KR101566084B1 - Din1 protein implicated in drought tolerance and the use thereof - Google Patents

Abstract

The present invention relates to a DIN1 protein related to dryness resistance of plants, and more particularly to a novel function of pepper DIN1 protein involved in abscisic acid (ABA) signal transduction and dry stress. The present invention provides a composition and an enhancing method for enhancing the dryness resistance of a plant using a red pepper DIN1 (CaDIN1) protein that plays a role of a voice regulator of abscisic acid signal transduction so that a plant can overcome harmful effects of stress , There is an effect that the tolerance to the drying of the plant can be controlled. Therefore, it is expected to be useful for the improvement of crops with high resistance to dry stress through the regulation of DIN1 expression.

Description

[0001] DRY RESISTANCE-RELATED PROTEIN DIN1 AND USE THEREOF [0002] DIN1 PROTEIN IMPLICATED IN DROUGHT TOLERANCE AND THE USE THEREOF [

The present invention relates to DIN1 protein related to dryness resistance of plants, and relates to a new function of red pepper DIN1 protein involved in abscisic acid signal transduction and dry stress.

Water scarcity is becoming a big problem globally and there are many areas where desertification is going on. This poses a serious problem for agriculture and the environment. Accordingly, it is necessary to develop a plant that can survive in a dry environment even if water is used in a small amount. When these techniques are developed and applied to crops, agricultural production is expected to increase significantly, especially in dry areas where plants with improved dry resistance are ideal. That is, plants capable of lowering the transpiration activity are advantageous in survival under dry conditions, and thus can contribute not only to improving agricultural productivity but also to environmental purification in highly dry environments.

Since plants are frequently exposed to a variety of environmental stresses such as drought, salt, cold, heat, pests and diseases, they have developed physiological, biochemical and molecular defense mechanisms to cope with the deleterious effects of stress, particularly abscisic acid : ABA) signal transduction regulation allows plants to overcome these stresses. It has been reported that plants pretreated with abscisic acid and stressed are more resistant to stress than plants that do not produce stress, while mutant plants that fail to produce abscisic acid or fail to respond to abscisic acid are known to be vulnerable to stress Taiz et al., Plant Physiology, 3rd edition: 543-555, 591-621). Therefore, it is expected that the use of proteins involved in the reaction of abscisic acid will enable to develop plants with improved resistance to environmental stress.

In the case of DIN, its function is still unknown, and it is known to play a role in the resistance to viruses in chloroplasts and mitochondria of plants and animals, and in the case of tobacco (Caplan et al., Cell, 132: 449- 462, 2008).

However, the ability of DIN1 to tolerate dry stress in plants is not yet known.

Therefore, the present inventors have completed the present invention by first finding that DIN1 protein of red pepper affects dryness resistance in plants.

Accordingly, it is an object of the present invention to provide a composition for promoting dryness resistance of a plant, which comprises as an active ingredient an expression or activity inhibitor of red pepper DIN1 protein.

Another object of the present invention is to provide a recombinant VIGS (Virus Induced Gene Silencing) vector comprising an ORF (open reading frame) of a gene encoding a pepper DIN1 protein, a plant transformed with said vector and having improved dry resistance, (In particular, seeds), and / or transforming plants with said vectors to silence the pepper DIN1 gene.

It is still another object of the present invention to provide a method for treating a candidate substance, which comprises treating a candidate substance to a plant, measuring the degree of expression of the red pepper DIN1 protein after treatment of the candidate substance, and comparing the degree of expression of the red pepper DIN1 protein with that of the candidate substance- And a step of selecting a candidate substance that has been reduced in the presence of the plant growth promoting agent.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the object of the present invention as described above, the present invention provides a composition for promoting dryness resistance of a plant comprising an effective amount of an expression or activity inhibitor of red pepper DIN1 protein as an active ingredient.

In one embodiment of the invention, the inhibitor may be selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, DNAzyme, peptide nucleic acids, antisense nucleotides, peptides, antibodies, have.

The present invention also provides a recombinant VIGS (Virus Induced Gene Silencing) vector containing an ORF (open reading frame) of a gene encoding pepper DIN1 protein.

In one embodiment of the present invention, the vector may be pTRV1 or pTRV2.

In addition, the present invention provides a plant transformed with the above-mentioned recombinant VIGS (Virus Induced Gene Silencing) vector to increase dry resistance.

In addition, the present invention provides a seed of a plant having the above-mentioned improved dryness resistance.

