KR101576586B1 - Biomarker AKR7A1 for detecting nephrotoxicity and method for detecting nephrotoxicity using the same - Google Patents

Abstract

The present invention relates to biomarkers for the evaluation of renal toxicity and their use. More particularly, the present invention relates to a composition for detecting biomarkers for the evaluation of renal toxicity, a kit comprising the same, and a detection method.

Description

(Biomarker AKR7A1 for detecting nephrotoxicity and method for detecting nephrotoxicity using the same)

The present invention relates to biomarkers for the evaluation of renal toxicity and their use. More particularly, the present invention relates to a composition for detecting biomarkers for the evaluation of renal toxicity, a kit comprising the same, a cell test method, and a detection method.

The kidney is metabolized in the body and discharges a variety of substances present in the blood. The blood is filtered through the glomerulus filtration, the renal tubular absorption and the reabsorption process, thereby discharging unnecessary substances into the body in the form of urine. Although the kidney weight is only 0.5% of body weight, the amount of blood flowing into the kidney is 20-25% of the total cardiac output, so it is susceptible to toxic xenobiotics. For example, excessive injections of drugs into the body, or various diseases, can damage the kidneys. If the kidneys are damaged, unnecessary substances in the body are not released, resulting in additional physical damage.

For example, drug-induced renal toxicity is frequently experienced in clinical practice, with 10-20% of acute renal insufficiency being caused by drugs, and about a quarter of the 100 commonly used drugs in the intensive care unit It is known that there is a risk of causing toxicity. In addition, it has been reported that kidney toxicity causes toxic injury to cells in various nephron sites and also affects specific cells present in the glomeruli.

In addition, the human body is exposed to various kidney toxic substances such as heavy metals, chemical substances, environmental pollutants as well as drugs, but there are no clinical signs or symptoms until about 70-80% of kidney epithelial cells are damaged, It is difficult to restore the function of the kidneys. Thus, it is urgently required to develop a technique for early detection of renal toxicity by improving the current evaluation method of renal toxicity using blood biochemical tests and histopathological examinations . In addition, it is important to develop non-invasive and clinically viable biomarkers that can detect kidney damage early.

Accordingly, the present inventors have uncovered new biomarkers for the evaluation of renal toxicity through the analysis of the proteomics of kidney tissue exposed to heavy metals. By using these biomarkers, toxicity due to various environmental substances such as heavy metals and side effects of drugs The present invention has been completed by completing a technique for predicting and evaluating the renal toxicity.

One object of the present invention is to provide a composition for evaluating renal toxicity, which comprises an agent for measuring the expression level of AKR7A1 (Aldo-keto reductase family 7, member A1) protein or mRNA encoding the same.

It is another object of the present invention to provide a kit for evaluating renal toxicity comprising the composition.

It is another object of the present invention to provide a method for detecting renal toxicity by detecting an AKR7A1 protein or an mRNA encoding the AKR7A1 protein from a sample of an individual.

Another object of the present invention is to provide a method for detecting an AKR7A1 protein or an mRNA encoding the AKR7A1 protein from a sample of an individual in order to provide information necessary for evaluating the renal toxicity.

Another object of the present invention is to provide a composition, a kit and a method for evaluating renal toxicity using the AKR7A1 protein or an mRNA encoding the same, as well as GSTP1 (glutathione s-transferase pi 1) protein or mRNA encoding the same will be.

Another object of the present invention is to provide a method for screening for AKR7A1 and GSTP1 protein or mRNA encoding the AKR7A1 and GSTP1 protein as well as ACO2 (Aconitase 2, mitochondrial precursor), PEPD (Xaa-Pro dipeptidase), SPTAN (Nonerythroid alpha- ), SELENBP1 (Selenium binding protein 1), ALDH9A1 (Aldehyde dehydrogenase 9A1), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), GDI 1 (GDP dissociation inhibitor 1), GSTA3 (Glutathione S- 1 precursor), SPNA2 (Alpha-spectrin 2), SELENBP2 (Selenium binding protein 1), CCT2 (T-complex protein 1 subunit beta), AKR1B8 (Aldo- keto reductase family 1, member B8), PSMC2 (Proteasome 26S subunit, ATPase 2) and GDI2 (GDP dissociation inhibitor 2), or a mRNA encoding the same, as well as a kit and a method for evaluating renal toxicity using the same.

The present invention relates to an evaluation method for predicting renal toxicity and side effects using biomarkers obtained through analysis of proteomics of kidney tissues exposed to heavy metals.

Renal toxicity is prevalent due to toxicity due to various environmental substances such as heavy metals and side effects of drugs, and a technology for predicting and evaluating such toxicity is urgently required. In the present invention, the expression of AKR7A1 as a new biomarker is measured to provide a technique useful for predicting or evaluating the risk of renal toxicity and side effects of an environmental substance or a drug. In addition, the present invention provides a technique utilizing GSTP1 as a biomarker usable with AKR7A1. In addition, the present invention utilizes biomarkers ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2, and / Technology.

In one embodiment, the present invention relates to a composition for evaluating renal toxicity comprising an agent that measures the level of expression of an AKR7A1 protein or an mRNA encoding the same.

