KR101608576B1 - Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same - Google Patents
Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same Download PDFInfo
- Publication number
- KR101608576B1 KR101608576B1 KR1020140045381A KR20140045381A KR101608576B1 KR 101608576 B1 KR101608576 B1 KR 101608576B1 KR 1020140045381 A KR1020140045381 A KR 1020140045381A KR 20140045381 A KR20140045381 A KR 20140045381A KR 101608576 B1 KR101608576 B1 KR 101608576B1
- Authority
- KR
- South Korea
- Prior art keywords
- seq
- nucleotide
- cucumber
- detecting
- primer
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
Abstract
본 발명은 오이 노균병원체 검출용 단일염기다형성(Single nucleotide polymorphism; SNP) 마커 및 이를 이용한 오이 노균병원체 검출방법에 관한 것으로서, 서열번호 1의 40번째 뉴클레오티드, 88번째 뉴클레오티드 및 151번째 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상의 단일염기다형성(SNP) 마커를 포함하는 10-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 오이 노균병원체 검출용 조성물을 제공한다. 또한, 본 발명은 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) 특이적 오이 노균병원체 검출방법 및 검출키트를 제공한다.The present invention relates to a single nucleotide polymorphism (SNP) marker for detecting a cucumber fungal disease and a method for detecting a cucumber fungal disease using the same, and more particularly, to a method for detecting a cucumber pathogen in a group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide A polynucleotide consisting of 10-100 consecutive DNA sequences comprising one or more selected single nucleotide polymorphism (SNP) markers, or a complementary polynucleotide thereof. In addition, the present invention provides a method for detecting pseudoperonospora cubensis-specific cucumber anticancer substances and a detection kit.
Description
본 발명은 오이 노균병원체 검출용 단일염기다형성(Single nucleotide polymorphism; SNP) 마커 및 이를 이용한 오이 노균병원체 검출방법에 관한 것이다.The present invention relates to a single nucleotide polymorphism (SNP) marker for detection of a cucumber fungal disease entity and a method for detecting a cucumber fungal disease entity using the same.
오이는 수천년 동안 재배되어 왔고, 전세계에서 재배되는 인기있는 식물 작물이다. 오이는 맛깔스런 향기가 있으며, 수분이 많고 각종 비타민과 무기질을 함유하고 있어 대부분의 소비자가 선호하는 생식용 채소로 최근에는 온실이나 비닐하우스 등에서 연중 재배된다. 오이는 생육 중에 많은 수분을 필요로 하는 호습성 채로로 토양 중에 뿌리의 분포가 얕기 때문에 토양수분이 부족할 경우 쉽게 장해를 받는다. 따라서 오이는 비교적 다습한 상태에서 재배되므로 다습한 환경에서 발생되는 노균병, 젯빛곰팡이병, 균핵병 등의 피해를 받기 쉽다.Cucumbers have been grown for thousands of years and are popular plant crops grown worldwide. Cucumbers have a delicious flavor, are juicy, contain a variety of vitamins and minerals, and are the most preferred consumer-recommended vegetable. They are grown all year round in greenhouses and greenhouses. Cucumber is a humectant that requires a lot of water during growth, and the distribution of roots in the soil is shallow, so it is easily damaged if the soil moisture is insufficient. Therefore, cucumbers are cultivated in a relatively humid environment, so they are susceptible to nosocomial diseases, jade fungus diseases, and scleroderma caused by humid environments.
노균병은 진균 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) (P.c.)에 의해 유발되고, 오이를 포함하여 많은 박과(Cucurbit) 종에서 유의한 작물 손실을 야기한다. 이 질병은 전세계에서 발견되고, 습도, 온도 조건에 영향받는다. 이 질병은 온실에서 성장한 식물, 및 노지에서 성장한 식물에서 발생한다. 노균병은 박과의 가장 중요한 잎 질병 중의 하나이고, 과실 수량 및 품질을 저하시킬 수 있고, 감수성 모종을 사멸시킬 수 있다. 초기에는 잎의 앞면에 퇴록된 부정형 반점이 생기고 엷은 황색을 띠며 잎 뒷면에는 수침상으로 나타난다. 아랫잎에서 먼저 발생되고 위로 번지는데 반점들이 합쳐지면 병반은 커지고 잎이 말라 죽는다. Mycosis is caused by the fungus Pseudoperonospora cubensis (P.C.) and causes significant crop loss in many cucurbit species including cucumber. The disease is found all over the world, and is affected by humidity and temperature conditions. The disease occurs in plants grown in greenhouses, and plants grown in open fields. Nonghyack disease is one of the most important leaf diseases of Bacillus, and it can decrease fruit yield and quality and can kill susceptible seedlings. Initially, irregular spots are formed on the front side of the leaf, light yellowish color appears on the back side of the leaf, It occurs first in the lower leaves and spreads upward. When the spots are combined, the lesion grows larger and the leaves dry.
