KR101582944B1 - Composition for detecting mutations of epidermal growth factor receptor gene and kit comprising the same - Google Patents

Abstract

The present invention relates to a composition for detecting epithelial cell growth factor receptor gene mutation and a kit comprising the same, and more particularly, to a primer and a probe set composition for detecting epithelial cell growth factor receptor gene mutation, an EGFR gene mutation detection And a RUO kit for detection of EGFR gene mutation comprising a primer / probe set of a part of the composition of the present invention. The system of the present invention can be used for the purpose of presenting a clue to the direction of future treatment as well as judging the necessity of administration of an anticancer drug because it is possible to predict and diagnose reactivity to a therapeutic agent for a cancer patient's prognosis through an automated procedure.

Description

TECHNICAL FIELD The present invention relates to a composition for detecting epithelial cell growth factor receptor gene mutation and a kit comprising the same,

The present invention relates to a composition for detecting epithelial cell growth factor receptor gene mutation and a kit comprising the same, and more particularly, to a primer and a probe set composition for detecting epithelial cell growth factor receptor gene mutation, an EGFR gene mutation detection And a RUO kit for detection of EGFR gene mutation comprising a primer / probe set of a part of the composition of the present invention.

Cancer refers to a group of abnormal cells caused by continuous division and proliferation by destroying the balance between cell division and death by various causes, and is also called a tumor or neoplasm. It generally develops in more than 100 parts of the body, including organs, white blood cells, bones, lymph nodes, etc., and develops into serious symptoms through the phenomenon of invasion into surrounding tissues and metastasis to other organs.

Cancer therapy is being developed continuously, and dozens of therapies for various cancers currently used in clinical trials are available. To date, however, clinicians have suffered from two difficulties: first, it takes several weeks for the treatment to become effective, and it is impossible to know in advance about which treatment is effective for individual patients. In other words, the therapeutic effects of anticancer drugs can not be judged within a few days, but they gradually appear over several weeks, so it takes a long time to judge the prescription drug to be ineffective. If the treatment is not effective enough, the patient will be considered for other types of treatment. If the clinician can not select the appropriate treatment for the patient at the time of initiation of treatment, the time will be delayed And the prognosis of the disease.

The second difficulty is that there are a number of patients who do not respond to the treatment. For example, lapatinib, a breast cancer treatment, has been shown to have therapeutic effects when high levels of HER2 protein (HER2 positive) and low levels of EGRF protein are present. However, metastatic HER2 negative breast cancer did not respond to lapatinib, indicating that lapatinib was ineffective. These results suggest that patients with breast cancer need to know precisely whether they are HER2 negative or positive before treatment, so that appropriate treatment can be selected.

Therefore, if the therapeutic response to the therapeutic agent and its side effects can be predicted in advance, it will be possible to lower the dropout rate of the drug and improve the compliance of the drug due to the wrong selection of the drug. It will also avoid the time it takes for the drug to take effect and the risk of side effects that the patient may experience.

Under this concept, the search for markers related to various drug reactivity or commercial in vitro diagnostics or accompanying diagnostic kits utilizing the same have been developed, and some of them have already been commercialized and used in clinical applications. However, these methods are generally less reliable than those of highly skilled laboratories. Therefore, in some cases, it is necessary to provide the sample of the patient to the service provider according to the predetermined procedure in the central lab method. In such a case, a relatively meaningful result may be obtained, and an inter-laboratory variation, -observer variation, and day-to-day variation may raise questions about the overall system reliability.

Thus, in the conventional method, there is a possibility that the diagnostic result may be erroneous depending on the place, the time, and the experimenter. Therefore, in order to obtain a stable result, a method or automation process in which the involvement of the experimenter is excluded is required.

EGFR, on the other hand, is a type of protein tyrosine kinase of the erbB receptor family. Upon binding of a growth factor ligand, such as an epidermal growth factor (EGF), the receptor may form a homodimer with another EGFR molecule or another class member such as erbB2 (HER2), erbB3 (HER3 ), Or erbB4 (HER4).

The formation of homologous and / or heterodimeric erbB receptors results in the phosphorylation of key tyrosine residues in the intracellular domain and induces the stimulation of many intracellular signaling pathways involved in cell proliferation and survival. Deregulation of erbB class signaling promotes proliferation, invasion, metastasis, angiogenesis and tumor cell survival and is described in many human cancers, including lung, head and neck cancer and breast cancer.

Therefore, a number of agents that currently represent a reasonable target for the development of anti-cancer drugs and that target EGFR, including zetitib (IRESSA (TM), TARCEVA (TM), are currently clinically applicable. In 2004, activation mutations in EGFR were reported to be correlated with responses to zetti-nip therapy in non-small-cell lung cancer (NSCLC) (Science [2004] Vol. 304, 1497-500 And New England Journal of Medicine [2004] Vol. 350, 2129-39). It is known that the most common EGFR activating mutations, L858R and delE746_A750, are associated with responsiveness to small molecule tyrosine kinase inhibitors such as zetytipine and erotinib as compared to wild-type (WT) wild-type EGFR. Ultimately, acquisition tolerance for therapies using zetti nip or elotinib is caused, for example, by mutation of the gatekeeper residue T790M, which is detected in 50% of clinically resistant patients It has been reported.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

Accordingly, the present inventors have made extensive efforts to develop a system for detecting mutations of the EGFR gene, in particular, a system capable of automation. As a result, a primer / probe set suitable for application to FFPE samples of cancer tissues has been discovered, The present invention has been completed.