In a preferred embodiment, the present invention relates to a composition for the evaluation of renal toxicity, further comprising an agent for measuring the level of expression of GSTP1 protein or an mRNA encoding the GSTP1 protein in the composition.

In another preferred embodiment of the present invention, the composition is selected from the group consisting of ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2 and GDI2 The present invention relates to a composition for evaluating renal toxicity, further comprising an agent for measuring the expression level of one or more proteins or mRNA encoding the same.

Renal toxicity may occur when exposed to a variety of environments that cause renal toxicity, including heavy metals, drugs, and exposure to chemicals. In the present invention, the drug means any substance existing in the natural world which causes toxicity to the elongation of an individual. For example, cisplatin, 4-aminophenol, PAP, aristolochic acid, 2-bromoethylamine, BEA, DCVC, cadmium, Cadmium chloride, cefoperazone, cephalothin, cerium nitrate, cinnabar, cyclospotine, sirolimus, doxorubicin, doxorubicin, herba cistanches, hexachlorobutadiene, hydrocortisone, gentamicin, lithium chloride, lanthanum nitrate, nanocopper, mercuric acid, But are not limited to, mercuric chloride, melamine, cyanuric acid, ochratoxin A, propyleneimine, puromycin, D-serine, Sodium chro mate, tacrolimus, TCTFP, tobramycin, uranylnitrate nitrate, vancomycin, and the like.

In the present invention, the heavy metal may be, but not limited to, mercury (Hg), cadmium (Cd), platinum (Pt), lead (Pb) or chromium (Cr).

Other substances causing kidney toxicity include halogenated hydrocarbons (eg, carbon tetrachloride, chloroform) and various environmental pollutants (2,4,5-Trichlorophenacetic acid, herbicide Paraquat, polychlorobiphenyl, 2,3,7,8-tetrachlorodibenzo -ρ-dioxin, and the like), but the present invention is not limited thereto.

As used herein, the term "evaluation" means identifying the presence or characteristic of a pathological condition. For the purposes of the present invention, the evaluation may mean diagnosing, predicting, searching or confirming whether or not kidney toxicity has occurred and whether it is likely to occur.

 The term "markers for evaluation, markers for evaluation, or evaluation markers" in the present invention refers to substances capable of distinguishing a cell or tissue that has developed or is likely to have renal toxicity from normal cells or tissues, Such as polypeptides or nucleic acids (such as mRNA), proteins, lipids, glycolipids, glycoproteins or sugars (monosaccharides, disaccharides, oligosaccharides, etc.) that show an increase or decrease in renal toxic cells or tissues. For the purpose of the present invention, the renal toxicity assessment marker of the present invention is AKR7A1, which expresses a specifically high level of expression in cells of tissues exposed to renal toxicity inducers, compared to cells of normal kidney tissue. In addition, the present invention provides GSTP1 as a marker of renal toxicity, which specifically expresses a high level of expression in the cells of tissues exposed to a renal toxicity inducing substance. The present invention also provides ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2 and / or GDI2 as the renal toxicity assessment markers. Here, ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2 and / or GDI2 are specific for cells exposed to the renal toxicity inducer There is a characteristic that indicates a high level of expression.

The protein or gene information of the biomarker for the evaluation of renal toxicity provided by the present invention can be easily obtained through a known gene database. For example, the amino acid sequence of the biomarker protein or the base sequence of the mRNA encoding the amino acid sequence is registered in the NCBI (National Center for Biotechnology Information), which is a known gene database. Table 1 below summarizes the information of each biomarker.

Biomarkers whose expression is increased by renal toxicity symbol full name Relative expression (times) Rats ( rat ) human( Human ) protein mRNA protein mRNA ACO2 Aconitase 2, mitochondrial precursor 5.3 NP_077374.2 NM_024398.2 NP_001089.1 (96%) NM_001098.2
(87%) GSTP1 Glutathione S-transferase pi 1 4.8 NP_036709.1 NM_012577.2 NP_000843.1 (86%) NM_000852.3 (83%) PEPD Xaa-Pro dipeptidase 4.6 NP_001009641.1 NM_001009641.1 CAG46470.1 (89%) CR541669.1 (86%) SPTAN Nonerythroid alpha-spectrin 3.8 AAA40770.1 J04828.1 AAA51790.1 (97%) J05243.1 (88%) ACO1 Aconitase 1 3.5 NP_059017.1 NM_017321.1 AAH18103.1 (93%) BC018103.1 (87%) SELENBP1 Selenium binding protein 1 3.5 NP_543168.1 NM_080892.1 AAH09084.1 (89%) BC009084.1 (87%) ALDH9A1 Aldehyde dehydrogenase 9A1 3.4 NP_071609.2 NM_022273.2 NP_000687.3 (90%) NM_000696.3 (85%) GAPDH Glyceraldehyde 3-phosphate dehydrogenase 3.4 NP_058704.1 NM_017008.4 AAA86283.1
(94%) M17851.1 (89%) GDI1 GDP dissociation inhibitor 1 3.2 NP_058784.2 NM_017088.2 NP_001484.1 (99%) NM_001493.2 (90%) GSTA3 Glutathione S-transferase alpha-3 3.2 NP_113697.1 NM_031509.2 NP_000838.3 (76%) NM_000847.4 (82%) GLG1 Golgi apparatus protein 1 precursor 3.1 NP_058907.1 NM_017211.2 NP_001139139.1 (95%) NM_001145667.1 (87%) SPTAN1 Alpha-spectrin 2 3.1 NP_741984.2 NM_171983.2 NP_003118.2 (98%) NM_003127.3 (89%) SELENBP1
CCT2 Selenium binding protein 1 or
T-complex protein 1 subunit beta 3 NP_543168.1
NP_001005905.1 NM_080892.1
NM_001005905.1 NP_003935.2 (89%)
NP_006422.1 (98%) NM_003944.3 (87%)
NM_006431.2 (89%) AKR7A1 Aldo-keto reductase family 7, member A1 3 NP_037347.1 NM_013215.1 NP_036199.2
(81%) NM_012067.2 (0%) AKR1B8 Aldo-keto reductase family 1, member B8 3 NP_775159.1 NM_173136.1 No information No information PSMC2
GDI2 Proteasome 26S subunit, ATPase 2 or
GDP dissociation inhibitor 2 3 AAH61542.1
NP_058972.2 BC061542.1
NM_017276.2 NP_002794.1 (99%)
AAP35514.1 (96%) NM_002803.3 (89%)
BT006868.1 (89%)