오이 노균병은 발병 후 방제가 어려운 단점이 있고, 일단 초기 방제에 실패하면 급속히 확산되어 막대한 피해를 발생시켜, 오이에 심각한 문제를 일으키는 질병이지만 마땅한 방제법이 없는 상태이고 초기 방제나 예방이 최선의 방법이다. 하지만 포자 상태로 바람에 날려 이동하므로 이들의 전파를 효율적으로 예측하거나 병발생 이전 단계에서 노균병의 감염 여부를 판별하는 방법이 없는 상황이다.Cucumber naturally-susceptible disease has a disadvantage that it is difficult to control after onset, and once it fails in initial control, it spreads rapidly and causes enormous damage. It is a disease that causes serious problems in cucumber, but there is no proper control method and initial control or prevention is the best way . However, there is no way to efficiently predict the propagation of these spores or to determine whether they are infectious in the pre-disease stage.
본 발명의 목적은 단일염기다형성(SNP) 마커를 이용한 오이 노균병원체 검출용 조성물을 제공하는데 있다. It is an object of the present invention to provide a composition for detecting a cucumber fungal body using a single base polymorphism (SNP) marker.
본 발명의 다른 목적은 오이 개체로부터 추출한 DNA로 PCR을 수행하고, PCR 증폭 산물을 검출하여 오이 노균병원체 감염 여부를 판단하는 오이 노균병원체 검출방법을 제공하는데 있다.It is another object of the present invention to provide a method for detecting a cucumber antifungal agent, which comprises performing PCR with DNA extracted from a cucumber and detecting a PCR amplification product to determine whether the cucumber is infected with a cucumber.
본 발명의 또 다른 목적은 상기 단일염기다형성(SNP) 마커를 포함하는 폴리뉴클레오티드에 특이적으로 결합하는 프로브 또는 상기 폴리뉴클레오티드를 증폭하기 위한 프라이머를 포함하는 오이 노균병원체 검출키트를 제공하는데 있다. It is still another object of the present invention to provide a cucurbitid body detection kit comprising a probe specifically binding to a polynucleotide comprising the single nucleotide polymorphism (SNP) marker or a primer for amplifying the polynucleotide.
본 발명은 서열번호 1의 40번째 뉴클레오티드, 88번째 뉴클레오티드 및 151번째 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상의 단일염기다형성(SNP) 마커를 포함하는 10-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 오이 노균병원체 검출용 조성물을 제공한다. The present invention provides a polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: 1, or And a composition for detecting a cucumber anticancer body comprising the complementary polynucleotide.
또한, 본 발명은 오이 개체로부터 DNA를 추출하는 단계; 상기 추출한 DNA를 주형으로 하고, 서열번호 2 및 서열번호 4의 프라이머 세트, 서열번호 5 및 서열번호 7의 프라이머 세트 및 서열번호 8 및 서열번호 9의 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및 상기 PCR 증폭 산물을 검출하여 오이 노균병원체 감염 여부를 판단하는 단계를 포함하는 오이 노균병원체 검출방법을 제공한다.The present invention also relates to a method for producing a cucumber plant, The primers set forth in SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: 8 and SEQ ID NO: 9, Performing PCR using the PCR; And a step of detecting the PCR amplification product and judging whether the cucumber mosquito infectious agent is infected or not.
