KR101546499B1 - 370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof - Google Patents
370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof Download PDFInfo
- Publication number
- KR101546499B1 KR101546499B1 KR1020130120136A KR20130120136A KR101546499B1 KR 101546499 B1 KR101546499 B1 KR 101546499B1 KR 1020130120136 A KR1020130120136 A KR 1020130120136A KR 20130120136 A KR20130120136 A KR 20130120136A KR 101546499 B1 KR101546499 B1 KR 101546499B1
- Authority
- KR
- South Korea
- Prior art keywords
- iksan
- wheat
- breeding
- gene
- length
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
- A01H6/4678—Triticum sp. [wheat]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
- A01H1/021—Methods of breeding using interspecific crosses, i.e. interspecies crosses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Physiology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Animal Husbandry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
본 발명은 이삭이 길고, 립수가 많은 다수확 경질밀 신초형 밀 ‘익산 370호’ 및 이의 육종방법에 관한 것으로서, 보다 구체적으로는 Xian 83을 모본으로 하고, 금강밀을 부본으로 하여 교잡한 것을 특징으로 하는 밀 신계통 ‘익산370호’ 및 이의 육종방법에 관한 것이다. 본 발명에 따른 ‘익산370호’는 모본인 ‘Xian 83’보다는 숙기가 빨라 국내 환경에서 재배가 가능하고, 부본인 ‘금강’보다는 이삭이 길고 립수가 많아 수량적 잠재요소가 매우 크므로, 단위 면적당 생산비 절감으로 가격 경쟁력 확보를 통한 국산밀 산업화에 기여하고, 초다수성 밀 품종 개발을 통한 식량 자급률 제고 기반 구출 및 농가소득이 향상될 수 있다.The present invention relates to a method of breeding a high-yielding, high-yielding, high-yielding wheat shoot mill type Iksan 370 having a long ear and a large number of rips, and more particularly to a method of breeding with Xian 83 as a model, Iksan 370, a wheat germ line, and a breeding method thereof. The 'Iksan 370' according to the present invention is grown faster than the 'Xian 83' in the domestic environment and has a larger number of ripples than the 'Geumgang' By reducing the production cost per area, it can contribute to the industrialization of domestic wheat by securing price competitiveness, and it can improve the self-sufficiency rate of food through the development of multi-modal wheat varieties and improve the farm income.
Description
본 발명은 이삭이 길고, 립수가 많은 다수확 경질밀 신초형 밀 ‘익산 370호’ 및 이의 육종방법에 관한 것이다.
The present invention relates to a method for breeding a high-yielding, high-yielding, high-yielding, high-yielding, high-ripening, high-yielding wheat shoot type mill Iksan 370 and its breeding method.
국내에도 서구식 식습관이 보편화되면서, 국내 밀 소비량은 연평균 400만 톤을 넘어서고 있으며, 국민 1인당 밀 소비량 또한 크게 증가하였다. 이에 따라 밀은 우리나라에서 쌀 다음으로 소비가 많은 곡물로서, 총 곡물소비량의 약 25%를 차지하는 곡물에 해당하나, 국내 밀의 식량자급도는 2.2%에 불과하여 국내에서 소비되는 밀의 대부분을 미국, 호주와 캐나다를 비롯한 외국에서 연간 400만톤 가량을 수입하여 이들 국가에 약 1,064백만 달러를 지불하고 있는 실정이다(농림수산식품 통계연보, 2012). As western eating habits have become commonplace in Korea, domestic wheat consumption has exceeded 4 million tons per year and wheat consumption per capita has also increased significantly. As a result, wheat is the next most popular grain in Korea, accounting for about 25% of the total grain consumption, but the domestic self-sufficiency rate of wheat is only 2.2% In Canada and other countries, about 4 million tons are imported annually and about $ 1,064 million is being paid to these countries (Agriculture, Forestry and Fisheries Statistics Yearbook, 2012).
국내 10a당 평균수량은 335kg(2011년 기준)으로 단위면적당 생산량이 낮고, 2013년 밀 수매가격은 40kg당 36,000원(900원/kg)으로 수입밀(329원/kg)에 비해 약 2.7배 높다(농림수산식품 통계연보, 2012). The average yield per unit of domestic 10a is 335kg (as of 2011) and the yield per unit area is low. In 2013, the wheat purchase price is 36,000 won (900 won / kg) per 40kg, 2.7 times higher than imported wheat (329 won / kg) (Agriculture, Forestry and Fisheries, Statistical Yearbook, 2012).
최근 정부 정책 및 소비자의 의식변화로 국산밀 재배면적과 생산량은 점차 증가하고 있지만, 수입밀에 비하여 가격이 두 배 이상 높아 가격경쟁력이 떨어지므로, 자급률 향상 및 소비에는 한계가 있다. 따라서 국산밀의 경쟁력 향상을 위해서는 생산농가와 가공업체의 소득보장이 매우 중요하므로 기존 품종과는 차별화된 밀 품종개발이 필요하다. 즉, 단위면적당 생산량 증대를 통해 생산 농가의 생산비를 낮추고, 가공업체는 낮은 가격으로 국산밀 제품을 만들 수 있는 획기적인 초다수성 밀 품종개발이 필요한 실정이다.
Due to recent changes in government policy and consumer consciousness, domestic wheat cultivation area and production volume are gradually increasing, but the price competitiveness is lowered by more than twice the price of imported wheat. Therefore, in order to improve the competitiveness of domestic wheat, it is very important to guarantee the income of farmers and processors. Therefore, it is necessary to develop wheat varieties different from existing ones. In other words, it is necessary to develop an innovative multi-grain wheat variety that can reduce the production cost of the production farm by increasing the production per unit area, and the processing company can produce the domestic wheat product at a low price.
이에 본 발명자들은, 수량성이 증가하면서도 강력분 특성을 나타내는 신계통 밀을 개발하기 위하여 예의 노력한 결과, Xian 83을 모본으로 하고, 금강밀을 부본으로 하여 교잡하여 우량계통을 선발하는 경우에 이삭이 길고, 립수가 많으면서도 경질밀 특성을 가진 계통이 육종됨을 확인하고 본 발명을 완성하였다.
Therefore, the present inventors have made intensive efforts to develop a new wheat wheat which shows high yield characteristics with increasing yield, and as a result, it has been found that when Xian 83 is used as an example, , And that the system having a high number of ribs and having a hard-wheat characteristic is breeded, and the present invention has been completed.
본 발명의 목적은 Xian 83을 모본으로 하고, 금강밀을 부본으로 하여 교잡하고, 상기 교잡종으로부터 여러 세대에 거쳐 선발된 이삭이 길고, 립수가 많으며, 다수확 밀 신계통 ‘익산370호’ 및 이의 육종방법을 제공하는 것이다.
It is an object of the present invention to provide a method for producing a hybrid of the present invention, which is based on Xian 83 as an example, hybridized with a goldsmith mill as a duplicate, and has a long ear, a large number of rips, Method.
상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 Xian 83을 모본으로 하고, 금강밀을 부본으로 하여 교잡하고, 상기 교잡종으로부터 여러 세대에 거쳐 선발된 이삭이 길고, 립수가 많으며, 다수확 신계통 ‘익산370호’의 육종방법을 제공한다.
As one embodiment for achieving the above object, the present invention provides a method of producing a hybrid seedlings comprising Xian 83 as an example, crossing with a goldsmith mill as a duplicate, picking a plurality of generations from the hybrid, It provides breeding methods of 'Iksan 370'.
구체적으로, 본 발명의‘익산370호’를 육종하는 방법은 다음과 같다.Specifically, the method of breeding the 'Iksan 370' of the present invention is as follows.