In the present invention, AKR7A1 has the same sequence information as AKR7A3, AFAR, AFB1-AR, rAFAR1, aflatoxin B1 aldehyde reductase, aflatoxin B1 aldehyde reductase member 1 and aflatoxin B1 aldehyde reductase member 3 in the gene database such as NCBI. AKR7A1 can be clearly understood by those skilled in the art by referring to the sequence information in the above table.

The term "agent for measuring the expression level of protein or mRNA" in the present invention means a molecule that can be used for detecting a marker by confirming the expression level of the biomarker whose expression is changed by renal toxicity as described above.

The expression level of the biomarker can be determined by confirming the expression level of the marker protein or the expression level of the gene mRNA encoding the marker protein.

In the present invention, "measurement of protein expression level" is a process for confirming the presence and expression level of a renal toxicity marker protein in a biological sample of a subject in order to evaluate renal toxicity. For example, The amount of the protein can be confirmed by detecting an antigen-antibody complex using an antibody that binds to the antibody. Examples of specific analytical methods include Western blot, enzyme linked immunosorbent as (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket, But are not limited to, immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, complement fixation assays, FACS, protein chips, and the like.

Preferably, the agent that measures the protein level is preferably an antibody.

The term "antibody" as used herein in the present invention means a specific protein molecule indicated for an antigenic site as a term known in the art. For the purpose of the present invention, an antibody refers to an antibody that specifically binds to the biomarker protein of the present invention, which is obtained by cloning each gene into an expression vector according to a conventional method, Protein can be obtained and can be prepared from the obtained protein by a conventional method. Also included are partial peptides that can be made from the protein, and the partial peptides of the invention include at least 7 amino acids, preferably 9 amino acids, more preferably 12 or more amino acids.

The form of the antibody of the present invention is not particularly limited, and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention and include all immunoglobulin antibodies. Furthermore, the antibodies of the present invention include special antibodies such as humanized antibodies.

Antibodies used in the detection of the marker for renal toxicity assays of the invention include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

In the present invention, "measurement of mRNA expression level" is a process for determining the presence and expression level of a gene encoding a renal toxin marker protein in a biological sample of a subject to evaluate renal toxicity. For example, It can be seen by measuring. Examples of specific analytical methods include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), northern blotting (Northern blotting), DNA chip, and the like, but are not limited thereto.

The agent that measures the level of expression of mRNA may preferably be a primer pair, a probe or an antisense oligonucleotide. Since the nucleic acid sequences of the biomarkers of the present invention are known, those skilled in the art can design primers, probes, or antisense oligonucleotides that specifically bind to specific regions of these genes based on the sequence.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a base pair with a complementary template and having a starting point for template strand copying ≪ / RTI > Primers can initiate DNA synthesis in the presence of reagents and different quaternary nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. Preferably, in the present invention, PCR amplification is performed using a polynucleotide sense and antisense primer that specifically binds to mRNA encoding a marker protein, thereby evaluating renal toxicity through the production of a desired product. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The term "probe" in the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or a few hundreds of nucleotides capable of specifically binding to mRAN and is labeled to confirm the presence or absence of a specific mRNA . The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. In the present invention, hybridization can be performed using a probe complementary to a marker mRNA polynucleotide to evaluate renal toxicity through hybridization. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).

The term "antisense oligonucleotide " in the present invention refers to a nucleic acid-based molecule having a complementary sequence to the mRNA sequence of the target biomarker gene and capable of forming a dimer with the mRNA of the marker gene.

Herein, complementary binding means that the antisense oligonucleotide is sufficiently complementary to hybridize selectively to the mRNA target of the RORC gene under a predetermined hybridization or annealing condition, preferably physiological conditions, Quot; means " including both substantially complementary and perfectly complementary, and is preferably completely complementary.

