano particle Sc-Nano, And it is identified, as a result it is consistent with expection；Then it is purified, and nano particle Sc-Nano after purification is entered Row ELISA identifications, qualification result（It is shown in Table 2）Show：Purifying obtain restructuring nano particle Sc-Nano contain PEDV antigens into Point.

With BCA protein quantification kits（Purchased from Pierce companies）To specifications to nano particle Sc-Nano after purification Quantitative analysis is carried out, measurement result shows：Nano particle Sc-Nano content is 2.5mg/ml.

1.6 fusion protein S d-ferri and correspondence nano particle preparation and identification

According to the sense primer ScF shown in table 1, anti-sense primer ScR and Porcine epidemic diarrhea virus S protein gene order（Details SEQ ID No.3）1381-2370 gene orders, and the method shown in embodiment 1.5（Plasmid used is pCDNA- SP-ferri）Prepare fusion protein S d-ferri, and the d-ferri containing fusion protein S nano particle Sd-Nano, and to it Identified, be as a result consistent with expection；Then it is purified, and ELISA is carried out to nano particle Sc-Nano after purification Identification, qualification result（It is shown in Table 2）Show：The restructuring nano particle Sc-Nano that purifying is obtained contains PEDV antigenic components.

With BCA protein quantification kits（Purchased from Pierce companies）To specifications to nano particle Sd-Nano after purification Quantitative analysis is carried out, measurement result shows：Nano particle Sd-Nano content is 3.3mg/ml.

1.7 fusion protein S e-ferri and correspondence nano particle preparation and identification

According to the sense primer SeF shown in table 1, anti-sense primer SeR and Porcine epidemic diarrhea virus S protein gene order（Details SEQ ID No.3）1-3978 gene orders, and method shown in embodiment 1.3 prepare fusion protein S e-ferri with And the nano particle Se-Nano of the e-ferri containing fusion protein S, and it is identified.As a result show, albumen, table are not purified into Bright albumen is expressed not successfully.

The preparation of the vaccine combination of embodiment 2

Nano particle Sa-Nano, Sb-Nano, Sc-Nano, Sd-Nano prepared by embodiment 1 is entered respectively using pH7.4 PBS Go and dilute, and add aluminium glue adjuvant and fully mix, make the content of contained nano particle in vaccine combination as shown in table 3, simultaneously The volume ratio for ensureing aluminium glue adjuvant and vaccine combination is 1:5.Using the vaccine combination prepared as immunogene, in 4 DEG C of guarantors Deposit standby.

Component contained by the pig epidemic diarrhea vaccine combination of table 3

The pig epidemic diarrhea vaccine combination immune efficacy of embodiment 3 is evaluated

3.1 active immunities are tested

3 age in days PEDV antibody, antigen negative piglet 88 are chosen, 11 groups are randomly divided into（Details are shown in Table 2）, 8/group.1A, Vaccine 1-6, the 2ml/ head of 1B, 1C, 1D, 1E, 1F, 1G group respectively as prepared by the intramuscular injection embodiment 2 of table 2；1H, 1I group are For the existing vaccine control group prepared according to Chinese patent CN103301476A methods, 2ml/ heads are immunized；1J, 1K group are sky The pH7.4 of white control group inoculation same dose PBS solution.14 days after immune, collection immune group and control group Swine serum, Each group serum neutralize antibody titers are detected respectively.Statistical is carried out to each piglet Mean antibody titer using the softwares of SPSS 15.0 Analysis.Meanwhile, immune group removes every oral 1ml Shanghai strain virus liquid of 1G, 1H group and blank control group 1J groups pig（Virus liquid TCID₅₀It is not less than 10^7.0/ml）Progress is attacked outside poison, remaining immune group 1A, 1B, 1C, 1D, 1F, 1I group and blank control group 1K The group oral 1ml HN1301 strain virus liquid of pig every（Virus liquid TCID₅₀It is not less than 10^7.0/ml）Poison is attacked in progress.Attack and 7 are observed after poison My god, each group incidence is counted, and judged according to morbidity criterion.

Active immunity efficacy test results are shown in Table 4.

The active immunity efficacy test results of table 4

As shown in Table 4：

（1）The neutralize antibody titers determined after piglet active immunity, are immunized pig epidemic diarrhea vaccine combination（1A, 1B, 1C, 1D, 1E, 1F, 1G group）The geometric average antibody titer of piglet is respectively 1:60、1:62.5、1:63、1:65、1:58、1:75、 1:67, it is found that antibody titer is suitable when antigenic content is identical, antibody titer slightly has rise with the rise of antigenic content, and shows Write and be higher than existing vaccine immunity group（2H, 2I group）'s（p<0.05）, it is significantly higher than blank control group（p<0.05）.

（2）Attack after poison, pig epidemic diarrhea vaccine combination is immunized（1A, 1B, 1C, 1D, 1E, 1F, 1G group）Piglet, In addition to immune same day appetite has declined, diarrhoea is had no in the observation period, spirit, diet are normal, and protective rate is 100%；And show There is technology control group（1H, 1I group）Have 3 respectively, the symptom such as suffering from diarrhoea occur in 2 piglets, spirit, appetite declines, and protective rate is only For 62.5%, 75%；Blank control group（1J, 1K group）Piglet is taken up in order of priority in attacking the 2nd after poison, falling ill within 3 days, to observation period knot Beam, the incidence of disease is 100%, wherein 3 piglets are dead because of diarrheal dehydration.

3.2 passive immunitys are tested

22 outward appearances of selection are normal, same period breeding, the sow heavy in pig that antigen, the antibody test such as PEDV, TGEV are negative, It is randomly divided into 11 groups（Details are shown in Table 3）, 2/group.2A, 2B, 2C, 2D, 2E, 2F, 2G group sow are respectively 5-7 weeks before childbirth Vaccine 1-6,2ml/ head prepared by embodiment 3 is immunized by the intramuscular injection of table 3, after 3 weeks, two are carried out with same immunization wayses and dosage Exempt from.

After immune Farrowing, while gathering sow blood, after handling respectively, neutralize antibody titers are determined.It the results are shown in Table 3, show：Immune vaccine 1-6 test group 2A, 2B, 2C, 2D, 2E, 2F, 2G group sow serum geometric average antibody titer point Wei 1:46、1:50、1:52、1:56、1:48、1:64、1:54, it is found that antibody titer is quite when antigenic content is identical, with antigen The rise of content and antibody titer slightly has rise, and be significantly higher than existing vaccine immunity group（2H, 2I group）'s（p<0.05）, It is significantly higher than blank control group（p<0.05）.

From each immune group and control sow litter, 8 first 3 age in days piglets are selected at random, and wherein immune group removes 2G, 2H Group and the oral 1ml Shanghai strain virus liquid of blank control group 2J every pig of group（Virus liquid TCID₅₀It is not less than 10^7.0/ml）Attacked It is malicious outer, remaining immune group 2A, 2B, 2C, 2D, 2E, 2F group and oral 1ml HN1301 plants of blank control group 2K every pig of group Virus liquid（Virus liquid TCID₅₀It is not less than 10^7.0/ml）Poison is attacked in progress.Attack after poison, observe 7 days, count each group incidence, and root Judged according to morbidity criterion.

Passive immunity efficacy test results are shown in Table 5.

The passive immunity efficacy test results of table 5

As shown in Table 5：

Attacked using the Porcine epidemic diarrhea virus Shanghai strain or HN1301 plant of separation after poison, pig epidemic diarrhea vaccine combination is immunized The immune group of thing（2A, 2B, 2C, 2D, 2E, 2F, 2G group）Sow litter, the classical symptom such as do not occur suffering from diarrhoea, spirit, Appetite is normal, and protective rate is 100%；And existing immunized controls group（2H, 2I group）Have 4 respectively, suffering from diarrhoea occur in 3 piglets Symptom, spirit, appetite decline, and protective rate is only 50%, 62.5%；Blank control group（2J, 2K group）Non-immune sow institute Farrowing pig is attacked after poison, and the clinical symptoms such as occurred suffering from diarrhoea in the 3rd day, terminated to the 7th day observation period, suffering from diarrhoea occur in whole piglets Clinical symptoms, wherein because of dehydration death occurs for 4 piglets.

In summary, whether active immunity or passive immunity, pig epidemic diarrhea epidemic disease prepared by nano particle used Preferable immune effect can be obtained after seedling composition is immune, protection completely can be obtained.

The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention God is with principle, and any modification, equivalent substitution and improvements made etc. should be included in the scope of the protection.

<110>Pulaike Biological Engineering Co., Ltd.

<120>A kind of fusion protein and its application

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 522

<212> DNA

<213>Artificial sequence

<400> 1

gagtctcagg tcagacaaca attcagcaag gacatcgaaa agctgctgaa cgagcaggtg 60

aacaaggaga tgcagagcag caacctgtac atgtccatgt ccagctggtg ctacacccac 120

agcctcgatg gcgccggcct gttcctgttc gatcacgccg ccgaggagta tgagcacgcc 180

aagaagctga tcgtgttcct gaacgagaac aacgtgcccg tgcagctgac cagcattagc 240

gcccccgagc acaagttcga gggactgaca cagatcttcc agaaggccta cgagcacgag 300

cagcacatca gcgagagcat caacaacatc gtggaccacg ccatcaaggg caaggaccac 360

gccaccttca atttcctgca gtggtacgtg agcgagcagc acgaggagga ggtgctgttc 420

aaggacatcc tggacaagat cgagctgatc ggcaacgaga accacggcct gtacctggcc 480

gaccagtacg tgaagggcat cgccaagagc aggaagagct ga 522

<210> 2

<211> 173

<212> PRT

<213>Artificial sequence

<400> 2

Glu Ser Gln Val Arg Gln Gln Phe Ser Lys Asp Ile Glu Lys Leu Leu

1 5 10 15

Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser Asn Leu Tyr Met Ser

20 25 30

Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp Gly Ala Gly Leu Phe

35 40 45

Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His Ala Lys Lys Leu Ile

50 55 60

Val Phe Leu Asn Glu Asn Asn Val Pro Val Gln Leu Thr Ser Ile Ser

65 70 75 80

Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala

85 90 95

Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile Asn Asn Ile Val Asp

100 105 110

His Ala Ile Lys Gly Lys Asp His Ala Thr Phe Asn Phe Leu Gln Trp

115 120 125

Tyr Val Ser Glu Gln His Glu Glu Glu Val Leu Phe Lys Asp Ile Leu

130 135 140

Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His Gly Leu Tyr Leu Ala

145 150 155 160

Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg Lys Ser

165 170

<210> 3

<211> 4158

<212> DNA

<213>Artificial sequence

<400> 3

atgaagtctt taacctactt ctggttgttc ttaccagtac tttcaacact tagcctacca 60

caagatgtca ccaggtgctc agctaacact aattttaggc ggttcttttc aaaatttaat 120

gttcaggcgc ctgcagttgt tgtactgggc ggttatctac ctattggtga aaaccagggt 180

gtcaattcaa cttggtactg tgctggccaa catccaactg ctagtggcgt tcatggtatc 240

tttcttagcc atattagagg tggtcatggc tttgagattg gcatttcgca agagcctttt 300

gaccctagtg gttaccagct ttatttacat aaggctacta acggtaacac taatgctact 360

gcgcgactgc gcatttgcca gtttcccagc attaaaacat tgggccccac tgctaataat 420

gatgttacaa caggtcgtaa ctgcctattt aacaaagcca tcccagctca tatgagtgaa 480

catagtgttg tcggcataac atgggataat gatcgtgtca ctgtcttttc tgacaagatc 540

tattattttt attttaaaaa tgattggtcc cgtgttgcga caaagtgtta caacagtgga 600

ggttgtgcta tgcaatatgt ttacgaaccc acttactaca tgcttaatgt tactagtgct 660

ggtgaggatg gtatttctta tcaaccctgt acagctaatt gcattggtta tgctgccaat 720

gtatttgcta ctgagcccaa tggccacata ccagaaggtt ttagttttaa taattggttt 780

cttttgtcca atggttccac tttggtgcat ggtaaggtgg tttccaacca accattgttg 840

gtcaattgtc ttttggccat tcctaagatt tatggactag gccaattttt ctcctttaat 900

caaacgatcg atggtgtttg taatggagct gctgtgcagc gtgcaccaga ggctctgagg 960

tttaatatta atgacacttc tgtcattctt gctgaaggct caattgtact tcatactgct 1020

ttaggaacaa atttttcttt tgtttgcagt aattcctcaa atcctcactt agccaccttt 1080

gccatacctc tgggtgctat ccaagtaccc tattattgtt ttcttaaagt ggatacttac 1140

aactccactg tttataaatt cttggctgtt ttacctccta ccgtcaggga aattgtcatc 1200

accaagtatg gtgatgttca tgtcaatggg tttggctact tgcatctcgg tttgttggat 1260

gctgtcacaa ttaatttcac tggtcatggc actgacgatg acgtttctgg tttttggacc 1320

atagcatcga ctaattttgt tgatgcactt atcgaagttc aaggaactgc cattcagcgt 1380

attctttatt gtgatgatcc tgttagccaa ctcaagtgtt ctcaggttgc ttttgacctt 1440

gacgatggtt tttaccctat ttcctctaca aaccttctga gtcatgaaca gccaacttct 1500

tttgttactt tgccatcatt taatgatcat tcttttgtta atattactgt ctctgctgct 1560

tttggtggtc atagtggtgc caaccttatt gcatctgaca ctactatcaa tggttttagt 1620

tctttctgtg ttgacactag acaatttacc atttcactgt tttataacgt tacaaacagt 1680

tatggttacg tgtctaaatc acaggacagt aattgccctt ttaccttgca atctgttaat 1740

gattacctgt cttttagcaa attttgtgtt tctaccagcc ttttggctag tgcctgtacc 1800

atagatcttt ttggttaccc tgagtttggt agtggtgtta agttcacgtc cctttacttt 1860

caattcacaa agggtgagtt gattactggc acgcctaaac catttgaagg tgttacggac 1920

gtttctttta tgactctgga tgtgtgtacc aagtatacta tctatggctt taaaggtgag 1980

ggtatcatta cccttacaaa ttctagcttt ttggcaggtg tttattatac atctgattct 2040

ggacagttgt tagcttttaa gaatgtcact agtggtgctg tttattctgt tacgccatgt 2100

tctttttcag agcaggctgc atatgttgat gatgatatag tgggtgttat ttctagtttg 2160

tctaactcca cttttaacag tactagggag ttgcctggtt tcttctacca ttctaatgat 2220

ggctctaatt gtacagagcc tgtgttggtg tatagtaaca taggtgtttg taaatctggc 2280

agtattggct atgtcccatc tcagtctggc caagtcaaga ttgcacccac ggttactggg 2340

aatattagta ttcccaccaa ctttagtatg agtattagga cagaatattt acagctttac 2400

aacacgcctt ttagtgttga ttgtgctaca tatgtttgta atggtaactc tcgttgtaaa 2460

catttactca cccagtacac tgcagcatgt aagactatag agtcagcatt acaactcagc 2520

gctaggcttg agtctgctga agtcaactct atgcttacta tttctgaaga ggctctacag 2580

ttagctacca tcagttcgtt taatggtgat ggatataatt ttactaatgt gctgggtgtt 2640

tccgtgtatg accctgcaag tggcagggtg gtacaaaaaa ggtctttcat tgaagacctg 2700

ctttttaata aagtggttac taatggcctt ggtactgttg atgaagacta taagcgctgt 2760

tctaatggcc gctctgtggc agatttagtc tgtgcgcagt attactctgg tgtcatggta 2820

ctacctggtg ttgttgacgc tgagaagctt catatgtata gtgcgtctct catcggtggt 2880

atggtgctag gaggttttac tgcagcagcg gcattgcctt ttagctatgc tgttcaagcg 2940

agactgaatt atcttgctct acagacggat gttctacagc ggaaccagca attgcttgct 3000

gagtctttta attctgctat tggtaatata acttcagcct ttgagagtgt taaagaggct 3060

attagtcaaa cttctaaggg tttgaacact gtggctcatg cgcttaccaa ggtccaagag 3120

gttgttaatt cgcagggtgc agctttgacc caacttaccg tacagctgca acacaacttc 3180

caagccattt ctagttctat tgatgacatt tactcccgac ttgacattct ttcagccgat 3240

