KR101590553B1 - M cell targeting moiety conjugated mIL-6 producing recombinant Lactococcus lactis IL1403 - Google Patents

Abstract

The present invention relates to transformed lactic acid bacteria and recombinant proteins which secrete M cell-targeted mIL-6. The present invention relates to a method for producing mIL-6 and M cell-specific peptides, respectively, Introducing a Usp45 secretion signal into the expression vector and constructing a transformed lactic acid bacteria strain; Expressing an immunologically active substance in the transformed lactic acid bacteria and assaying for secretion; Determining a physiological activity characteristic and a protein secretion efficiency of the transformed lactic acid bacteria; The activity of the immunoregulatory protein is expressed as in evaluated in vitro and in and confirming M cell targeting ability in vivo . Accordingly, the present invention provides a novel recombinant expression vector to which mIL6 protein and M-cell specific peptide have been introduced and a transformed lactic acid bacterium into which the novel recombinant expression vector has been introduced to produce a recombinant protein secretion trait capable of inducing mucosal immune response more strongly There is provided an excellent effect of providing a transformed lactic acid bacteria strain and a vaccine for oral administration for immunity enhancement containing the same as an effective ingredient.

Description

M cell targeting mIL-6 secretion Lactococcus lactis IL1403 Recombinant lactic acid bacteria {M cell targeting moiety conjugated mIL-6 producing recombinant Lactococcus lactis IL1403}

The present invention relates to transformed lactic acid bacteria that secrete M cell-targeted mIL-6 and recombinant proteins using the same.

Globally, 90% of diseases in humans and livestock are known to be digestive diseases such as Food born disease or Water born disease. In order to directly block and prevent bacterial and viral gastrointestinal infectious diseases such as dysentery, cholera, etc., it is an effective strategy to activate mucosal immune response in gastrointestinal tract through oral vaccine as compared with injection vaccine. Nevertheless, to date, vaccines to prevent these diseases are mostly attenuated live vaccines in the form of injections through muscles. The most disadvantage of injected live vaccines is that they have a potential safety problem and a low induction of intestinal mucosal immune response. Proteins, which are the main constituents of oral vaccines, are denatured by low pH by gastric acid, various nutrient degrading enzymes of digestive tract, and are liable to lose their inherent functions (problems during transit), and even if they are safely delivered to the digestive tract, Utilization of oral vaccines is very limited so far as absorption efficiency (problem of absorption in the body) is low.

On the other hand, there is a GALT (Gut-Associated Lymphoid Tissue) like Peyer's patch in the small intestine's mucosa layer. Specially differentiated cells such as M cells on the Peyer's patch absorb the small intestinal antigen and transmit it to the lower immune system To induce the mucosal immune response, thereby effectively preventing pathogens that enter through the gastrointestinal tract. If an oral vaccine system capable of delivering an antigen by targeting M cells is developed, it is expected to greatly enhance the induction efficiency of mucosal immune response. Thus, it is expected that the M cell target through various research strategies (introduction of M cell target type functional group, etc.) Research is underway.

Lactic acid bacteria (LAB) is a representative food microorganism (GRAS) that has been used in the production of fermented foods by humans, and its availability and nutritional value have already been found through many studies. Recently, The metabolic activities and characteristics of lactic acid bacteria have been revealed and various applications have been suggested. Currently, lactic acid bacteria are used as a probiotic agent in livestock field for the purpose of improving the immune function and growth rate of an animal. In the field of food, lactic acid bacteria are also used as inoculation strains in dairy fermented foods such as cheese and fermented milk. Advantages of delivering drugs using lactic acid bacteria include: 1) delivering drugs more safely to the small intestine (Jerry M. Wells et al., 2008 Nat Reviews immunology). 2) Lactic acid bacteria survive in the intestines and continuously secrete the drug. 3) It is more convenient than injecting method and minimizes patient's stress. 4) Recently, Lactobacillus stimulates Toll like recptor 2 signal on the surface of antigen-presenting cell dendritic cell, (K Ramirez et al, 2009 Mucosal immunity) because of its adjuvant effect.