Accordingly, an object of the present invention is to provide a primer and a probe set composition for detecting an epidermal growth factor receptor (EGFR) gene mutation.

Another object of the present invention is to provide a kit for detecting mutation of EGFR gene comprising the composition of the present invention and a RUO kit for detecting EGFR gene mutation comprising a part of the primer / probe set of the composition of the present invention.

In order to accomplish the above object, the present invention provides primer and probe set composition for detecting epidermal growth factor receptor (EGFR) gene mutation.

In order to accomplish another object of the present invention, the present invention provides a kit for detecting mutation of EGFR gene comprising the composition of the present invention and a RUO kit for detecting mutation of EGFR gene comprising a part of the primer / probe set of the composition of the present invention .

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The following references provide one of the skills with a general definition of the various terms used in the specification of the present invention: Singleton et al ., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2nd ed. 1994); THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walkered., 1988); And Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a primer and a probe set composition for detecting epidermal growth factor receptor (EGFR) gene mutation, which comprises a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a primer selected from the group consisting of SEQ ID NOs: A reverse primer of SEQ ID NO: 4, a polynucleotide set of a probe selected from the group consisting of SEQ ID NOs: 14 to 42, a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: A polynucleotide set of a probe selected from the group consisting of SEQ ID NOS: 43 to 50, a forward primer of SEQ ID NO: 7, an inverse primer of SEQ ID NO: 8, and a polynucleotide set of a probe selected from the group consisting of SEQ ID NOS: 51 to 54 this It includes a selected polynucleotide as an active ingredient.

The composition of the present invention may preferably be for predicting the responsiveness of an EGFR inhibitor to treatment. In 2004, a mutation in EGFR was reported to correlate with the response to zepitibem therapy in non-small-cell lung cancer (NSCLC) (Science [2004] Vol. 304, 1497-500 New England Journal of Medicine [2004] Vol. 350, 2129-39), many relevant EGFR mutations have been identified. The EGFR inhibitor may preferably be erlotinib or gefitinib.

In the present invention, the term " primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis under pH conditions. Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The suitable length of the primer is determined by a number of factors, such as the temperature, the application, and the source of the primer, but is typically 15-30 nucleotides. Short primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template. The term " annealing " or " priming " means that the oligodeoxynucleotide or nucleic acid is apposited to the template nucleic acid, which polymerizes the nucleotide to form a complementary nucleic acid molecule to the template nucleic acid or a portion thereof .

In the present invention, " probe " is designed as a kind of taqman probe used for quantitative PCR. Preferably, a fluorescent material (HEX, VIC, FAM dye) is attached to the probe, and TAMRA can be used as a quencher on the 3 'side of all the probes. The TaqMan probe is an oligonucleotide tagged with the 5 'end as a fluorescent substance and the 3' end as a quencher. The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but there is a quencher at the 3 'end of the probe However, if the TaqMan probe hybridizes to the template due to the 5 '→ 3' exonuclease activity of the Taq DNA polymerase in the next step of extension, the fluorescent material is separated from the probe and is inhibited by quencher And fluorescence is emitted quantitatively by the principle of the fluorescence emitted by the PCR reaction.

The primers and probes specific for the genomic DNA gene mutation in the present invention may be one for detecting mutations in the epidermal growth factor receptor (EGFR) gene. Preferably, the primers and probes specific for the genomic DNA gene mutation are used in the same sequence for the PCR reaction solution and the standard PCR reaction solution, and each independently have the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, A reverse primer of SEQ ID NO: 4, and a polynucleotide set of a probe selected from the group consisting of SEQ ID NOS: 14 to 42, a forward primer of SEQ ID NO: 5, a polynucleotide set of SEQ ID NO: A reverse primer of SEQ ID NO: 6 and a polynucleotide set of a probe selected from the group consisting of SEQ ID NOs: 43 to 50, a forward primer of SEQ ID NO: 7, a reverse primer of SEQ ID NO: Nucleotide set It may be at least one selected from the group consisting of.

The measurement of the PCR reaction can be performed according to a method known in the art, but can be measured by an optical quantitative analysis system using a probe labeled with a reporter fluorescent dye and / or a quencher fluorescent dye, Can be performed by measuring the fluorescence value for each PCR reaction of each undifferentiated droplet.

Specifically, since the probe is combined with FAM, HEX, VIC fluorescent dye (fluorescent substance) or EvaGreen fluorescent dye, it can be performed by measuring fluorescence thereon. This process can be performed by a commercially available detector (for example, Droplet Reader from biorad), which detects the droplet fluorescence signal of each sample in the apparatus, counts the number of positive and negative droplets, and automatically Analysis can be completed.

In this case, probes to be added to the PCR reaction solution and probes to be added to the standard PCR reaction solution for detection may be respectively associated with different fluorescent materials.

Meanwhile, the present invention provides a kit for detecting EGFR gene mutation comprising the primer / probe set of the present invention.