또한, 본 발명은 서열번호 1의 40번째 뉴클레오티드, 88번째 뉴클레오티드 및 151번째 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상의 단일염기다형성(SNP) 마커를 포함하는 10-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프로브 또는 상기 폴리뉴클레오티드를 증폭하기 위한 프라이머를 포함하는 오이 노균병원체 검출 키트를 제공한다. The present invention also provides a polynucleotide comprising 10-100 consecutive DNA sequences comprising one or more single nucleotide polymorphism (SNP) markers selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: A probe that specifically binds to a nucleotide or a complementary polynucleotide thereof, or a primer for amplifying the polynucleotide.
본 발명은 오이 노균병원체 검출용 단일염기다형성(Single nucleotide polymorphism; SNP) 마커 및 이를 이용한 오이 노균병원체 검출 방법에 관한 것으로서, 정기적인 모니터링을 통한 오이 재배지 근처의 포충망에서 수집된 포자나 병징이 나타나지 않은 오이 잎에서 추출한 DNA에서 본 발명의 SNP 마커를 이용하여 슈도페로노스포라 쿠벤시스(P. cubensis) 존재 여부를 진단하여 노균병에 대한 피해를 최소화시킬 수 있을 것으로 예상된다.The present invention relates to a single nucleotide polymorphism (SNP) marker for detecting a cucumber fungal disease, and a method for detecting a cucumber fungal disease using the same, wherein a spore or symptom collected from a buggy near the cucumber planting site It is anticipated that by using the SNP markers of the present invention in the DNA extracted from cucumber leaves, the presence of P. cubensis can be diagnosed to minimize damage to nociceptive diseases.
도 1a는 베타-튜블린(beta-tublin) 유전자에 있어서, 쿠벤시스(P. cubensis)와 휴뮬리(P. humuli)를 dendrogram 상에서 다른 그룹으로 그룹화(grouping)한 결과이다. CDM은 다양한 P. cubensis isolates이고, H로 시작되는 것은 P. humuli isolates이다.
도 1b는 슈도페로노스포라 쿠벤시스(P. cubensis)(첫 번째 및 두 번째 줄)와 슈도페로노스포라 휴뮬리(P. humuli)(세 번째 줄)의 서열 간 SNP를 나타낸다.
도 2는 PCR을 통한 슈도페로노스포라 쿠벤시스(P. cubensis) 및 슈도페로노스포라 휴뮬리(P. humuli) 특이적 검출 결과를 나타낸다. M: Molecular Marker, 1: 오이 식물체 DNA + (프라이머 A + B 조합), 2. 오이 식물체 DNA + (프라이머 D + E 조합), 3. P. cubensis DNA + (프라이머 A + C 조합), 4. P. cubensis DNA + (프라이머 B + C 조합), 5. P. cubensis DNA + (프라이머 D + F 조합), 6. P. cubensis DNA + (프라이머 E + F 조합), 7. P. humuli DNA + (프라이머 A + C 조합), 8. P. humuli DNA + (프라이머 B + C 조합), 9. P. humuli DNA + (프라이머 D + F 조합), 10. P. humuli DNA + (프라이머 E + F 조합)
도 3은 슈도페로노스포라 쿠벤시스(P. cubensis) 및 슈도페로노스포라 휴뮬리(P. humuli) 간의 SNP 서열을 Realtime PCR 기기를 활용하여 한 번의 PCR 반응을 통해서 슈도페로노스포라 쿠벤시스(P. cubensis)를 검출하는 방법을 나타낸다. 본 발명의 SNP 영역을 포함하여 제작된 프라이머 세트(서열번호 8 및 서열번호 9)를 이용한 결과이다.FIG. 1A shows the result of grouping of P. cubensis and P. humuli into different groups on a dendrogram in the beta-tublin gene. The CDM is a variety of P. cubensis isolates, and those beginning with H are P. humuli isolates.
Figure 1b shows the SNP between the sequences of P. cubensis (first and second lines) and P. humuli (third line).
Fig. 2 shows specific detection results of Pseudomonas spp. (P. cubensis) and Pseudomonas aeruginosa (P. humuli) through PCR. M: Molecular Marker, 1: Cucumber plant DNA + (primer A + B combination), 2. Cucumber plant DNA + (primer D + E combination), 3. P. cubensis DNA + (primer A + C combination) 5. P. cubensis DNA + (primer D + F combination), 6. P. cubensis DNA + (primer E + F combination), 7. P. humuli DNA + (Primer A + C combination), 8. P. humuli DNA + (primer B + C combination), 9. P. humuli DNA + (primer D + F combination), 10. P. humuli DNA + Combination)
FIG. 3 shows the SNP sequence between Pseudomonas spp. And Pseudomonas spp. Using a Realtime PCR instrument. The PCR reaction was carried out in a single PCR to obtain Pseudomonas spp. . cubensis) is detected. (SEQ ID NO: 8 and SEQ ID NO: 9) prepared using the SNP region of the present invention.