Korean Patent Publication No. 10-2010-0082154 discloses a method for producing a target protein on the surface of a microorganism by transfecting a high expression vector containing a RepE mutant protein and a coating gene of the protein and discloses a method for producing a porcine epidemic diarrhea virus infection Has been disclosed in Korean Patent Registration No. 10-0773241 for a method of introducing a protein having an inhibitory effect on E. coli into a vaccine or a probiotic agent. EP 0 925 364 (WO 98/010079) discloses a method for using the avian influenza HA gene as a vaccine using transgenic plants or recombinant microorganisms expressing exogenous antigens, and recombinant microorganisms expressing mycobacterial antigenic factors WO 2011/008735 discloses a method of using a polypeptide of the microorganism as a live vaccine using a lactic acid bacteria vector.

The present inventors have filed a domestic patent application for introducing IL2 protein and M-cell specific peptide into an expression vector to increase the efficiency and efficiency of absorption into the small intestine (Korean Patent No. 10-1457940).

Interleukin-6 is a multifunctional cytokine, not only an immune cell, but a cytokine secreted by many cell types. It induces the differentiation of B cells into plasma B cells, enhances the proliferation of T cells, and acts on many other congenital and acquired immunity. The present invention introduces the M cell specific target peptide of the present invention, which was developed by the inventors of the present invention, at the end of IL-6 for the purpose of enhancing the absorption in the small intestine of the drug. At this time, IL-6 is more efficiently transmitted through M cell on the surface of Payer's patch, which is an important lymphoid tissue in the intestine, with the help of M cell specific peptide, and then it is transferred to immune cells (T cell, B cell) The present inventors have confirmed that the mucosal immune response can be more strongly induced by activating the mucosal immune response.

Accordingly, the present invention is to provide a novel recombinant expression vector that expresses USP45-IL6-CKS9 by introducing the M cell-specific peptide CKS9.

Another object of the present invention is to provide a transformed lactic acid bacteria into which the recombinant expression vector has been introduced.

It is still another object of the present invention to provide an oral vaccine composition for immunization and a feed composition for livestock containing the transformed lactic acid bacteria that secrete USP45-IL6-CKS9 fusion protein as an active ingredient.

The above object of the present invention is achieved by a method for producing a recombinant vector comprising the steps of: cloning IL-6 and an M cell specific peptide, respectively, Introducing a Usp45 secretion signal into the expression vector and constructing a transformed lactic acid bacteria strain; Expressing an immunologically active substance in the transformed lactic acid bacteria and assaying the same; Assaying physiological activity characteristics and immunomodulating protein secretion efficiency of the transformed lactic acid bacteria; The activity of the immunoregulatory protein is expressed as in evaluated in vitro and in RTI ID = 0.0 > M-cell < / RTI > targeting ability in vivo .

The present invention provides recombinant expression vectors in which M-cell specific peptides are introduced to express USP45-IL6-CKS9.

The present invention also provides a transformed lactic acid bacteria strain into which the recombinant expression vector has been introduced.

The present invention also provides an oral vaccine composition for immunization and a feed composition for livestock comprising the transformed lactic acid bacteria as an active ingredient.

According to a number of experimental results, when the transformed lactic acid bacterium of the present invention contains 0.1% or more of the total weight of the general feed, the immunity enhancing effect is effective.

The present invention provides a novel recombinant expression vector into which an IL6 protein and an M cell specific peptide are introduced and a transformed lactic acid bacteria into which the novel recombinant expression vector is introduced. There is an excellent effect of providing a vaccine for oral administration for enhancing and an animal feed composition for animal husbandry.

1 is a schematic diagram showing a protein expression vector according to the present invention.
Figure 2 is a graphical representation of the Lactococcus lactis < RTI ID = 0.0 > IL 1403 < / RTI >
3 is a photograph showing mIL6, mIL6-CKS9, and CKS9-mIL6 expression and secretion in the transformed lactic acid bacteria strain according to the present invention.
FIG. 4 is a graph showing the protein content of cultured supernatants of mIL6, mIL6-CKS9, and CKS9-mIL6 transformants according to the present invention.
FIG. 5 is a graph showing growth rate and pH change of a strain according to the present invention over time according to the present invention.
FIG. 6 is a schematic diagram showing a cell proliferation experiment according to the present invention. FIG.
FIG. 7 is a graph showing cell regulation activity in the 7TD1 proliferation experiment according to the present invention. FIG.
8 is a schematic diagram of a closed ileal loop assay and immunohistochemistry according to the present invention.
FIG. 9 is a photograph showing the M cell targeting ability of the lactic acid bacterial production immunoregulatory protein according to the present invention. FIG.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples. However, these examples and experimental examples are for illustrating the present invention, and the scope of the present invention is not limited to these examples and experimental examples.

