KR101582261B1 - Escherichia coli strain ewg4 for producing d-galactonate and use thereof - Google Patents

Abstract

The present invention relates to an Escherichia coli strain EWG4 (E. coli BW25113 (DE3) ΔgalKΔdgoK/pET28a-aradH) which produces D-galactonate, and a use thereof and, more specifically, to an Escherichia coli strain EWG4 which easily produces D-galactonate in large quantity, and a use thereof. According to the present invention, provided are a recombinant Escherichia coli strain EWG4 (E. coli BW25113 (DE3) ΔgalKΔdgoK/pET28a-aradH) having excellent D-galactonate productivity, and a method which easily synthesizes the D-galactonate.

Description

E. coli strain EWG4 producing D-galactonate and its use {ESCHERICHIA COLI STRAIN EWG4 FOR PRODUCING D-GALACTONATE AND USE THEREOF}

The present invention generally, and more particularly, to facilitate the D- galacto carbonate go on D- galactosidase E. coli strain to produce carbonate EWG4 [E. coli BW25113 (DE3) Δ Δ galK dgoK / pET28a- aradH] and use thereof And to the use of E. coli strain EWG4 and E. coli strain EWG4 which can be produced in large quantities.

D-galactose is one of many carbohydrates found in nature, especially in giant red algae with 25-35% dry weight (Patent Document 1). It is used for the production of a variety of biofuels and platform chemicals through biological and / or chemical methods. Recent reports have highlighted the chemical conversion of D-galactose into furfural, a useful precursor compound for polymer synthesis, pharmaceuticals and other petroleum-like chemicals.

D-galactonate, which is a D-galactose derivative, is a valuable organic acid used as a polyester precursor, a food additive, a pharmaceutical intermediate, and a cosmetic raw material (Patent Document 2). D-galactonate is chemically produced through oxidation of the atmosphere of D-galactose via an alumina supported gold catalyst at pH 8-10 in the presence of oxygen, generally at 60 < 0 > C. This reaction is complete within 4 hours, but the pH sensitivity of the reaction often reduces the catalytic activity causing lactone intermediate accumulation.

On the other hand, the biological conversion of D-galactonate from D-galactose has not yet been completely explored. Despite the fact that some microorganisms can convert D-galactose to D-galactonate, a lack of genetic information on these microorganisms and available limited genetic tools have led to the development of D-galactonate Delayed additional metabolic engineering. There are several routes by which D-galactose can be metabolized. Microorganisms such as Escherichia coli and Lactococcus lactis can inherently metabolize D-galactose through the Leloir pathway. This pathway was first associated with D-galactose phosphorylation, followed by uridyllylphosphate (UDP-glucose) uridylylmonophosphate (UMP) in the presence of galactose-1-phosphate . ≪ / RTI > Finally, secreted glucose-1-phosphate enters the pathway. D-galactonate is produced from the pathway of Lewar. Another D-galactose metabolite is the DeLey-Doudoroff pathway found in Azotobacter vinelandii, CauLobacter crescentus and Pseudomonas fluorescens. pathway. In this pathway, the initial reduction of D-galactose to D-galactonate is catalyzed by galactose dehydrogenase enzyme (GalDH), then 2-keto-3-deoxy-galactonate -keto-3-deoxy-D-galactonate), followed by phosphorylation before cleavage to secrete pyruvate and glyceraldehyde phosphate. Therefore, D-galactonate can be produced from the Draey-Dowdoll off pathway.

Thus, in accordance with the lack of a suitable biological approach for D-galactonate production, a method is needed which can produce D-galactonate in large quantities.

US 2010/0124774 A1 US 5650436 B

In order to solve the above problems, the present invention provides an easy to produce a large amount of E. coli strain EWG4 [E. coli BW25113 (DE3) Δ Δ galK dgoK / pET28a- aradH] The Lactobacillus carbonate D- go. Also provided is a method for producing the E. coli EWG4 and uses thereof.