The kit of the present invention can be preferably used for the detection of mutations of the EGFR gene by PCR reaction using the primer / probe set of the present invention. The kit of the present invention may further comprise tools and / or reagents known in the art used for PCR or detection thereof. The kit of the present invention may further comprise a tube, a well plate, an instructional material describing a method of use and the like to be used for mixing the components as necessary.

In addition, the kit of the present invention may be a research use only (RUO) or an investigation use only (IVD) kit. IVD kits also include IVD-CDx kits.

On the other hand, the present invention provides a RUO kit for detecting EGFR gene mutation comprising a forward primer of SEQ ID NO: 1, a reverse primer of SEQ ID NO: 2 and a polynucleotide set of probes selected from the group consisting of SEQ ID NOs: 10 to 13 as an active ingredient .

The present invention also provides a polynucleotide set of a probe selected from the group consisting of a forward primer of SEQ ID NO: 3, a reverse primer of SEQ ID NO: 4, and SEQ ID NOs: 14, 15, 20, 21, 26, 27, 28, 31, 33, As an active ingredient, an EGFR gene mutation detecting RUO kit.

The reverse primer of SEQ ID NO: 4 and the primers of SEQ ID NOs: 14, 16, 17, 18, 19, 22, 23, 24, 25, 29, 30, 32, 35, 36, 37, 38, 39, 40, 41, and 42 as an active ingredient. The present invention also provides an RUO kit for detecting mutation in EGFR gene comprising the polynucleotide set of the probe selected from the group consisting of SEQ ID NO:

In addition, the present invention provides a RUO kit for detecting EGFR gene mutation comprising as an active ingredient a polynucleotide set of a forward primer of SEQ ID NO: 5, a reverse primer of SEQ ID NO: 6, and a probe selected from the group consisting of SEQ ID NOs: 43 to 50 .

In addition, the present invention provides an RUO kit for detecting EGFR gene mutation comprising a forward primer of SEQ ID NO: 7, a reverse primer of SEQ ID NO: 8 and a polynucleotide set of probes selected from the group consisting of SEQ ID NOs: 51 to 54 as an active ingredient .

The kit of the present invention is used in qPCR (quantitative PCR) or digital PCR method.

The template applicable to the kit of the present invention can be used without limitation as long as mutation detection of EGFR is necessary and PCR reaction is possible. Preferably, the kit of the present invention comprises DNA isolated from formalin fixed paraffin embedded (FFPE) cDNA (complementary DNA) can be used as a template.

The tissue obtained from the patient after biopsy is usually fixed with formalin (formaldehyde) or the like. The immobilized biological sample is generally dehydrated and embedded in a solid support such as paraffin, and the sample thus prepared is called an FFPE sample. Nucleic acids in the FFPE sample, especially DNA, are present in immobilized cells and are either fragmented or cross-linked by formalin, so it is necessary to remove the paraffin and dissolve the fixed cells to elute the DNA and other nucleic acids in the cells.

In the present invention, the term " paraffin " comprehensively refers to a foraging medium of a biological sample used in all analyzes including morphological, immunohistochemical and enzymatic histochemical analysis. That is, the paraffin in the present invention may be a petroleum-based paraffin wax alone, and may be any one selected from the group consisting of all kinds of petroleum-based paraffin waxes, May be included. Herein, the petroleum paraffin wax refers to a mixture of hydrocarbons which are solid at room temperature derived from petroleum.

In general, a specimen of a cancer patient treated with FFPE is cut into a thickness of 5 to 10 μm using a rotary microtome, and then a nucleic acid containing DNA is isolated through a commercially available nucleic acid separation kit for FFPE or a device utilizing the same . Kits / devices for separating nucleic acids from FFPE include, for example, the Tissue Preparation System from Siemens and VERSANT tissue preparation reagents.

In addition, the kit of the present invention can be a DNA or cDNA separated from blood circulating CTC (circulating tumor cell) as a template. CTC is a tumor cell found in the peripheral blood of a malignant tumor patient. Because CTC plays an important role in the process of metastasis, CTC is considered to be crucial in the study and diagnosis of cancer, but the number of circulating tumor cells in the peripheral blood is very rare, and there are fewer than a dozen There is a need for a detection system that requires a degree of sensitivity to detect tumor cells.

Therapeutic reactivity in the present invention can be defined as " responsive " for a therapeutic agent if the growth rate is inhibited as a result of contact with the therapeutic agent compared to its growth in the absence of contact with the therapeutic agent. The growth of cancer can be measured in various ways, for example, the expression of a tumor marker suitable for the size of the tumor or its tumor type can be measured. In addition, the above " reactivity " may indicate an increase in survival time on a significant survival curve.

Cancer is " non-responsive " to the therapeutic agent unless the growth rate is suppressed or suppressed to a very low extent as a result of contact with the therapeutic agent as compared to its growth not in contact with the therapeutic agent. As noted above, cancer growth can be measured in a variety of ways, for example, the expression of tumor markers suitable for the size of the tumor or its tumor type can be measured. Non-responsive measures can be assessed using additional criteria beyond the growth size of the tumor, including the patient's quality of life, metastasis, and the like.