본 발명자들은 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) 특이적인 염기서열을 확보하고, 이렇게 확보된 SNP 마커를 이용한 PCR 프라이머를 통해 슈도페로노스포라 쿠벤시스를 특이적으로 검출할 수 있음을 확인하고 본 발명을 완성하였다.
The present inventors have confirmed that Pseudoperonospora cubensis-specific base sequences can be obtained, and Pseudorferonospora cubensis can be specifically detected through PCR primers using the thus-obtained SNP markers. Thereby completing the invention.
본 발명은 서열번호 1의 40번째 뉴클레오티드, 88번째 뉴클레오티드 및 151번째 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상의 단일염기다형성(SNP) 마커를 포함하는 10-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 오이 노균병원체 검출용 조성물을 제공한다. The present invention provides a polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: 1, or And a composition for detecting a cucumber anticancer body comprising the complementary polynucleotide.
상세하게는, 상기 서열번호 1의 40번째 뉴클레오티드의 대립유전자형은 A/G이고, 88번째 뉴클레오티드의 대립유전자형은 A/G이며, 151번째 뉴클레오티드의 대립유전자형은 T/C일 수 있다. Specifically, the allele of the 40 th nucleotide of SEQ ID NO: 1 is A / G, the allele of the 88 th nucleotide is A / G, and the allele of the 151 th nucleotide is T / C.
상기 서열번호 1은 다중염기기재 방식에 따라 작성하였으며, 서열번호 1의 40번째 및 88번째 뉴클레오티드는 A 또는 G일 수 있으므로 "r"라고 기재하고, 151번째 뉴클레오티드는 T 또는 C일 수 있으므로 "y"라고 기재하였다.Since the 40th and 88th nucleotides of SEQ ID NO: 1 can be either A or G, "r" and the 151th nucleotide may be T or C, so "y ".
상세하게는, 상기 오이 노균병원체는 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis)일 수 있다.
Specifically, the cucumber anticancer agent may be Pseudoperonospora cubensis.
본 발명의 다형성(polymorphism)은 단일 유전자 좌위에 두 가지 이상의 대립유전자가 존재하는 경우를 의미하며, '다형성부위(polymorphic site)'란 상기 대립유전자가 존재하는 유전자 좌위를 의미한다. 다형성 부위 중에서, 단일 염기만이 상이한 것을 ‘단일염기다형성’, 즉 SNP(single nucleotide polymorphism)라고 한다.
The polymorphism of the present invention means a case where two or more alleles exist in a single gene locus, and a 'polymorphic site' means a gene locus in which the above-mentioned allele exists. Of the polymorphic sites, only single bases differing from each other are referred to as 'single nucleotide polymorphism' (SNP).
본 발명은 시료로부터 DNA를 추출하는 단계; 상기 추출한 DNA를 주형으로 하고, 서열번호 2 및 서열번호 4의 프라이머 세트, 서열번호 5 및 서열번호 7의 프라이머 세트 및 서열번호 8 및 서열번호 9의 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및 상기 PCR 증폭 산물을 검출하여 오이 노균병원체 감염 여부를 판단하는 단계를 포함하는 오이 노균병원체 검출방법을 제공한다.The present invention relates to a method for detecting DNA comprising: extracting DNA from a sample; The primers set forth in SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: 8 and SEQ ID NO: 9, Performing PCR using the PCR; And a step of detecting the PCR amplification product and judging whether the cucumber mosquito infectious agent is infected or not.
상세하게는, 상기 오이 노균병원체 검출 방법은 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) 특이적인 방법이다.
Specifically, the method for detecting a cucumber naturally infected body is a method specific to Pseudoperonospora cubensis.