The present invention provides E. coli strain EWG4 [ E. coli BW25113 (DE3) [Delta] galK [ Delta] dgoK / pET28a- aradH ] having D-galactonate production ability deposited with accession number KCTC 12538BP.

The Escherichia coli strain EWG4 may be obtained by removing the galK gene encoding galactokinase and the dgoK gene encoding 2-dehydro-3-deoxy-galactonate kinase have.

The galK gene may be composed of the nucleotide sequence of SEQ ID NO: 2.

The dgoK gene may be composed of the nucleotide sequence of SEQ ID NO: 3.

However, the gene is not limited to the above-mentioned nucleotide sequence, and one or a few bases in the nucleotide sequence may be added, deleted or substituted to have a nucleotide sequence exhibiting the same function.

The E. coli strain EWG4 may contain an arabinose dehydrogenase (aradh) gene. The aradh gene is most preferably composed of SEQ ID NO: 1, but it is not limited to the above base sequence, and one or a few bases in the above sequence may have a base sequence showing the same function as an added, deleted or substituted sequence .

The present invention also provides a method for producing a galactolytic enzyme, comprising the steps of: (1) removing galK gene encoding galactokinase in E. coli and dgoK gene encoding 2-dehydro-3-deoxy-galactonate kinase; A step (step 2) of producing arabinose dehydrogenase (aradh) gene and E. coli expression vector pET28a with a restriction enzyme and ligating with a ligase to form pET28a- aradh ; And a step (step 3) of transfecting Escherichia coli obtained in step 1 with pET28a- aradh prepared in step 2 above.

The galK gene may be composed of the nucleotide sequence of SEQ ID NO: 2.

The dgoK gene may be composed of the nucleotide sequence of SEQ ID NO: 3.

The aradh gene may be composed of the nucleotide sequence of SEQ ID NO: 1

However, the genes are not limited to the above base sequence, and one or a few bases in the sequence may be added, deleted or substituted, and may have a base sequence exhibiting the same function.

The step of removing the gene of step 1 is preferably performed by a method of destroying a gene using a gene disruption cassette, but the present invention is not limited thereto, and all gene knockout methods used in the art can be used Do.

The restriction enzyme may be NcoI and BamHI.

The present invention also provides a method for producing D-galactonate comprising culturing the E. coli strain EWG4 to prepare a culture solution, and recovering D-galactonate from the culture solution.

The cultivation may be performed by a non-continuous fermentation method.

The cultivation can be carried out at 27 to 40 캜, more preferably 30 to 37 캜.

The culture can be carried out at a pH of 6 to 8, more preferably at a pH of 7.

The culture is preferably performed for 36 hours or more, more preferably for 36 to 72 hours, but is not limited thereto.

The culture may be performed in a medium containing a carbon source.

In accordance with the present invention, D- go excellent ability of recombinant E. coli strains Lactobacillus carbonate production EWG4 [E. coli BW25113 (DE3) Δ Δ galK dgoK / pET28a- aradH] and may provide a method for easily synthesizing them.

Level 1 is the growth of the solid containing carbonate Lactobacillus D- or D- galactose as a carbon source to go medium E. coli BW25113 wild-type strain and galK and / or dgoK gene disrupted strain (Δ galK, galK Δ Δ dgoK) Lt; / RTI >
Figure 2 shows the production ability of Lactococcus carbonate D- go by discontinuous fermentation in EWG4 [E. coli BW25113 (DE3) Δ Δ galK dgoK / pET28a- aradH].

Hereinafter, the present invention will be described in more detail with reference to examples. The objects, features and advantages of the present invention can be easily understood through the following embodiments. It is to be understood that both the foregoing general description and the following detailed description of the present invention are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Therefore, the scope of the present invention should not be limited by the following examples.

