KR101546499B1 - 370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof - Google Patents

Abstract

The present invention relates to a method of breeding a high-yielding, high-yielding, high-yielding wheat shoot mill type Iksan 370 having a long ear and a large number of rips, and more particularly to a method of breeding with Xian 83 as a model, Iksan 370, a wheat germ line, and a breeding method thereof. The 'Iksan 370' according to the present invention is grown faster than the 'Xian 83' in the domestic environment and has a larger number of ripples than the 'Geumgang' By reducing the production cost per area, it can contribute to the industrialization of domestic wheat by securing price competitiveness, and it can improve the self-sufficiency rate of food through the development of multi-modal wheat varieties and improve the farm income.

Description

[0001] The present invention relates to a method for breeding large-diameter hard wheat shoots of high yield and hard wheat and breeding method,

The present invention relates to a method for breeding a high-yielding, high-yielding, high-yielding, high-yielding, high-ripening, high-yielding wheat shoot type mill Iksan 370 and its breeding method.

As western eating habits have become commonplace in Korea, domestic wheat consumption has exceeded 4 million tons per year and wheat consumption per capita has also increased significantly. As a result, wheat is the next most popular grain in Korea, accounting for about 25% of the total grain consumption, but the domestic self-sufficiency rate of wheat is only 2.2% In Canada and other countries, about 4 million tons are imported annually and about $ 1,064 million is being paid to these countries (Agriculture, Forestry and Fisheries Statistics Yearbook, 2012).

The average yield per unit of domestic 10a is 335kg (as of 2011) and the yield per unit area is low. In 2013, the wheat purchase price is 36,000 won (900 won / kg) per 40kg, 2.7 times higher than imported wheat (329 won / kg) (Agriculture, Forestry and Fisheries, Statistical Yearbook, 2012).

Due to recent changes in government policy and consumer consciousness, domestic wheat cultivation area and production volume are gradually increasing, but the price competitiveness is lowered by more than twice the price of imported wheat. Therefore, in order to improve the competitiveness of domestic wheat, it is very important to guarantee the income of farmers and processors. Therefore, it is necessary to develop wheat varieties different from existing ones. In other words, it is necessary to develop an innovative multi-grain wheat variety that can reduce the production cost of the production farm by increasing the production per unit area, and the processing company can produce the domestic wheat product at a low price.

Therefore, the present inventors have made intensive efforts to develop a new wheat wheat which shows high yield characteristics with increasing yield, and as a result, it has been found that when Xian 83 is used as an example, , And that the system having a high number of ribs and having a hard-wheat characteristic is breeded, and the present invention has been completed.

It is an object of the present invention to provide a method for producing a hybrid of the present invention, which is based on Xian 83 as an example, hybridized with a goldsmith mill as a duplicate, and has a long ear, a large number of rips, Method.

As one embodiment for achieving the above object, the present invention provides a method of producing a hybrid seedlings comprising Xian 83 as an example, crossing with a goldsmith mill as a duplicate, picking a plurality of generations from the hybrid, It provides breeding methods of 'Iksan 370'.

Specifically, the method of breeding the 'Iksan 370' of the present invention is as follows.

First, a hybrid (F ₁ , IW20050259) was cultivated by artificial interbreeding of 'Xian 83', a collecting species of CIMMYT in Mexico, and 'Geomang Mill (IT213100)', a multipurpose wheat variety . (F ₂ ) seeds generated from the seeds of the hybrids (F ₁ ) were developed by the general group breeding method, and the lines with favorable cold tolerance were selected. The hybrid third generation (F ₃ ) A total of 67 strains with long and large rips were selected. The fourth generation (F ₄ ) seeds of the selected plants were disclosed to general seedling breeding, and the selection was made based on a strong lineage with a good grass shape, a long ear, a large number of rips, Respectively.

IW20050259-BBB-9-55-4-1, which has a high cold tolerance and a high degree of tolerance, was reported to the production test in 2013, and its growth characteristics, physiological disorders, disease resistance, tolerance, It was named "Iksan 370" because of its superior characteristics.

The 'Geumgangmil' used in the present invention is a new variety cultivated by the Rural Development Administration and is widely used in Korea. It is an easily obtainable variety and the yield is 393 kg / 10a on average.