In addition, the present invention provides a method for promoting dryness resistance of a plant comprising transforming a plant with the recombinant VIGS (Virus Induced Gene Silencing) vector to silence the pepper DIN1 gene.

In one embodiment of the present invention, the method may include transforming Agrobacterium with the recombinant VIGS vector and infecting the transformed Agrobacterium into the plant.

Further, the present invention provides a method of screening a plant dry resistance enhancer comprising the steps of:

(a) treating the candidate material with a plant;

(b) measuring the degree of expression of the red pepper DIN1 protein after treating the candidate substance; And

(c) selecting candidates for which the degree of expression of the red pepper DIN1 protein is decreased as compared with the control group not treated with the candidate substance.

In one embodiment of the present invention, the degree of expression in step (b) may be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical analysis, RealTime- PCR, qRT-PCR, Western blotting, Northern blotting, and flow cytometry (FACS).

In addition, in one embodiment of the present invention, the pepper DIN1 protein may be composed of the amino acid sequence of SEQ ID NO: 1.

In another embodiment of the present invention, the plant is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats, sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feed crops including ragras, red clover, orchardgrass, alpha alpha, tall fescue, and penny al ragas.

The present invention relates to a composition and an enhancement method for enhancing plant dryness resistance using a pepper DIN1 (CaDIN1) protein that plays a role as a negative regulator in abscisic acid signaling (ABA) signaling that plays an important role in environmental stress of a plant , There is an effect that the tolerance to drying in plants can be controlled.

In particular, when the DIN1 protein is knocked down in the plant according to the present invention, the dry resistance of the plant is markedly improved.

Therefore, it is expected to be useful for the improvement of crops and the like which can be utilized by humans through the regulation of DIN1 expression.

1 compares the DIN amino acid sequences of DIN1 of pepper with Nicotiana tabacum (Tobacco), Medicago truncatula (Barrel_medic), Oryza sativa Japonica Group (Rice) and Zea mays (Maize).
Fig. 2 shows the expression of CaDIN1 gene in pepper leaves after 6 hours and 12 hours, respectively, in pepper at 100 [mu] M ABA, 200 mM salt (NaCl) and dehydration treatment.
FIG. 3 shows the resistance against dry stress in the leaves of pepper plants which silenced the expression of CaDIN1. FIG. 3a shows the expression of TRV2 (CaDIN1), which is an empty vector (TRV2: 00, control) (2 days, rewatering) after dehydration (12 days, before rewatering) of transformed pepper plants and FIG. 3b shows the result immediately after removing leaves (0 hours) and 24 hours And quantifying the lipid peroxidation by expressing the percentage increase of TBARS in each leaf as a percentage.
Figure 4 shows the reduced sensitivity to ABA of the CaDIN1-OX transgenic Arabidopsis line, Figure 4a is an image showing seedling germination of the wild-type and transfected lines exposed to 0.4 [mu] M ABA in 0.5X MS medium, 4b shows the percentage of green cotyledon seedlings of wild-type and transgenic plants exposed to 1.0 μM ABA for 10 days in 0.5X MS medium. FIG. 4C is an image showing seedling growth of wild-type and transgenic plants exposed to 1.0 μM ABA for 10 days, and FIG. 4D is an image showing the root length of the seedlings (WT: wild type (Col-0) CaDIN1 transgenic Arabidopsis plants).
Figure 5 shows the reduced resistance to the dry stress of the CaDIN1-OX transgenic Arabidopsis lines, Figure 5a shows the results of the dehydration of the wild-type and CaDIN1-OX transgenic plants before (above) Figure 5B shows the percentage of surviving plants after 3 days of rehydration of the dehydrated plants for 12 days. Figure 5C shows the ABA-treated wild type and CaDIN1-OX trait The pore openness in the transgenic plants was measured using a microscope.
FIG. 6 shows the expression of genes responsive to ABA in DIN1-OX mutants dehydrated for 12 hours by RT-PCR.

The present invention is characterized by providing a composition for promoting dryness resistance of a plant comprising as an active ingredient an expression and / or activity inhibitor of red pepper DIN1 (CaDIN1) protein.

The inventors of the present invention have been studying to discover new functions of non-biological stress of DIN1 and found that DIN1 gene is strongly induced in pepper leaves exposed to abscisic acid (ABA) and dry (dehydration) stress (See Example 2).

In this regard, in one embodiment of the present invention, silencing of the pepper DIN1 (CaDIN1) gene in pepper plants by Virus Induced Gene Silencing (VIGS) technique results in a low lipid peroxidation level in dehydrated leaves Respectively. In addition, overexpression of the CaDIN1 gene in Arabidopsis shows that the sensitivity to ABA is reduced in germination and seedling growth, so that CaDIN1 acts as a negative regulator of ABA signaling by suppressing leaf water loss in dry conditions (See Examples 3 to 5).

Accordingly, the present invention provides a composition for promoting dryness resistance of a plant comprising as an active ingredient an expression or activity inhibitor of red pepper DIN1 protein, wherein the inhibitor comprises a sequence of the pepper DIN1 gene, a sequence complementary to the sequence, (Small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, PNA (peptide nucleic acids), antisense Nucleotide, and is preferably any one of a compound, a peptide, a peptide mimetics, an antibody, or an aptamer which is complementary to the capsicum DIN1 protein to inhibit its activity But is not limited thereto.

The siRNA preferably comprises a sense sequence of 15 to 30 mers selected in the base sequence of the mRNA encoding the pepper DIN1 and an antisense sequence complementarily binding to the sense sequence, but is not limited thereto , The antisense nucleotide binds (hybridizes) to a complementary base sequence of DNA, immature-mRNA or mature mRNA to inhibit the flow of genetic information as a protein in the DNA, as defined in the Watson-click base pair. The antisense nucleotide Are long chains of monomeric units, they can be easily synthesized against the target RNA sequence. In addition, the peptide mimetics inhibit the binding domain of the capsicum DIN1 protein to inhibit the activity of the capsicum DIN1 protein. The peptide mimetics may be peptides or non-peptides, and psi binding (Benkirane, N., et al. J And may be composed of amino acids joined by non-peptide bonds, such as " conformationally constrained "peptides, cyclic mimetics (Biol. Chem., 271: 33218-33224, 1996) ), At least one exocyclic domain, a binding moiety (binding amino acid), and an active site. Peptide mimetics is structurally similar to the secondary structural features of the pepper DIN1 protein and has been shown to be an antibody (Park, BW et al. Nat Biotechnol 18, 194-198, 2000) or a water soluble receptor (Takasaki, W. et al. Nat Biotechnol 15, 1266 (Wrighton, NC et al., Nat Biotechnol 15, 1261-1265, 1997), which can mimic the inhibitory properties of a large molecule such as, for example, ). The antibody is a polyclonal or monoclonal antibody, preferably a monoclonal antibody. Antibodies can be produced using methods commonly practiced in the art, such as the fusion method (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), the recombinant DNA method (US Patent No. 4,816,56) Or phage antibody library methods (Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 58, 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley / Greene, NY, 1991, the disclosures of which are incorporated herein by reference. The aptamer is a single chain DNA or RNA molecule, which has high affinity and selectivity to specific chemical molecules or biological molecules by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment) (J. Tuerand L. Gold, Science 249, 505-510, 2005; AD Ellington and JW Szostak, Nature 346, 818-822, 1990; M. Famulok, et al. (Wilson and Szostak, Annu. Rev. Biochem. 68, 611-647, 1999), it is possible to specifically bind to the target to adjust the activity of the target, for example, , The ability of the target to function through coupling can be blocked.

In addition, the present invention is characterized by providing a recombinant VIGS (Virus Induced Gene Silencing) vector containing an ORF (open reading frame) of a gene encoding pepper DIN1 (CaDIN1) protein.

Virus-induced gene silencing (VIGS), a virus-induced gene silencing phenomenon, is also referred to as virus-induced RNA silencing. It is a kind of post-transcriptional gene silencing phenomenon well known in various plants and fungi, insects, nematodes, fishes, and rats. It is a kind of gene silencing phenomenon that occurs when a virus is invaded and replicated in a plant and the endogenous gene homologous to the viral genome is expressed in the infected plant. And the expression and replication of the viral genome are inhibited together. That is, when a part or the whole of a specific gene derived from a host is inserted into a cDNA of a viral genome, and the virus is infected with a plant by infectious RNA, the corresponding host RNA is targeted and the expression of the target gene is suppressed in the infected host plant It disappears. As a result, the function of the target gene can be indirectly estimated. The virus-induced gene silencing (VIGS) mechanism is known to be a type of RNA-mediated plant defense mechanism against viruses, characterized by 1) gene silencing after transcription, 2) RNA conversion, and 3) nucleotide sequence specificity.

In one embodiment of the present invention, the present inventors inserted the transforming vector TRV (Tobacco Rattle Virus) for VIGS into which the ORF region of CaDIN1 was inserted into Agrobacterium, and infected the Agrobacterium with the CaDIN1 gene, (See Example 3).

In the present invention, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. Recombinant cells can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used herein to refer to a DNA fragment (s), a nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. A preferred example of the recombinant vector in the present invention may be, but is not limited to, a plasmid vector, pTRV1 or pTRV2, capable of transferring a part of itself to a plant cell when present in a suitable host such as Agrobacterium tumefaciens , And other suitable vectors that can be used to introduce the DNA of the present invention into a plant host include viruses such as those that can be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, Vector, e. G., An incomplete plant viral vector. The vector can be advantageously used when it is difficult to transform a plant host properly. Further, in the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to a DNA upstream region from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

In addition, the present invention provides a plant transformed with the above-mentioned recombinant VIGS (Virus Induced Gene Silencing) vector to enhance dry resistance and / or seeds thereof.

In addition, the present invention provides a method for promoting dryness resistance of a plant comprising transforming a plant with the vector to silence the pepper DIN1 gene.

In the above, transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period, and the transformation of plant species is common to all plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for known protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. (Klein et al., 1987, Nature 327, 70), infiltration of plants or the transformation of Agrobacterium species by transformation of mature pollen or microparticles Infections caused by (non-integrative) viruses in Tuomorphisian mediated gene transfer (European Patent No. 0301316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery.

In the present invention, the most preferred method for enhancing the drying resistance of the plant is to transform Agrobacterium with a recombinant VIGS vector into which the ORF region of the gene encoding the CaDIN1 protein is inserted, and transforming the transformed Agrobacterium The method comprising infiltrating the plant.

Further, the present invention can provide a screening method for a plant dry resistance enhancer comprising the following steps.

Specifically, in the screening method,

(a) treating the candidate material with a plant;

(b) measuring the degree of expression of the red pepper DIN1 protein after treating the candidate substance; And

(c) selecting the candidates for which the degree of expression of the red pepper DIN1 protein is decreased as compared to the control group not treated with the candidate substance, but it is not limited thereto.

In this method, the degree of expression in step (b) may be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical analysis, RealTime-PCR, qRT-PCR (Water), or a protein encoded therefrom, which is known to a person skilled in the art, but is not limited thereto, and is preferably measured by any one of Western blotting, Northern blotting and flow cytometry (FACS) Of the total amount of < / RTI >

In addition, in the present invention, the DIN1 protein comprises a pepper DIN1 protein consisting of the amino acid sequence shown in SEQ ID NO: 1, and functional equivalents of the proteins. "Functional equivalent" means at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably at least 70% or more, more preferably 90% or more, Refers to a protein having a homology of at least 95% and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 1. "Substantially homogenous bioactivity" means activity against non-biological stress such as susceptibility to ABA, salt or drought (dehydration) in plants.

Also, in the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats and sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feed crops including rice grass, red clover, orchardgrass, alpha-alpha, tall fescue, and perennial rice, and most preferably rice straw or pepper.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Experimental Example ]

An embodiment of the present invention was carried out by the following conditions and methods.

1. Plant material and growth conditions

Capsicum annuum L., cv. Hanbyul seeds were prepared from steam sterilized blended soil (peat moss: perlite: vermiculite = 5: 3: 2, v / v / v), sand, and loam soil 1: 1: 1 (v / v / v). And white fluorescent intensity for 16 hours a day, 80 μmol photons m ^-2 s ^{- 1} was grown at 27 ± 1 ℃ room flashes the light.

Arabidopsis The seeds were germinated in MS medium (Murashige and Skoog agar) supplemented with 1% sucrose in a chamber set at 60% humidity, 16 hours day / 8 hour night cycle, and 24 ° C temperature. Arabidopsis seedlings peat moss: Perlite: Vermiculite a 9: 1: in a soil mixture in a proportion of 1 24 ℃ temperature, 60% humidity, a fluorescent lamp with day / night cycle conditions for 16 hours / 8 hours (130 μmol photons m ^-2 s ^-1 ) light.

2. ABA , Salt and dry stress treatment

First, for dry stress treatment, red pepper and Arabidopsis plants were carefully removed from the soil to avoid scratching and the plants were dehydrated on 3MM paper (Whatman, Clifton, UK). In addition, ABA treatment resulted in stratification of wild-type and CaDIN1-overexpressing (CaDIN1-OX) transgenic Arabidopsis seeds at 4 ° C for 2 days and seeding on plates containing MS agar medium supplemented with 0.4 μM or 1.0 μM ABA. For the germination test, 30 seeds per genotype were sown on each plate, and the number of seeds germinated after 3 days was counted. The seedlings were grown at 24 ° C / 21 ° C for 12 hours / 12 hours day / night cycles with light intensity conditions of 130 μmol photons m ^-2 s ^-1 .

In addition, two-week old wild-type and CaDIN1-OX transgenic Arabidopsis seedlings were randomly planted in a tray containing blended soil (peat moss: perlite: vermiculite = 9: 1: 1). In addition, dehydration stress was given to the 5-week-old plants by stopping watering for 12 days. The plants were again watered for 2 days to recover and the survival rate of plants with rehydrated green leaves was calculated. To quantitatively determine dry resistance, pepper and Arabidopsis leaves were removed from the plant and placed on a petri-dish. The Petri dish was placed in a growth chamber at 40% relative humidity, and the loss of fresh weight was measured at a fixed time, and the experiment was repeated three times.

The salt stress treatment and analysis was performed by planting the red pepper seedlings at random on a tray containing the blended soil (peat moss: pearlite: vermiculite: vermiculite = vermiculite = 9: 1: 1), treating the pepper plants with 6 mM of NaCl at a concentration of 200 mM, After 24 hours, sampling was performed to extract total RNA.

3. Northern Blot ( Northern blot ) analysis

Total RNA was extracted from pepper leaf tissues using a triazole reagent (Invitrogen, Carlsbad, Calif., USA). In order to analyze gene expression levels by Northern blotting, the same amount of RNA was separated from 1.2% formaldehyde-agarose gel to which EtBr (ethidium bromide) was added, and a nylon membrane (Hybond N ⁺ , Amersham, Little Chalfont, UK ). CaDIN1 cDNA was labeled with isotope ( ³² P) using a random primer kit (Boehringer Mannheim, Mannheim, Germany). Prehybridization and hybridization were performed at 65 ° C in 5% (w / v) dextran sulfate, 0.25 M disodium phosphate, pH 7.2, 7% (w / v) SDS and 1 mM EDTA solution. The membrane was washed with 0.1% SDS / 2x SSC solution twice at room temperature for 10 minutes each and then washed three times with 0.1% SDS / 0.1x SSC solution at 65 ° C for 5 minutes each. The hybridization blot was sensitized to X-ray film to confirm the result.

4. Stomatal aperture  Biological assay

For the bioassay, the leaf husks were harvested from 4-week-old plant rosette leaves and stained with a stomatal opening solution (SOS: 50 mM KCl, 10 mM MES-KOH, pH 6.15, 10 mM CaCl ₂ ). After 2.5 hours, the solution was replaced with an SOS solution containing 5 μM ABA and further incubated for 2.5 hours. Then, 60 pores were measured for each sample, and the experiments were performed independently three times.

5. Virus - induced gene silencing  ( VIGS )

A tobacco rattle virus (TRV) -based VIGS system was used according to a known method to knockdown the CaDIN1 gene in pepper (Kim et al., Plant J 72: 843-855, 2012). That is, an open reading frame (ORF) portion of CaDIN1 was inserted into the pTRV2 vector to construct pTRV2: CaDIN1. And pTRV1, pTRV2: 00, or pTRV2: CaDIN1 carrying Agrobacterium tumefaciens strain GV3101 was infiltrated into fully expanded cotyledons of pepper (OD ₆₀₀ = 0.2 for each strain). The plants were placed in a growth chamber at 26 ° C with a photoperiod set at 16 hours a day / 8 hours a night to allow growth and virus to spread. Six leaf stage CaDIN1 expression - silenced pepper plants were used for dry condition treatment and lipid peroxidation analysis.

6. Lipid Peroxidation Analysis

Lipid peroxidation levels were measured by measuring the concentration of thiobarbituric acid reactive substances (TBARS) formed by the reaction of MDA (malondialdehyde) and TBA (thiobarbituric acid), one of the byproducts of lipid peroxidation. The leaf samples (100 mg) collected from pepper and Arabidopsis were homogenized in a 20% trichloroacetic acid (w / v) solution containing 0.5% (w / v) TBA and heated at 95 ° C for 30 minutes. It cooled for 5 minutes. After centrifugation at 13,000 xg for 10 minutes, the absorbance of the supernatant was measured at 532 nm and 600 nm. Remove the specific absorbance in the absorbance at 532nm, 155 mM ^-1 cm ^{- -} ratio at 600nm was calculated the MDA concentration using the extinction coefficient of ^1, the average value of the results of the experiments at least three times independently Respectively.