우선, 멕시코 국제밀옥수수연구소(CIMMYT)의 수집종인 ‘Xian 83’을 모본으로 하고, 다목적용 밀 품종인 ‘금강밀(IT213100)’을 부본으로 인공 교배하여 교잡종(F1, IW20050259)을 육성하였다. 이후, 교잡종(F1)의 식물체의 이삭에서 발생된 분리세대(F2) 종자를 일반적인 집단육종법에 의해 전개한 후, 내한성이 양호한 계통을 선발하였으며, 잡종 제3세대(F3)는 국립식량과학원 시험포장에 집단재배하여 이삭이 길고 립수가 많은 67계통을 선발하였다. 상기에서 선발된 식물체의 제4세대(F4) 종자를 일반적인 계통육종법에 의해 포장에 공시하여 초형(草型)이 양호하며 이삭이 길고 립수가 많은 다수확이면서 도복(倒伏)에 강한 계통 위주로 선발을 실시하였다. First, a hybrid (F 1 , IW20050259) was cultivated by artificial interbreeding of 'Xian 83', a collecting species of CIMMYT in Mexico, and 'Geomang Mill (IT213100)', a multipurpose wheat variety . (F 2 ) seeds generated from the seeds of the hybrids (F 1 ) were developed by the general group breeding method, and the lines with favorable cold tolerance were selected. The hybrid third generation (F 3 ) A total of 67 strains with long and large rips were selected. The fourth generation (F 4 ) seeds of the selected plants were disclosed to general seedling breeding, and the selection was made based on a strong lineage with a good grass shape, a long ear, a large number of rips, Respectively.
이후 상기 내한성이 강하고 다수확 계통인 IW20050259-B-B-B-9-55-4-1를 2013년도에 생산력검정시험에 공시하여 생육특성, 생리장해, 내병성, 내도복성, 수발아성 및 수량구성요소를 조사한 결과, 그 특성이 우수하여 ‘익산370호’로 계통명을 부여하였다.
IW20050259-BBB-9-55-4-1, which has a high cold tolerance and a high degree of tolerance, was reported to the production test in 2013, and its growth characteristics, physiological disorders, disease resistance, tolerance, It was named "Iksan 370" because of its superior characteristics.
본 발명에서 부본으로 사용된 ‘금강밀’은 농촌진흥청에서 육성된 신품종으로 현재 우리나라에서 널리 이용되고 있으며, 쉽게 구할 수 있는 품종으로 수확량은 평균 393kg/10a이다. The 'Geumgangmil' used in the present invention is a new variety cultivated by the Rural Development Administration and is widely used in Korea. It is an easily obtainable variety and the yield is 393 kg / 10a on average.
또한, 본 발명에서 모본으로 사용된‘Xian 83’은 국내 밀 품종 보다는 이삭이 길고 립수는 많지만, 숙기가 금강밀보다 3주 정도 늦어 국내 환경에서는 적합하지 않은 특성을 가지고 있다. In addition, 'Xian 83' used as a prototype in the present invention has a longer ear and a larger number of ripples than a domestic wheat variety, but has a characteristic that it is not suitable in domestic environment because it is about three weeks later than the Kumgang wheat.
본 발명의 ‘익산370호’는 모본인 ‘Xian 83’과 같이 이삭이 길고 립수가 많으면서도, 숙기를 앞당겨 국내 환경에서도 재배가 가능하다.
The 'Iksan 370' of the present invention, like the 'Xian 83' of the parent, has a long ear and a large number of ribs.
본 발명의 또 하나의 양태로서, 상기 육종방법에 의해 얻어진 밀 신계통 ‘익산370호’를 제공한다.
As another embodiment of the present invention, there is provided a wheat germ line Iksan 370 obtained by the breeding method.
본 발명의 ‘익산370호’의 육종 과정에 대하여는 상기에서 설명한 바와 같다.The breeding process of 'Iksan 370' of the present invention is as described above.
본 발명의 신계통 밀 ‘익산370호’는 하기와 같은 식물학적 특성을 가질 수 있으며, 이에 제한되는 것은 아니다.The novel wheat flour 'Iksan 370' of the present invention may have the following botanical characteristics, but is not limited thereto.
구체적으로, Ⅱ형의 춘화처리(vernalization); 녹색의 넓고 긴 잎; 중간정도 굵기의 연노란색 줄기; 방추형의 흰 이삭; 중간정도 크기의 까락; 중간정도 크기의 적립계 종실; 90 내지 100cm의 초장; 90내지 100cm의 간장; 7 내지 11개의 분얼; 3 내지 7개의 유효분얼; 4.5 내지 5.5mm의 줄기 굵기; 17 내지 23개의 총 잎 수; 180 내지 210cm2의 잎 넓이; 25 내지 30cm의 지엽 길이; 1.5 내지 2.3cm의 지엽 폭; 10 내지 20cm2의 지엽 넓이; 0.6 내지 0.9의 광합성 효율; 5월 13~14일의 출수기; 5월 17일 경의 영화기; 6월 13~15일의 성숙기; 13 내지 18cm의 이삭 길이; 5.7 내지 7.0cm의 까락 길이; 50개 이상의 이삭당 립수; 780 내지 830g의 리터중; 44 내지 45g의 천립중; 660kg/10a 이상의 전작 수량성; 440kg/10a 이상의 답리작 수량성; 6.5 내지 7.0mm의 종자 길이; 3.0 내지 4.0mm의 종자 폭, 2.8 내지 3.2mm의 종자 두께; 1.7 내지 1.9의 원마도(roundness); 75% 이상의 제분율; 0.5% 이상의 회분함량; 13% 이상의 단백질 함량; 13% 이상의 글루텐 함량; 75ml 이상의 침전가; 72μm 이상의 밀가루 입자크기; 야생형의 Wx-A1, Wx-B1 및 Wx-D1의 GBSS(granule-bound starch synthase) 유전자; 685bp 크기의 PPO18 유전자(어두운 색의 밀가루); 야생형의 Pina-D1 유전자 및 변이형의 Pinb-D1 유전자; 0.5cm 미만의 고엽장 길이; 3% 미만의 고엽율; 및 15% 미만의 수발아율의 특성을 가질 수 있으나, 이에 제한되지 않는다.
Specifically, vernalization of type II; Wide and long leaves of green; Medium yellow stalks; Spindle white spine; Medium-sized casks; Medium-size earning system; A plant length of 90 to 100 cm; 90 to 100 cm of liver; 7 to 11 tangles; Three to seven valid tuples; A stem diameter of 4.5 to 5.5 mm; 17 to 23 total number of leaves; A leaf width of 180 to 210 cm 2 ; A length of a paper sheet of 25 to 30 cm; A sheet width of 1.5 to 2.3 cm; A lateral width of 10 to 20 cm 2 ; A photosynthetic efficiency of 0.6 to 0.9; Heading for May 13-14; A movie about May 17; Maturity of 13-15 June; A spike length of 13 to 18 cm; A calace length of 5.7 to 7.0 cm; Ribs per 50 or more heads; Among 780 to 830 grams of liters; 44 to 45 grams of ginseng; 660 kg / 10a or more of full-grain yield; Manure yield of more than 440 kg / 10a; A seed length of 6.5 to 7.0 mm; A seed width of 3.0 to 4.0 mm, a seed thickness of 2.8 to 3.2 mm; A roundness of 1.7 to 1.9; 75% or more milling fraction; Ash content of 0.5% or more; A protein content of 13% or more; A gluten content of 13% or more; More than 75 ml of sediment; Flour particle size greater than 72μm; A granule-bound starch synthase (GBSS) gene of wild type Wx-A1, Wx-B1 and Wx-D1; A 685 bp size PPO18 gene (dark wheat flour); The wild-type Pina-D1 gene and the mutant Pinb-D1 gene; A leaf length of less than 0.5 cm; A solids content of less than 3%; And a water germination rate of less than 15%, but is not limited thereto.
본 발명의 ‘익산370호’는 경기도 수원시 권선구 서둔동 소재 국립농업과학원 농업유전자원센터에 2013년 8월 6일자 기탁번호 K218462로 일반 기탁하였고, 동일한 종자에 대하여 상기 기관에 2013년 10월 18일자 기탁번호 KACC98034P로 특허 기탁을 하였는 바, 상기 기관 등을 통해 용이하게 입수할 수 있다.