In another aspect, the present invention relates to a kit for evaluating renal toxicity, comprising a composition comprising an agent that measures the level of expression of an AKR7A1 protein or an mRNA encoding the same.

In a preferred embodiment, the present invention further relates to a kit for evaluating renal toxicity, further comprising a composition comprising an agent for measuring the expression level of GSTP1 (glutathione s-transferase pi < 1 > .

In another preferred embodiment of the present invention, the composition is selected from the group consisting of ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2 and GDI2 The present invention relates to a kit for evaluating renal toxicity, further comprising a composition comprising an agent that measures the level of expression of one or more proteins or mRNA encoding the same.

The kit of the present invention can detect the marker by confirming the expression level of the protein of the marker for the evaluation of renal toxicity or the gene encoding the marker. The kit for detecting markers of the present invention may contain a primer, a probe or optionally an antibody recognizing a marker for measuring the level of expression of a marker for evaluation of renal toxicity, as well as one or more other component composition solution or apparatus suitable for the assay .

As a specific example, in the present invention, a kit for measuring the expression level of a marker protein for evaluating renal toxicity includes a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, and a chromogenic substrate . ≪ / RTI > The substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a slide glass made of glass, etc. The chromogenic enzyme may be peroxidase, Alkaline phosphatase may be used as the fluorescent substance, FITC, RITC or the like may be used as the fluorescent substance, and the coloring substrate solution may be ABTS (2,2'-azino-bis- (3-ethylbenzothiazolin- ), OPD (o-phenylenediamine), TMB (tetramethylbenzidine), and the like.

As another specific example, in the present invention, the kit for measuring the mRNA expression level of the marker may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits can be used in conjunction with test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-Polymers Enzymes such as enzyme and reverse transcriptase, DNase, RNase inhibitor, DEPC-water, and sterilized water. It may also contain a specific primer pair for quantitative control. In addition, the kit of the present invention may be a kit for detecting a marker for the evaluation of renal toxicity, which includes essential elements necessary for carrying out a DNA chip. The DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof.

In another aspect, the present invention relates to a method for detecting an AKR7A1 protein or an mRNA encoding the AKR7A1 protein from a sample of an individual to provide information necessary for evaluating renal toxicity.

In a preferred embodiment, the present invention relates to a method comprising the further step of detecting GSTP1 protein or an mRNA encoding the GSTP1 protein.

In a preferred embodiment, the present invention provides a method of screening for a compound selected from the group consisting of ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2 and GDI2 Or a mRNA encoding the same is further detected.

More specifically, the expression of the gene can be detected at the mRNA level or the protein level, and the separation of the mRNA or protein in the biological sample can be carried out using a known process.

In the present invention, the term "individual" means an animal having a kidney in the body organs among living things in the natural world, preferably a mammal, and more preferably a human. Examples of the mammals include rats (rats, mice, etc.), rabbits, horses, cows, sheep, dogs, cats, monkeys and humans, but the kind of the present invention is not limited by the above examples.

In the present invention, the term "sample of an individual" refers to a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine in which the expression level of the marker protein for the evaluation of renal toxicity or mRNA encoding the same is different. But are not limited thereto. Preferably, it may be kidney tissue or cells constituting it.

Through the above detection methods, it is possible to confirm or predict the actual renal toxicity of a suspected patient with renal toxicity by comparing the gene expression level in the normal control group with the gene expression level in suspected kidney toxicity. That is, the expression level of the marker of the present invention is measured from a sample such as a cell or tissue presumed to have renal toxicity, the level of expression of the marker of the present invention is measured from a sample such as normal cells or tissue, , If the expression level of the marker of the present invention is found to be significantly increased in the cell derived from the presumed nephrotoxicity than that of the normal cell, the subject can be predicted as a kidney toxic patient.

Analysis methods for detecting the marker protein include Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Oucheronian immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assay, complement fixation assay, FACS, Protein chips, and the like. Through the above analysis methods, it is possible to compare the amount of the antigen-antibody complex formed in the normal control group with the amount of the antigen-antibody complex formed in the suspected kidney toxin, and the expression level of the marker gene for the renal toxicity To determine whether or not an actual renal toxicity of a suspected kidney toxic individual has occurred can be predicted or confirmed.

The term "antigen-antibody complex" in the present invention means a combination of a marker protein for the evaluation of renal toxicity and an antibody specific thereto, and the amount of the antigen-antibody complex formed is quantitatively determined through the size of a signal of a detection label .

Measurement of protein expression levels is preferably performed using an ELISA method. ELISAs include direct ELISA using labeled antibodies that recognize the antigen attached to the solid support, indirect ELISA using labeled antibodies that recognize the capture antibody in a complex of antibodies recognizing the antigen attached to the solid support, A direct sandwich ELISA using another labeled antibody that recognizes an antigen in the complex of antibody and antigen, a method of reacting with another antibody recognizing an antigen in a complex of an antibody and an antigen attached to a solid support, Indirect sandwich ELISA using a secondary antibody, and various ELISA methods. More preferably, the antibody is attached to a solid support, the sample is reacted, and the labeled antibody recognizing the antigen of the antigen-antibody complex is adhered to produce an enzyme, or an antibody that recognizes the antigen of the antigen-antibody complex Is detected by a sandwich ELISA method in which a labeled secondary antibody is attached and the enzyme is developed. It is possible to confirm the occurrence of renal toxicity by checking the degree of complex formation of marker protein and antibody for evaluation of renal toxicity.