7. RNA  Extraction and qRT - PCR

Total RNA was extracted from leaf tissues of Arabidopsis and Pepper plants using RNeasy Mini kit (Qiagen, Valencia, CA, USA). All RNA samples were digested with RNA-free DNase to remove genomic DNA. After quantification with a spectrophotometer, 1 μg of total RNA was used for cDNA synthesis using Transcript First Strand cDNA synthesis kit (Roche). At the same time, PCR was performed without reverse transcriptase, and PCR products were used for qRT-PCR to reaffirm genomic DNA contamination in cDNA samples. The synthesized cDNA was amplified using a CFX96 Touch ™ real-time PCR detection system (Bio-Rad, Hercules, CA, USA) together with iQTMSYBR Green Supermix and the specific primers shown in Table 1 below. All reactions were repeated three times. The PCR conditions were as follows: After heating for 5 minutes at 95 ° C, 45 cycles (95 ° C for 20 seconds, 60 ° C for 20 seconds, and 72 ° C for 20 seconds) repeat. qRT-PCR was performed at least twice each in biological and technical replicates. The relative expression level of each gene was calculated by the ΔΔCt method (Livak et al., Methods 25: 402-408, 2001) and three internal control genes (Actin 1, EF1α, 18s rRNA) Were used for normalization.

designation The sequence (5'-3 ') SEQ ID NO: CaDIN1-F ATCGTTATTTAGATGTCAGAACT 2 CaDIN1-R GTTGAATAAAAGGCTAATAATAG 3 RAB18-F GGAAGAAGGGAATAACACAAAAGAT 4 RAB18-R GCGTTACAAACCCTCATTATTTTTA 5 RD29A-F CACAATCACTTGGCTCCACTGTTG 6 RD29A-R ACCTAGTAGCTGGTATGGAGGAACT 7 RD29B-F GTTGAAGAGTCTCCACAATCACTTG 8 RD29B-R ATTAACCCAATCTCTTTTTCACACA 9 RD22-F CTTCAAAGTCTTAAAGGTGAAGCC 10 RD22-R TAACCAAAACATCCCAAAAGATAGA 11 RD26-F AGGTCTTAATCCAATTCCAGAGCTA 12 RD26-R ACCCATCAGTAACTTCACATCTCTC 13 DREB2A-F CTACAAAGCCTCAACTACGGAATAC 14 DREB2A-R AAACTCGGATAGAGAATCAACAGTC 15 CaACT1-F GACGTGACCTAACTGATAACCTGAT 16 CaACT1-R CTCTCAGCACCAATGGTAATAACTT 17 CaEF1a-F TTAAGGATCTTAAGCGTGGTTATGT 18 CaEF1a-R TCTTCAAGAACTTAGGCTCCTTCTC 19 Ca18SrRNA-F TATGGTGTGCACCGGTCGTCTCGT 20 Ca18SrRNA-R GCAGTTGTTCGTCTTTCATAAATCCAA 21

[Example 1]

DIN1 Sequence of Homology  analysis

To investigate the degree of similarity of the pepper DIN1 (CaDIN1) protein between plants, the present inventors used Nicotiana tabacum (accession no. BAA88985: Tobacco), Medicago truncatula (accession No. XP_003612270: Barrel_medic), Oryza sativa Japonica Group Accession No. BAD61695: Rice) and Zea mays (Accession No. ACG42699: Maize). As a result, as shown in FIG. 1, the DIN of the tobacco was 82.1% identical to that of Tobacco, and it was found that the order of tobacco was the most similar, and the homology with rice was the lowest.

[Example 2]

ABA , Salt and drying stress CaDIN1  Induction of gene

To investigate whether CaDIN1 expression is promoted by ABA, salt (NaCl) and dry stress, the present inventors prepared pepper plants treated with 100 μM ABA and 200 mM NaCl, respectively. The pepper plants were carefully removed from the pots and dehydrated (Dry) Stressed pepper plants were prepared. As a result, as shown in Fig. 2, expression of CaDIN1 gene was found to change in all treatment conditions. In particular, ABA and salt treatment showed an increase in expression level more than 12 hours after 6 hours of treatment, Treatment was increased after 6 hours of dehydration and then decreased significantly after 12 hours.