"Iksan 370" of the present invention was deposited at the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science, Gyeonggi-do, Suwon-dong, Gyeonggi-do, on August 6, 2013 with the deposit number K218462 and the same seed was deposited on October 18, No. KACC98034P, which has been patented, it is readily available through the above-mentioned institutions.
본 발명의 ‘익산370호’는 금강밀 품종의 특성을 유지하면서도 동시에 이보다 수량성이 증가되고 강력분성을 가진 것을 특징으로 하여 기존의 밀 품종보다 형질적으로 우수한 신계통을 제공할 수 있고, 이에 따라 상기 ‘익산370호’는 생식용, 가공용 등으로 활용될 수 있다.
The 'Iksan 370' of the present invention is characterized by having higher yield and higher toughness at the same time while maintaining the characteristics of Kum River flour varieties. Therefore, it is possible to provide a new type strain superior to the existing wheat varieties Accordingly, 'Iksan 370' may be used for reproductive and processing purposes.
이삭이 길고 립수가 많아 수량적 잠재요소가 매우 큰 본 발명의 ‘익산370호’의 개발을 통하여, 단위면적당 생산비 절감으로 가격 경쟁력 확보를 통한 국산밀 산업화에 기여하고, 초다수성 밀 품종 개발을 통한 식량 자급률 제고 기반 구출 및 농가소득이 향상될 수 있다.
The development of Iksan 370 of the present invention, which has a long ear and a large number of ripples, has a great potential for quantitative contribution, contributing to the industrialization of domestic wheat by securing price competitiveness by reducing the production cost per unit area, Increased food self-sufficiency through rescue and farm income can be improved.
도 1은 신계통 밀 ‘익산370호’의 육성경위를 나타낸 도이다.
도 2는 신계통 밀 ‘익산370호’의 계통도이다.
도 3a는 ‘익산370호’ 및 금강밀의 사진이다.
도 3b는 ‘익산370호’ 및 금강밀의 생장곡선을 나타낸 도이다.
도 4a는 ‘익산370호’ 및 금강밀의 출수기의 이삭을 찍은 사진이다.
도 4b는 ‘익산370호’ 및 금강밀의 성숙기의 이삭을 찍은 사진이다.
도 5는 금강밀의 이삭 및 소수를 찍은 사진이다.
도 6은 ‘익산370호’의 이삭 및 소수를 찍은 사진이다.
도 7은 ‘익산370호’ 및 금강밀의 전작 및 답리작에서 실시한 생산력검정 예비시험 결과를 나타낸 도이다.
도 8a는 ‘익산370호’의 종자 형태를 찍은 사진이다.
도 8b는 금강밀의 종자 형태를 찍은 사진이다.
도 9는 ‘익산370호’의 밀가루 입자 크기 및 부피를 나타낸 도이다.Fig. 1 is a diagram showing a breeding process of a new strain mill 'Iksan 370'.
2 is a systematic view of a new line mill Iksan 370. Fig.
FIG. 3A is a photograph of 'Iksan 370' and Kumgang wheat.
FIG. 3B is a diagram showing a growth curve of 'Iksan 370' and a steel mill.
FIG. 4A is a photograph of the 'Iksan 370' and the ear of the head of Kumkang wheat.
FIG. 4B is a photograph of the 'Iksan 370' and the ears of mature stage of Kumgang wheat.
Fig. 5 is a photograph showing the ears and prime numbers of a steel mill.
FIG. 6 is a photograph of the ears and a few of the 'Iksan 370'.
Fig. 7 is a diagram showing the result of preliminary test of productivity test carried out in the previous work and the work of Kumkang wheat and 'Iksan 370'.
8A is a photograph showing the seed shape of 'Iksan 370'.
Fig. 8B is a photograph showing a seed form of a silver alloy mill.
9 is a diagram showing the particle size and volume of flour of 'Iksan 370'.
이하, 본 발명을 하기 실시예에서 보다 구체적으로 설명한다. 그러나 이들 예는 본 발명의 이해를 돕기 위한 것일 뿐, 이들에 의해 본 발명이 한정되는 것은 아니다.
Hereinafter, the present invention will be described more specifically in the following examples. However, these examples are provided only to aid understanding of the present invention, and the present invention is not limited thereto.
실시예Example 1: 육종 과정 1: Breeding process
밀 수량성 증대를 위하여, 2005년도에 숙기는 늦지만 이삭이 길고 립수가 많은 멕시코 국제밀옥수수연구소(CIMMYT)의 수집종인 Xian 83을 모본으로 하고, 숙기가 빠르고 다목적용 밀 품종인 금강밀(IT213100)을 부본으로 인공교배하여 IW20050259 조합을 육성하였다. In order to increase the wheat yield, the sample of Xian 83, a collection of the CIMMYT, which is late in maturity but has a long ear and a large number of rips, is used as a model. It is a fast and versatile variety of wheat (IT213100 ) Was artificially mated with a duplicate to foster the IW20050259 combination.
국립식량과학원 시험포장(전라북도 익산시)에서 교잡종(F1)의 식물체의 이삭에서 발생된 분리세대(F2) 종자를 국립식량과학원 운봉출장소(전라북도 남원시)에서 일반적인 집단육종법에 의해 내한성이 양호한 계통을 선발하였다. 잡종 제3세대(F3)는 국립식량과학원 시험포장에 집단재배하여 이삭이 길고 립수가 많은 67계통을 선발하였다. 선발된 제4세대(F4) 종자를 일반적인 계통육종법에 의해 포장에 공시하여 초형(草型)이 양호하며 이삭이 길고 립수가 많은 다수확이면서 도복(倒伏)에 강한 계통 위주로 선발을 실시하였다. 내한성이 강하고 다수확 계통인 IW20050259-B-B-B-9-55-4-1를 2013년도에 생산력검정시험에 공시하여 생육특성, 생리장해, 내병성, 내도복성, 수발아성 및 수량구성요소를 조사한 결과, 그 특성이 우수하여 ‘익산370호’로 계통명을 부여하였다. (F 2 ) seeds generated from the seeds of the hybrids (F 1 ) in the test packaging of the National Institute of Food Science and Technology (Iksan, Jeollabuk-do) were analyzed by the general group breeding method at the Unbong Branch of the National Institute of Food and Nutrition (Namwon, Jeollabuk- Were selected. The hybrid third generation (F 3 ) group was cultivated in the test package of the National Institute of Food Science and Technology and selected 67 species with long and large ripeness. Fourth generation (F 4 ) seeds were selected by general systematic breeding method, and the selection was made on the basis of strong lineage system which was good in herbaceous form and had long ears and large number of ripples. IW20050259-BBB-9-55-4-1, which has a strong cold resistance and high yield, was reported to the productivity test in 2013, and its growth characteristics, physiological disorders, disease resistance, tolerance, And the name of the system was given to 'Iksan 370'.
본 발명의 ‘익산370호’는 경기도 수원시 권선구 서둔동 소재 국립농업과학원 농업유전자원센터에 2013년 8월 6일자 기탁번호 K218462로 일반 기탁하였고, 동일한 종자에 대하여 동일 기관에 2013년 10월 18일자 기탁번호 KACC98034P로 특허 기탁을 하였다. 육성 경위를 도식화하면 도 1 및 도 2와 같다.
"Iksan 370" of the present invention was deposited at the National Institute of Agricultural Science and Technology, National Institute of Agricultural Science, Gyeonggi-do, Suwon-dong, Gyeonggi-do, on August 6, 2013, with deposit number K218462, and deposited with the same institution on October 18, No. KACC98034P. Fig. 1 and Fig. 2 show the process of cultivation.