The therapeutic response to cancer therapy may be therapeutic response to an inhibitor of epidermal growth factor receptor (EGFR), and thus the cancer of the present invention may be lung cancer, breast cancer, bladder cancer, stomach cancer.

EGFR is a protein product of the oncogene erbB or ErbB1. ErbB or ErbB1 is one of the ERBB family of protooncogenes, which is known to be an important factor in the development of many cancers. It has been observed that the expression of EGFR is increased in breast cancer, bladder cancer, stomach cancer and the like, including lung cancer.

A variety of EGFR target drugs have been developed to treat epithelial cancers such as lung cancer, breast cancer, bladder cancer and stomach cancer. In particular, Gefitinib (AstraZeneca UK Ltd., trade name "IRESSA") and Erlotinib , Inc. & OSI Pharmaceuticals, Inc., trade name "TARCEVA") are representative drugs. Zetytipine and elotinib are quinazoline compounds that inhibit tyrosine kinase activity of EGFR and inhibit phosphorylation thereby inhibiting cell growth.

The nucleic acid isolated from the sample of the present invention is preferably a genomic DNA, more preferably a genomic DNA presumed to have a mutation.

The compositions or kits of the invention can preferably be used for EGFR mutation detection in automated or semi-automated methods. In the above, automation can be achieved by injecting a sample (sample); Relocation or movement of a substrate (e.g., tube, plate) that has been extracted, separated, or reacted; Reagent, buffer stock, replenishment; Means that all or most of the process, except equipment maintenance, takes place through means other than human (for example, a robot).

The composition or kit of the present invention showed excellent mutation detection ability in detecting each mutation in the EGFR gene mutation, which was superior to conventional comparative products.

For reference, the above-mentioned nucleotide and protein work can be referred to the following references (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982); Sambrook et al Inc., San Diego, Calif. (1990), < RTI ID = 0.0 > Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press De Andres et al., BioTechniques 18: 42044 (1995); Held et al., ≪ Diagnostic 2: 84-91 (2000); K. Specht et al., Am. J. Pathol., 158: 419 -29 (2001)).

Therefore, the system of the present invention can be used for the purpose of predicting the necessity of administration of an anticancer drug and suggesting a clue to the future treatment direction since it is possible to predict and diagnose the response of the cancer patient to the therapeutic agent through an automated process .

1 shows a vector map of a pIDTSmart Amp vector.
Figure 2 is a flow chart of the separation process in the FFPE sample of the method of the present invention.
3 is a conceptual diagram of a CTC separation method among the methods of the present invention.
4 is an example of the PCR reaction result in CTC cells according to the method of the present invention.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Isolation of DNA from FFPE Samples

A sample (size 600 mm ² ) of patients with lung cancer treated with FFPE was used as a sample. The FFPE sample was cut into a thickness of 5 to 10 μm using a rotary microtome and mixed with a buffer for FFPE (FFPE buffer, VERSANT tissue preparation reagents, Box 1, siemens), incubated at 80 ° C. for 30 minutes, Respectively. The temperature was lowered to 65 ° C, proteinase K (VERSANT tissue preparation reagents, Box 2, siemens) was mixed and incubated for 30 minutes. Magnetic beads (VERSANT tissue preparation reagents, Box 1, siemens) were mixed and incubated at 65 ° C for 15 minutes to allow cell debris to adhere, and magnetic force was applied to the bottom of the tube, And the upper solution was transferred to a new tube containing magnetic beads and lysis buffer (VERSANT tissue preparation reagents, Box 1, siemens) in advance. At this time, the paraffin layer formed on the upper part of the tube is not transferred to the new tube.

And incubated at room temperature for 10 minutes to bind the nucleic acid molecule to the magnetic beads. The magnetic beads were separated by applying a magnetic force to the bottom of the tube, and the supernatant was removed and then washed with washing buffer 1, 2, 3, VERSANT tissue preparation reagents, Box 1, siemens. The elution buffer (VERSANT tissue preparation reagents, Box 1, siemens) was added thereto, followed by incubation at 70 ° C for 10 minutes to elute nucleic acid molecules. The supernatant from which the nucleic acid molecules were eluted was separately transferred to a new tube to remove the magnetic beads, followed by RNase (VERSANT tissue preparation reagents, siemens) at 37 ° C for 10 minutes to remove the RNA. The results of quantifying the separated DNA are shown in Table 1 below.

ng / ul Total DNA Mean 12.745 1.274 S.D. 4.705 0.470

≪ Example 2 >

Production of standard material vector

To verify the designed primers and probes, and to make the reference material required for ddPCR performance, a standard material vector (named mini-clone) was constructed. The mini-clone was first synthesized in about 300 bp of the EGFR mutation region, ie, the probe site in the middle of each exon. The synthesized DNA fragment was inserted between the universal link sequence of the pIDTSmart Amp vector (see FIG. 1), and the clone was transformed into E. coli DH5α cells.

In order to maximize the efficiency of ddPCR (droplet digital PCR) by linearizing a standard material vector in a circular form or a super-coiled form, the restriction enzyme was treated with a reference material vector. Standard vector (Miniclone DNA) ClaI restriction enzyme was reacted at 37 ° C for 30 min. After the reaction product was quantified, it was stored at -20 ° C until use.