These results indicate that CaDIN1 is specifically involved in the response to ABA signal transduction, salt and dry stress.

[Example 3]

CaDIN1 - Silent  Improved resistance to drying stress of pepper plants

In order to investigate the role of CaDIN1 gene in response to dry stress, loss of CaDIN1 function in pepper was induced by VIGS technique. First, the pepper plants inoculated with the recombinant TRV silencing constructs (CaDIN1-silenced TRV vector) and the empty vector (control) were grown in pots for 5 weeks under normal growing conditions, then watering was stopped for 12 days, And watering (rehydrating). As a result, as shown in FIG. 3A, the pepper plant (TRV2: CaDIN1), which lost CaDIN1 function, was less prone to wilting than the control group when the water cycle was stopped and recovered from wilting even when rehydrated appear.

In this regard, lipid peroxidation occurs due to free radicals induced by drying while dry stress causes damage to plant cell membranes, resulting in the production of small hydrocarbon fragments, including MDA (malondialdehyde) Since it is known to be inversely related to dry stress resistance, the present inventors analyzed the induction of lipid peroxidation by measuring the accumulation amount of TBARS in the leaves of the inoculated plants. As a result, as shown in FIG. 3B, an increase percentage of the MDA concentration immediately after (0 hour) or after 24 hours of removal of the leaves was lower in the leaves of the plants infected with the CaDIN1-silenced vector compared to the plants infected with the empty vector .

This result implies that the CaDIN1 gene is related to the dry sensitivity in pepper plants.

[Example 4]

CaDIN1 Of the Arabidopsis mutant line overexpressing Reduced ABA  responsiveness

FIG. 2 confirms the role of CaDIN1 in ABA-mediated and stress-induced signal transduction systems by confirming that CaDIN1 gene is largely induced in pepper plants by ABA, salt or dry stress. Therefore, in order to examine the in vivo function of the CaDIN1 gene, the present inventors have found that transgenic Arabidopsis thaliana (CaDIN1-OX) overexpressing CaDIN1 using two independent T3 homozygous lines in the presence of a strong all-time expressing 35S promoter, Respectively. The CaDIN1-OX and wild-type Arabidopsis plants were germinated in 0.5X MS medium supplemented with 0, 0.4, or 1.0 μM ABA. As shown in FIG. 4A, the transgenic Arabidopsis phenotype As shown in FIG. 4B, when seeds of each plant germinate, the number of seedlings having green cotyledons was found to be larger in the CaDIN1-OX plants than in the wild-type plants. As shown in FIGS. 4C and 4D, the greening, kidney, and root growth of cotyledons mediated by ABA in the CaDIN1-OX plants were reduced.

This result implies that the sensitivity to ABA is decreased in Arabidopsis overexpressing CaDIN1 gene.

[Example 5]

CaDIN1  Reduced resistance to dry stress in transgenic plants

Overexpression of the CaDIN1 gene in Arabidopsis lines showed reduced resistance to drying. 5A and 5B, the CaDIN1-OX plants exhibited more wilting phenotypes when the soil was dried when the water cycle was interrupted for 12 days, and the number of recovered plants was increased by watering again for 3 days, Compared to -OX plants, they were much larger in wild type.

In addition, pore opening after ABA treatment was measured to see if the high rate of transcription in the transgenic plants caused low ABA sensitivity. As a result, as shown in FIG. 5C, when leaves were not treated with ABA, there was no difference in transparency between wild type and transgenic plants. However, when plants were exposed to 20 μM ABA, CaDIN1-OX trait The degree of pore blocking in the transgenic plants was lower than that of the wild plants.

In addition, in order to investigate whether the reduced ABA sensitivity of CaDIN1-OX transgenic plants in dry conditions affects the expression level of ABA and drying-responsive genes such as RAB18, RD29b, RD29a, RD26, DREB2A, and RD22, And CaDIN1-OX transgenic plants were subjected to qRT-PCR analysis and dehydration (dry) stress was applied to the two lines. As a result, as shown in Fig. 6, the expression amounts of RAB18, RD29b and RD29a were significantly lower in the CaDIN1-OX plants than in the wild type. The expression levels of RD26, DREB2A and RD22 were also slightly lower in CaDIN1-OX plants.