실시예Example 2: ' 2: ' 익산370호Iksan 370 '의 생육특성 분석Analysis of Growth Characteristics
'익산370호'의 생산력검정 시험은 2013년에 국립식량과학원 벼맥류부에서 전작과 답리작 조건으로 수행하였다. 구체적으로, 생육특성, 생리장해, 내병성, 내도복성, 수발아성, 붉은곰팡이병 및 수량구성요소를 조사하였으며, 조사 및 평가방법은 농업과학기술 연구조사분석기준(농촌진흥청, 2012)과 신품종 심사를 위한 작물별 특성조사요령(농림부 국립종자관리소, 2000)에 준하였다.
The test of productivity of 'Iksan 370' was conducted in 2013 under the previous work and working conditions in the paddy field of the National Institute of Food Science and Technology. The results of this study are as follows: 1) The characteristics of growth, physiological, physiological, tolerance, tolerance, mildew, red fungus and yield were investigated. (National Seed Management Office, Ministry of Agriculture and Forestry, 2000).
실시예Example 2-1: 고유 특성 2-1: Unique characteristics
품종명System and
Breed name
고유 특성에 대하여 상기 표 1에서 나타낸 바와 같이, '익산370호'의 파성은 Ⅱ형으로 춘파가 가능하고, 잎의 색은 녹색이며, 폭은 금강밀에 비해 넓고 긴 편이다. 줄기 굵기는 중간 정도이며, 이삭은 방추형이고, 까락은 중간 정도이다. 종실 크기는 중간 정도이며, 종실색은 적립계로 금강밀 백립계와는 차이를 보였다.
Regarding the intrinsic properties, as shown in Table 1, 'Iksan 370' is of type II, and its color is green and its width is broad and long compared with that of gold. The stem is medium in thickness, the ears are fusiform, and the sac is medium. Seed size was medium and seed color was different from that of gold - milled white - ground system.
실시예Example 2-2: 줄기 및 2-2: Stem and 분얼특성Tribological characteristics
품종명System and
Breed name
(cm)Plant height
(cm)
(cm)Soy sauce
(cm)
(mm)Stem diameter
(mm)
줄기와 분얼특성은 상기 표 2에 나타낸 바와 같다. 구체적으로, '익산370호'의 초장은 96cm로, 금강밀보다 20cm 더 길었다. 생장곡선은 S자 곡선을 이루었으며(도 3), 월동 후 온도가 상승하는 3월 20일부터 신장하기 시작하여 출수기(5월 14일)가 지난 5월 26일에 정점을 이루었다. Stem and tangle characteristics are shown in Table 2 above. Specifically, the plant length of 'Iksan 370' is 96cm, which is 20cm longer than Kum River. The growth curve formed an S-shaped curve (Fig. 3) and began to grow from March 20, when the temperature rose after wintering, peaking on May 26 last year (May 14).
줄기길이(간장)은 '익산370호'가 95cm로 금강밀보다 16cm 길었으며, 1주당 총 분얼수는 9개로 금강밀보다 3개 적었고, 유효분얼은 5개로 금강밀보다 4개 적었다. 줄기의 절간별 크기를 조사한 결과, 이삭 바로 아래 첫 번째 마디의 길이는 40.8cm로 간장 전체길이의 43%로 가장 길었고, 두 번째 마디의 길이는 20.1cm, 세 번째 마디는 11.3cm, 네 번째 마디는 9.1cm, 다섯 번째 마디는 3.5cm였다. 위에서 세 번째 마디의 줄기 직경은 '익산370호'가 5.02mm로 금강밀보다 두꺼웠다.
The stem length (soy sauce length) of 'Iksan 370' was 95cm, 16cm longer than that of Kum River, and the total number of tins per week was 9, which was 3 less than that of Kum River. The length of the first node under the ears was 40.8cm, the longest was 43% of the total length of the liver, the length of the second node was 20.1cm, the third node was 11.3cm, Was 9.1 cm, and the fifth node was 3.5 cm. The stem diameter of the third node above was 5.02mm, 'Iksan 370', which was thicker than Kumkang wheat.
실시예Example 2-3: 잎과 광합성효율 분석 2-3: Leaf and photosynthetic efficiency analysis
품종명System and
Breed name
(매)ground game
(every)
(cm2)Leaf area
(cm 2 )
(cm)Length
(cm)
(cm)width
(cm)
(cm2)Leaf area
(cm 2 )
(Fm/Fv)Photosynthetic efficiency
(Fm / Fv)
잎과 지엽의 광합성효율은 상기 표 3에 나타낸 바와 같다. 구체적으로, '익산370호'의 주당 총 엽수는 20개로 금강밀보다 11개 적었지만, 엽면적은 193.1cm2로 2.5배(114.3cm2) 넓었는데, 이는 '익산370호'의 잎이 길고 넓다는 것을 의미한다. 지엽의 엽장은 28.14cm로 금강밀보다 10.34cm 길고, 폭은 1.84cm로 금강밀보다 약 2배 넓었으며, 엽면적은 14.78cm2로 금강밀보다 약 3.3배(10.32 cm2) 넓었다. 광합성효율은 0.83으로 금강밀보다 약간 높게 나타났다.
The photosynthetic efficiency of leaves and leaves is shown in Table 3 above. Specifically, the total number of leaves per week of Iksan 370 was 20, which was 11 fewer than that of Kum river, but the leaf area was 193.1 cm 2 , 2.5 times (114.3 cm 2 ), which is long and wide in Iksan 370 Means that. Leaf length of the paper is longer than a 10.34cm by 28.14cm Geum mill, the width was about twice wider than Geum mill to 1.84cm, leaf area is about 3.3 times (10.32 cm 2) was broader than Geum mill to 14.78cm 2. The photosynthetic efficiency was 0.83, which was slightly higher than that of gold.
실시예Example 2-4: 출수기 및 성숙기 분석 2-4: Analysis of heading and maturity
조건culture
Condition
출수기와 성숙기는 상기 표 4에서 보는 바와 같이 국립식량과학원 벼맥류부에서 2013년 전작과 답리작 조건에서 수행하였다. As shown in Table 4 above, heading and maturity were performed at the National Institute of Food Science and Technology, Pyeongtaek,
출수기는 전작과 답리작 조건에서 각각 5월 14일과 5월 13일로 금강밀에 비해 10과 8일 늦었다. 영화기는 전작과 답리작에서 5월 17일로 금강밀에 비해 5~6일 정도 늦었지만, 출수기에서 영화기까지의 기간은 3~4일로 금강밀(7일)보다 짧았다. 성숙기는 전작과 답리작에서 각각 6월 15일과 6월 13일로 금강밀에 비해 7~9일 정도 길었다. 이는 익산370호는 금강밀보다 숙기가 늦은 만숙종이었다. ‘익산370호’의 출수기와 성숙기는 금강밀보다는 늦지만, Xian 83 보다는 빠른 특성을 보였으며 국내 환경조건에서도 재배가 가능하다.
The heading was late on May 14th and May 13th respectively under the former work and the previous work condition, respectively, 10 and 8 days later than Kum river. The film was delayed 5 to 6 days later than the Kumgang wheat on May 17th in the previous film and apprenticeship, but the period from heading to filming was shorter than the Kumgang mill (7 days) for 3-4 days. The maturity period was June 15th and June 13th, respectively, in the previous works and the previous works, respectively, which were 7 ~ 9 days longer than the Kum river. The Iksan 370 was a late-mature species that was late in maturity. The heading and mature stage of 'Iksan 370' is slower than that of Kum River but it is faster than Xian 83 and can be cultivated under domestic environmental conditions.