gttcaggtag accgtctcat caccggcaga ttatcagcac ttaatgcttt tgttgctcaa 3300

acccttacta agtatactga ggttcaggct agcaggaaac tagcacagca aaaggttaat 3360

gagtgcgtta aatcgcaatc tcagcgttat ggtttttgtg gtggtgatgg cgagcacatt 3420

ttctctctgg tacaggccgc acctcaaggc ctgctgtttt tacacacagt acttgtaccg 3480

ggtgactttg taaatgttat tgccatcgct ggcttatgtg ttaacgatga aattgccttg 3540

actctacgtg agcctggttt agtcttgttt acgcatgaac ttcaagatac tgcgacggaa 3600

tattttgttt catcgcggcg tatgtatgaa cctagaaaac ctaccgttgg tgattttgtt 3660

caaattgaga gttgtgtggt cacctatgtc aatttgacta gagaccaact accagaagta 3720

atcccagatt acatcgatgt taacaaaaca cttgatgaga ttttagcctc tctgcccaat 3780

agaactggtc caagtctttc tctagatgtt tttaatgcca cttatcttaa tctcactggt 3840

gaaattgcag atttagagca gcgttcagag tctctccgta atactacaga agagctccaa 3900

agtcttatat ataatatcaa caacacacta gttgaccttg agtggctcaa ccgagttgag 3960

acatatatca agtggccgtg gtgggtttgg ttgattattt ttattgttct catctttgtt 4020

gtgtcattac tagtgttctg ctgcatttcc acgggttgtt gtggatgctg cggctgctgt 4080

ggtgcttgtt tttcaggttg ttgtaggggt cctagacttc aaccttacga agcttttgaa 4140

aaggtccacg tgcagtga 4158

Claims

1. a kind of fusion protein, wherein, the fusion protein includes the list being connected with Porcine epidemic diarrhea virus antigenic protein Body ferritin subunit albumen；Wherein, the Porcine epidemic diarrhea virus antigenic protein includes Porcine epidemic diarrhea virus S protein And/or its fragment；Wherein, the Porcine epidemic diarrhea virus antigenic protein can also further comprise Porcine epidemic diarrhea virus S1 albumen, M albumen, N protein and/or its fragment.

2. fusion protein according to claim 1, wherein, the monomer ferritin subunit albumen includes bacterial ferritin, planted Thing ferritin, algae ferritin, insect ferritin, fungi ferritin and mammalian ferritin；Wherein, the monomer ferritin is sub- Base albumen is helicobacter pylori ferritin；Wherein, the monomer ferritin subunit albumen is the helicobacter pylori ferritin of optimization； Wherein, the nucleotide sequence coded SEQ ID NO.2 amino acid sequences of the helicobacter pylori ferritin of the optimization；The monomer iron Protein subunit protein, which is included, allows that the fusion protein itself is assembled into the domain of nano particle.

3. fusion protein according to claim 1, wherein, the fusion protein itself can be assembled into nano particle；Wherein, Connected in the middle of Porcine epidemic diarrhea virus antigenic protein described in the fusion protein and the monomer ferritin subunit albumen Flexible albumen；Wherein, the elastin be amino acid sequence GGSGG, GGSGGGGSGG, GGSGGGGSGGGGSGG, The albumen of GGSG, GGSGGGSG, GGSGGGSGGGSG, SGG, GSG, GG or NGTGGSG coding.

4. a kind of nano particle, wherein, the nano particle is the nanometer for including any one of the claim 1-3 fusion proteins Particle, wherein, it is sub- that the fusion protein includes the monomer ferritin being connected with the Porcine epidemic diarrhea virus antigenic protein Base albumen so that the nano particle is in its surface comprising 24 Porcine epidemic diarrhea virus antigenic protein monomers.

