KR101608576B1 - Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker for detecting a cucumber fungal disease and a method for detecting a cucumber fungal disease using the same, and more particularly, to a method for detecting a cucumber pathogen in a group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide A polynucleotide consisting of 10-100 consecutive DNA sequences comprising one or more selected single nucleotide polymorphism (SNP) markers, or a complementary polynucleotide thereof. In addition, the present invention provides a method for detecting pseudoperonospora cubensis-specific cucumber anticancer substances and a detection kit.

Description

TECHNICAL FIELD The present invention relates to a single nucleotide polymorphism marker for detecting a polynucleotide of a cucumber, and a method for detecting a polynucleotide polymorphism using the polynucleotide,

The present invention relates to a single nucleotide polymorphism (SNP) marker for detection of a cucumber fungal disease entity and a method for detecting a cucumber fungal disease entity using the same.

Cucumbers have been grown for thousands of years and are popular plant crops grown worldwide. Cucumbers have a delicious flavor, are juicy, contain a variety of vitamins and minerals, and are the most preferred consumer-recommended vegetable. They are grown all year round in greenhouses and greenhouses. Cucumber is a humectant that requires a lot of water during growth, and the distribution of roots in the soil is shallow, so it is easily damaged if the soil moisture is insufficient. Therefore, cucumbers are cultivated in a relatively humid environment, so they are susceptible to nosocomial diseases, jade fungus diseases, and scleroderma caused by humid environments.

Mycosis is caused by the fungus Pseudoperonospora cubensis (P.C.) and causes significant crop loss in many cucurbit species including cucumber. The disease is found all over the world, and is affected by humidity and temperature conditions. The disease occurs in plants grown in greenhouses, and plants grown in open fields. Nonghyack disease is one of the most important leaf diseases of Bacillus, and it can decrease fruit yield and quality and can kill susceptible seedlings. Initially, irregular spots are formed on the front side of the leaf, light yellowish color appears on the back side of the leaf, It occurs first in the lower leaves and spreads upward. When the spots are combined, the lesion grows larger and the leaves dry.

Cucumber naturally-susceptible disease has a disadvantage that it is difficult to control after onset, and once it fails in initial control, it spreads rapidly and causes enormous damage. It is a disease that causes serious problems in cucumber, but there is no proper control method and initial control or prevention is the best way . However, there is no way to efficiently predict the propagation of these spores or to determine whether they are infectious in the pre-disease stage.

US Published Patent 2011-0126309A1 (Released May 26, 2011)

It is an object of the present invention to provide a composition for detecting a cucumber fungal body using a single base polymorphism (SNP) marker.

It is another object of the present invention to provide a method for detecting a cucumber antifungal agent, which comprises performing PCR with DNA extracted from a cucumber and detecting a PCR amplification product to determine whether the cucumber is infected with a cucumber.

It is still another object of the present invention to provide a cucurbitid body detection kit comprising a probe specifically binding to a polynucleotide comprising the single nucleotide polymorphism (SNP) marker or a primer for amplifying the polynucleotide.

The present invention provides a polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: 1, or And a composition for detecting a cucumber anticancer body comprising the complementary polynucleotide.

The present invention also relates to a method for producing a cucumber plant, The primers set forth in SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: 8 and SEQ ID NO: 9, Performing PCR using the PCR; And a step of detecting the PCR amplification product and judging whether the cucumber mosquito infectious agent is infected or not.

The present invention also provides a polynucleotide comprising 10-100 consecutive DNA sequences comprising one or more single nucleotide polymorphism (SNP) markers selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: A probe that specifically binds to a nucleotide or a complementary polynucleotide thereof, or a primer for amplifying the polynucleotide.

The present invention relates to a single nucleotide polymorphism (SNP) marker for detecting a cucumber fungal disease, and a method for detecting a cucumber fungal disease using the same, wherein a spore or symptom collected from a buggy near the cucumber planting site It is anticipated that by using the SNP markers of the present invention in the DNA extracted from cucumber leaves, the presence of P. cubensis can be diagnosed to minimize damage to nociceptive diseases.