상기 시료로부터 DNA를 추출하는 단계에서, 시료는 오이 노균병원체의 감염이 의심되는 시료는 모두 포함될 수 있는데, 그 예로는 오이 재배지 근처의 포충망에서 수집된 포자나 병징이 나타나지 않은 오이 잎 등이다. 시료로부터 DNA를 추출하는 방법은 특별히 한정되지 않으며, 당업계에 공지된 기술 또는 시판되고 있는 DNA 추출용 키트를 사용할 수 있다.
In the step of extracting DNA from the sample, the sample may include all of the samples suspected of infecting the cucumber naturally infected body, such as cucumber leaves and spores collected in a bug bug near the cucumber field. A method for extracting DNA from a sample is not particularly limited, and a technique known in the art or a commercially available DNA extraction kit can be used.
본 발명은 서열번호 1의 40번째 뉴클레오티드, 88번째 뉴클레오티드 및 151번째 뉴클레오티드로 이루어진 군에서 선택된 어느 하나 이상의 단일염기다형성(SNP) 마커를 포함하는 10-100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드에 특이적으로 결합하는 프로브 또는 상기 폴리뉴클레오티드를 증폭하기 위한 프라이머를 포함하는 오이 노균병원체 검출 키트를 제공한다. 상세하게는, 상기 오이 노균병원체는 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis)일 수 있다.The present invention provides a polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one single nucleotide polymorphism (SNP) marker selected from the group consisting of the 40th nucleotide, the 88th nucleotide and the 151th nucleotide of SEQ ID NO: 1, or A probe specifically binding to a complementary polynucleotide thereof, or a primer for amplifying the polynucleotide. Specifically, the cucumber anticancer agent may be Pseudoperonospora cubensis.
바람직하게는, 상기 프라이머는 서열번호 2 및 서열번호 4의 프라이머 세트, 서열번호 5 및 서열번호 7의 프라이머 세트 및 서열번호 8 및 서열번호 9의 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트일 수 있지만, 이에 제한되는 것은 아니다.
Preferably, the primer is at least one primer set selected from the group consisting of the primer set of SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: But is not limited thereto.
상기 "프로브"는 mRNA외 특이적으로 결합을 이룰 수 있는 짧게는 수 염기 내The term "probe" means a probe that specifically binds to the mRNA,
지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있어서 특정 mRNA의 존재 유무, 발현양을 확인할 수 있다. 프로브는 올리고뉴클레오타이드(oligonucleotide) 프로브, 단쇄 DNA(single strand DNA) 프로브, 이중쇄 DNA(double strand DNA)프로브, RNA 프로브 등의 형태로 제작될 수 있다. 적절한 프로브의 선택 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택할 수 있다.
And is labeled with nucleic acid fragments such as RNA or DNA corresponding to several hundred bases, so that the presence or expression amount of specific mRNA can be confirmed. The probe may be prepared in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art.
상기 "프라이머"란 적절한 버퍼 중의 적절한 조건 (예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드를 말한다. 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 15 내지 30 뉴클레오티드이다. 짧은 프라이머 분자는 일반적으로 주형과 안정한 혼성체를 형성하기 위해서는 더 낮은 온도를 필요로 한다. 프라이머 서열은 주형과 완전하게 상보적일 필요는 없으나, 주형과 혼성화 할 정도로 충분히 상보적이어야 한다.
The term "primer" as used herein refers to an oligonucleotide that acts as a starting point for template-directed DNA synthesis under appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and polymerases such as DNA, RNA polymerase or reverse transcriptase) Lt; / RTI > oligonucleotides. The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.
이하, 하기 실시예를 통해 본 발명을 보다 상세하게 설명한다. 다만, 이러한 실시예에 의해 본 발명이 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.
< < 실시예Example > >
염기서열 분석 결과, 병원성인 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) 와 비병원성인 슈도페로노스포라 휴뮬리(Pseudoperonospora humuli)는 염기서열이 가장 유사하고 병원체 분류에 주로 사용하는 ITS-rRNA 서열은 100% 동일하므로 슈도페로노스포라 쿠벤시스(P. cubensis)를 특이적으로 증폭할 새로운 서열을 확보해야 한다. 그래서 NCBI에서 다양한 슈도페로노스포라 쿠벤시스(P. cubensis) 개체와 슈도페로노스포라 휴뮬리(P. humuli) 개체의 염기서열을 다운받아서 다형성을 보이는 슈도페로노스포라 쿠벤시스(P. cubensis) 특이적인 염기서열을 확보하는 작업을 진행하였다. As a result of the base sequence analysis, Pseudoperonospora cubensis and non-pathogenic Pseudoperonospora humuli were most similar to each other and the ITS-rRNA sequence used for pathogen classification was 100% It is necessary to secure a new sequence to specifically amplify Pseudomonas spp. (P. cubensis). Thus, the NCBI was able to obtain the polymorphism of P. cubensis, which was obtained by downloading the base sequence of various Pseudomonas spp. (P. cubensis) and Pseudomonas aeruginosa P. humuli And the sequence of the nucleotide sequence was confirmed.
그 결과, ITS-rRNA, rRNA, ITS, COXII 서열 등에서 슈도페로노스포라 쿠벤시스(P. cubensis) 개체 간에 차이가 나타나는 서열이 발견되었지만, 슈도페로노스포라 휴뮬리(P. humuli) 개체에서도 동일한 서열의 차이가 발견되었다. 그래서 상대적으로 다양한 종 간에서도 매우 잘 보존된(highly conserved) 서열을 지닌 유전자 서열을 다운받아서 슈도페로노스포라 쿠벤시스(P. cubensis) 개체와 슈도페로노스포라 휴뮬리(P. humuli) 개체와 비교하니 하나의 유전자(beta-tubulin)에서 쿠벤시스(P. cubensis)와 휴뮬리(P. humuli)를 dendrogram 상에서 다른 그룹으로 그룹화(grouping)할 수 있었고 (도 1a), 두 그룹의 서열 간에서 몇 군데의 SNP 차이를 발견할 수 있었다 (도 1b). As a result, although sequences showing differences between individuals of Pseudomonas aeruginosa (P. cubensis) were found in ITS-rRNA, rRNA, ITS, and COX II sequences, the sequence of P. humuli in Pseudomonas aeruginosa Was found. Thus, a gene sequence with a highly conserved sequence in relatively diverse species was downloaded and compared with P. pneumoniae and P. humuli individuals It was possible to group P. cubensis and P. humuli into different groups on a dendrogram in one gene (beta-tubulin) (Fig. 1a) (Fig. 1B).
이렇게 발견된 SNP 서열을 이용해서 슈도페로노스포라 쿠벤시스(P. cubensis)와 슈도페로노스포라 휴뮬리(P. humuli)를 특이적으로 증폭할 수 있는 대립유전자-특이 프라이머(allele-specific primer)를 디자인하였다. 표 1에 나타난 것처럼 종간에 나타난 SNP (* 표시된 부분) 서열을 3' 말단에 위치하게 프라이머를 하나 디자인하고, 나머지 하나는 두 종 간에 공통적으로 발견되는 서열로 프라이머를 디자인해서 PCR 증폭을 실시하면 종 특이적인 PCR 산물을 얻을 수 있다.
Using these SNP sequences, allele-specific primers capable of specifically amplifying P. cubensis and P. humuli can be obtained. In addition, Respectively. As shown in Table 1, one primer was designed to be located at the 3 'end of the SNP (indicated in the *) in the species, and the other was designed by designing a primer with a sequence commonly found between the two species. Specific PCR products can be obtained.
beta-tubulin
beta-tubulin
상기의 프라이머 조합을 이용하여 PCR 반응[96도 변성(denature), 55도 결합(annealing), 74도 신장(extension), 30회)을 실시한 결과, 도 2와 같이 슈도페로노스포라 쿠벤시스(P. cubensis)와 슈도페로노스포라 휴뮬리(P. humuli)를 특이적으로 검출할 수 있었다.As a result of carrying out PCR reaction (denaturation at 96 °, annealing at 55 °, extension at 74 °, and 30 times) using the above primer combination, Pseudomonas fluorescens (P cubensis) and P. humuli (P. humuli) could be specifically detected.
한편, 상기의 프라이머를 이용한 방법으로 슈도페로노스포라 쿠벤시스(P. cubensis)를 검출하기에는 최소한 2가지 PCR 반응을 실시하여야 하는데, 이런 점을 개선하기 위하여 한 번의 PCR 반응으로 재현성 있게 검출이 가능한 프라이머 세트를 개발하였다. TubulinR2 프라이머(AGGCACATGACTTCATCGGC; 서열번호 8) 및 TubulinF2 프라이머(AGAGCCCTACAACGCTACGT; 서열번호 9) 조합을 이용한 실시간 PCR(Real-time PCR) 방법을 통해 슈도페로노스포라 쿠벤시스(P. cubensis)를 검출할 수 있었다(도 3). On the other hand, in order to detect P. pneumoniae (P. cubensis) by the above-mentioned method using a primer, at least two PCR reactions must be performed. In order to solve this problem, a primer that can be reproducibly detected by a single PCR reaction Set. Real time PCR using a combination of TubulinR2 primer (AGGCACATGACTTCATCGGC; SEQ ID NO: 8) and TubulinF2 primer (AGAGCCCTACAACGCTACGT; SEQ ID NO: 9) was able to detect Pseudomonas spp. 3).
<110> INDUSTRY-ACADEMIA COOPERATION GROUP OF SEJONG UNIVERSITY <120> Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same <130> ADP-2013-0527 <160> 9 <170> KopatentIn 2.0 <210> 1 <211> 240 <212> DNA <213> Pseudoperonospora cubensis <400> 1 cattatgtgc acgtactcgg tatgtccatc ccctaaggtr tcggacacgg tcgtagagcc 60 ctacaacgct acgttgtctg tgcaccarct tgtcgaaaat gccgatgaag tcatgtgcct 120 ggacaacgaa gccctgtacg acatttgctt ycgcacactt aagctcacga cccctacgta 180 cggtgacttg aaccatttgg tgtgtgccgc catgtctggt atcaccactt gtctacgatt 240 240 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctctacgacc gtgtccgtt 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctctacgacc gtgtccgtc 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cagggtttcc agatcactca 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 actgtagaat aacacacaat tagga 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 actgtagaat aacacacaat taggg 25 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gattgtacga tgtgcagcta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aggcacatga cttcatcggc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 agagccctac aacgctacgt 20 <110> INDUSTRY-ACADEMIA COOPERATION GROUP OF SEJONG UNIVERSITY <120> Single nucleotide polymorphism marker detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same <130> ADP-2013-0527 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 240 <212> DNA <213> Pseudoperonospora cubensis <400> 1 cattatgtgc acgtactcgg tatgtccatc ccctaaggtr tcggacacgg tcgtagagcc 60 ctacaacgct acgttgtctg tgcaccarct tgtcgaaaat gccgatgaag tcatgtgcct 120 ggacaacgaa gccctgtacg acatttgctt ycgcacactt aagctcacga cccctacgta 180 cggtgacttg aaccatttgg tgtgtgccgc catgtctggt atcaccactt gtctacgatt 240 240 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctctacgacc gtgtccgtt 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctctacgacc gtgtccgtc 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cagggtttcc agatcactca 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 actgtagaat aacacacaat tagga 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 actgtagaat aacacacaat taggg 25 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gattgtacga tgtgcagcta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 aggcacatga cttcatcggc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 agagccctac aacgctacgt 20
Claims (8)
상기 추출한 DNA를 주형으로 하고, 서열번호 2 및 서열번호 4의 프라이머 세트, 서열번호 5 및 서열번호 7의 프라이머 세트 및 서열번호 8 및 서열번호 9의 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 이용하여 PCR을 수행하는 단계; 및
상기 PCR 증폭 산물을 검출하여 오이 노균병원체 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) 감염 여부를 판단하는 단계를 포함하는 오이 노균병원체 슈도페로노스포라 쿠벤시스(Pseudoperonospora cubensis) 검출방법.Extracting DNA from the sample;
The primers set forth in SEQ ID NO: 2 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 7, and the primer set of SEQ ID NO: 8 and SEQ ID NO: 9, Performing PCR using the PCR; And
Detecting the PCR amplification product and determining whether the cucumber is infected with the cucumber mosquito repellent Pseudoperonospora cubensis. 2. The method according to claim 1, wherein the pseudoperonospora cubensis is a cucumber plant.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140045381A KR101608576B1 (en) | 2014-04-16 | 2014-04-16 | Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140045381A KR101608576B1 (en) | 2014-04-16 | 2014-04-16 | Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20150120011A KR20150120011A (en) | 2015-10-27 |
KR101608576B1 true KR101608576B1 (en) | 2016-04-04 |
Family
ID=54428344
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020140045381A KR101608576B1 (en) | 2014-04-16 | 2014-04-16 | Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101608576B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102108751B1 (en) | 2018-12-11 | 2020-05-08 | 대한민국 | Single nucleotide polymorphism probes for seed purity determination and identification of varieties in cucumber |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110126309A1 (en) | 2009-10-22 | 2011-05-26 | Seminis Vegetables Seeds, Inc. | Methods and compositions for identifying downy mildew resistant cucumber plants |
-
2014
- 2014-04-16 KR KR1020140045381A patent/KR101608576B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110126309A1 (en) | 2009-10-22 | 2011-05-26 | Seminis Vegetables Seeds, Inc. | Methods and compositions for identifying downy mildew resistant cucumber plants |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102108751B1 (en) | 2018-12-11 | 2020-05-08 | 대한민국 | Single nucleotide polymorphism probes for seed purity determination and identification of varieties in cucumber |
Also Published As
Publication number | Publication date |
---|---|
KR20150120011A (en) | 2015-10-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Dhawan et al. | Development of male-specific SCAR marker in date palm (Phoenix dactylifera L.) | |
Caramante et al. | Simple sequence repeats are able to trace tomato cultivars in tomato food chains | |
CN111961750A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance gene Ty-1 and application thereof | |
Chapman et al. | Using quantitative real time PCR melt curve analysis of partial CO1 sequence for rapid biotype differentiation of Bactericera cockerelli (Hemiptera: Triozidae) | |
KR101676912B1 (en) | PNA probe set for identifying ginseng cultivars and method for identifying ginseng cultivars using the same | |
CN111961751B (en) | KASP primer for detecting tomato root knot nematode resistance gene Mi-1.2 and application thereof | |
KR101608576B1 (en) | Single nucleotide polymorphism marker for detecting Pseudoperonospora cubensis and method for detecting Pseudoperonospora cubensis using the same | |
CN109517921B (en) | InDel molecular marker closely linked with major QTL synthesized by barley P3G and C3G and application thereof | |
KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
KR101413102B1 (en) | Composition for detecting Cochliobolus miyabeanus and method for detection of Cochliobolus miyabeanus using the same | |
KR100560996B1 (en) | A DNA marker for detection of Phytophthora capsici in red pepper | |
KR101144988B1 (en) | SCAR markers for discrimination of apple cultivars and use thereof | |
Jamali et al. | Nested-PCR for detecting Terfezia claveryi in roots of Helianthemum species in field and greenhouse conditions. | |
Shymanovich et al. | Disease Progress and Detection of a California Resistance-Breaking Strain of Tomato Spotted Wilt Virus in Tomato with LAMP and CRISPR-Cas12a Assays | |
Munusamy et al. | RT-qPCR profiling of pathogenesis related genes in Musa acuminata cv.‘Berangan’seedlings challenged with Fusarium oxysporum f. sp. cubense Tropical Race 4 | |
KR101716029B1 (en) | Sequence Characterized Amplified Region Molecular Marker Related to WMV and ZYMV resistance Characteristic in Squash and use thereof | |
KR101909786B1 (en) | Primer set for detecting Rosellinia necatrix and method for detecting using the same | |
Saleh | R-ISSR marker as a useful tool for detection of new genomic loci in Arthrocnemum macrostachyum | |
KR101684069B1 (en) | Novel genomic marker for identifying Flammulina vehitipes and uses thereof | |
KR20200075637A (en) | Primers for multiple detection of the virus in Cucurbitaceae and detection method by using the same | |
KR20150050062A (en) | Specific primers for detection of greenhouse whitefly and uses thereof | |
KR101490013B1 (en) | Molecular marker for selecting cucumber downy mildew disease resistant variety and selection method using the same marker | |
KR102162805B1 (en) | Marker composition for discriminating anthracnose-resistant or sensitive grape cultivar and uses thereof | |
KR101955071B1 (en) | Snp markers for discrimination of raphanus sativus | |
JP2010239960A (en) | Variety identification marker of vegetative propagation crop |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20190221 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20200219 Year of fee payment: 5 |