In addition, 'Xian 83' used as a prototype in the present invention has a longer ear and a larger number of ripples than a domestic wheat variety, but has a characteristic that it is not suitable in domestic environment because it is about three weeks later than the Kumgang wheat.

The 'Iksan 370' of the present invention, like the 'Xian 83' of the parent, has a long ear and a large number of ribs.

As another embodiment of the present invention, there is provided a wheat germ line Iksan 370 obtained by the breeding method.

The breeding process of 'Iksan 370' of the present invention is as described above.

The novel wheat flour 'Iksan 370' of the present invention may have the following botanical characteristics, but is not limited thereto.

Specifically, vernalization of type II; Wide and long leaves of green; Medium yellow stalks; Spindle white spine; Medium-sized casks; Medium-size earning system; A plant length of 90 to 100 cm; 90 to 100 cm of liver; 7 to 11 tangles; Three to seven valid tuples; A stem diameter of 4.5 to 5.5 mm; 17 to 23 total number of leaves; A leaf width of 180 to 210 cm ² ; A length of a paper sheet of 25 to 30 cm; A sheet width of 1.5 to 2.3 cm; A lateral width of 10 to 20 cm ² ; A photosynthetic efficiency of 0.6 to 0.9; Heading for May 13-14; A movie about May 17; Maturity of 13-15 June; A spike length of 13 to 18 cm; A calace length of 5.7 to 7.0 cm; Ribs per 50 or more heads; Among 780 to 830 grams of liters; 44 to 45 grams of ginseng; 660 kg / 10a or more of full-grain yield; Manure yield of more than 440 kg / 10a; A seed length of 6.5 to 7.0 mm; A seed width of 3.0 to 4.0 mm, a seed thickness of 2.8 to 3.2 mm; A roundness of 1.7 to 1.9; 75% or more milling fraction; Ash content of 0.5% or more; A protein content of 13% or more; A gluten content of 13% or more; More than 75 ml of sediment; Flour particle size greater than 72μm; A granule-bound starch synthase (GBSS) gene of wild type Wx-A1, Wx-B1 and Wx-D1; A 685 bp size PPO18 gene (dark wheat flour); The wild-type Pina-D1 gene and the mutant Pinb-D1 gene; A leaf length of less than 0.5 cm; A solids content of less than 3%; And a water germination rate of less than 15%, but is not limited thereto.

"Iksan 370" of the present invention was deposited at the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science, Gyeonggi-do, Suwon-dong, Gyeonggi-do, on August 6, 2013 with the deposit number K218462 and the same seed was deposited on October 18, No. KACC98034P, which has been patented, it is readily available through the above-mentioned institutions.

The 'Iksan 370' of the present invention is characterized by having higher yield and higher toughness at the same time while maintaining the characteristics of Kum River flour varieties. Therefore, it is possible to provide a new type strain superior to the existing wheat varieties Accordingly, 'Iksan 370' may be used for reproductive and processing purposes.

The development of Iksan 370 of the present invention, which has a long ear and a large number of ripples, has a great potential for quantitative contribution, contributing to the industrialization of domestic wheat by securing price competitiveness by reducing the production cost per unit area, Increased food self-sufficiency through rescue and farm income can be improved.

Fig. 1 is a diagram showing a breeding process of a new strain mill 'Iksan 370'.
2 is a systematic view of a new line mill Iksan 370. Fig.
FIG. 3A is a photograph of 'Iksan 370' and Kumgang wheat.
FIG. 3B is a diagram showing a growth curve of 'Iksan 370' and a steel mill.
FIG. 4A is a photograph of the 'Iksan 370' and the ear of the head of Kumkang wheat.
FIG. 4B is a photograph of the 'Iksan 370' and the ears of mature stage of Kumgang wheat.
Fig. 5 is a photograph showing the ears and prime numbers of a steel mill.
FIG. 6 is a photograph of the ears and a few of the 'Iksan 370'.
Fig. 7 is a diagram showing the result of preliminary test of productivity test carried out in the previous work and the work of Kumkang wheat and 'Iksan 370'.
8A is a photograph showing the seed shape of 'Iksan 370'.
Fig. 8B is a photograph showing a seed form of a silver alloy mill.
9 is a diagram showing the particle size and volume of flour of 'Iksan 370'.