FIG. 1A shows the result of grouping of P. cubensis and P. humuli into different groups on a dendrogram in the beta-tublin gene. The CDM is a variety of P. cubensis isolates, and those beginning with H are P. humuli isolates.
Figure 1b shows the SNP between the sequences of P. cubensis (first and second lines) and P. humuli (third line).
Fig. 2 shows specific detection results of Pseudomonas spp. (P. cubensis) and Pseudomonas aeruginosa (P. humuli) through PCR. M: Molecular Marker, 1: Cucumber plant DNA + (primer A + B combination), 2. Cucumber plant DNA + (primer D + E combination), 3. P. cubensis DNA + (primer A + C combination) 5. P. cubensis DNA + (primer D + F combination), 6. P. cubensis DNA + (primer E + F combination), 7. P. humuli DNA + (Primer A + C combination), 8. P. humuli DNA + (primer B + C combination), 9. P. humuli DNA + (primer D + F combination), 10. P. humuli DNA + Combination)
FIG. 3 shows the SNP sequence between Pseudomonas spp. And Pseudomonas spp. Using a Realtime PCR instrument. The PCR reaction was carried out in a single PCR to obtain Pseudomonas spp. . cubensis) is detected. (SEQ ID NO: 8 and SEQ ID NO: 9) prepared using the SNP region of the present invention.

The present inventors have confirmed that Pseudoperonospora cubensis-specific base sequences can be obtained, and Pseudorferonospora cubensis can be specifically detected through PCR primers using the thus-obtained SNP markers. Thereby completing the invention.

The present invention provides a polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: 1, or And a composition for detecting a cucumber anticancer body comprising the complementary polynucleotide.

Specifically, the allele of the 40 th nucleotide of SEQ ID NO: 1 is A / G, the allele of the 88 th nucleotide is A / G, and the allele of the 151 th nucleotide is T / C.

Since the 40th and 88th nucleotides of SEQ ID NO: 1 can be either A or G, "r" and the 151th nucleotide may be T or C, so "y ".

Specifically, the cucumber anticancer agent may be Pseudoperonospora cubensis.

The polymorphism of the present invention means a case where two or more alleles exist in a single gene locus, and a 'polymorphic site' means a gene locus in which the above-mentioned allele exists. Of the polymorphic sites, only single bases differing from each other are referred to as 'single nucleotide polymorphism' (SNP).

The present invention relates to a method for detecting DNA comprising: extracting DNA from a sample; The primers set forth in SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: 8 and SEQ ID NO: 9, Performing PCR using the PCR; And a step of detecting the PCR amplification product and judging whether the cucumber mosquito infectious agent is infected or not.

Specifically, the method for detecting a cucumber naturally infected body is a method specific to Pseudoperonospora cubensis.

In the step of extracting DNA from the sample, the sample may include all of the samples suspected of infecting the cucumber naturally infected body, such as cucumber leaves and spores collected in a bug bug near the cucumber field. A method for extracting DNA from a sample is not particularly limited, and a technique known in the art or a commercially available DNA extraction kit can be used.

The present invention provides a polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: 1, or A probe specifically binding to a complementary polynucleotide thereof, or a primer for amplifying the polynucleotide. Specifically, the cucumber anticancer agent may be Pseudoperonospora cubensis.

Preferably, the primer is at least one primer set selected from the group consisting of the primer set of SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: But is not limited thereto.

The term "probe" means a probe that specifically binds to the mRNA,

And is labeled with nucleic acid fragments such as RNA or DNA corresponding to several hundred bases, so that the presence or expression amount of specific mRNA can be confirmed. The probe may be prepared in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art.

The term "primer" as used herein refers to an oligonucleotide that acts as a starting point for template-directed DNA synthesis under appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and polymerases such as DNA, RNA polymerase or reverse transcriptase) Lt; / RTI > oligonucleotides. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

< Example  >

As a result of the base sequence analysis, Pseudoperonospora cubensis and non-pathogenic Pseudoperonospora humuli were most similar to each other and the ITS-rRNA sequence used for pathogen classification was 100% It is necessary to secure a new sequence to specifically amplify Pseudomonas spp. (P. cubensis). Thus, the NCBI was able to obtain the polymorphism of P. cubensis, which was obtained by downloading the base sequence of various Pseudomonas spp. (P. cubensis) and Pseudomonas aeruginosa P. humuli And the sequence of the nucleotide sequence was confirmed.

As a result, although sequences showing differences between individuals of Pseudomonas aeruginosa (P. cubensis) were found in ITS-rRNA, rRNA, ITS, and COX II sequences, the sequence of P. humuli in Pseudomonas aeruginosa Was found. Thus, a gene sequence with a highly conserved sequence in relatively diverse species was downloaded and compared with P. pneumoniae and P. humuli individuals It was possible to group P. cubensis and P. humuli into different groups on a dendrogram in one gene (beta-tubulin) (Fig. 1a) (Fig. 1B).