실시예Example 2-5: 이삭 및 수량구성 요소 분석 2-5: Analysis of grain and yield component
품종명System and
Breed name
(cm)The length of the ears
(cm)
(cm)The length of the rock
(cm)
립수Per spike
Number of Ribs
수수per m 2
Sorghum
(g)Liter
(g)
(g)Heavenly
(g)
이삭 및 수량구성 요소는 상기 표 5 및 도 4 내지 도 6에 나타낸 바와 같다. 이삭의 길이는 전작과 답리작에서 각각 15.3cm와 15.6cm로 금강밀보다 6.0cm이상 긴 장수형 타입이었다. 소수는 금강밀은 보통 12개 정도이지만 '익산370호'는 18개로 금강밀보다 많았다. 까락의 길이는 전작과 답리작 조건에서 각각 6.2cm와 6.6cm로 금강밀보다 길었다. 이삭당 립수는 전작과 답리작에서 각각 59개와 53개로 금강밀보다 22~25개 많았다. 리터중은 금강밀보다 약간 적었으며, 천립중은 전작과 답리작에서 각각 44.6g으로 금강밀과 비슷한 대립종이었다.
The grain and yield components are as shown in Table 5 and Figures 4 to 6 above. The length of the ears was 15.3cm and 15.6cm respectively in the previous works and the masterpieces. The small number of Kumkang mill is usually about 12, but Iksan 370 is 18 more than Kumkang wheat. The length of the carac was 6.2 cm and 6.6 cm, respectively, longer than that of the goldsmith at the previous work and the work condition. The number of ripples per ears was 59 and 53 in the previous works, respectively, and 22 to 25 more than the Kum river. Liter was slightly less than that of Kum River, and the weight of ginseng was 44.6g in each of the previous works and the other works.
실시예Example 2-6: 수량성 분석 2-6: Quantitative analysis
전작과 답리작에서 실시한 생산력검정예비시험결과는 도 7에 나타낸 바와 같다. 전작에서 수량은 661kg/10a로 금강밀에 비해 34% 증수하였고, 답리작에서는 443kg/10a로 52% 증수하였다.
The result of the preliminary test of productivity test conducted in the previous work and the work is shown in Fig. In the previous work, the yield was 661kg / 10a, which was 34% higher than that of gold alloy mills, and 52% at 443kg / 10a.
실시예Example 2-7: 종자특성 분석 2-7: Analysis of seed characteristics
종실특성은 SeedCount(SeedCount Co. Australia)를 이용하여 입장, 입폭, 입두께, 원마도(Roundness) 등을 분석하였다. The SeedCount (SeedCount Co. Australia) was used to analyze the seeding characteristics, mouth width, mouth thickness, and roundness.
품종명System and
Breed name
(mm)Entrance
(mm)
(mm)Mouth width
(mm)
(mm)Mouth thickness
(mm)
(비율)Won-do
(ratio)
종자특성은 상기 표 6 및 도 8에 나타낸 바와 같다. 종자의 길이와 두께는 각각 6.73mm와 2.95mm로 금강밀과 비슷하였고, 종자의 폭은 3.50mm로 금강밀보다 1mm 적어 최종적으로 원마도는 1.81로 금강밀보다 낮았다.
Seed characteristics are shown in Table 6 and FIG. The length and thickness of the seeds were 6.73mm and 2.95mm, respectively. The width of the seed was 3.50mm, which was 1mm less than that of the steel mill.
실시예Example 3: ' 3: ' 익산370호'의Iksan 370 품질 분석 Quality analysis
품질 분석을 위한 제분은 뷸러(Buhler)제분기를 이용하였으며, 밀가루의 수분, 회분과 단백질함량은 각각 AACC 방법(2000) 44-15A, 08-01과 46-30에 준하여 측정하였다. 침전가는 밀가루 3g을 이용하여 Axford 등(1979)의 방법에 준하여 측정하였으며, 글루텐 함량은 밀가루 10g에서 전체 글루텐 무게를 비율로 나타내었으며, 글루텐 추출은 AACC 방법(2000) 38-10에 따라 측정하였다. 밀가루의 입자크기(PSI, Particle size index)는 Laser Diffraction Particle Size Analyser(Becman LS13320, Germany)를 이용하여 측정하였다. 반죽 특성은 10g Mixograph(National Mfg. Co. USA)를 이용하여 AACC 방법(2000)에 준하여 측정하였다. 밀가루 색도는 Minolta JS-555(Minolta Camera Co. Japan)을 이용하여 밝기, 적색도와 황색도를 측정하였으며, 이를 각각 L*(밝기), a*(적색도)와 b*(황색도) 값으로 나타내었다. For the quality analysis, Buhler mill was used for milling, moisture, ash and protein content of wheat flour were measured according to AACC method (2000) 44-15A, 08-01 and 46-30 respectively. The gluten content was determined by the ratio of total gluten weight at 10 g of wheat flour and the gluten extraction was measured according to AACC method (2000) 38-10. Particle size index (PSI) of wheat flour was measured using a Laser Diffraction Particle Size Analyzer (Becman LS13320, Germany). The dough characteristics were measured according to the AACC method (2000) using a 10 g Mixograph (National Mfg. Co. USA). The brightness, redness and yellowness of the wheat flour were measured using Minolta JS-555 (Minolta Camera Co., Japan) and the values were measured as L * (brightness), a * (redness) and b * (yellowness) Respectively.
(%)Ash
(%)
(%)protein
(%)
(%)gluten
(%)
(ml)Precipitant
(ml)
크기
(um)particle
size
(um)
(L*)brightness
(L *)
(a*)Redness
(a *)
(b*)Yellowness
(b *)
품종명System and
Breed name
Glu - D1 HMW-GS
Glu - D1
(%)Quantity of water
(%)
(min)Kneading time
(min)
(mm)Dough resistance
(mm)
그 결과, 품질특성은 상기 표 7 및 표 8에 나타낸 바와 같다. 제분율은 익산370호가 75.46%로 금강밀보다 2%이상 높았고, 회분함량도 0.57%로 금강밀보다 높았다. 단백질함량은 13.53%로 금강밀보다 높고 질적인 특성을 나타내는 글루텐 함량과 침전가도 각각 13.55%와 77.5㎖로 금강밀보다 높아 강력분 특성을 나타내었다. 밀가루의 크기는 평균 72.91um로 금강밀보다 컸으며, 밀가루 입자 분포(도 9)를 보면 시중에서 판매되는 강력분과 같은 경향을 나타내었다. 밀가루의 밝기는 90.47로 금강밀보다 어둡게 나타났는데 이는 회분함량, 글루텐과 단백질함량이 높기 때문에 어두워진 것으로 판단된다. 제빵적성과 관련된 고분자량 글루테닌 조성 중 Glu-D1은 5+10으로 금강밀과 같았다. 밀가루 반죽특성에서 가수량은 65.0%로 금강밀보다 많았으며 반죽시간은 5분 38초로 같았고, 반죽안정도는 18.0mm로 비슷하였다.
As a result, the quality characteristics are as shown in Tables 7 and 8 above. The milling rate of Iksan 370 was 75.46%, which was more than 2% higher than that of Kumkang wheat and the ash content was 0.57% higher than that of Kum river. Protein content was 13.53%, which was higher than that of gold - milled wheat flour. The gluten content and sedimentation rate, which are qualitative characteristics, were 13.55% and 77.5ml, respectively. The mean size of flour was 72.91 ㎛, which was larger than that of gold. The distribution of wheat flour (Fig. 9) showed the same tendency as that of commercially available wheat flour. The brightness of the flour was 90.47, which was darker than that of the gold mill, which was judged to be dark due to high ash content, gluten and protein content. Among the high molecular weight glutenin compositions associated with baking aptitude, Glu-D1 was 5 + In the flour dough characteristics, the amount of water was 65.0%, which was higher than that of gold. The dough time was 5 minutes and 38 seconds, and the dough stability was similar to 18.0mm.