Example : mIL -6 gene Cloning  And recombinant expression vector construction

In order to express Murine Interleukin 6 (mIL-6) in lactic acid bacteria, the genes Usp45-IL6, Usp45-IL6, and Usp45-IL6, which are ligated by the order of Usp45 secreation signal, mIL-6, and M-cell targeting peptide ligand (CKSTHPLSC) The sequences of IL6-CKS9 and USP45-CKS9-IL6 (see Table 1 below) were cloned by codon optimization after oligo-annealing and PCR.

The gene sequences of Usp45-IL6, Usp45-IL6-CKS9, and USP45-CKS9-IL6 according to the present invention


Sequence Listing 1

USP45-IL6
(651bp)

ATGAAAAAGAAAATCATCTCTGCGATCCTGATGTCTACCGTTATCCTGTCTGCGGCAGCACCGCTGTCTGGTGTTTACGCGGACACCTTCCCGACCTCTCAGGTTCGTCGCGGCGACTTCACTGAAGACACTACTCCGAATCGCCCGGTTTACACTACCTCTCAAGTTGGCGGTCTGATTACCCATGTGCTGTGGGAGATTGTTGAAATGCGTAAAGAACTGTGTAATGGTAACAGCGATTGCATGAATAATGACGACGCGCTCGCAGAGAACAACCTGAAGCTCCCAGAGATCCAGCGCAATGACGGTTGTTATCAAACTGGTTATAATCAAGAAATTTGCCTGCTGAAGATTTCCTCTGGCCTGCTCGAATACCACAGCTACCTGGAGTACATGAAGAATAACCTCAAAGACAATAAGAAGGATAAGGCGCGTGTGCTCCAGCGTGATACCGAGACTCTCATTCATATCTTTAATCAGGAGGTAAAGGATCTGCATAAGATCGTTCTGCCAACTCCAATCTCTAACGCTCTGCTGACTGATAAACTGGAAAGCCAGAAAGAATGGCTGCGTACCAAGACTATCCAATTTATCCTCAAATCCCTCGAAGAATTTCTCAAGGTAACTCTCCGTTCTACTCGCCAGACTTAA



Sequence Listing 2

USP45-IL6-CKS9
(699bp)
ATGAAAAAGAAAATCATCTCTGCGATCCTGATGTCTACCGTTATCCTGTCTGCGGCAGCACCGCTGTCTGGTGTTTACGCGGACACCTTCCCGACCTCTCAGGTTCGTCGCGGCGACTTCACTGAAGACACTACTCCGAATCGCCCGGTTTACACTACCTCTCAAGTTGGCGGTCTGATTACCCATGTGCTGTGGGAGATTGTTGAAATGCGTAAAGAACTGTGTAATGGTAACAGCGATTGCATGAATAATGACGACGCGCTCGCAGAGAACAACCTGAAGCTCCCAGAGATCCAGCGCAATGACGGTTGTTATCAAACTGGTTATAATCAAGAAATTTGCCTGCTGAAGATTTCCTCTGGCCTGCTCGAATACCACAGCTACCTGGAGTACATGAAGAATAACCTCAAAGACAATAAGAAGGATAAGGCGCGTGTGCTCCAGCGTGATACCGAGACTCTCATTCATATCTTTAATCAGGAGGTAAAGGATCTGCATAAGATCGTTCTGCCAACTCCAATCTCTAACGCTCTGCTGACTGATAAACTGGAAAGCCAGAAAGAATGGCTGCGTACCAAGACTATCCAATTTATCCTCAAATCCCTCGAAGAATTTCTCAAGGTAACTCTCCGTTCTACTCGCCAGACTAGCGGCGGTGGCGGTGCTTGCAAAAGCACTCATCCGCTGTCTTGTGGTTAA