In the present invention, the level after PCR amplification of an object to be detected may be entirely different depending on the sample to be tested, so a criterion for discriminating whether amplification by a primer / probe specific for a mutation is necessary. For this purpose, the reference material vector can be obtained by transforming a polynucleotide of 100 to 350 bp covering a genomic DNA gene mutation into an ordinary vector. Preferably, the reference material vector of the present invention can be used by inserting about 300 bp in the pIDTSmart Amp vector in the region where the mutation occurred in each exon of EGFR, i.e., the probe position as the center.

Preferably, the reference material vector of the present invention may be a vector containing a DNA fragment of about 300 bp in which a mutation has occurred in each exon of EGFR, that is, a probe position in the middle, which is transformed into a host cell such as Escherichia coli Amplification, and extraction. More preferably, the reference material vector of the present invention is a polynucleotide of 100 to 350 bp in position 159701 to 159701 of the EGFR gene in the case of exon 18, in the case of exon 19, 160501 of EGFR gene 100 to 350 bp polynucleotide at 160900 base, exon 20, 100 to 350 bp polynucleotide at 167101 to 167500 base, exon 21 of EGFR gene, 100 to 350 bp at 177551 to 177930 base of EGFR gene, The polynucleotide DNA fragment of 350 bp may be inserted into the pIDTSmart Amp vector.

< Example  3>

primer / Probe  Design and Selection

In order to develop a biomarker for EGFR, a lung cancer-related gene, the mutation position was confirmed based on the cosmic number (http://cancer.sanger.ac.uk). Primer 3 primers for each gene were designed using a primer 3 program, and the rest except for EGFR-21 was designed so that the forward region overlap with the intron region. At this time, the Tm value of the primer was 58 ° C to 60 ° C and the GC% was designed to be 40% to 60%.

The probes were designed with the taqman probe to select those that met the criteria. HEX / VIC reporter fluorescence was attached to the 5'wild type prolove, and FAM dye was attached to the 5'mutant probe to detect the amplification. TAMRA was used as a quencher on the 3 'side of all probes. 4, 31, 8, and 4 probes were designed and synthesized on EGFR exons 18, 19, 20, and 21, respectively. The probes designed by the present inventors have allele specificities and almost all probes have cosmic numbers.

The information of the designed primer (Table 2) and the probe (Table 3 and Table 4) are as follows.

Name of the primer order SEQ ID NO: location C1-F1 (EGFR18F) tgaggatcttgaaggaaactga One Exon 18 C1-R1 (EGFR18R) ctgtgccagggaccttacct 2 Exon 18 C5-F2 (EGFR19F) tggatcccagaaggtgagaa 3 Exxon 19 C5-R2 (EGFR19R) gcagaaactcacatcgagga 4 Exxon 19 C36-F1 (EGFR20F) ccctccaggaagcctacg 5 Exxon 20 C36-R1 (EGFR20R) cagccgaagggcatga 6 Exxon 20 C44-F1 (EGFR21F) acaccgcagcatgtcaagat 7 Exon 21 C44-R1 (EGFR21R) tgcctccttctgcatggtat 8 Exon 21

primer
designation order order
number location Detection mutation P1-2 HEX-aagatcaaagtgctgggctccg 9 Exon 18 EGFR18P_WT P1-3 HEX-caaaaagatcaaagtgctgggctc 10 Exon 18 EGFR18P_WT P2-2 FAM-aagatcaaagtgctggCctccg 11 Exon 18 EGFR18P_2156G > C mt P3-2 FAM-aagatcaaagtgctgAgctccgg 12 Exon 18 EGFR18P_2155G> A mt P4-2 FAM-aagatcaaagtgctgTgctccgg 13 Exon 18 EGFR18P_2155G > T mt P5-3 HEX-ccgtcgctatcaaggaattaagagaagc 14 Exxon 19 EGFR19P_WT P6-2 FAM-aaattcccgtcgctatcaAaacatc 15 Exxon 19 EGFR19P_c.2235_2249 del 15 mt P7 FAM-ccgtcgctatcaaAATatctccgaaag 16 Exxon 19 EGFR19P_c.2235_2252> AAT mt P8 FAM-tcccgtcgctatcaaGtctccgaaa 17 Exxon 19 EGFR19P_c.2236_2253 del 18 mT P9 FAM-gtcgctatcaagGcatctccgaaag 18 Exxon 19 EGFR19P_c.2237_2251 del 15 mt P10 FAM-attcccgtcgctatcaagGctcc 19 Exxon 19 EGFR19P_c.2237_2254 del 18 mt P11-2 FAM-attcccgtcgctatcaaggTtccg 20 Exxon 19 EGFR19P_c.2237_2255> T mt P12-2 FAM-aaAtCCCGTcGCTATCAaGacat 21 Exxon 19 EGFR19P_c.2236_2250 del 15 mt P13 FAM-gctatcaaggAtccgaaagccaaca 22 Exxon 19 EGFR19P_c.2238_2255 del 18 mt P14-2 FAM-cccgtcgctatcaaggaGCcaacat 23 Exxon 19 EGFR19P_c.2238_2248> GC mt P15-2 FAM-ccgtcgctatcaaggaGCAatctccg 24 Exxon 19 EGFR19P_c.2238_2252> GCA mt P16-2 FAM-cccgtcgctatcaaggaaGcaacatc 25 Exxon 19 EGFR19P_c.2239_2247del 9-1 mt P17-5 FAM-ccgtcgctatcaaggaaTctccgaa 26 Exxon 19 EGFR19P_c.2239_2253del15mt (C17 = C23 = C25) P18-2 FAM-ccgtcgctatcaaggaAccgaaag 27 Exxon 19 EGFR19P_c.2239_2256 del 18 mT P19 FAM-atcaaggaaCcaacatctccgaaag 28 Exxon 19 EGFR19P_c.2239_2248 TTAAGAGAAG > C-2 mt P20-2 FAM-ccgtcgctatcaaggaaCAgaaagcc 29 Exxon 19 EGFR19P_c.2239_2258> CA mt P21-2 FAM-ccgtcgctatcaaggaatCatctccga 30 Exxon 19 EGFR19P_c.2240_2251 del 12 mT P22-2 FAM-ccgtcgctatcaaggaaTcgaaag 31 Exxon 19 EGFR19P_c.2240_2257 del 18 mT