실시예Example 4: 4: 익산370호의Iksan 370 품질관련 유전적 특성 분석 Analysis of quality related genetic characteristics
익산370호의 품질관련 유전적 특성을 확인하기 위하여 게놈 유전자 중합효소연쇄반응(Genomic DNA PCR)을 수행하였다. Genomic DNA 추출은 SolGent사(Korea)의 Genomic DNA extraction Kit for plant를 사용하였다. 즉, 식물체의 어린잎을 잘라 액체질소로 급냉 후 고운 가루가 될 때까지 분쇄하였다. 분쇄 후 바로 추출완충액(extraction buffer)를 300㎕ 넣어주고 분쇄 가루와 잘 섞어주었다. 그 뒤 65℃ 항온수조에서 30분간 반응시킨 후 13,000rpm, 4℃에서 20분간 원심분리 하였다. 원심분리 후 상층액을 새 tube에 옮기고 아이소프로필(isopropyl) 300㎕ 첨가 후 천천히 혼합하여 DNA를 뭉치게 하였다. 다시 13,000rpm, 5분간 원심분리 한 뒤 상층액을 제거 한 뒤 80% 에탄올 50㎕을 넣고 세척하였다. 세척 후 13,000rpm, 5분간 원심분리 하고 에탄올을 제거한 후 팰럿(pellet)을 상온에서 건조한 후 멸균 증류수를 넣어 팰럿(pellet)을 녹였다. 추출한 DNA는 Nano drop을 이용하여 정량을 하였다. Genomic DNA polymerase chain reaction (PCR) was performed to confirm the quality related genetic characteristics of Iksan 370. Genomic DNA extraction was performed using SolGent's Genomic DNA Extraction Kit for plant. That is, the young leaves of the plants were cut and quenched with liquid nitrogen, and then pulverized until fine powder was obtained. Immediately after grinding, 300 μl of extraction buffer was added and mixed well with the ground powder. Then, the reaction was carried out in a constant temperature water bath at 65 ° C for 30 minutes and then centrifuged at 13,000 rpm and 4 ° C for 20 minutes. After centrifugation, the supernatant was transferred to a new tube, 300 μl of isopropyl was added, and the DNAs were pooled by slow mixing. After centrifugation at 13,000 rpm for 5 minutes, the supernatant was removed, and 50 μl of 80% ethanol was added thereto. After washing, the mixture was centrifuged at 13,000 rpm for 5 minutes, and the ethanol was removed. The pellet was dried at room temperature, and sterilized distilled water was added to dissolve the pellet. The extracted DNA was quantitated using Nano drop.
종실 내 함유되어 있는 고분자 글루텐 특성 중 Glu-D1 특성은 Appelbee 등(2009)의 방법, 종실의 폴리페놀 옥시데이즈(polyphenol oxidase) 활성과 관련된 PPO 유전적 특성은 Sun 등(2005), 전분합성 관련 유전자인 GBSS I 유전적 특성은 Nakamura 등(2002), 종실경도와 관련된 퓨로인돌라인즈(puroindolines) 유전적 특성은 Chen 등(2007)의 방법에 준하여 실시하였다. The characteristics of Glu-D1 among the polymer gluten characteristics contained in the seeds were determined by the method of Appelbee et al. (2009), PPO genetic characteristics related to the polyphenol oxidase activity of the seeds, Sun et al. (2005) Nakamura et al. (2002) genetic characteristics of GBSS I, and genetic characteristics of puroindolines related to seedling hardness were performed according to the method of Chen et al. (2007).
구체적으로, GBSS(granule-bound starch synthase)는 광합성에 의해 생성된 당분자를 종실에서 중합해 저장탄수화물 형태인 아밀로스로 만드는 효소로서, 아밀로스 함량분석을 통해 찰기를 구별할 수 있다. 밀에는 게놈별로 Wx-A1, Wx-B1 및 Wx-D1이 존재한다. PPO는 폴리페놀 산화효소(polyphenol oxidase)로서, 페놀을 산화하여 퀴논(quinone)을 생성하는 반응을 촉매하여 효소적 갈변(browning)의 원인이 되는 효소이다. 따라서, 상기 효소의 함량에 따라 밀가루의 색 밝기가 달라질 수 있다. 퓨로인돌라인즈(puroindolines)는 밀의 전분입자 결합 단백질로서, 연질밀 또는 경질밀과 같은 종실의 경도를 결정한다. Specifically, granule-bound starch synthase (GBSS) is an enzyme that polymerizes sugar molecules produced by photosynthesis to form amylose, a form of stored carbohydrate, which can be distinguished by analysis of amylose content. There are Wx-A1, Wx-B1 and Wx-D1 for each genome in wheat. PPO is a polyphenol oxidase, which catalyzes the reaction of oxidizing phenol to form quinone, which causes enzyme browning. Therefore, the color brightness of wheat flour may vary depending on the content of the enzyme. Puroindolines are starch particle binding proteins of wheat, which determine the hardness of seeds such as soft wheat or hard wheat.
상기 유전자들은 모두 공지된 유전자로서, 미국국립보건원의 GenBank 등 공지의 데이터베이스로부터 얻을 수 있으며, 그 예로 Wx-A1(AB737985), Wx-B1(AB426607), Wx-D1(AF113844.1), PPO18(EF07148), Pina-D1(AB177392) 및 Pinb-D1(AB180737)일 수 있으나, 이에 제한되지 않는다.These genes are all known genes and can be obtained from known databases such as GenBank of the National Institutes of Health such as Wx-A1 (AB737985), Wx-B1 (AB426607), Wx-D1 (AF113844.1), PPO18 EF07148), Pina-D1 (AB177392) and Pinb-D1 (AB180737).
PCR은 Veriti® Dx96-WellThermalCycler(Applied Biosystem, USA)을 사용하였다. 밀 품질관련 각각의 유전자서열 특이적 분자표지 분석을 위한 PCR 조성은, genomic DNA은 100ng이었으며, 프라이머는 각각 0.5μmol/l를, MgCl2와 dNTP는 각각 2.0 mmol/l를, Taq 중합효소(GenetBio Prime DNA polymerase, Korea)는 1 unit을 사용하였으며, 총 반응액은 25㎕로 하였다. PCR 반응은 94℃에서 5분간 변성반응을 거친 후, 증폭단계에서 94℃에서 30초, 각각의 유전자에 맞는 어닐링(annealing) 온도에서 30초, 72℃에서 60초를 35회 반복하여 진행한 후 최종 신장반응은 72℃에서 10분간 수행하였다. PCR 산물은 EtBr(0.5㎍/㎖)이 포함된 2.0% 아가로스 겔에서 100V로 2시간 동안 전기영동한 후 UV transilluminator에서 확인하였다(표 10).PCR was used (Applied Biosystem, USA) Veriti ® Dx96-WellThermalCycler. For wheat quality-related gene sequence-specific molecular markers, PCR was performed with 100 ng of genomic DNA, 0.5 mmol / l of primers, 2.0 mmol / l of MgCl 2 and dNTPs, and Taq polymerase (GenetBio Prime DNA polymerase, Korea) was used as a unit and the total reaction volume was 25 μl. The PCR reaction was carried out at 94 ° C for 5 minutes, followed by amplification at 94 ° C for 30 seconds, annealing at 30 ° C for 30 seconds and 72 ° C for 35 seconds, The final elongation reaction was carried out at 72 ° C for 10 minutes. The PCR product was electrophoresed in a 2.0% agarose gel containing EtBr (0.5 μg / ml) at 100 V for 2 hours and then confirmed on a UV transilluminator (Table 10).