Sequence Listing 3

USP45-CKS9-IL6
(696 bp)
ATGAAAAAGAAAATCATCTCTGCGATCCTGATGTCTACCGTTATCCTGTCTGCGGCAGCACCGCTGTCTGGTGTTTACGCGGACACCGCTTGCAAAAGCACTCATCCGCTGTCTTGTGGCGGTGGCGGTAGCTTTCCGACTTCCCAAGTGCGTCGCGGCGACTTCACTGAAGACACTACTCCGAATCGCCCGGTTTACACTACCTCTCAAGTTGGCGGTCTGATTACCCATGTGCTGTGGGAGATTGTTGAAATGCGTAAAGAACTGTGTAATGGTAACAGCGATTGCATGAATAATGACGACGCGCTCGCAGAGAACAACCTGAAGCTCCCAGAGATCCAGCGCAATGACGGTTGTTATCAAACTGGTTATAATCAAGAAATTTGCCTGCTGAAGATTTCCTCTGGCCTGCTCGAATACCACAGCTACCTGGAGTACATGAAGAATAACCTCAAAGACAATAAGAAGGATAAGGCGCGTGTGCTCCAGCGTGATACCGAGACTCTCATTCATATCTTTAATCAGGAGGTAAAGGATCTGCATAAGATCGTTCTGCCAACTCCAATCTCTAACGCTCTGCTGACTGATAAACTGGAAAGCCAGAAAGAATGGCTGCGTACCAAGACTATCCAATTTATCCTCAAATCCCTCGAAGAATTTCTCAAGGTAACTCTCCGTTCTACTCGCCAGACTTAA

The plasmid pIL252 was used for expression of the gene sequences mIL-6, mIL6-CKS9, and CKS9-mIL6 of the present invention (Fig. 1). The Usp45 secreation signal was introduced into the pIL252 vector system and secreted from the lactic acid bacteria. After constructing the transformed lactic acid bacteria capable of expressing the M-cell target peptide-bound protein at the N-terminal and C-terminal of mIL6, the presence or absence of the target peptide The following experiments were conducted to compare the target capacities according to the location of the connection.

In the above-mentioned transformants, lactic acid bacteria Lactococcus lactis IL 1403 (USP45-IL6-CKS9) having excellent immunological activity and excellent M cell targeting ability was deposited with KCTC12492BP on September 25, 2013, Korea Research Institute of Bioscience and Biotechnology.

Experimental Example  1. Test for the expression of protein in transformed lactic acid bacteria

The expression and secretion of the immunoactive substance in the transformed L. lactis IL1403 lactic acid bacteria capable of expressing the three immunologically active substances IL6 of the above [Table 1] depending on the presence or absence of the target peptide linkage and the linkage site was determined by Western blotting ), And then selected. Transformed Lactococcus lactis IL1403 was cultured in M17G (M17, 5% Glucose) medium to determine the expression of mIL6.

Transfected Lactococcus cultured at 37 ° C for 16 hours lactis IL 1403 10 mL was separated from the culture supernatant and the cells in a centrifuge (4,500 rpm) (FIG. 2). After discarding the culture supernatant, the cells were washed twice with distilled water, 500 μl of distilled water and glass beads were added to the pellet, and the cells were disrupted for 30 minutes using a bead beater. After centrifugation (13,000 rpm), only the supernatant in which cytoplasmic proteins were dissolved was subjected to SDS-PAGE and western blotting to examine protein expression. Culture supernatants were assayed by concentration of proteins with trichloroacetic acid (TCA). For the concentration method, add 0.4 mL of 80% TCA (trichloroacetic acid) (v / v) to 1.6 mL of the culture supernatant, incubate on ice for 30 minutes and centrifuge (13,000 rpm) . To this, 0.3 mL of cold acetone was added, followed by washing with vortexing, and then the supernatant was removed with a centrifuge (13,000 rpm). The protein precipitate was dissolved in 0.5 mL of Tris-Hcl (pH = 8.0), and SDS-PAGE and western blotting were performed to examine protein expression.

As a result, mIL6-specific bands were detected in the intracellular proteins, and IL6-CKS9 and CKS9-IL6 proteins were detected at a slightly higher level than mIL6 because the target peptides were linked (FIG. The secreted protein in the supernatant was also detected in all three strains and the band pattern showed a low band pattern because the secretion signal was separated from the protein in the cell.

Table 2 below shows the amino acid sequences of the three bands.

The protein amino acid sequences of Usp45-IL6, Usp45-IL6-CKS9, and USP45-CKS9-IL6 according to the present invention
Sequence Listing 4
USP45-IL6
(216 aa)
MKKKIISAILMSTVILSAAAPLSGVYADTFPTSQVRRGDFTEDTTPNRPVYTTSQVGGLITHVLWEIVEMRKELCNGNSDCMNNDDALAENNLKLPEIQRNDGCYQTGYNQEICLLKISSGLLEYHSYLEYMKNNLKDNKKDKARVLQRDTETLIHIFNQEVKDLHKIVLPTPISNALLTDKLESQKEWLRTKTIQFILKSLEEFLKVTLRSTRQT

Sequence Listing 5
USP45-IL6-CKS9
(232 aa)
MKKKIISAILMSTVILSAAAPLSGVYADTFPTSQVRRGDFTEDTTPNRPVYTTSQVGGLITHVLWEIVEMRKELCNGNSDCMNNDDALAENNLKLPEIQRNDGCYQTGYNQEICLLKISSGLLEYHSYLEYMKNNLKDNKKDKARVLQRDTETLIHIFNQEVKDLHKIVLPTPISNALLTDKLESQKEWLRTKTIQFILKSLEEFLKVTLRSTRQTSGGGGACKSTHPLSCG

Sequence Listing 6
USP45-CKS9-IL6
(231a.a)
MKKKIISAILMSTVILSAAAPLSGVYADTACKSTHPLSCGGGGSFPTSQVRRGDFTEDTTPNRPVYTTSQVGGLITHVLWEIVEMRKELCNGNSDCMNNDDALAENNLKLPEIQRNDGCYQTGYNQEICLLKISSGLLEYHSYLEYMKNNLKDNKKDKARVLQRDTETLIHIFNQEVKDLHKIVLPTPISNALLTDKLESQKEWLRTKTIQFILKSLEEFLKVTLRSTRQT

Experimental Example  2. Transformation Lactic acid bacteria  Growth ability and pH  Change experiment

In accordance with the present invention, the transformed L. lactis IL1403 lactic acid bacteria capable of secretion of three immunologically active substances were selected and cultured, and the difference in growth ability and acid production ability against wild type was assayed. Further, Protein secretion efficiency in the supernatant was analyzed by ELISA.

In order to examine the efficiency of the extracellular mIL6 secretion of the three lactic acid bacteria Lactococcus lactis IL1403 (IL6), L. lactis IL1403 (IL6-CKS9) and L. lactis IL1403 (CKS9-IL6) selected above, mIL6- The content of protein in culture supernatant was measured using high sensitivity ELISA technique. The amount of mIL6 secreted and accumulated in the culture supernatant from 0 to 25 hours after the start of the transformant strain was measured to find that the L. lactis IL1403 (IL6) transformant contained L. lactis IL1403 (IL6-CKS9) and L The level of protein secretion and accumulation was higher than that of Lactis IL1403 (CKS9-IL6) and reached a level of 1,000 ng / mL or more (Fig. 4).

On the other hand, the growth rate and acid production ability (pH change) of the strain according to time were examined in order to examine whether the transformant of the present invention having the ability to secrete recombinant mIL6 caused a change in physiological characteristics in comparison with wild type lactic acid bacteria. As a result of the experiment, it was observed that the three transformants of the present invention were delayed slightly in the log phase compared to the wilt type, and the acid production capacity was slightly lower in the transformant than in the wild type 5). However, the wild type and the two transformants showed no significant difference in growth rate and acid production ability as a whole.

Experimental Example  3. The recombinant protein of the present invention In vitro Cell proliferation experiment

In order to test the cell regulatory activity of mIL-6, CKS9-mIL6, and mIL6-CKS9 proteins in the medium secreted by the transformed lactic acid bacteria according to the present invention, the 7TD1 cell line (hybridoma cell) In vitro cell proliferation assay (Fig. 6).

7TD1 cells were cultured in 10 mL of RPMI 1640 (5% FBS, 2.5 x 10 ^-5 M 2-mercaptoethanol, 0.5 ng.ml recombinant mouse IL6) in a 100 mm cell culture dish through a subculture, and 4 days before the experiment, After washing twice with IL6 free medium, the cells are incubated for 2 days in a culture medium free of recombinant mouse IL6. After 2 days, the cell number was counted with trypan blue, and 2 × 10 ⁶ cells were added to 96 wells. The supernatant of the recombinant lactic acid bacteria diluted to an appropriate concentration was added to the IL6 source. The final concentration of IL6 added was determined to be 5 pg / mL, 10 pg / mL, and 20 pg / mL, and a group not supplemented with commercial mIL6 and mIL6 was used as a control group to produce / The secretion of recombinant mIL-6, CKS9-mIL6, and mIL6-CKS9 was confirmed by MTS assay.

As shown in FIG. 7, in the group treated with the lactic acid bacteria supernatant that secreted recombinant IL6-CKS9 and IL6 at three levels of treatment concentration, cell proliferation was at the same level as that of the treated purified mIL6 treatment group, but CKS9- In the group treated with the IL6-releasing lactic acid supernatant, cell proliferation was only about the same as in the group without addition of mIL6. Therefore, IL6 and IL6-CKS9 secreted by the lactic acid bacteria of the present invention showed protein activity as an immunoactive substance, whereas CKS9-IL6 lost its protein activity.

Experimental Example  4. The recombinant protein of the present invention In vivo M cells Target capability  Experiment

In order to test in vivo whether the recombinant mIL-6, CKS9-mIL6, or mIL6-CKS9 protein secreted in the culture supernatant by the transformed lactic acid bacteria according to the present invention had M cell-targeting ability, After a small intestine was ligated, a closed-ileal loop assay was performed in which mIL-6, CKS9-mIL6, and mIL6-CKS9 were injected, and the M cells were assayed for their target function by immunohistochemistry (FIG.

8-week-old BalB / c rats were hungry overnight and then anesthetized. The ileal lavage was performed by lifting the small intestine and straining the illeum patch at intervals of 1 cm on both sides of the peyer's patch. Recombinant lactic acid bacteria supernatants containing 1 ug / 200ul recombinant mIL6, mIL6-CKS9, and CKS9-IL6 were injected into the ileal loop and cultured at 37 ° C for 1 hour. The ileal loop was carefully cut, washed with PBS, and soaked in 4% paraformaldehyde for 1 hour in 20% sucrose overnight. The cryo-section was then frozen in tissue using an OCT compound And then cryosectioned to a thickness of 14 μm. Sectioning tissue sections were fixed in acetone for 5 minutes, washed with PBS and blocked with 3% goat serum for 1 hour. MIL6 was detected by treating mouse anti-IL6 for 1 hour and goat anti-mose IgG for 1 hour. UEA-1 was treated for 1 hour to stain M cell of Peyer's patch and stained with DAPI. As shown in FIG. 9, IL6-CKS9, that is, the protein having the target peptide linked to the C-terminus only had a targeting ability, and the CKS9-IL6 ligated with the target peptide at the N-terminus did not show the target ability ).

Korea Biotechnology Research Institute KCTC12492BP 20130925

<110> SNU R & DB FOUNDATION <120> M cell targeting moiety conjugated IL-6 producing recombinant          Lactococcus lactis IL1403 <130> 1 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 651 <212> DNA <213> murine <400> 1 atgaaaaaga aaatcatctc tgcgatcctg atgtctaccg ttatcctgtc tgcggcagca 60 ccgctgtctg gtgtttacgc ggacaccttc ccgacctctc aggttcgtcg cggcgacttc 120 actgaagaca ctactccgaa tcgcccggtt tacactacct ctcaagttgg cggtctgatt 180 acccatgtgc tgtgggagat tgttgaaatg cgtaaagaac tgtgtaatgg taacagcgat 240 tgcatgaata atgacgacgc gctcgcagag aacaacctga agctcccaga gatccagcgc 300 ggtttcaat ggcctgctcg aataccacag ctacctggag tacatgaaga ataacctcaa agacaataag 420 aaggataagg cgcgtgtgct ccagcgtgat accgagactc tcattcatat ctttaatcag 480 gaggtaaagg atctgcataa gatcgttctg ccaactccaa tctctaacgc tctgctgact 540 gataaactgg aaagccagaa agaatggctg cgtaccaaga ctatccaatt tatcctcaaa 600 tccctcgaag aatttctcaa ggtaactctc cgttctactc gccagactta a 651 <210> 2 <211> 699 <212> DNA <213> murine <400> 2 atgaaaaaga aaatcatctc tgcgatcctg atgtctaccg ttatcctgtc tgcggcagca 60 ccgctgtctg gtgtttacgc ggacaccttc ccgacctctc aggttcgtcg cggcgacttc 120 actgaagaca ctactccgaa tcgcccggtt tacactacct ctcaagttgg cggtctgatt 180 acccatgtgc tgtgggagat tgttgaaatg cgtaaagaac tgtgtaatgg taacagcgat 240 tgcatgaata atgacgacgc gctcgcagag aacaacctga agctcccaga gatccagcgc 300 ggtttcaat ggcctgctcg aataccacag ctacctggag tacatgaaga ataacctcaa agacaataag 420 aaggataagg cgcgtgtgct ccagcgtgat accgagactc tcattcatat ctttaatcag 480 gaggtaaagg atctgcataa gatcgttctg ccaactccaa tctctaacgc tctgctgact 540 gataaactgg aaagccagaa agaatggctg cgtaccaaga ctatccaatt tatcctcaaa 600 tccctcgaag aatttctcaa ggtaactctc cgttctactc gccagactag cggcggtggc 660 ggtgcttgca aaagcactca tccgctgtct tgtggttaa 699 <210> 3 <211> 696 <212> DNA <213> murine <400> 3 atgaaaaaga aaatcatctc tgcgatcctg atgtctaccg ttatcctgtc tgcggcagca 60 ccgctgtctg gtgtttacgc ggacaccgct tgcaaaagca ctcatccgct gtcttgtggc 120 ggtggcggta gctttccgac ttcccaagtg cgtcgcggcg acttcactga agacactact 180 ccgaatcgcc cggtttacac tacctctcaa gttggcggtc tgattaccca tgtgctgtgg 240 gagattgttg aaatgcgtaa agaactgtgt aatggtaaca gcgattgcat gaataatgac 300 gacgcgctcg cagagaacaa cctgaagctc ccagagatcc agcgcaatga cggttgttat 360 caaactggtt ataatcaaga aatttgcctg ctgaagattt cctctggcct gctcgaatac 420 cacagctacc tggagtacat gaagaataac ctcaaagaca ataagaagga taaggcgcgt 480 gtgctccagc gtgataccga gactctcatt catatcttta atcaggaggt aaaggatctg 540 cataagatcg ttctgccaac tccaatctct aacgctctgc tgactgataa actggaaagc 600 cagaaagaat ggctgcgtac caagactatc caatttatcc tcaaatccct cgaagaattt 660 ctcaaggtaa ctctccgttc tactcgccag acttaa 696 <210> 4 <211> 216 <212> PRT <213> murine <400> 4 Met Lys Lys Lys Ile Ile Ser Ile Leu Met Ser Thr Val Ile Leu   1 5 10 15 Ser Ala Ala Ala Ala Ala Ala Ala Ala Asp Thr Phe Pro Thr              20 25 30 Ser Gln Val Arg Arg Gly Asp Phe Thr Glu Asp Thr Thr Pro Asn Arg          35 40 45 Pro Val Tyr Thr Thr Ser Gln Val Gly Gly Leu Ile Thr His Val Leu      50 55 60 Trp Glu Ile Val Glu Met Arg Lys Glu Leu Cys Asn Gly Asn Ser Asp  65 70 75 80 Cys Met Asn Asn Asp Asp Ala Leu Ala Glu Asn Asn Leu Lys Leu Pro                  85 90 95 Glu Ile Gln Arg Asn Asp Gly Cys Tyr Gln Thr Gly Tyr Asn Gln Glu             100 105 110 Ile Cys Leu Leu Lys Ile Ser Ser Gly Leu Leu Glu Tyr His Ser Tyr         115 120 125 Leu Glu Tyr Met Lys Asn Asn Leu Lys Asp Asn Lys Lys Asp Lys Ala     130 135 140 Arg Val Leu Gln Arg Asp Thr Glu Thr Leu Ile His Ile Phe Asn Gln 145 150 155 160 Glu Val Lys Asp Leu His Lys Ile Val Leu Pro Thr Pro Ile Ser Asn                 165 170 175 Ala Leu Leu Thr Asp Lys Leu Glu Ser Gln Lys Glu Trp Leu Arg Thr             180 185 190 Lys Thr Ile Gln Phe Ile Leu Lys Ser Leu Glu Glu Phe Leu Lys Val         195 200 205 Thr Leu Arg Ser Thr Arg Gln Thr     210 215 <210> 5 <211> 232 <212> PRT <213> murine <400> 5 Met Lys Lys Lys Ile Ile Ser Ile Leu Met Ser Thr Val Ile Leu   1 5 10 15 Ser Ala Ala Ala Ala Ala Ala Ala Ala Asp Thr Phe Pro Thr              20 25 30 Ser Gln Val Arg Arg Gly Asp Phe Thr Glu Asp Thr Thr Pro Asn Arg          35 40 45 Pro Val Tyr Thr Thr Ser Gln Val Gly Gly Leu Ile Thr His Val Leu      50 55 60 Trp Glu Ile Val Glu Met Arg Lys Glu Leu Cys Asn Gly Asn Ser Asp  65 70 75 80 Cys Met Asn Asn Asp Asp Ala Leu Ala Glu Asn Asn Leu Lys Leu Pro                  85 90 95 Glu Ile Gln Arg Asn Asp Gly Cys Tyr Gln Thr Gly Tyr Asn Gln Glu             100 105 110 Ile Cys Leu Leu Lys Ile Ser Ser Gly Leu Leu Glu Tyr His Ser Tyr         115 120 125 Leu Glu Tyr Met Lys Asn Asn Leu Lys Asp Asn Lys Lys Asp Lys Ala     130 135 140 Arg Val Leu Gln Arg Asp Thr Glu Thr Leu Ile His Ile Phe Asn Gln 145 150 155 160 Glu Val Lys Asp Leu His Lys Ile Val Leu Pro Thr Pro Ile Ser Asn                 165 170 175 Ala Leu Leu Thr Asp Lys Leu Glu Ser Gln Lys Glu Trp Leu Arg Thr             180 185 190 Lys Thr Ile Gln Phe Ile Leu Lys Ser Leu Glu Glu Phe Leu Lys Val         195 200 205 Thr Leu Arg Ser Thr Arg Gln Thr Ser Gly Gly Gly Gly Ala Cys Lys     210 215 220 Ser Thr His Pro Leu Ser Cys Gly 225 230 <210> 6 <211> 651 <212> PRT <213> murine <400> 6 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala   1 5 10 15 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala              20 25 30 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala          35 40 45 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala      50 55 60 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala  65 70 75 80 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                  85 90 95 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             100 105 110 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         115 120 125 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     130 135 140 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 145 150 155 160 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                 165 170 175 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             180 185 190 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         195 200 205 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     210 215 220 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 225 230 235 240 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                 245 250 255 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             260 265 270 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         275 280 285 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     290 295 300 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 305 310 315 320 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                 325 330 335 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             340 345 350 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         355 360 365 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     370 375 380 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 385 390 395 400 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                 405 410 415 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             420 425 430 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         435 440 445 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     450 455 460 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 465 470 475 480 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                 485 490 495 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             500 505 510 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         515 520 525 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     530 535 540 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 545 550 555 560 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala                 565 570 575 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala             580 585 590 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala         595 600 605 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala     610 615 620 Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala Ala 625 630 635 640 Facebook facebook Ala Ala to contact Ala Ala.                 645 650

Claims (6)

delete A polynucleotide consisting of the nucleotide sequence of Sequence Listing 2 encoding the USP45-IL6-CKS9 (699 bp) protein. A recombinant vector PIL252 comprising a polynucleotide consisting of the gene sequence of SEQ ID NO: 2 encoding a USP45-IL6-CKS9 (699 bp) protein. Lactococcus lactis IL1403 (USP45-IL6-CKS9) transfected lactic acid bacteria KCTC 12492BP into which the recombinant vector of claim 3 is introduced. A vaccine composition for oral administration for immunity enhancement comprising the Lactococcus lactis IL1403 (USP45-IL6-CKS9) transformed lactic acid bacteria of claim 4 as an active ingredient. An immunostimulating animal feed containing the Lactococcus lactis IL1403 (USP45-IL6-CKS9) transformed lactic acid bacteria of claim 4 as an active ingredient.

Images