* WT: wildtype; mt: mutant (see Table 4 below)

primer
designation order order
number location Detection mutation P24-3 FAM_gtcgctatcaaggaaccatctccg 32 Exxon 19 EGFR19P_c.2239_2251> C mt P26 FAM-aaaattcccgtcgctatcaaggTT 33 Exxon 19 EGFR19P_2237_2253> TTGCT mt P27 FAM-aaattcccgtcgctatcaaggaaG 34 Exxon 19 EGFR19P_2239_2257> GT mt P28 FAM_aaattcccgtcgctatcGcaacatct 35 Exxon 19 EGFR19P_c.2233_2247del15 mt P29 FAM_agaagcaacactcgatgtgagtttctgctt 36 Exxon 19 EGFR19P_c.2253_2276del24 mt P30-2 FAM-ccgtcgctatcaaAATTCcaacatctc 37 Exxon 19 EGFR19P_c.2235_2248> AATTC mt P31-2 FAM-ttcccgtcgctatcaagTatctccga 38 Exxon 19 EGFR19P_c.2237_2252> T mt P32-2 FAM-ccgtcgctatcaaAATTCcatctccga 39 Exxon 19 EGFR19P_c.2235_2251> AATTC mt P33-2 FAM-tcccgtcgctatcaaAATtccgaaag 40 Exxon 19 EGFR19P_c.2235_2255> AAT mt P34-2 FAM-ccgtcgctatcaaggTCTcgaaagcca 41 Exxon 19 EGFR19P_c.2237_2257> TCT mt P35 FAM_ctatcaaggaaCAAccgaaagccaaca 42 Exxon 19 EGFR19P_c.2239_2256> CAA mt P36-5 HEX-ctgggcatctgcctcacctcca 43 Exxon 20 EGFR20P_WT P37 FAM-agggcatgagctgcAtgatgagc 44 Exxon 20 EGFR20P_c.2369C > T mt P38-2 FAM-cctacgtgatggccaTcgtggac 45 Exxon 20 EGFR20P_c.2303G > T mt P39 FAM-gccagcgtgGCCAGCGTGg 46 Exxon 20 EGFR20P_c.2307_2308 insGCCAGCGTG mt P40-2 FAM-cgtggacaaccccacacacgtg 47 Exxon 20 EGFR20P_c.2319_2320 insCAC mt P41-2 FAM-ccagcgtggacGGTaacccccac 48 Exxon 20 EGFR20P_c.2310_2311 insGGT mt P42-2 FAM-tggccagcgtggacaGCGTGGAC 49 Exxon 20 EGFR20P_c.2311_2312 insGCGTGGACA mt P43 FAM_tggccagcgtggCCAGCGTGG 50 Exxon 20 EGFR20P_c.2309_2310 AC> CCAGCGTGGAT mt P44-4 HEX-agattttgggctggccaaact 51 Exon 21 EGFR21P_WT P45-5 FAM-agatcacagattttgggcGgg 52 Exon 21 EGFR21P_C.2573T> G mt P46-2 FAM-ctggccaaacAgctgggtgcgg 53 Exon 21 EGFR21P_c.2582T > A mt P47-2 FAM-cacagattttgggcGTgccaaact 54 Exon 21 EGFR21Pc.2573_2574TG> GT mt

< Example  4>

Comparative experiment with licensed products

The comparative assay was performed for the sensitivity test for the correlation test between the method using the cobas EGFR mutation test kit approved by the KFDA and the method of the present invention.

The mutation frequency was adjusted to 7% by 5%, 1%, 0.5%, 0.1%, 0.05%, 0.02% and 0.01%, respectively, and the samples were subjected to the Kobas EGFR gene mutation test kit And the method of the present invention. The Kovas EGFR gene mutation test was performed according to the manufacturer's instructions.

The target samples were divided into three cases. First, DNA extracted from Horizon's FFPE tissue (exon 19, delE746-A750 (1)) and Horizon's mutant genomic DNA were used.

As a result of measuring the minimum mutation frequency using a template spiking gDNA in Miniclone, the minimum measurement result of the Kobas EGFR gene mutation test was 0.5% to 5%, whereas in the case of the present invention, 0.02% It was confirmed that it was possible to test at 0.1%. Especially remarkable result was that the mutation position of 2239_2257> GT could not be measured by the Kobas EGFR gene mutation test, and the sensitivity of the present invention was 0.05% The results of this study are as follows.

* ddPCR uses 33 ng gDNA (10 ⁴ copies) as template

** Cobas EGFR mutation kit used 50 ng (1.5x10 ⁴ copies) as template

Secondly, the sensitivity and specificity of the mutant genomic DNA from Horizon's FFPE tissue were compared with those of Horizon's mutant genomic DNA. The results of the Korbas EGFR gene mutation test were 0.5% ~ 5% The minimum measurement value was measured as 0.02% ~ 0.5% depending on the location of the mutation. This shows that the sensitivity is at least 10 times higher in the product comparison analysis.

* ddPCR uses 33 ng gDNA (10 ⁴ copies) as template

** Cobas EGFR mutation kit used 50 ng (1.5x10 ⁴ copies) as template

< Example  5>

CTC  Separation and EGFR  Measurement of mutation

CTC obtained a blood sample from a cancer patient by means of a CTC separator based on the magnetophoresis method. A conceptual diagram of the CTC separation method by magnetophoresis is shown in FIG. The separation method of CTC will be described in more detail as follows.

A microfluidics chip prepared for CTC separation was mounted on a CTC separator capable of injecting blood and buffer. Blood was flowed through the injection ports at both ends while the buffer was poured into the middle channel. To the blood, a magnetic substance-specific antibody (EpCam antibody) was specifically added so as to be specifically bound to CTC, so that it was specifically magnetized only to CTC. The ferromagnetic material pre-installed in the microfluidics chip is magnetized by the permanent magnet installed in the CTC separator, and the magnetic force generated from the magnetized ferromagnetic material causes the CTC cells to move toward the central CTC separation channel. After the flow of blood, CTC collected at the side of the CTC separation channel was used for subsequent experiments.

Mutations in the EGFR gene were measured in DNA isolated from human CTC cells. DNA was isolated from the separated CTCs, and the mutation was confirmed according to the method of the present invention using the primer / probe of the present invention.

As a result, as shown in FIG. 4, small droplets amplified by the PCR product were detected due to the presence of a mutation as in the case of the P5 and P44 probes, and it was found that CTC can predict the therapeutic reactivity through detection of EGFR mutation .

As described above, since the system of the present invention can predict and diagnose reactivity of a cancer patient to a therapeutic agent through an automated process, it is useful for the purpose of suggesting a clue to the direction of treatment in the future including judgment of necessity of administration of an anti- Can be used.

<110> SNU R & DB FOUNDATION <120> Composition for detecting mutations of epidermal growth factor          receptor gene and kit comprising the same <130> NP14-0070 <160> 54 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> C1-F1 (EGFR18F) <400> 1 tgaggatctt gaaggaaact ga 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C1-R1 (EGFR18R) <400> 2 ctgtgccagg gaccttacct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C5-F2 (EGFR19F) <400> 3 tggatcccag aaggtgagaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C5-R2 (EGFR19R) <400> 4 gcagaaactc acatcgagga 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> C36-F1 (EGFR20F) <400> 5 ccctccagga agcctacg 18 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> C36-R1 (EGFR20R) <400> 6 cagccgaagg gcatga 16 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > C44-F1 (EGFR21F) <400> 7 acaccgcagc atgtcaagat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > C44-R1 (EGFR21R) <400> 8 tgcctccttc tgcatggtat 20 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> P1-2 <400> 9 aagatcaaag tgctgggctc cg 22 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P1-3 <400> 10 caaaaagatc aaagtgctgg gctc 24 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> P2-2 <400> 11 aagatcaaag tgctggcctc cg 22 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P3-2 <400> 12 aagatcaaag tgctgagctc cgg 23 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P4-2 <400> 13 aagatcaaag tgctgtgctc cgg 23 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P5-3 <400> 14 ccgtcgctat caaggaatta agagaagc 28 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P6-2 <400> 15 aaattcccgt cgctatcaaa acatc 25 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P7 <400> 16 ccgtcgctat caaaatatct ccgaaag 27 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P8 <400> 17 tcccgtcgct atcaagtctc cgaaa 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P9 <400> 18 gtcgctatca aggcatctcc gaaag 25 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P10 <400> 19 attcccgtcg ctatcaaggc tcc 23 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P11-2 <400> 20 attcccgtcg ctatcaaggt tccg 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P12-2 <400> 21 aaattcccgt cgctatcaag acat 24 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P13 <400> 22 gctatcaagg atccgaaagc caaca 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P14-2 <400> 23 cccgtcgcta tcaaggagcc aacat 25 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P15-2 <400> 24 ccgtcgctat caaggagcaa tctccg 26 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P16-2 <400> 25 cccgtcgcta tcaaggaagc aacatc 26 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P17-5 <400> 26 ccgtcgctat caaggaatct ccgaa 25 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P18-2 <400> 27 ccgtcgctat caaggaaccg aaag 24 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> P19 <400> 28 atcaaggaac caacatctcc gaaag 25 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P20-2 <400> 29 ccgtcgctat caaggaacag aaagcc 26 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P21-2 <400> 30 ccgtcgctat caaggaatca tctccga 27 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P22-2 <400> 31 ccgtcgctat caaggaatcg aaag 24 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P24-3 <400> 32 gtcgctatca aggaaccatc tccg 24 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P26 <400> 33 aaaattcccg tcgctatcaa ggtt 24 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P27 <400> 34 aaattcccgt cgctatcaag gaag 24 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P28 <400> 35 aaattcccgt cgctatcgca acatct 26 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P29 <400> 36 agaagcaaca ctcgatgtga gtttctgctt 30 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P30-2 <400> 37 ccgtcgctat caaaattcca acatctc 27 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P31-2 <400> 38 ttcccgtcgc tatcaagtat ctccga 26 <210> 39 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P32-2 <400> 39 ccgtcgctat caaaattcca tctccga 27 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P33-2 <400> 40 tcccgtcgct atcaaaattc cgaaag 26 <210> 41 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P34-2 <400> 41 ccgtcgctat caaggtctcg aaagcca 27 <210> 42 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P35 <400> 42 ctatcaagga acaaccgaaa gccaaca 27 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> P36-5 <400> 43 ctgggcatct gcctcacctc ca 22 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P37 <400> 44 agggcatgag ctgcatgatg agc 23 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P38-2 <400> 45 cctacgtgat ggccatcgtg gac 23 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> P39 <400> 46 gccagcgtgg ccagcgtgg 19 <210> 47 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> P40-2 <400> 47 cgtggacaac ccccaccacg tg 22 <210> 48 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P41-2 <400> 48 ccagcgtgga cggtaacccc cac 23 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P42-2 <400> 49 tggccagcgt ggacagcgtg gac 23 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P43 <400> 50 tggccagcgt ggccagcgtg g 21 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P44-4 <400> 51 agattttggg ctggccaaac t 21 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P45-5 <400> 52 agatcacaga ttttgggcgg g 21 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> P46-2 <400> 53 ctggccaaac agctgggtgc gg 22 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P47-2 <400> 54 cacagatttt gggcgtgcca aact 24

Claims (15)

A reverse primer of SEQ ID NO: 2, a reverse primer of SEQ ID NO: 2, a polynucleotide set of a probe selected from the group consisting of SEQ ID NOs: 9 to 13, a forward primer of SEQ ID NO: 3, The reverse primer of SEQ ID NO: 6 and the polynucleotide set of the probe selected from the group consisting of SEQ ID NOS: 43 to 50, the forward primer of SEQ ID NO: 7, the polynucleotide set of SEQ ID NO: 51 to 54 as an active ingredient, and a primer and probe set composition for detecting an epidermal growth factor receptor (EGFR) gene mutation.
The primer and probe set composition according to claim 1, wherein the EGFR mutation detection is for predicting the responsiveness to an EGFR inhibitor.
3. The primer and probe set composition according to claim 2, wherein the EGFR inhibitor is erlotinib or gefitinib.
2. The primer and probe set composition according to claim 1, wherein the probe is bound to a fluorescent material.
5. The primer and probe set composition according to claim 4, wherein the fluorescent material is at least one selected from the group consisting of VIX, HEX, FAM and EverGreen dyes.
A kit for detecting EGFR gene mutation comprising the primer and probe set composition of claim 1 as an active ingredient.
7. The kit of claim 6, wherein the kit is a research use only (RUO) or an investigation use only (IVD) kit.
A reverse primer of SEQ ID NO: 2, and a polynucleotide set of probes selected from the group consisting of SEQ ID NOs: 10 to 13 as an active ingredient.
A polynucleotide set of a probe selected from the group consisting of a forward primer of SEQ ID NO: 3, a reverse primer of SEQ ID NO: 4, a probe of SEQ ID NO: 14, and SEQ ID NOs: 15, 20, 21, 26, 27, 28, 31, 33, A kit for detecting EGFR gene mutation as an active ingredient.
A reverse primer of SEQ ID NO: 4, a probe of SEQ ID NO: 14, and a probe of SEQ ID NO: 16, 17, 18, 19, 22, 23, 24, 25, 29, 30, 32, 35, 36, 37, 38, 39, 40, 41, and 42 as an active ingredient, wherein the polynucleotide set of the probe is selected from the group consisting of:
A reverse primer of SEQ ID NO: 6, and a polynucleotide set of probes selected from the group consisting of SEQ ID NOs: 43 to 50 as an active ingredient.
A reverse primer of SEQ ID NO: 8, and a polynucleotide set of probes selected from the group consisting of SEQ ID NOS: 51 to 54 as an active ingredient.
13. The kit according to any one of claims 6 to 12, wherein the kit is used for qPCR (quantitative PCR) or digital PCR method.
13. The kit according to any one of claims 6 to 12, wherein the kit comprises DNA or cDNA separated from FFPE (formalin fixed paraffin embedded) tissue as a template.
13. The kit according to any one of claims 6 to 12, wherein the kit comprises DNA or cDNA separated from CTC (circulating tumor cells) isolated from blood as a template.

Images