Hereinafter, the present invention will be described more specifically in the following examples. However, these examples are provided only to aid understanding of the present invention, and the present invention is not limited thereto.

Example  1: Breeding process

In order to increase the wheat yield, the sample of Xian 83, a collection of the CIMMYT, which is late in maturity but has a long ear and a large number of rips, is used as a model. It is a fast and versatile variety of wheat (IT213100 ) Was artificially mated with a duplicate to foster the IW20050259 combination.

(F ₂ ) seeds generated from the seeds of the hybrids (F ₁ ) in the test packaging of the National Institute of Food Science and Technology (Iksan, Jeollabuk-do) were analyzed by the general group breeding method at the Unbong Branch of the National Institute of Food and Nutrition (Namwon, Jeollabuk- Were selected. The hybrid third generation (F ₃ ) group was cultivated in the test package of the National Institute of Food Science and Technology and selected 67 species with long and large ripeness. Fourth generation (F ₄ ) seeds were selected by general systematic breeding method, and the selection was made on the basis of strong lineage system which was good in herbaceous form and had long ears and large number of ripples. IW20050259-BBB-9-55-4-1, which has a strong cold resistance and high yield, was reported to the productivity test in 2013, and its growth characteristics, physiological disorders, disease resistance, tolerance, And the name of the system was given to 'Iksan 370'.

"Iksan 370" of the present invention was deposited at the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science, Gyeonggi-do, Suwon-dong, Gyeonggi-do, on August 6, 2013, with deposit number K218462, and deposited with the same institution on October 18, No. KACC98034P. Fig. 1 and Fig. 2 show the process of cultivation.

Example  2: ' Iksan 370 Analysis of Growth Characteristics

The test of productivity of 'Iksan 370' was conducted in 2013 under the previous work and working conditions in the paddy field of the National Institute of Food Science and Technology. The results of this study are as follows: 1) The characteristics of growth, physiological, physiological, tolerance, tolerance, mildew, red fungus and yield were investigated. (National Seed Management Office, Ministry of Agriculture and Forestry, 2000).

Example  2-1: Unique characteristics

System and
Breed name Wave Leaf stem ear beard strain color width chapter color thickness color shape color Length size color Iksan 370 II green broadness Longitude Yellowish white middle Yellowish white Fusiform Yellowish white middle middle Red Kum river mill II green middle middle Yellowish white middle Yellowish white Fusiform Yellowish white middle middle White

Regarding the intrinsic properties, as shown in Table 1, 'Iksan 370' is of type II, and its color is green and its width is broad and long compared with that of gold. The stem is medium in thickness, the ears are fusiform, and the sac is medium. Seed size was medium and seed color was different from that of gold - milled white - ground system.

Example  2-2: Stem and Tribological characteristics

System and
Breed name Plant height
(cm) Soy sauce
(cm) Total hard water / week Effective water / week Length (cm) Stem diameter
(mm) Iksan 370 96 95 9 5 40.8 20.1 11.3 9.1 3.5 5.02 Kum river mill 76 79 12 9 36.6 19.2 10.4 3.4 0.0 4.35

Stem and tangle characteristics are shown in Table 2 above. Specifically, the plant length of 'Iksan 370' is 96cm, which is 20cm longer than Kum River. The growth curve formed an S-shaped curve (Fig. 3) and began to grow from March 20, when the temperature rose after wintering, peaking on May 26 last year (May 14).

The stem length (soy sauce length) of 'Iksan 370' was 95cm, 16cm longer than that of Kum River, and the total number of tins per week was 9, which was 3 less than that of Kum River. The length of the first node under the ears was 40.8cm, the longest was 43% of the total length of the liver, the length of the second node was 20.1cm, the third node was 11.3cm, Was 9.1 cm, and the fifth node was 3.5 cm. The stem diameter of the third node above was 5.02mm, 'Iksan 370', which was thicker than Kumkang wheat.