Further, preferably, Western blotting using one or more antibodies against the marker for evaluating renal toxicity is used. For example, the whole protein is separated from the sample, and the protein is separated according to size by electrophoresis, and then transferred to the nitrocellulose membrane to react with the antibody. The amount of the protein produced by the expression of the gene can be confirmed by confirming the amount of the generated antigen-antibody complex using the labeled antibody, thereby confirming whether or not the renal toxicity has occurred. The detection method is performed by examining the expression level of the marker gene in the control group and the expression level of the marker gene in the cell in which the kidney toxicity occurs. The level of mRNA or protein may be expressed as the absolute (e.g., [mu] g / ml) or relative (e.g., the relative intensity of the signal) difference of the marker protein.

Preferably, immunohistological staining using at least one antibody against the marker for the renal toxicity evaluation is performed. For example, samples of normal kidney tissues or cells, and cells or tissues suspected of being renal toxic, are collected and fixed, and then paraffin-embedded blocks are prepared by methods well known in the art. They are made into sections with a thickness of several micrometers and attached to a glass slide, and then reacted with a selected one of the above antibodies by a known method. Thereafter, the unreacted antibody is washed and labeled with one of the above-mentioned detection labels to read the label of the antibody on a microscope.

In addition, preferably, the protein chip in which at least one antibody against the marker for the renal toxicity evaluation is arranged at a predetermined position on the substrate and immobilized at a high density is used. For example, a method of analyzing a sample using a protein chip is a method of separating a protein from a sample, hybridizing the separated protein with a protein chip to form an antigen-antibody complex, reading the protein, To confirm whether or not kidney toxicity has occurred.

Examples of the assay method for detecting the mRNA of the marker include, but are not limited to, reverse transcriptase polymerase, competitive reverse transcriptase polymerase, real-time reverse transcriptase polymerase, RNase protection assay, northern blotting, and DNA chip. Through the above detection methods, it is possible to compare the mRNA expression amount in the normal control group with the mRNA expression amount in the suspected kidney toxin, and determine whether the expression level of mRNA in the kidney toxicity evaluation marker gene is increased or decreased, It is possible to evaluate the occurrence of actual kidney toxicity.

Measurement of mRNA expression level is preferably performed using a reverse transcriptase polymerase reaction method or a DNA chip using a primer specific to a gene used as a marker for evaluating renal toxicity. The above reverse transcriptase-polymerase reaction can be confirmed by the electrophoresis after the reaction and the band pattern and the band thickness can be confirmed, so that the mRNA expression and the degree of the gene used as a marker for the evaluation of the renal toxicity can be confirmed and compared with the control group, It can be easily confirmed or predicted. On the other hand, a DNA chip uses a DNA chip in which a nucleic acid corresponding to the marker gene for the renal toxicity assessment or a fragment thereof is attached at high density on a glass-like substrate. The DNA chip separates the mRNA from the sample, A labeled cDNA probe can be prepared, hybridized to a DNA chip, and the occurrence of renal toxicity can be read.

By analyzing the expression pattern of the biomarker through the above detection method, it is possible to accurately and simply confirm or predict the renal toxicity of a patient exposed to a kidney toxic inducing substance such as heavy metals or drugs. Based on this, Therapeutic and new drug development.

The biomarker of the present invention and its application technology can be useful for predicting and evaluating the toxicity due to various environmental substances such as heavy metals and side effects of drugs and further development of safe new drugs free from renal toxicity, But also in the study of action mechanisms that cause it.

FIG. 1 shows the results of confirming the increase of AKR7A1 and GSTP1 proteins by analyzing the proteomics of kidney tissue after exposure to heavy metal mercury in rats. Con (control) is the kidney tissue of rats not exposed to heavy metal mercury, and Hg is the result in kidney tissue of rats exposed to heavy metal mercury.
FIG. 2 shows the results of confirming the expression of the AKR7A1 and GSTP1 genes in the rat through heavy-metal mercury-exposed kidney tissue mRNA analysis. In addition, the results of comparison with known biomarkers for evaluation of renal toxicity, Kim1, Spp1, TIMP1, and Lcn2, are also shown.
Figure 3 shows the results of evaluating cytotoxicity by mercury in rat derived renal tubular cells.
FIG. 4 shows the results of confirming the increase of expression of AKR7A1 and GSTP1 genes through mRNA analysis after exposing mercury to rat derived renal tubular cells.
FIG. 5 shows the results of confirming an increase in expression of Kim1, Spp1, TIMP1, and Lcn2 genes, which are known biomarkers for renal toxicity evaluation, through mRNA analysis after exposing mercury to rat derived renal tubular cells.
Fig. 6 shows the results of evaluation of cytotoxicity by cadmium in rat derived renal tubular cells.
FIG. 7 shows the results of confirming the expression of AKR7A1 and GSTP1 genes and the increase in expression of Kim1, Spp1, TIMP1, and Lcn2 genes, which are known biomarkers for evaluating renal toxicity, through mRNA analysis after cadmium exposure to rat derived renal tubular cells.
FIG. 8 shows the results of evaluating cytotoxicity by cisplatin in rat-derived renal tubular cells.
FIG. 9 shows the results of confirming the expression of AKR7A1 and GSTP1 genes and the expression of Kim1, Spp1, TIMP1, and Lcn2 genes, which are known biomarkers for evaluating renal toxicity, through mRNA analysis after exposing cisplatin to rat renal tubular cells.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Experimental animals In rats  Heavy Metals Utilizing the method of proteomics after mercury exposure New biomarker  excavation

Heavy metal mercury (Hg) was exposed to Sprague-Dawley rats (Nara Biotech, 3 weeks old, 20 rats) once every two days for a total of 14 days and kidney tissues were isolated. The concentration of mercury was divided by the concentration and the concentration (2.03 mg / kg HgCl2; 1.5 mg / kg Hg) and the high concentration (10.15 mg / kg HgCl2; 7.5 mg / kg Hg), respectively. In the case of rats not exposed to mercury, 2 ml / kg of water was administered and kidney tissue was separated and used as a control.

Utilizing the proteomics technique for the kidney tissue samples of the rats exposed or not exposed to the mercury, proteins showing significant differences in expression levels in the two kidney tissue samples were excavated. The proteomics were performed in the following manner. Sample lysis buffer was added to the kidney tissues of rats exposed to heavy metals and tissues were lysed using a tissue grinder. The pulverized tissue was centrifuged at 10,000 × g for 15 minutes to separate the supernatant, and the protein concentration was quantitated by BCA protein assay. The extracted proteins were subjected to 18-cm pH 4-7 IPG (immobilized pH gradient) strips on primary electrophoresis in protean isoelectric focusing (IEF) cells and secondary electrophoresis was performed on 9-17% SDS-PAGE gels. The completed gels were stained with Coomassie blue and observed for protein spots. The stained gels were stored in 2% acetic acid solution after scanning and images were analyzed by Image analysis software. The spots were expressed more than three times as compared with the control, and protein identification analysis of these spots was carried out. The trypsin-treated protein was digested into several peptide fragments and analyzed by mass-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF) to determine isoelectric point and molecular weight Proteins were searched through the protein database of the Nation Center for Biotechnology Information (NCBI).

As a result, it was confirmed that AKR7A1 and GSTP1 proteins were significantly increased in kidney tissues of rats exposed to mercury compared to the control group (Fig. 1). In addition, ACO2, PEPD, SPTAN, ACO1, SELENBP1, ALDH9A1, GAPDH, GDI1, GSTA3, GLG1, SPNA2, SELENBP2, CCT2, AKR1B8, PSMC2 and GDI2 proteins were also significantly increased (Table 2).

Biomarkers whose expression is increased by renal toxicity symbol full name Relative expression (times) ACO2 Aconitase 2, mitochondrial precursor 5.3 GSTP1 Glutathione S-transferase pi 1 4.8 PEPD Xaa-Pro dipeptidase 4.6 SPTAN Nonerythroid alpha-spectrin 3.8 ACO1 Aconitase 1 3.5 SELENBP1 Selenium binding protein 1 3.5 ALDH9A1 Aldehyde dehydrogenase 9A1 3.4 GAPDH Glyceraldehyde 3-phosphate dehydrogenase 3.4 GDI1 GDP dissociation inhibitor 1 3.2 GSTA3 Glutathione S-transferase alpha-3 3.2 GLG1 Golgi apparatus protein 1 precursor 3.1 SPTAN1 Alpha-spectrin 2 3.1 SELENBP1
CCT2 Selenium binding protein 1 or
T-complex protein 1 subunit beta 3 AKR7A1 Aldo-keto reductase family 7, member A1 3 AKR1B8 Aldo-keto reductase family 1, member B8 3 PSMC2
GDI2 Proteasome 26S subunit, ATPase 2 or
GDP dissociation inhibitor 2 3

Example  2. Experimental animals were exposed to heavy metal mercury mRNA  Analysis confirms the increase of new biomarkers

As described in Example 1, the rats were exposed to heavy metal mercury and kidney tissues were isolated. After total mRNA was isolated from the kidney tissues, the expression levels of AKR7A1 and GSTP1 mRNA were analyzed by qRT-PCR, respectively. The PCR conditions were pre-denaturation at 94 ° C for 3 minutes, followed by 45 cycles of denaturation at 94 ° C for 10 seconds, annealing at 55 ° C for 30 seconds, and extension at 72 ° C for 10 seconds, followed by 1 minute at 95 ° C and 60 ° C, Melting temperature analysis of each PCR product was performed by lowering the temperature from 60 ° C to 95 ° C and measuring the fluorescence value at each 0.5 ° C. The primer sequences used are shown in the following table.

symbol Primer  (5'-3 ') SEQ ID NO: 18s Forward GTAACCCGTTGAACCCCATT One Reverse CCATCCAATCGGTAGTAGCG 2 KIM1 Forward TGGCACTGTGACATCCTCAGA 3 Reverse GCAACGGACATGCCAACATA 4 Spp1 Forward GATCGATAGTGCCGAGAAGC 5 Reverse TGAAACTCGTGGCTCTGATG 6 TMP1 Forward ACAGCTTTCTGCAACTCG 7 Reverse CTATAGGTCTTTACGAAGGCC 8 Lcn2 Forward GATTCGTCAGCTTTGCCAAGT 9 Reverse CATTGGTCGGTGGGAACAG 10 AKR7A1 Forward ATTTGTACCCTCTGCAAGAA 11 Reverse TTGAAGGCGTAGAACCTTAG 12 GSTP1 Forward GCTCAAGTCCACTTGTCTGT 13 Reverse CAAGATGGCATTAGATTGGT 14

As a result, it was confirmed that the mRNA expression of AKR7A1 and GSTP1 mRNA was relatively increased from the mRNA isolated from the kidney tissue of the rats exposed to mercury, compared with the case where the mRNA was not exposed. In addition, it was confirmed that the expression level of AKR7A1 and GSTP1 mRNA was significantly increased with increasing mercury exposure (0.15, 1.5, 7.5 mg / kg). In addition, the increase in the mRNA expression level of AKR7A1 and GSTP1 when exposed to mercury was higher than that of the known biomarkers for the evaluation of renal toxicity, Kim1, Spp1, TIMP1, and Lcn2, and it was confirmed to be suitable as a new biomarker 2).

Example  3. Rat  Mercury-induced toxicity in derived renal tubular cells and new Biomarker  Verification of utilization

Rats were exposed to mercury and assessed for cytotoxicity in normal rat kidney tubular epithelial cells (NRK52E). Toxicity was assessed by the MTT assay, a cell activity assay, and the LDH assay, an indicator of cell membrane damage by toxicity. First, cultured NRK-52E cells (ATCC CRL-1571) were seeded in 96-well plates at 5 * 10 ³ cells / well and cultured at 37 ° C for 24 hours. The concentration of mercury in each concentration (0, 0.1, 1, 5 μM HgCl ₂ ) was replaced with the culture medium, and then cultured for another 24 hours. The degree of cytotoxicity was measured by MTT method. Cells treated with heavy metals were treated with 10% MTT solution (5 mg / ml) mixed with culture medium and cultured for 4 hours. After 4 hours, MTT solution was removed, MTT formazan was dissolved by adding DMSO, and the absorbance was measured at 570 nm. In addition, culture medium for 24 hours after mercury exposure was collected and used for LDH assay. LDH assay was performed using PROMEGA CytoTox 96® kit. The assay method was the same as the kit protocol.

As a result, it was confirmed that the kidney cytotoxicity was increased as the dose of mercury was increased (FIG. 3).

 In addition, the total mRNA was isolated after exposing the NRK52E cells to mercury, and the expression amounts of mRNAs of AKR7A1 and GSTP1 were analyzed by qRT-PCR in the same manner as in Example 2, respectively. As a result, it was confirmed that the expression level of AKR7A1 mRNA was greatly increased with the increase of mercury exposure, and the expression of GSTP1 mRNA was also significantly increased (FIG. 4).

As a result of comparing the above results with mRNA expression changes of known biomarkers for the evaluation of renal toxicity, Kim1, Spp1, TIMP1, and Lcn2, mRNA expression levels of AKR7A1 and GSTP1 mRNA expressed in the present invention were compared with those of the conventional biomarkers Sensitive measurement (FIG. 5).

Example  4. Other than mercury Kidney toxicity  The inducing substances (cadmium, Cisplatin New Biomarker  Assessment of predictive power

It has been confirmed that the biomarkers AKR7A1 and GSTP1 discovered in the present invention can be used not only for mercury but also for the evaluation of renal toxicity of cadmium as a heavy metal other than the heavy metal which is highly problematic in inducing renal toxicity and cisplatin having a problem of renal toxicity . First, the cytotoxicity of the rat derived renal tubular cell line NRK52E to cadmium and cisplatin, respectively, was evaluated by MTT assay as described in Example 3. As a result, both of cadmium and cisplatin were increased in renal cytotoxicity (Fig. 6 and Fig. 8). It was confirmed that this was sensitively reflected in the amount of mRNA change of the new biomarkers AKR7A1 and GSTP1, and it was confirmed that this was significantly higher than the known biomarkers for the evaluation of renal toxicity, Kim1, Spp1, TIMP1, and Lcn2 And Fig. 9).

Overall, in the present invention, Akr7a1 and GSTP1 were identified as indicators for predicting renal toxicity. In the experiments using renal tubular cells, these two biomarkers showed excellent prediction ability because of the good agreement between the renal cytotoxicity and the expression of these biomarkers. Therefore, it can contribute to prediction and evaluation of the possibility of renal toxicity of medicines and environmental substances.