The results indicate that CaDIN1-OX plants are less resistant to ABA-mediated drying than wild-type plants.

From the above results, we found that when the expression of CaDIN1 is silenced in the dry stress, the loss of weight loss and MDA concentration are decreased, while when CaDIN1 is overexpressed, not only the weight loss and MDA concentration are increased but also the sensitivity to ABA is lowered, And that the recovery of fading was reduced, indicating that CaDIN1 was involved in plant response to dry stress.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> DIN1 PROTEIN IMPLICATED IN DROUGHT TOLERANCE AND THE USE THEREOF <130> PB13-11545 <160> 21 <170> Kopatentin 2.0 <210> 1 <211> 179 <212> PRT <213> Capsicum annuum L., cv. Hanbyul - DIN1 <400> 1 Met Arg Thr Ile Ser Leu Ser Ser Thr Ser Phe Ser Leu Leu Thr His   1 5 10 15 Ser Lys Ile Asn Gly Ser Ala Ser Leu Ile Pro Met Ala Arg Ser Gln              20 25 30 Phe Gln Pro Gln Arg Arg Arg Asn Ile Gly Thr Thr Ser Ser Arg Asn          35 40 45 Pro Asn Phe Ser Trp Met Ala Ala Val Gly Glu Lys Val Gln Ser Pro      50 55 60 Thr Val Pro Thr Ser Val Pro Val Val Ala Leu Glu Leu Leu Gln  65 70 75 80 Ala Gly His Arg Tyr Leu Asp Val Arg Thr Val Glu Glu Phe Ser Asp                  85 90 95 Gly His Ala Pro Gly Ala Ile Asn Ile Pro Tyr Met Phe Arg Ile Gly             100 105 110 Ser Gly Met Ile Lys Asn Pro Asn Phe Phe Ala Glu Val Leu Glu His         115 120 125 Phe Gly Lys Asp Asp Glu Ile Ile Val Gly Cys Gln Leu Gly Lys Arg     130 135 140 Ser Phe Met Ala Ala Thr Asp Leu Ala Ala Gly Phe Thr Gly Val 145 150 155 160 Thr Asp Ile Aly Gly Gly Tyr Ala Ala Trp Thr Glu Ser Gly Leu Pro                 165 170 175 Thr Glu Pro             <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CaDIN1-F <400> 2 atcgttattt agatgtcaga act 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CaDIN1-R <400> 3 gttgaataaa aggctaataa tag 23 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RAB18-F <400> 4 ggaagaaggg aataacacaa aagat 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RAB18-R <400> 5 gcgttacaaa ccctcattat tttta 25 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RD29A-F <400> 6 cacaatcact tggctccact gttg 24 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD29A-R <400> 7 acctagtagc tggtatggag gaact 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD29B-F <400> 8 gttgaagagt ctccacaatc acttg 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD29B-R <400> 9 attaacccaa tctctttttc acaca 25 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RD22-F <400> 10 cttcaaagtc ttaaaggtga agcc 24 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD22-R <400> 11 taaccaaaac atcccaaaag ataga 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD26-F <400> 12 aggtcttaat ccaattccag agcta 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RD26-R <400> 13 acccatcagt aacttcacat ctctc 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> DREB2A-F <400> 14 ctacaaagcc tcaactacgg aatac 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> DREB2A-R <400> 15 aaactcggat agagaatcaa cagtc 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaACT1-F <400> 16 gacgtgacct aactgataac ctgat 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaACT1-R <400> 17 ctctcagcac caatggtaat aactt 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaEF1a-F <400> 18 ttaaggatct taagcgtggt tatgt 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CaEF1a-R <400> 19 tcttcaagaa cttaggctcc ttctc 25 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ca18SrRNA-F <400> 20 tatggtgtgc accggtcgtc tcgt 24 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Ca18SrRNA-R <400> 21 gcagttgttc gtctttcata aatccaa 27

Claims (11)

A composition for promoting dryness resistance of a plant comprising, as an active ingredient, an expression or activity inhibitor of red pepper DIN1 protein,
The pepper DIN1 protein consists of the amino acid sequence shown in SEQ ID NO: 1,
Wherein the inhibitor is a recombinant VIGS (Virus Induced Gene Silencing) vector comprising an ORF (open reading frame) of a gene encoding pepper DIN1 protein.
The method according to claim 1,
Wherein said vector is pTRV1 or pTRV2. delete delete delete delete delete delete delete delete delete

Images