Example  2-3: Leaf and photosynthetic efficiency analysis

System and
Breed name Plant The ground game
(every) Leaf area
(cm ² ) Length
(cm) width
(cm) Leaf area
(cm ² ) Photosynthetic efficiency
(Fm / Fv) Iksan 370 20 193.1 28.14 1.84 14.78 0.83 Kum river mill 31 78.8 17.80 0.90 4.46 0.82

The photosynthetic efficiency of leaves and leaves is shown in Table 3 above. Specifically, the total number of leaves per week of Iksan 370 was 20, which was 11 fewer than that of Kum river, but the leaf area was 193.1 cm ² , 2.5 times (114.3 cm ² ), which is long and wide in Iksan 370 Means that. Leaf length of the paper is longer than a 10.34cm by 28.14cm Geum mill, the width was about twice wider than Geum mill to 1.84cm, leaf area is about 3.3 times (10.32 cm ²⁾ was broader than Geum mill to 14.78cm ^2. The photosynthetic efficiency was 0.83, which was slightly higher than that of gold.

Example  2-4: Analysis of heading and maturity

culture
Condition Head Office (Mon. Sun) Blower (Mon. Sun) Maturity (Mon. Sun) Iksan 370 Kum river mill Iksan 370 Kum river mill Iksan 370 Kum river mill Previous work 5.14 5. 4 5.17 5.11 6.15 6.6 Copycat 5.13 5.5 5.17 5.12 6.13 6.6

As shown in Table 4 above, heading and maturity were performed at the National Institute of Food Science and Technology, Pyeongtaek,

The heading was late on May 14th and May 13th respectively under the former work and the previous work condition, respectively, 10 and 8 days later than Kum river. The film was delayed 5 to 6 days later than the Kumgang wheat on May 17th in the previous film and apprenticeship, but the period from heading to filming was shorter than the Kumgang mill (7 days) for 3-4 days. The maturity period was June 15th and June 13th, respectively, in the previous works and the previous works, respectively, which were 7 ~ 9 days longer than the Kum river. The Iksan 370 was a late-mature species that was late in maturity. The heading and mature stage of 'Iksan 370' is slower than that of Kum River but it is faster than Xian 83 and can be cultivated under domestic environmental conditions.

Example  2-5: Analysis of grain and yield component

Cultivation condition System and
Breed name The length of the ears
(cm) The length of the rock
(cm) Per spike
Number of Ribs per m ²
Sorghum Liter
(g) Heavenly
(g) Previous work Iksan 370 15.3 6.2 59 661 811 44.6 Kum river mill 7.0 5.5 34 1,139 823 44.9 Copycat Iksan 370 15.6 6.6 53 728 791 44.7 Kum river mill 7.0 4.8 31 692 833 44.4

The grain and yield components are as shown in Table 5 and Figures 4 to 6 above. The length of the ears was 15.3cm and 15.6cm respectively in the previous works and the masterpieces. The small number of Kumkang mill is usually about 12, but Iksan 370 is 18 more than Kumkang wheat. The length of the carac was 6.2 cm and 6.6 cm, respectively, longer than that of the goldsmith at the previous work and the work condition. The number of ripples per ears was 59 and 53 in the previous works, respectively, and 22 to 25 more than the Kum river. Liter was slightly less than that of Kum River, and the weight of ginseng was 44.6g in each of the previous works and the other works.

Example  2-6: Quantitative analysis

The result of the preliminary test of productivity test conducted in the previous work and the work is shown in Fig. In the previous work, the yield was 661kg / 10a, which was 34% higher than that of gold alloy mills, and 52% at 443kg / 10a.

Example  2-7: Analysis of seed characteristics

The SeedCount (SeedCount Co. Australia) was used to analyze the seeding characteristics, mouth width, mouth thickness, and roundness.

System and
Breed name Entrance
(mm) Mouth width
(mm) Mouth thickness
(mm) Won-do
(ratio) Iksan 370 6.73 3.50 2.95 1.81 Kum river mill 6.76 4.33 2.95 1.82

Seed characteristics are shown in Table 6 and FIG. The length and thickness of the seeds were 6.73mm and 2.95mm, respectively. The width of the seed was 3.50mm, which was 1mm less than that of the steel mill.

Example  3: ' Iksan 370  Quality analysis

For the quality analysis, Buhler mill was used for milling, moisture, ash and protein content of wheat flour were measured according to AACC method (2000) 44-15A, 08-01 and 46-30 respectively. The gluten content was determined by the ratio of total gluten weight at 10 g of wheat flour and the gluten extraction was measured according to AACC method (2000) 38-10. Particle size index (PSI) of wheat flour was measured using a Laser Diffraction Particle Size Analyzer (Becman LS13320, Germany). The dough characteristics were measured according to the AACC method (2000) using a 10 g Mixograph (National Mfg. Co. USA). The brightness, redness and yellowness of the wheat flour were measured using Minolta JS-555 (Minolta Camera Co., Japan) and the values were measured as L * (brightness), a * (redness) and b * (yellowness) Respectively.

System and breed name Flour fraction (%) Ash
(%) protein
(%) gluten
(%) Precipitant
(ml) particle
size
(um) Flour color brightness
(L *) Redness
(a *) Yellowness
(b *) Iksan 370 75.46 0.57 13.53 13.55 77.5 72.91 90.47 -0.35 7.27 Kum river mill 73.39 0.41 11.82 8.90 60.0 71.57 91.43 -0.88 9.94

System and
Breed name HMW-GS
Glu - D1 Mickogram Quantity of water
(%) Kneading time
(min) Dough resistance
(mm) Iksan 370 5 + 10 65.0 5.38 18.0 Kum river mill 5 + 10 60.0 5.38 17.5

As a result, the quality characteristics are as shown in Tables 7 and 8 above. The milling rate of Iksan 370 was 75.46%, which was more than 2% higher than that of Kumkang wheat and the ash content was 0.57% higher than that of Kum river. Protein content was 13.53%, which was higher than that of gold - milled wheat flour. The gluten content and sedimentation rate, which are qualitative characteristics, were 13.55% and 77.5ml, respectively. The mean size of flour was 72.91 ㎛, which was larger than that of gold. The distribution of wheat flour (Fig. 9) showed the same tendency as that of commercially available wheat flour. The brightness of the flour was 90.47, which was darker than that of the gold mill, which was judged to be dark due to high ash content, gluten and protein content. Among the high molecular weight glutenin compositions associated with baking aptitude, Glu-D1 was 5 + In the flour dough characteristics, the amount of water was 65.0%, which was higher than that of gold. The dough time was 5 minutes and 38 seconds, and the dough stability was similar to 18.0mm.

Example  4: Iksan 370  Analysis of quality related genetic characteristics

Genomic DNA polymerase chain reaction (PCR) was performed to confirm the quality related genetic characteristics of Iksan 370. Genomic DNA extraction was performed using SolGent's Genomic DNA Extraction Kit for plant. That is, the young leaves of the plants were cut and quenched with liquid nitrogen, and then pulverized until fine powder was obtained. Immediately after grinding, 300 μl of extraction buffer was added and mixed well with the ground powder. Then, the reaction was carried out in a constant temperature water bath at 65 ° C for 30 minutes and then centrifuged at 13,000 rpm and 4 ° C for 20 minutes. After centrifugation, the supernatant was transferred to a new tube, 300 μl of isopropyl was added, and the DNAs were pooled by slow mixing. After centrifugation at 13,000 rpm for 5 minutes, the supernatant was removed, and 50 μl of 80% ethanol was added thereto. After washing, the mixture was centrifuged at 13,000 rpm for 5 minutes, and the ethanol was removed. The pellet was dried at room temperature, and sterilized distilled water was added to dissolve the pellet. The extracted DNA was quantitated using Nano drop.

The characteristics of Glu-D1 among the polymer gluten characteristics contained in the seeds were determined by the method of Appelbee et al. (2009), PPO genetic characteristics related to the polyphenol oxidase activity of the seeds, Sun et al. (2005) Nakamura et al. (2002) genetic characteristics of GBSS I, and genetic characteristics of puroindolines related to seedling hardness were performed according to the method of Chen et al. (2007).

Specifically, granule-bound starch synthase (GBSS) is an enzyme that polymerizes sugar molecules produced by photosynthesis to form amylose, a form of stored carbohydrate, which can be distinguished by analysis of amylose content. There are Wx-A1, Wx-B1 and Wx-D1 for each genome in wheat. PPO is a polyphenol oxidase, which catalyzes the reaction of oxidizing phenol to form quinone, which causes enzyme browning. Therefore, the color brightness of wheat flour may vary depending on the content of the enzyme. Puroindolines are starch particle binding proteins of wheat, which determine the hardness of seeds such as soft wheat or hard wheat.

These genes are all known genes and can be obtained from known databases such as GenBank of the National Institutes of Health such as Wx-A1 (AB737985), Wx-B1 (AB426607), Wx-D1 (AF113844.1), PPO18 EF07148), Pina-D1 (AB177392) and Pinb-D1 (AB180737).

PCR was used ^{(Applied Biosystem, USA) Veriti ®} Dx96-WellThermalCycler. For wheat quality-related gene sequence-specific molecular markers, PCR was performed with 100 ng of genomic DNA, 0.5 mmol / l of primers, 2.0 mmol / l of MgCl ₂ and dNTPs, and Taq polymerase (GenetBio Prime DNA polymerase, Korea) was used as a unit and the total reaction volume was 25 μl. The PCR reaction was carried out at 94 ° C for 5 minutes, followed by amplification at 94 ° C for 30 seconds, annealing at 30 ° C for 30 seconds and 72 ° C for 35 seconds, The final elongation reaction was carried out at 72 ° C for 10 minutes. The PCR product was electrophoresed in a 2.0% agarose gel containing EtBr (0.5 μg / ml) at 100 V for 2 hours and then confirmed on a UV transilluminator (Table 10).

System and
Breed name GBSS ^{One )} PPO18 ^{2 )} Puroindolines Wx -A1 Wx -B1 Wx - D1 Pina - D1 Pinb - D1 Iksan 370 a a a 685bp a ^{3 )} b ^{4 )} Kum river mill a a a 685bp a b

¹⁾ GBSS: amylose synthesis gene, ²⁾ PPO18: Polyphenol oxidizing activity gene, ³⁾ a = general type ^{(wild type), 4) b} = variant (mutant)

Marker name SEQ ID NO: Primer sequence Annealing
Temperature (℃) Product size (bp) Number of expression bands Glu - D1 One
2 F: CGTCCCTATAAAAGCCTAGC
R: AGTATGAAACCTGCTGCGCAC 59 450 1 or 0 Wx -A1 3
4 F: CCGCGCTTGTAGCAGTGGAAGTACC
R: TCGTGTTCGTCGGCGCCGAGATGG 65 389 1 or 2 Wx -B1 5
6 F: CTGACGTCCATGCCGTTGACGA
R: CTGGCCTGCTACCTCAAGAGCAACT 55 425 2 or 3 Wx - D1 7
8 F: ACAGGATCTCTCCTGGAAG
R: GCAAGGAAAATAGTGAAGC 55 850 or
251 One PPO18 9
10 F: CTGCTGGCTCTTCTTCCCA
R: AAGAAGTTGCCCATGTCCGC 62 876 or 685 One Pina - D1 11
12 F: ATGAAGGCCCTCTTCCTCA
R: TCACCAGTAATAGCCAATAGTG 58 447 1 or 0 Pinb - D1 13
14 F: ATGAAGACCTTATTCCTCCTA
R: TCACCAGTAATAGCCACTAGGGAA 58 320 or 200 One

As a result, as shown in Tables 9 and 10, GBSS (granule-bound starch synthase) related to the amylose content of the quality-related genes showed a similarity to that of A-type and A-type in the A, B and D genomes PPO18 , which is related to polyphenol oxidase activity, showed a band expression of 685 bp , indicating that the brightness of the flour was slightly darker than that of the case of the kumquam wheat. In puroindolines related to seedling hardness, hard wheat characteristics such as diamond strength were observed in Pina - D1 and Pinb - D1 . It is considered that the genetic characteristics related to quality are the same as those of kumquang wheat.

Example  5: ' Iksan 370  Assessment of disaster resistance

Cold resistance was evaluated at the Unbong Test Center of the National Institute of Food Science and Technology (Namwon, Jeonbuk). For the resistance test of red fungus, Fusarium Graminearum was used as the inoculation method. Type I method using spray when spraying flowers after heading and Type II method using syringe were used. FHB severity was assessed as a percentage of the number of diseased wines in the total number of wines. The powdery mildew resistance test was performed by Bluemeira Graminis was used for the inoculation method and the seedling stage and adult stage were investigated. In the seedlings test, the degree of resistance was classified as O, R, M, S, and adult test was divided into 0 ~ 9 grades. The avalanche resistance test was carried out for about 35 days after heading, and the ratio was expressed as the ratio of the total number of wrinkles to the total number of wrinkles after 7 days in the dark room where the saturation humidity was maintained at 100%.