Using these SNP sequences, allele-specific primers capable of specifically amplifying P. cubensis and P. humuli can be obtained. In addition, Respectively. As shown in Table 1, one primer was designed to be located at the 3 'end of the SNP (indicated in the *) in the species, and the other was designed by designing a primer with a sequence commonly found between the two species. Specific PCR products can be obtained.

gene Name of the primer Primer symbol Base sequence


beta-tubulin cubensis_A_R A CTCTACGACCGTGTCCGTT ^* (SEQ ID NO: 2) humuli_A_R B CTCTACGACCGTGTCCGTC ^* (SEQ ID NO: 3) coommon_A_F C CAGGGTTTCCAGATCACTCA (SEQ ID NO: 4) cubensis_B_R D ACTGTAGAATAACACACAATTAGGA ^* (SEQ ID NO: 5) humuli_B_R E ACTGTAGAATAACACACAATTAGGG ^* (SEQ ID NO: 6) common_B_F F GATTGTACGATGTGCAGCTA (SEQ ID NO: 7)

As a result of carrying out PCR reaction (denaturation at 96 °, annealing at 55 °, extension at 74 °, and 30 times) using the above primer combination, Pseudomonas fluorescens (P cubensis) and P. humuli (P. humuli) could be specifically detected.

On the other hand, in order to detect P. pneumoniae (P. cubensis) by the above-mentioned method using a primer, at least two PCR reactions must be performed. In order to solve this problem, a primer that can be reproducibly detected by a single PCR reaction Set. Real time PCR using a combination of TubulinR2 primer (AGGCACATGACTTCATCGGC; SEQ ID NO: 8) and TubulinF2 primer (AGAGCCCTACAACGCTACGT; SEQ ID NO: 9) was able to detect Pseudomonas spp. 3).

<110> INDUSTRY-ACADEMIA COOPERATION GROUP OF SEJONG UNIVERSITY <120> Single nucleotide polymorphism marker detecting          Pseudoperonospora cubensis and method for detecting          Pseudoperonospora cubensis using the same <130> ADP-2013-0527 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 240 <212> DNA <213> Pseudoperonospora cubensis <400> 1 cattatgtgc acgtactcgg tatgtccatc ccctaaggtr tcggacacgg tcgtagagcc 60 ctacaacgct acgttgtctg tgcaccarct tgtcgaaaat gccgatgaag tcatgtgcct 120 ggacaacgaa gccctgtacg acatttgctt ycgcacactt aagctcacga cccctacgta 180 cggtgacttg aaccatttgg tgtgtgccgc catgtctggt atcaccactt gtctacgatt 240                                                                          240 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctctacgacc gtgtccgtt 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctctacgacc gtgtccgtc 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cagggtttcc agatcactca 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 actgtagaat aacacacaat tagga 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 actgtagaat aacacacaat taggg 25 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gattgtacga tgtgcagcta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aggcacatga cttcatcggc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 agagccctac aacgctacgt 20

Claims (8)

A polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151st nucleotide of SEQ ID NO: 1, or a complementary A composition for detecting pseudoperonospora cubensis, which comprises a polynucleotide. The method according to claim 1, wherein the allele of the 40 th nucleotide of SEQ ID NO: 1 is A / G, the allele of the 88 th nucleotide is A / G, and the allele of the 151 th nucleotide is T / C A composition for detecting pseudoperonospora cubensis, a cucumber naturally infected body. delete Extracting DNA from the sample;
The primers set forth in SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: 8 and SEQ ID NO: 9, Performing PCR using the PCR; And
Detecting the PCR amplification product and determining whether the cucumber is infected with the cucumber mosquito repellent Pseudoperonospora cubensis. 2. The method according to claim 1, wherein the pseudoperonospora cubensis is a cucumber plant. delete A polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151st nucleotide of SEQ ID NO: 1, or a complementary 1. A cucumber antifungal compound Pseudoperonospora cubensis detection kit comprising a probe specifically binding to a polynucleotide or a primer for amplifying the polynucleotide. The primer set according to claim 6, wherein the primer comprises a primer set of SEQ ID NO: 2 and SEQ ID NO: 4, a primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and a primer set of SEQ ID NO: Wherein said cucumber is a set of cucumber seedlings. delete

Images