<110> INDUSTRY-UNIVERSITY COOPERATION FOUNDATION HANYANG UNIVERSITY ERICA CAMPUS <120> Biomarker AKR7A1 for detecting nephrotoxicity and method for          detecting nephrotoxicity using the same <130> DPP20134361KR <160> 14 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for 18s rRNA <400> 1 gtaacccgtt gaaccccatt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for 18s rRNA <400> 2 ccatccaatc ggtagtagcg 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for KIM1 <400> 3 tggcactgtg acatcctcag a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for KIM1 <400> 4 gcaacggaca tgccaacata 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Spp1 <400> 5 gatcgatagt gccgagaagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Spp1 <400> 6 tgaaactcgt ggctctgatg 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for TMP1 <400> 7 acagctttct gcaactcg 18 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for TMP1 <400> 8 ctataggtct ttacgaaggc c 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Lcn2 <400> 9 gattcgtcag ctttgccaag t 21 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Lcn2 <400> 10 cattggtcgg tgggaacag 19 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for AKR7A1 <400> 11 atttgtaccc tctgcaagaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for AKR7A1 <400> 12 ttgaaggcgt agaaccttag 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for GSTP1 <400> 13 gctcaagtcc acttgtctgt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for GSTP1 <400> 14 caagatggca ttagattggt 20

Claims (13)

A primer, a probe or an antisense oligonucleotide that specifically binds to an antibody specific to AKR7A1 (Aldo-keto reductase family 7, member A1) protein or an mRNA encoding AKR7A1 protein,
Wherein the AKR7A1 protein or the AKR7A1 protein-encoding mRNA is expressed more in a heavy metal or a drug-induced kidney toxin than the normal control group.
Compositions for evaluating renal toxicity by heavy metals or drugs
The method according to claim 1, further comprising an antibody specific for GSTP1 (glutathione s-transferase pi 1) protein, or a primer, probe or antisense oligonucleotide specifically binding to an mRNA encoding the GSTP1 protein, / RTI &gt;
The method according to claim 2, wherein the ACO2 (Aconitase 2, mitochondrial precursor), PEPD (Xaa-Pro dipeptidase), SPTAN (Nonerythroid alpha-spectrin), ACO1 (Aconitase 1), SELENBP1 (Selenium binding protein 1), ALDH9A1 (Aldehyde dehydrogenase 9A1 ), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), GDP dissociation inhibitor 1, GSTA3 (Glutathione S-transferase alpha-3), Golgi apparatus protein 1 precursor, SPNA2 (Alpha-spectrin 2), SELENBP2 binding protein 1), CCT2 (T-complex protein 1 subunit beta), AKR1B8 (Aldo-keto reductase family 1, member B8), PSMC2 (Proteasome 26S subunit, ATPase 2) and GDI2 (GDP dissociation inhibitor 2) A composition for the evaluation of renal toxicity, further comprising a primer, a probe or an antisense oligonucleotide which specifically binds to an antibody specific for the at least one protein selected, or to an mRNA encoding said protein.
delete delete delete A kit for evaluating renal toxicity by heavy metals or drugs, comprising the composition of any one of claims 1 to 3.
8. The kit according to claim 7, wherein the kit is a protein chip kit.
The expression level of AKR7A1 (Aldo-keto reductase family 7, member A1) protein or mRNA encoding the AKR7A1 protein is detected in a sample of a heavy metal or a subject exposed to the drug and the expression level thereof is compared with the expression level of the AKR7A1 protein of the normal control sample or the mRNA encoding the AKR7A1 protein Comparing; And
And identifying the subject as a kidney toxic patient when the expression level of AKR7A1 protein or an mRNA encoding the AKR7A1 protein is higher than that of a normal control sample in a sample of a heavy metal or a subject exposed to the drug.
A method for detecting an AKR7A1 protein or an mRNA encoding the AKR7A1 protein from a sample of an individual to provide information necessary to evaluate renal toxicity by heavy metals or drugs.
10. The method according to claim 9, further comprising the step of detecting GSTP1 (glutathione s-transferase pi 1) protein or an mRNA encoding the same.
10. The method according to claim 9, wherein the sample is selected from the group consisting of ACO2 (Aconitase 2, mitochondrial precursor), PEPD (Xaa-Pro dipeptidase), SPTAN (Nonerythroid alpha-spectrin), ACO1 (Aconitase 1), SELENBP1 (Selenium binding protein 1), ALDH9A1 (Glutathione S-transferase alpha-3), GLG1 (Golgi apparatus protein 1 precursor), SPNA2 (Alpha-spectrin 2), GDH1 (GDP dissociation inhibitor 1), GDDH (Glyceraldehyde 3-phosphate dehydrogenase) , SELENBP2 (Selenium binding protein 1), CCT2 (T-complex protein 1 subunit beta), AKR1B8 (Aldo-keto reductase family 1, member B8), PSMC2 (Proteasome 26S subunit, ATPase 2) and GDI2 (GDP dissociation inhibitor 2) And detecting mRNA encoding at least one protein selected from the group consisting of: &lt; RTI ID = 0.0 &gt;
delete 10. The method of claim 9, wherein the detection of the protein is performed by an antigen-antibody reaction using an antibody specific for the protein.

Images