5. a kind of vaccine combination, wherein, the vaccine combination includes nano particle and/or veterinary science described in claim 4 Upper acceptable carrier；Wherein, the content of nano particle described in the vaccine combination is 0.5-200 μ g/ml, preferably 5- 100µg/ml。

6. vaccine combination according to claim 5, wherein, the carrier includes adjuvant；Wherein, the adjuvant includes aluminium glue Adjuvant, saponin(e, water-in-oil emulsion, oil in water emulsion, W/O/W emulsion, the polymer, suitable of acrylic or methacrylic acid Anhydride maleique and alkenyl（alkenyl）Copolymer, RIBI adjuvant systems, Block co-polymer, SAF- of derivative M, monophosphoryl lipid A, Avridine lipids-amine adjuvant, E.coli LT, cholera toxin, IMS 1314, cell wall One or more in acyl dipeptides or Gel adjuvants；Wherein, the adjuvant is aluminium glue adjuvant；Wherein, institute in the vaccine combination The volume ratio for stating adjuvant is 5%-30%, preferably 20%.

7. according to any one of the claim 5-6 vaccine combinations, wherein, the vaccine combination also includes other antigens； Wherein, other described antigens include transmissible gastro-enteritis virus antigen, porcine rotavirus antigen, pig circular ring virus antigen, pig Reproductive and respiratory syndrome virus antigen, haemophilus parasuis antigen, PPV Antigen Using, Actinobacillus pleuropneumoniae resist Original, bacillus coli antigen, atrophic rhinitis antigen, porcine pseudorabies virus antigen, hog cholera pathogen antigen, swine influenza virus One or more in antigen；Wherein, other described antigens are transmissible gastro-enteritis virus antigen.

8. a kind of preparation method of any one of the claim 5-7 vaccine combination, wherein, the preparation method includes：Step Suddenly（1）Fusion protein described in clonal expression, fusion protein itself is assembled into nano particle, and step（2）Institute is mixed in proportion State nano particle and carrier；

Wherein, the step in the preparation method（1）Fusion protein described in middle clonal expression flows to clone the pig respectively Row diarrhea virus antigenic protein, the monomer ferritin subunit albumen, then carried out two kinds of albumen with genetic engineering means Amalgamation and expression；Wherein, the Porcine epidemic diarrhea virus antigenic protein is Porcine epidemic diarrhea virus S protein and/or its piece Section, can also further comprise S1 albumen, M albumen, N protein and/or its fragment；Wherein, the Porcine epidemic diarrhea virus antigen Property albumen include Porcine epidemic diarrhea virus S protein and/or its fragment；Wherein, the monomer ferritin subunit albumen includes thin Bacterium ferritin, phytoferritin, algae ferritin, insect ferritin, fungi ferritin and mammalian ferritin；Wherein, it is described Monomer ferritin subunit albumen is helicobacter pylori ferritin；Wherein, the monomer ferritin subunit albumen is the pylorus of optimization Helicobacter ferritin；Wherein, the nucleotide sequence coded SEQ ID NO.2 amino acid sequences of the helicobacter pylori ferritin of the optimization Row；

Wherein, the step in preparation method（1）Described in the antigenic egg of Porcine epidemic diarrhea virus described in fusion protein In vain with being connected with elastin in the middle of the monomer ferritin subunit albumen；Wherein, the elastin is amino acid sequence GGSGG, GGSGGGGSGG, GGSGGGGSGGGGSGG, GGSG, GGSGGGSG, GGSGGGSGGGSG, SGG, GSG, GG or The albumen of NGTGGSG codings.

9. any one of the claim 5-7 vaccine combinations are preparing the medicine of prevention and/or treatment Porcine Epidemic Diarrhea In application.

10. a kind of helicobacter pylori ferritin of optimization, wherein, the helicobacter pylori ferritin nucleotide sequence of the optimization is compiled Code SEQ ID NO.2 amino acid sequences.