System and breed name Cold resistance Red mold
Disease rate (%) Powdery mildew Germination rate (%) A leafy leaf
(cm) Solid leaf rate
(%) TypeI TypeII Seedlings adult Iksan 370 0.3 2.5 73.0 87.7 Midway One 13.9 Kum river mill 1.8 14.0 55.2 81.1 Lee Byung-sung 5 31.6

As a result, the disaster resistance was as shown in Table 11 above. As a result of the cold tolerance test conducted at Ungong Branch of the National Institute of Food Science, In other words, 'Iksan 370' had a low leaf height of 0.3cm and a low leaf rate of 2.5%. Resistance of red mold was 73.0% and 87.7% in Type I and Type Ⅱ, respectively. The resistance to powdery mildew disease showed moderate resistance in the seedling stage and in the adult test, it was more resistant than Kumkang wheat. The water germination rate was 13.9%, which was stronger than that of gold mild wheat.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, and all changes or modifications derived from the equivalents thereof will be included in the scope of the present invention.

National Institute of Agricultural Science K218462 (general deposit) 20130806 National Institute of Agricultural Science KACC98034P (Patent Deposit) 20131018

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) &Lt; 120 > A new plant type wheat ' Iksan370 ' with long spikes, high yield and          hard wheat and breeding method thereof <130> PA130789 / KR <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1 forward primer <400> 1 cgtccctata aaagcctagc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1 reverse primer <400> 2 agtatgaaac ctgctgcgca c 21 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Wx-A1 forward primer <400> 3 ccgcgcttgt agcagtggaa gtacc 25 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Wx-A1 reverse primer <400> 4 tcgtgttcgt cggcgccgag atgg 24 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Wx-B1 forward primer <400> 5 ctgacgtcca tgccgttgac ga 22 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Wx-B1 reverse primer <400> 6 ctggcctgct acctcaagag caact 25 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wx-D1 forward primer <400> 7 acaggatctc tcctggaag 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wx-D1 reverse primer <400> 8 gcaaggaaaa tagtgaagc 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPO18 forward primer <400> 9 ctgctggctc ttcttccca 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPO18 reverse primer <400> 10 aagaagttgc ccatgtccgc 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Pina-D1 forward primer <400> 11 atgaaggccc tcttcctca 19 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Pina-D1 reverse primer <400> 12 tcaccagtaa tagccaatag tg 22 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Pinb-D1 forward primer <400> 13 atgaagacct tattcctcct a 21 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Pinb-D1 reverse primer <400> 14 tcaccagtaa tagccactag ggaa 24

Claims (5)

'Iksan 370', a milky line deposited with KACC 98034P, characterized by having a long grain and a large number of ripples and having all of the following characteristics:

i) Botanical characteristics
Height: 90 to 100 cm
Leaf color: green
Number of leaves: 17 to 23
Leaf area: 180 to 210 cm ²
Length of ear: 13 to 18 cm
Length of the rock: 5.7 to 7.0 cm
Ribs per ear: 50 to 70
Length of paper: 25 to 30 cm
Paper width: 1.5 to 2.3 cm
Area of the sheet: 10 to 20 cm ² ;
ii) Hybrid with Xian 83 as an example and a gold mine as a duplicate; And
iii) has a granule-bound starch synthase (GBSS) gene of wild type Wx-A1, Wx-B1 and Wx-D1, a PPO18 gene of 685 bp size, a wild type Pina-D1 gene and a mutant Pinb-D1 gene.
delete delete delete Xian 83 as an example and hybridizing with a goldsmith mill as a copy;
Selecting a line having a favorable cold tolerance among the separated generations (F ₂ ) generated from the spike of the plant of the hybrid (F ₁ );
Collecting the third generation (F ₃ ) of the selected plants to select a line having a long egg and a large number of rips; And
The disclosure of the fourth generation (F ₄₎ Seeds of the selection of the plant in the packaging by the strain breeding, Isaac long, often the number of ribs, comprising the steps of: selecting a strong system for lodging (倒伏), characterized in, A method of breeding the milky line "Iksan 370" deposited with KACC98034P.

Images