품종명System and
Breed name
1) GBSS : 아밀로스합성 유전자, 2) PPO18 : Polyphenol 산화 활성 유전자, 3) a = 일반형(wild type), 4) b = 변이형(mutant)
1) GBSS: amylose synthesis gene, 2) PPO18: Polyphenol oxidizing activity gene, 3) a = general type (wild type), 4) b = variant (mutant)
온도(℃)Annealing
Temperature (℃)
2One
2
R: AGTATGAAACCTGCTGCGCACF: CGTCCCTATAAAAGCCTAGC
R: AGTATGAAACCTGCTGCGCAC
43
4
R: TCGTGTTCGTCGGCGCCGAGATGGF: CCGCGCTTGTAGCAGTGGAAGTACC
R: TCGTGTTCGTCGGCGCCGAGATGG
65
6
R: CTGGCCTGCTACCTCAAGAGCAACTF: CTGACGTCCATGCCGTTGACGA
R: CTGGCCTGCTACCTCAAGAGCAACT
87
8
R: GCAAGGAAAATAGTGAAGCF: ACAGGATCTCTCCTGGAAG
R:
251850 or
251
109
10
R: AAGAAGTTGCCCATGTCCGCF: CTGCTGGCTCTTCTTCCCA
R: AAGAAGTTGCCCATGTCCGC
1211
12
R: TCACCAGTAATAGCCAATAGTGF: ATGAAGGCCCTCTTCCTCA
R: TCACCAGTAATAGCCAATAGTG
1413
14
R: TCACCAGTAATAGCCACTAGGGAAF: ATGAAGACCTTATTCCTCCTA
R: TCACCAGTAATAGCCACTAGGGAA
그 결과, 상기 표 9 및 표 10에 나타낸 바와 같이, 품질관련 유전자 중 아밀로스 함량과 관련 있는 GBSS(granule-bound starch synthase)는 A, B, D 게놈에서 모두 a형으로 금강밀과 같은 메성을 보였으며, 폴리페놀 옥시데이즈(polypheol oxidase) 활성과 관련 있는 PPO18에서는 685bp의 밴드발현을 보여 금강밀과 같이 밀가루의 색 밝기가 약간 어두운 특성을 보였다. 종실경도와 관련있는 퓨로인돌라인즈(puroindolines)에서는 Pina - D1에서는 a, Pinb - D1에서는 b로 금강밀과 같은 경질밀 특성을 보였다. 이는 교배본으로 사용된 금강밀과 초형이나 수형은 다르지만, 품질관련 유전적 특성은 금강밀과 동일한 특성을 보이는 것으로 판단된다.
As a result, as shown in Tables 9 and 10, GBSS (granule-bound starch synthase) related to the amylose content of the quality-related genes showed a similarity to that of A-type and A-type in the A, B and D genomes PPO18 , which is related to polyphenol oxidase activity, showed a band expression of 685 bp , indicating that the brightness of the flour was slightly darker than that of the case of the kumquam wheat. In puroindolines related to seedling hardness, hard wheat characteristics such as diamond strength were observed in Pina - D1 and Pinb - D1 . It is considered that the genetic characteristics related to quality are the same as those of kumquang wheat.
실시예Example 5: ' 5: ' 익산370호'의Iksan 370 재해저항성 평가 Assessment of disaster resistance
재해저항성 평가에서 내한성은 국립식량과학원 운봉시험지(전북 남원시)에서 실시하였으며, 주요 조사항목은 고사율, 고엽장, 고엽율을 조사하였다. 붉은곰팡이병 저항성 검정을 위하여 Fusarium graminearum을 이용하였으며 접종방법은 출수기 후 꽃이 필 때 스프레이를 이용한 Type I 방식과 주사기를 이용한 Type Ⅱ 방식을 이용하였다. 붉은곰팡이병 이병률(FHB severity)은 전체립수에서 병에 걸린 립수의 비율로 조사하였다. 흰가루병 저항성 검정은 Bluemeira graminis를 이용하였으며, 접종방식은 유묘기와 성체시기에 조사를 실시하였다. 유묘검정에서 저항성 정도는 O, R, M, S로 구분 판정하였고, 성체검정은 0~9 등급으로 나누어 조사하였다. 수발아 저항성 검정은 출수 후 35일경 이삭을 채취하여 포화습도가 100% 유지되는 암실에서 7일간 처리한 후 전체 립수에 대한 수발아된 립수의 비율로 표기하였다.Cold resistance was evaluated at the Unbong Test Center of the National Institute of Food Science and Technology (Namwon, Jeonbuk). For the resistance test of red fungus, Fusarium Graminearum was used as the inoculation method. Type I method using spray when spraying flowers after heading and Type II method using syringe were used. FHB severity was assessed as a percentage of the number of diseased wines in the total number of wines. The powdery mildew resistance test was performed by Bluemeira Graminis was used for the inoculation method and the seedling stage and adult stage were investigated. In the seedlings test, the degree of resistance was classified as O, R, M, S, and adult test was divided into 0 ~ 9 grades. The avalanche resistance test was carried out for about 35 days after heading, and the ratio was expressed as the ratio of the total number of wrinkles to the total number of wrinkles after 7 days in the dark room where the saturation humidity was maintained at 100%.
이병율(%)Red mold
Disease rate (%)
(cm)A leafy leaf
(cm)
(%)Solid leaf rate
(%)
그 결과, 재해저항성은 상기 표 11에 나타낸 바와 같다. 국립식량과학원 운봉출장소에서 실시한 내한성 검정결과 고사된 개체는 없었으나 고엽이 발생 되었다. 즉, '익산370호'는 고엽장이 0.3cm로 고엽장이 적고 고엽율이 2.5%로 낮아 금강밀에 비해 내한성이 강하였다. 붉은곰팡이병 저항성은 Type I과 Type Ⅱ에서 각각 73.0%와 87.7%의 이병율을 보여 금강밀보다는 약하였다. 흰가루병 저항성은 유묘기에 중도저항성을 보였고, 성체검정에서는 1등급으로 금강밀보다 저항성이 강하였다. 수발아율은 13.9%로 금강밀보다 수발아에는 강하였다.
As a result, the disaster resistance was as shown in Table 11 above. As a result of the cold tolerance test conducted at Ungong Branch of the National Institute of Food Science, In other words, 'Iksan 370' had a low leaf height of 0.3cm and a low leaf rate of 2.5%. Resistance of red mold was 73.0% and 87.7% in Type I and Type Ⅱ, respectively. The resistance to powdery mildew disease showed moderate resistance in the seedling stage and in the adult test, it was more resistant than Kumkang wheat. The water germination rate was 13.9%, which was stronger than that of gold mild wheat.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며, 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허청구범위의 의미 및 범위, 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.
From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, and all changes or modifications derived from the equivalents thereof will be included in the scope of the present invention.
<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> A new plant type wheat'Iksan370' with long spikes, high yield and hard wheat and breeding method thereof <130> PA130789/KR <160> 14 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1 forward primer <400> 1 cgtccctata aaagcctagc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1 reverse primer <400> 2 agtatgaaac ctgctgcgca c 21 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Wx-A1 forward primer <400> 3 ccgcgcttgt agcagtggaa gtacc 25 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Wx-A1 reverse primer <400> 4 tcgtgttcgt cggcgccgag atgg 24 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Wx-B1 forward primer <400> 5 ctgacgtcca tgccgttgac ga 22 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Wx-B1 reverse primer <400> 6 ctggcctgct acctcaagag caact 25 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wx-D1 forward primer <400> 7 acaggatctc tcctggaag 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wx-D1 reverse primer <400> 8 gcaaggaaaa tagtgaagc 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPO18 forward primer <400> 9 ctgctggctc ttcttccca 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPO18 reverse primer <400> 10 aagaagttgc ccatgtccgc 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Pina-D1 forward primer <400> 11 atgaaggccc tcttcctca 19 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Pina-D1 reverse primer <400> 12 tcaccagtaa tagccaatag tg 22 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Pinb-D1 forward primer <400> 13 atgaagacct tattcctcct a 21 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Pinb-D1 reverse primer <400> 14 tcaccagtaa tagccactag ggaa 24 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) ≪ 120 > A new plant type wheat ' Iksan370 ' with long spikes, high yield and hard wheat and breeding method thereof <130> PA130789 / KR <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1 forward primer <400> 1 cgtccctata aaagcctagc 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glu-D1 reverse primer <400> 2 agtatgaaac ctgctgcgca c 21 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Wx-A1 forward primer <400> 3 ccgcgcttgt agcagtggaa gtacc 25 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Wx-A1 reverse primer <400> 4 tcgtgttcgt cggcgccgag atgg 24 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Wx-B1 forward primer <400> 5 ctgacgtcca tgccgttgac ga 22 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Wx-B1 reverse primer <400> 6 ctggcctgct acctcaagag caact 25 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wx-D1 forward primer <400> 7 acaggatctc tcctggaag 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wx-D1 reverse primer <400> 8 gcaaggaaaa tagtgaagc 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PPO18 forward primer <400> 9 ctgctggctc ttcttccca 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPO18 reverse primer <400> 10 aagaagttgc ccatgtccgc 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Pina-D1 forward primer <400> 11 atgaaggccc tcttcctca 19 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Pina-D1 reverse primer <400> 12 tcaccagtaa tagccaatag tg 22 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Pinb-D1 forward primer <400> 13 atgaagacct tattcctcct a 21 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Pinb-D1 reverse primer <400> 14 tcaccagtaa tagccactag ggaa 24
Claims (5)
i) 식물학적 특성
초장: 90 내지 100cm
잎의 색: 녹색
잎의 수: 17 내지 23개
잎 면적: 180 내지 210cm2
이삭의 길이: 13 내지 18cm
까락의 길이: 5.7 내지 7.0cm
이삭당 립수: 50 내지 70개
지엽 길이: 25 내지 30cm
지엽 폭: 1.5 내지 2.3cm
지엽 면적: 10 내지 20cm2;
ii) Xian 83을 모본으로 하고, 금강밀을 부본으로 한 교잡종임; 및
iii) 야생형의 Wx-A1, Wx-B1 및 Wx-D1의 GBSS(granule-bound starch synthase) 유전자, 685bp 크기의 PPO18 유전자, 야생형의 Pina-D1 유전자 및 변이형의 Pinb-D1 유전자를 갖는 것임.