Example:

EWG4 [ E. coli BW25113 (DE3) DELTA galK Δ dgoK / pET28a- aradH ] synthesis

Strain and plasmid synthesis

Gene deletions for E. coli BW25113 (DE3) are described by Liu et al. (Bioprocess Biosyst Eng 2014 37: 383-391). Gene coding for lactic kinase (galactokinase) going to facilitate the first step of galactose metabolism D- galK: a (Galactose kinase gene, SEQ ID NO: 2) strains were destroyed in the E. coli BW25113 Δ galK :: kan mutant (E coli BW25113 (DE3) ΔgalK :: kan) was purchased from the National BioResource Project (NIG, Japan) (Baba et al., Mol Syst Biol 2006 2: 0008). Gene deletion experiments were performed with a one-step inactivation method (Datsenko and Wanner, Proc Natl Acad Sci USA 2000 97: 6640-6645).

The kanamycin resistance of E. coli BW25113 (DE3) ΔgalK :: kan was removed by treatment with pCP20 plasmid carrying flippase. Then, E. coli BW25113 (DE3) Δ galK :: from frt strain dgoK (2-dehyro-3-kinase deoxygalactonate gene, SEQ ID NO: 3) The gene was disrupted. dgoK destruction cassette (disruption cassette) was amplified using the primers (primer kdgoK) pKD3 as a template and the following: forward primer (GCCTGAACGGAAAATCTCCGGCTGCGGTGTTAGCAGAAGTCATATGAATATCCTCCTTAGT, SEQ ID NO: 4, kdgok-F) and reverse primer (GCATGAGCGATGCTCCTTATACCAGCCTGAAATGCCGTGTGTGTAGGCTGGAGCTGCTTCG, SEQ ID NO: 5, kdgok- R). The prepared PCR product contains a chloramphenicol resistance gene having, on the side, a FRT site and 40 base pairs corresponding to the 5 th and 3 rd end regions of dgoK. The prepared PCR product contains a chloramphenicol resistance gene having, on the side, a FRT site and 40 base pairs corresponding to the 5 th and 3 rd end regions of dgoK.

The pKD46 plasmid was used as a red recombinant expression vector and introduced into E. coli BW25113 (DE3)? galK :: frt. The dgoK disruption cassette was then introduced into E. coli BW25113 (DE3) [Delta] galK :: frt / pKD46 to complete homologous recombination. The prepared strain has the following genotype: E. coli BW25113 (DE3) Δ Δ galK dgoK :: Cm / pKD46. The pKD46 plasmid was removed from the strain by heat treatment at 42 ° C and then pCP20 was introduced into strain E. coli BW25113 (DE3) Δ galK ΔdgoK :: Cm. pCP20 is a helper plasmid that carries the yeast FLP recombinase gene (flippase) and transduces it into the FLP enzyme. FLP recognizes the recombinant enzyme (flippase) recognition point (FRT) and attacks the resistance gene for the antibiotic inserted in the host chromosome. Due to the role of FLP, antibiotic resistance is removed and DNA traces remain on the FRT site. (See Cherepanov and Wackernagel, 1995, Gene Vol.185, p.1-14 [Doi 10.1016 / 0378-1119 (95) 00193-A]). Heat-induced and treated (heat treatment and induction) Then, the resulting strain has the following genotype: E. coli BW25113 (DE3) Δ Δ dgoK galK.

E. coli BW25113 (DE3) DELTA galK Δ dgoK of Growth phenotype test

E. coli BW25113 (DE3) for Lactobacillus carbonate D- or D- galactose go as a single carbon source (sole source carbons) of the galK Δ Δ dgoK The growth phenotype was tested. The strains were tested in M9 solid medium containing 2 g L < ^-1 > D-galactose or D-galactonate as a sole carbons source. The strains cultivated overnight (Overnight) were diluted to 0.1 AU, 0.01 AU and 0.001 AU at OD ₆₀₀ . A diluted culture aliquot (5 μL) was dropped onto the solid medium surface and incubated at 37 ° C. until growth was observed. The results are shown in FIG. The wild type strain BW25113 showed growth in galactose or galactonate. The galK -deficient strain did not show growth only in galactose, but the double mutant? galK ? dgoK strain showed no growth in all carbon sources. E. coli BW25113 (DE3) [Delta] galK [ Delta] dgoK was used as the host for D-galactonate production, since the preferred strain should not be able to grow on galactose and galactonate .

pET28a- aradh  synthesis

The optimized codon aradh (GeneBank: ATCC29145.1, SEQ ID NO: 1) of Azospirillum brasilense synthesized by Bioneer (South Korea) was ligated to the NcoI and BamHI sites of E. coli expression vector pET28a pET28a- aradh . This plasmid was introduced into E. coli BW25113 (DE3) ΔgalKΔdgoK and transformed to prepare EWG4.

Experimental Example 1: Enzyme activity assay

AraDH activity was measured from crude cell extracts using a known method (Liu et al., Bioprocess Biosyst Eng 2014 37: 383-391). One unit of enzyme activity is defined as the amount of enzyme that converts 1 μmol of sugar substrate per minute to sugar. Specific activity was calculated as enzyme activity per mg protein. For the enzyme activity analysis, the optimal pH of AraDH was determined using potassium acetate (100 mM, pH 5.0-7.0), Tris-HCl (100 mM, pH 8.0-10.0) and glycine (100 mM, pH 10-12.3) Was determined as pH 5.0 to 12.3. The activity of AraDH on L-arabinose or D-galactose was almost similar (2.4 ± 0.2 to 3.7 ± 0.2 U mg ^-1 protein), and the enzyme tended to favor NADP ⁺ as a cofactor. The activity of AraDH (2.4 ± 0.2 U mg ^-1 ) on D-galactose was significantly higher than that of GalDH (1.2 ± 0.1 U mg ^-1 protein).

Experimental Example 2: D-galactonate productivity and yield analysis (non-continuous fermentation and metabolite analysis)

To evaluate the D-galactonate productivity and yield of EWG4, discontinuous fermentation was performed using a 5 L scale laboratory discontinuous fermentor.

Batch fermentation consisted of 2 L of M9 minimal salt, 5 g L ^-1 tryptone, 32 g L ^-1 glucose, 40 mg L ^-1 kanamycin and 40 g L ^-1 D-galactose or L - 5 L laboratory scale fermentor containing arabinose. Inoculant (100 mL overnight culture) was transferred into the fermentation vessel to start discontinuous fermentation (t = 0 h). The temperature was maintained at 37 DEG C, a stirring speed of 600 rpm and an airflow of 0.5 vvm. The pH was maintained at 7.0 by the addition of 3M H ₂ SO ₄ or 30% NH ₄ OH. When the OD ₆₀₀ reached about 8.0 AU, 0.5 mM IPTG was added and the temperature was lowered to 30 ° C. Dissolved oxygen was maintained at 20% air saturation by automatic control of stirring speed. Foaming was minimized by the addition of a foam inhibitor (Antifoam A, Sigma, Korea).

Extracellular metabolites were analyzed by Waters HPLC equipped with Bio-Rad Aminex HPX-87H column (300 ㅧ 7.8 mm). The column temperature was maintained at 55 占 폚. The eluent was pumped at a flow rate of 0.4 mL min <" ^{1 &} gt ;, and the peaks were detected using a Waters 2414 refractive index detector. The results of the analysis are shown in Fig. Discontinuous fermentation of EWG4 produced 24.0 g L ^-1 D-galactonate, 36% higher than strains carrying Gal DH, a specific D-galactose dehydrogenase.

Korea Biotechnology Research Institute KCTC12538BP 20140108

<110> MYONGJI UNIVERSITY INDUSTRY AND ACADEMIA COOPERATION FOUNDATION <120> ESCHERICHIA COLI STRAIN EWG4 FOR PRODUCING D-GALACTONATE AND USE <130> P14-0166 / MJU <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 950 <212> DNA <213> Azospirillum brasilense <400> 1 ccatggatgt ctgaccaggt ttctctgggt gttgttggta tcggtaaaat cgcgcgtgac 60 cagcacctgc cggcgatcga cgcggaaccg ggtttcaaac tgaccgcgtg cgcgtctcgt 120 cacgcggaag ttaccggtgt tcgtaactac cgtgacctgc gtgcgctgct ggcggcggaa 180 cgtgaactgg acgcggtttc tctgtgcgcg ccgccgcagg ttcgttacgc gcaggcgcgt 240 gcggcgctgg aagcgggtaa acacgttatg ctggaaaaac cgccgggtgc gaccctgggt 300 gaagttgcgg ttctggaagc gctggcgcgt gaacgtggtc tgaccctgtt cgcgacctgg 360 cactctcgtt gcgcgtctgc ggttgaaccg gcgcgtgaat ggctggcgac ccgtgcgatc 420 cgtgcggttc aggttcgttg gaaagaagac gttcgtcgtt ggcacccggg tcagcagtgg 480 atctgggaac cgggtggtct gggtgttttc gacccgggta tcaacgcgct gtctatcgtt 540 acccgtatcc tgccgcgtga actggttctg cgtgaagcga ccctgatcgt tccgtctgac 600 gttcagaccc cgatcgcggc ggaactggac tgcgcggaca ccgacggtgt tccggttcgt 660 gcggagtttg actggcgtca cggtccggtt gaacagtggg aaatcgcggt tgacaccgcg 720 gacggtgttc tggcgatctc tcgtggtggt gcgcagctgt ctatcgcggg tgaaccggtt 780 gaactgggtc cggaacgtga atacccggcg ctgtacgcgc acttccacgc gctgatcgcg 840 cgtggtgaat ctgacgttga cgttcgtccg ctgcgtctgg ttgcggacgc gttcctgttc 900 ggtcgtcgtg ttcagaccga cgcgttcggt cgttgaggat ccgacatcta 950 <210> 2 <211> 1149 <212> DNA <213> Escherichia coli <400> 2 atgagtctga aagaaaaaac acaatctctg tttgccaacg catttggcta ccctgccact 60 cacaccattc aggcgcctgg ccgcgtgaat ttgattggtg aacacaccga ctacaacgac 120 ggtttcgttc tgccctgcgc gattgattat caaaccgtga tcagttgtgc accacgcgat 180 gaccgtaaag ttcgcgtgat ggcagccgat tatgaaaatc agctcgacga gttttccctc 240 gatgcgccca ttgtcgcaca tgaaaactat caatgggcta actacgttcg tggcgtggtg 300 aaacatctgc aactgcgtaa caacagcttc ggcggcgtgg acatggtgat cagcggcaat 360 gtgccgcgg gtgccgggtt aagttcttcc gcttcactgg aagtcgcggt cggaaccgta 420 ttgcagcagc tttatcatct gccgctggac ggcgcacaaa tcgcgcttaa cggtcaggaa 480 gcagaaaacc agtttgtagg ctgtaactgc gggatcatgg atcagctaat ttccgcgctc 540 ggcaagaaag atcatgcctt gctgatcgat tgccgctcac tggggaccaa agcagtttcc 600 atgcccaaag gtgtggctgt cgtcatcatc aacagtaact tcaaacgtac cctggttggc 660 agcgaataca acacccgtcg tgaacagtgc gaaaccggtg cgcgtttctt ccagcagcca 720 gccctgcgtg atgtcaccat tgaagagttc aacgctgttg cgcatgaact ggacccgatc 780 gtggcaaaac gcgtgcgtca tatactgact gaaaacgccc gcaccgttga agctgccagc 840 gcgctggagc aaggcgacct gaaacgtatg ggcgagttga tggcggagtc tcatgcctct 900 atgcgcgatg atttcgaaat caccgtgccg caaattgaca ctctggtaga aatcgtcaaa 960 gctgtgattg gcgacaaagg tggcgtacgc atgaccggcg gcggatttgg cggctgtatc 1020 gtcgcgctga tcccggaaga gctggtgcct gccgtacagc aagctgtcgc tgaacaatat 1080 gaagcaaaaa caggtattaa agagactttt tacgtttgta aaccatcaca aggagcagga 1140 cagtgctga 1149 <210> 3 <211> 879 <212> DNA <213> Escherichia coli <400> 3 atgacagctc gctacatcgc aattgactgg ggatcgacca atctgcgcgc ctggctttat 60 cagggcgacc actgcctgga gagcaggcaa tcagaagcag gcgtcacgcg cctgaacgga 120 aaatctccgg ctgcggtgtt agcagaagtc acgaccgact ggcgtgaaga gaaaacgcca 180 gtggtactgg caggaatggt tggcagcaac gtcggctgga aagttgcacc gtatttatct 240 gttcctgcct gtttttcgtc tattggcgaa caattaacgt cagttggcga caatatctgg 300 attattcccg gattatgtgt ctctcatgac gataaccaca atgtgatgcg cggcgaagaa 360 acacaattga tcggcgcgcg agctctggct ccttcctctc tttatgtcat gcccggaacc 420 cattgcaaat gggtgcaggc cgatagccag caaatcaacg attttcgcac cgtgatgacc 480 ggtgaattac atcatttact gttaaatcac tcattgattg gcgcaggttt gccgccgcag 540 gaaaactctg ccgatgcctt cacagctggc cttgagcgtg gtcttaatac gcccgccata 600 ttgccgcagc tttttgaagt tcgcgcctcg catgtgctgg gaacacttcc ccgcgaacag 660 gtcagcgaat ttctctctgg tttgttgatt ggcgcagagg tcgccagtat gcgcgactat 720 gtggcccatc aacacgccat cacccttgtc gccggaacat cgctgaccgc gcgctaccag 780 caagcctttc aggcgatggg ttgcgacgtg acggcggtgg cgggcgacac ggcatttcag 840 gctggtataa ggagcatcgc tcatgcagtg gcaaactaa 879 <210> 4 <211> 61 <212> RNA <213> Artificial Sequence <220> <223> forward primer for kdgok <400> 4 gcctgaacgg aaaatctccg gctgcggtgt tagcagaagt catatgaata tcctccttag 60 t 61 <210> 5 <211> 61 <212> RNA <213> Artificial Sequence <220> <223> reverse primer for kdgok <400> 5 gcatgagcga tgctccttat accagcctga aatgccgtgt gtgtaggctg gagctgcttc 60 g 61

Claims (14)

E. coli strain EWG4 having D-galactonate-producing ability deposited with accession number KCTC 12538BP.
The method according to claim 1,
The Escherichia coli strain EWG4 is obtained by removing the galK gene encoding galactokinase and the dgoK gene encoding 2-dehydro-3-deoxy- galactonate kinase.
The method of claim 2,
Wherein the galK gene is composed of the nucleotide sequence of SEQ ID NO: 2. EWG4.
The method of claim 2,
Wherein the dgoK gene comprises the nucleotide sequence of SEQ ID NO: 3.
The method according to claim 1,
Wherein the Escherichia coli strain comprises an arabinose dehydrogenase (aradh) gene.
The method of claim 5,
Wherein the aradh gene comprises the nucleotide sequence of SEQ ID NO: 1.
Removing the galK gene encoding galactokinase in E. coli and the dgoK gene encoding 2-dehydro-3-deoxy-galactonate kinase (step 1);
A step (step 2) of treating arabinose dehydrogenase (aradh) gene and E. coli expression vector pET28a with a restriction enzyme and ligating with a ligase to prepare pET28a-aradh;
(Step 3) of transfecting Escherichia coli obtained in step 1 with pET28a- aradh produced in step 2 above.
The method of claim 7,
Wherein the step of removing the gene of step 1 is performed by a method of destroying a gene using a gene disruption cassette.
The method of claim 7,
Wherein the restriction enzymes are NcoI and BamHI.
Culturing the strain of claim 1 to produce a culture medium; and
And recovering D-galactonate from the culture.
The method of claim 10,
Wherein the culture is performed by a non-continuous fermentation method.
The method of claim 10,
Wherein the culturing is performed at 27 to 40 占 폚.
The method of claim 10,
Wherein the culture is carried out at a pH of 6 to 8.
The method of claim 10,
Wherein the culture is carried out in a medium containing a carbon source.

Images