'Iksan 370', a milky line deposited with KACC 98034P, characterized by having a long grain and a large number of ripples and having all of the following characteristics:
i) Botanical characteristics
Height: 90 to 100 cm
Leaf color: green
Number of leaves: 17 to 23
Leaf area: 180 to 210 cm 2
Length of ear: 13 to 18 cm
Length of the rock: 5.7 to 7.0 cm
Ribs per ear: 50 to 70
Length of paper: 25 to 30 cm
Paper width: 1.5 to 2.3 cm
Area of the sheet: 10 to 20 cm 2 ;
ii) Hybrid with Xian 83 as an example and a gold mine as a duplicate; And
iii) has a granule-bound starch synthase (GBSS) gene of wild type Wx-A1, Wx-B1 and Wx-D1, a PPO18 gene of 685 bp size, a wild type Pina-D1 gene and a mutant Pinb-D1 gene.
상기 교잡종(F1)의 식물체의 이삭에서 발생된 분리세대(F2) 중에서 내한성이 양호한 계통을 선발하는 단계;
상기 선발된 식물체의 제3세대(F3)를 집단 재배하여 이삭이 길고 립수가 많은 계통을 선발하는 단계; 및
상기 선발된 식물체의 제4세대(F4) 종자를 계통육종법에 의해 포장에 공시하여, 이삭이 길고, 립수가 많으며, 도복(倒伏)에 강한 계통을 선발하는 단계를 포함하는 것을 특징으로 하는, KACC98034P로 기탁된 밀 신계통 ‘익산370호’의 육종방법.
Xian 83 as an example and hybridizing with a goldsmith mill as a copy;
Selecting a line having a favorable cold tolerance among the separated generations (F 2 ) generated from the spike of the plant of the hybrid (F 1 );
Collecting the third generation (F 3 ) of the selected plants to select a line having a long egg and a large number of rips; And
The disclosure of the fourth generation (F 4) Seeds of the selection of the plant in the packaging by the strain breeding, Isaac long, often the number of ribs, comprising the steps of: selecting a strong system for lodging (倒伏), characterized in, A method of breeding the milky line "Iksan 370" deposited with KACC98034P.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130120136A KR101546499B1 (en) | 2013-10-08 | 2013-10-08 | 370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130120136A KR101546499B1 (en) | 2013-10-08 | 2013-10-08 | 370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20150041717A KR20150041717A (en) | 2015-04-17 |
KR101546499B1 true KR101546499B1 (en) | 2015-08-25 |
Family
ID=53035085
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020130120136A KR101546499B1 (en) | 2013-10-08 | 2013-10-08 | 370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101546499B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101960068B1 (en) * | 2018-10-16 | 2019-03-19 | 고려대학교 산학협력단 | Novel Variety of Extra-short Wheat cultivar 'Mini' |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017217589A1 (en) * | 2016-06-17 | 2017-12-21 | 대한민국(농촌진흥청장) | Wheat strain ofree for reducing gluten intolerance |
KR102035666B1 (en) * | 2017-08-09 | 2019-11-29 | 대한민국 | A new variety of wheat ((KCTC18591P) and Food compsotion for anti-oxidative activity comprising thereof. |
-
2013
- 2013-10-08 KR KR1020130120136A patent/KR101546499B1/en active IP Right Grant
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101960068B1 (en) * | 2018-10-16 | 2019-03-19 | 고려대학교 산학협력단 | Novel Variety of Extra-short Wheat cultivar 'Mini' |
Also Published As
Publication number | Publication date |
---|---|
KR20150041717A (en) | 2015-04-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Mekonnon | Selection of barley varieties for their yield potential at low Rain Fall Area based on both quantitative and qualitative characters North West Tigray, Shire, Ethiopia | |
Reddy et al. | Sorghum improvement (1980–2010): Status and way forward | |
KR101546499B1 (en) | 370 A new plant type wheatIksan370 with long spikes high yield and hard wheat and breeding method thereof | |
CN107896978A (en) | A kind of selection for special glutinous rice variety of making wine | |
Chaudhary et al. | Effect of different dates of sowing on yield attributes, yield and quality of Barley (Hordeum vulgare L.) cultivars | |
Ajibola et al. | Agronomic evaluation of performance of sesame varieties in maize-based intercropping system in the southern guinean savanna of Nigeria | |
KR101201436B1 (en) | A black waxy giant embryo rice plant 'Milyang 263' harboring giant embryonic gene and breeding method thereof | |
CN101300957A (en) | Method for breeding Zhen dao No. 13 using ladder polymerization improved technique | |
Singh et al. | Widening the genetic base of Indian barley through the use of exotics | |
Rerkasem | The Agroecosystem of Thai rice: a review | |
Ben‐Zeev et al. | Unraveling the central role of root morphology and anatomy in lodging of tef (Eragrostis tef) | |
Oluwaranti et al. | Grain yield of maize varieties of different maturity groups under marginal rainfall conditions | |
Stehno | Emmer wheat Rudico can extend the spectra of cultivated plants | |
WHITE | The effects of mixing barley cultivars on incidence of powdery mildew (Erysighe graminis) and on yield in Northern Ireland | |
JP5906080B2 (en) | Rice varieties resistant to brown planthopper | |
Divashuk et al. | Effect of allelic forms of GRFs genes on the development of common wheat under different conditions of nitrogen supplementation | |
Krishna et al. | Components of genetic variation for Macrophomina phaseolona resistance in maize. | |
Georgieva et al. | Model of forage pea (Pisum sativum L.) cultivar in conditions of organic production. | |
Ahmed et al. | Detection of Genetic Similarity of Sugarcane Genotypes. | |
CN107821158A (en) | A kind of selection of black rice wine specific breed | |
KR102618294B1 (en) | New japonica rice variety 'Sebok' with increased environmental stress resistance and antioxidant content and breeding method thereof | |
Koroleva et al. | Features of heterosis manifestation in interlinear hybrids of sweet pepper in unheated film greenhouses | |
Chandrawanshi et al. | Effect of Nitrogen and Foliar Applied Boron on Yield and economics of Barlyaey (Hordeum vulgare L.) | |
Sholihin | Vamas 1, a new early root bulking, high-yielding, high-starch content cassava variety | |
KR20230124843A (en) | Breeding method for brown rice using KASP marker-assisted backcrossing and rice having thin seed coat and aleurone layer produced by the method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |