KR101535737B1 - Compositions for diagnosis and treatment of preeclampsia comprising miRNA - Google Patents

Abstract

The present invention relates to a composition for diagnosing preeclampsia, which includes a formulation for measuring an expression level of miRNA having increasing or decreasing expression in the preeclampsia placenta compared to a normal control group, and to a diagnosing kit including the same. Moreover, the present invention relates to a composition for preventing or treating preeclampsia by using the miRNA, a method for providing information for diagnosing preeclampsia, and a method for screening a preeclampsia treating agent. According to the present invention, as a result of analyzing an miRNa expression profile in the preeclampsia (PE) placenta compared to a normal control group, it has been clarified that thirteen miRNA molecules are upwardly adjusted and two miRNA molecules are downwardly adjusted. Accordingly, a technique of the present invention using corresponding miRNA in the field of diagnosing and treating preeclampsia may be very usefully used.

Description

[0001] The present invention relates to a composition for diagnosis and treatment of preeclampsia comprising miRNA,

The present invention relates to a composition for diagnosing preeclampsia comprising an agent for measuring an expression level of miRNA whose expression is increased or decreased in the placenta of preeclampticus compared to a normal control group, and a diagnostic kit comprising the same. The present invention also relates to a composition for preventing or treating preeclampsia using the miRNA, a method for providing information for the diagnosis of preeclampsia, and a screening method for treating preeclampsia.

Preeclampsia (PE) is the leading cause of mortality and morbidity in pregnant and newborn babies worldwide. PE is characterized by pregnancy-associated hypertension with impaired proteinuria. PE occurs in about 5-8% of all pregnant women and approximately 25% of all PEs experience intrauterine growth retardation (IUGR) (Chelbi ST, et al., Mol Cell Endocrinol 2008; 282 (1-2): 120-9). Despite efforts to identify pathogenesis, the main cause of PE remains to be understood. However, it is clear that the placenta plays a pivotal role in the pathogenesis of PE (Noack F, et al., J Perinat Med 2011; 39 (3): 267-71). It has been recognized that PE occurs as a result of a variety of processes including insufficient immune tolerance, impaired placentation, endothelial cell dysfunction, and systemic inflammation (White LJ, et al., Reprod Biol Endocrinol 2009; 7: 98). The placenta serves as a source of mediators for these processes (Enquobahriade, et al., Am J Obstet Gynecol 2011; 204 (2). 178.e12-e21).

The mechanism of PE appears to be a combination of genetic, epigenetic, and environmental factors. In fact, reproductive processes play an important role in the development and recording of environmental signals through phenomena known as 'fetal programming' (Krause B, et al., Curr Vasc Pharmacol 2009; 7 (4): 513-20). Although there are studies that have revealed different gene expression in PE, the posterior control of the placenta is not known (Enquobahrie DA et al., Am J Obstet Gynecol 2011; 204 (2). 178.e12-e21). In addition to DNA methylation and histone modification, different expression patterns of miRNAs in the placenta of various pathological pregnancies have recently been reported (Choudhury M, et al., Clin Exp Hypertens 2012; 34 (5): 334e41).

MicroRNAs (miRNAs) are short (~ 22 nucleotides), single stranded, non-coding RNA molecules. miRNA plays an important role in gene regulation after transcription. miRNAs induce messenger RNA (mRNA) degradation or translational repression through complementary base pairing. Over 1,000 miRNAs have been identified in the human genome (miRBase). Most miRNAs target one or more mRNAs simultaneously. In addition, several miRNAs target the same mRNA, which can induce a synergistic effect. miRNA plays an important role in various cellular processes such as differentiation, proliferation, apoptosis, metabolic homeostasis, tumorigenesis and DNA methylation (Li H, et al., Hypertension 2003; 42 (5): 895-900). Thus, profiling miRNA expression can provide important information on the investigation of physiological and pathological conditions.

Recent studies have reported that miRNA regulation disorders are associated with the pathogenesis of PE (Hu Y, et al., Clin Chem Lab Med 2009; 47 (8): 923-9). In addition, miRNAs may be useful in the diagnosis and prediction of pregnancy-related disorders because placental miRNAs are secreted into the maternal circulation (Prieto DM, et al., J Reprod Immunol 2011; 88 (2): 106-11). However, the study of array-based miRNA profiling in PE suggests a lack of consistent results (Mayor-Lynn K, et al., Reprod Sci 2011; 18 (1): 46-56). More research is needed to resolve these differences. In the present invention, microarray analysis of miRNA expression profiles, as well as real-time qRT-PCR analysis, was performed in placental tissues from severe PE and normal blood pressure pregnant women to investigate the relationship between placental miRNA and PE pathogenesis.

Therefore, it is a primary object of the present invention to provide a method for diagnosing preeclampsia, which comprises administering to a mammal in need of such treatment a therapeutically effective amount of at least one of miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR- comprising an agent that measures the expression level of one or more miRNAs selected from the group consisting of miR-26a, miR-198, miR-202, miR-191, miR-95, miR-204, miR- And a composition for diagnosing preeclampsia.

It is another object of the present invention to provide a kit for the diagnosis of preeclampsia comprising the diagnostic composition.

It is still another object of the present invention to provide a method for providing information necessary for the diagnosis of preeclampsia, which comprises measuring the expression of the one or more miRNAs from a biological sample of a patient to be diagnosed.

It is still another object of the present invention to provide a pharmaceutical composition for preventing or treating preeclampsia comprising the miRNA or an expression inhibitor thereof as an active ingredient.

It is still another object of the present invention to provide a screening method of a therapeutic agent for preeclampsia using the miRNA.

In order to achieve the above object, the present invention provides a pharmaceutical composition comprising miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR- 198, miR-202, miR-191, miR-95, miR-204, miR-21 and miR-223 .

In one embodiment of the invention, the expression level of the miRNA can be measured in the placenta or maternal blood of a patient suspected of having preeclampsia.

In one embodiment of the invention, the agent may be a primer or a probe that specifically binds to the miRNA.

In addition, the present invention provides a kit for the diagnosis of preeclampsia comprising the diagnostic composition.

The present invention also relates to a method of screening for a disease or condition selected from the group consisting of miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR-25, miR- Providing information necessary for the diagnosis of preeclampsia comprising measuring the expression of one or more miRNAs selected from the group consisting of miR-198, miR-202, miR-191, miR-95, miR-204, miR-21 and miR- ≪ / RTI >

In one embodiment of the present invention, the expression of the miRNA can be measured using a reverse transcriptase polymerase, a competitive reverse transcriptase polymerase, a real-time reverse transcriptase polymerase, an RNase protection assay, northern blotting, or a gene chip have.

The present invention also provides miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR-25, miR-296-3p, miR- , miR-191, miR-95 and miR-204 as an active ingredient. The present invention also provides a pharmaceutical composition for preventing or treating preeclampsia.

In one embodiment of the present invention, the miRNA expression inhibitor may be an antisense oligonucleotide consisting of a sequence complementary to the miRNA nucleotide sequence.

The present invention also provides a pharmaceutical composition for preventing or treating preeclampsia comprising miR-21 or miR-223 as an active ingredient.

In one embodiment of the present invention, the miR-21 or miR-223 may be inserted into an expression vector.

The present invention also relates to a pharmaceutical composition comprising a) miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR-25, miR-296-3p, miR- -202, miR-191, miR-95, miR-204, miR-21 and miR-223 in a cell comprising a nucleotide sequence encoding a miRNA selected from the group consisting of: MiR-296-5p, miR-26b, miR-25, miR-296-3p, and miR-26a , the test substance is judged to be a therapeutic agent for preeclampsia when the expression of miR-198, miR-202, miR-191, miR-95 or miR-204 is decreased or the expression of miR-21 or miR- The present invention provides a screening method for a therapeutic agent for preeclampsia.

According to the present invention, an analysis of the miRNA expression profile in the placenta of preeclampsia (PE) compared to a normal control revealed that 13 miRNAs were up-regulated and 2 miRNAs were down-regulated. Therefore, the technique of the present invention using the miRNA in the field of diagnosis and treatment of preeclampsia can be very usefully used.

Figure 1 is a diagram showing the histopathological characteristics of placenta preeclampticus.
Figure 2 shows the expression of miRNAs using real-time RT-PCR analysis.

The present invention analyzed miRNA expression profiles using PNA-based microarray methods. As a result, 13 miRNAs were up-regulated in the placenta of preeclampsia (PE) compared to the normal control, and 2 miRNAs were down-regulated.

Based on the results of these studies, the present inventors intend to provide novel diagnostic and therapeutic uses of miRNAs whose expression level changes in the placenta of preeclampsia.

In the present invention, miRNA profiles were analyzed using a hybridization-based method using PNA probes. This method is a sensitive sensitive specific tool for detection of target miRNA. Because PNA is uncharged unlike DNA, and the binding force between PNA and RNA strands is strong (Gambari R. Curr Pharm Des 2001; 7 (17): 1839-62). In addition, these platforms used the 'labeling on-chip' method to directly label mature miRNAs after hybridizing to microarray slides. Therefore, its specificity is increased. Modified miRNAs (miR-92b, miR-197, miR-296-4p, miR-296-4p, miR-26b, miR-25 and miR-296-3p) RT-PCR was performed to verify microarray data. RT-PCR was also performed using independent validation samples as well as a training set. All seven miRNAs significantly increased in PE placenta in agreement with microarray data. MiR-92b showed the greatest change (12.28 fold change) in the PE patients of the present invention (see Table 2). However, this molecule was not investigated much. However, several predicted target genes for miR-92b appear to be related to the pathogenesis of PE. KLF4 is a cell cycle inhibitor and is known to promote trophoblast differentiation. Disruption of trophoblast differentiation can lead to PE (White LJ, et al., Reprod Biol Endocrinol 2009; 7: 98). In addition, TEF has been reported to be involved in the differentiation of the cytotrophoblast into syncytiotrophoblast (Jacquemin P, et al., Dev Dyn 1998; 212 (3): 423-36). These reports support that miR-92b is highly involved in the pathogenesis of PE. However, additional functional studies are needed to investigate the interaction between miR-92b and these molecules.

It is clear that the precise etiology of PE remains to be investigated, but the placenta plays a decisive role in the development of PE. According to the previous hypothesis, damaged extravillous trophoblasts cause failure of physiologic conversion of the uterine spiral artery, which in turn leads to hypoxia, Release of the fragment, and maternal inflammatory response (Huppertz B. Hypertension 2008; 51 (4): 970-5).

Early detection can provide adequate management and prevention, but PE can not be detected until clinical symptoms occur. Despite considerable advantages, early diagnosis and prevention of PE remains an important challenge. In recent decades there has been tremendous effort to find serum markers for early detection of PE. Soluble VEGF receptor-1, soluble PIGF (placental growth factor), and endoglin (an antiangiogenic protein) have been proposed as potential markers for PE. However, they are less than expected due to low detection rates and diagnosis in late pregnancy (Thadhani R, et al., J Clin Endocrinol Metab 2004; 89 (2): 770-5). Therefore, it is urgently necessary to identify non-invasive biomarkers for early detection of PE.

As mentioned above, the first confirmable pathological feature is poor megakaryocyte cell migration resulting from the lack of physiological conversion of the spiral arteries of the decidual membrane (Lala PK, et al., Placenta 2003; 24 (6): 575- 87). The present invention demonstrates that the target genes of 15 differentially expressed miRNAs in PE are associated with cell migration signaling pathways, adherence junctions, focal adhesion and TGF signaling pathways. Further, HGF and ADM among the common target genes of the present invention need to be further studied. Both genes are associated with reduced expression in PE and with nutrient migration and syncytialization (Kauma SW, et al., J Clin Endocrinol Metab 1999; 84 (11): 4092-6). Based on these results, miRNA regulatory disorders will cause dysfunction in the early stages of the pathogenesis.

In addition, placenta miRNA is released into maternal blood and is likely to cause a pregnancy disease (Prieto DM, et al., J Reprod Immunol 2011; 88 (2): 106-11). Thus, plasma miRNA levels and patterns can be biomarkers for early diagnosis of preeclampsia. In the present invention, since miR-92b exhibits the greatest change in PE, large-scale studies on the measurement of serum expression of these miRNAs containing miR-92b should be performed. In addition, posterior sexual therapy can fundamentally provide a management tool due to the reversibility of postural changes (Nelissen EC, et al., Hum Reprod Update 2011; 17 (3): 397-417).

Environmental stimuli can interfere with the epigenetics of the placenta. In addition, recent studies have reported that endothelial dysfunction in the maternal subject can persist for a long period of time and induce cardiovascular disease in old age (Steinberg G, et al., Thromb Res 2009-123 (Suppl. 2): S93-9). In addition, PE contributes to the risk of development of metabolic syndrome associated with low birth weight at adulthood, known as 'welfare genetic markers' (Wu L, et al., Reproduction 2012; 143 (3): 389-97). Overexpression of miR-198 has been reported to be associated with coronary artery disease (Hoekstra M, et al., Biochem Biophys Res Commun 2010; 394 (3): 792-7). It has also been reported that miR-223 is expressed at low levels in patients with type 2 diabetes (Zampetaki A, et al., Circ Res 2010; 107 (6): 810-7).

In accordance with the present invention, the present invention provides miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR- A method for measuring the expression level of one or more miRNAs selected from the group consisting of miR-26, miR-26a, miR-198, miR-202, miR-191, miR-95, miR-204, miR- And a composition for the diagnosis of preeclampsia.

From the 158 human miRNAs known to be associated with cancer or stem cells, the miRNAs were analyzed by PNA-based profiling assays to reveal the pathogenesis of placental miRNA and preeclampsia (PE) . Therefore, the miRNAs selected by the present inventors can be used for diagnosis and treatment of preeclampsia as a new medical use.

MiRNAs of the present invention are composed of the sequences shown in Table 1 below.

microRNA order  miR-92b AGGGACGGGACGCGGUGCAGUG  miR-197 CGGGUAGAGAGGGCAGUGGGAGG  miR-342-3p UCUCACACAGAAAUCGCACCCGU  miR-296-5p AGGGCCCCCCCUCAAUCCUGU  miR-26b UUCAAGUAAUUCAGGAUAGGU  miR-25 AGGCGGAGACUUGGGCAAUUG  miR-296-3p GAGGGUUGGGUGGAGGCUCUCC  miR-26a UUCAAGUAAUCCAGGAUAGGCU  miR-198 GGUCCAGAGGGGAGAUAGGUUC  miR-202 UUCCUAUGCAUAUACUUCUUUG  miR-191 CAACGGAAUCCCAAAAGCAGCUG  miR-95 UCAAUAAAUGUCUGUUGAAUU  miR-204 UUCCCUUUGUCAUCCUAUGCCU  miR-21 UAGCUUAUCAGACUGAUGUUGA  miR-223 CGUGUAUUUGACAAGCUGAGUU

The present invention is based on confirming that the expression level of the miRNA is significantly increased or decreased in the placenta of patients with severe preeclampsia as compared with the control group of normal blood pressure. That is, the miRNA according to the present invention is used as a diagnostic marker for the preeclampsia.

Accordingly, the present invention provides a composition for diagnosing preeclampsia comprising an agent for measuring the expression level of one or more miRNAs selected from the group consisting of miRNAs.

In the diagnostic composition of the present invention, the expression level of the miRNA can be measured in the placenta or maternal blood of a patient suspected of having preeclampsia. Recent reports indicate that placental miRNAs are secreted into the maternal circulation and thus are useful for the diagnosis and prediction of pregnancy-related disorders (Prieto DM, et al., J Reprod Immunol 2011; 88 (2): 106-11), it is well known in the art that changes in miRNA expression levels in the placenta can be measured through maternal blood.

In the diagnostic composition of the present invention, the agent is not particularly limited as long as it is a substance capable of specifically binding to miRNA and measuring the level of miRNA, and the agent commonly used in the field of bio-kits can be widely used. An oligonucleotide having a complementary sequence or a fragment thereof, and is preferably a primer or a probe that specifically binds to the miRNA.

The primer is a nucleic acid sequence having a short free 3 'hydroxyl group and is capable of forming base pairs with a complementary template and having a short length functioning as a starting point for template strand copy Quot; means a nucleic acid sequence. Primers can be used to initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. In the present invention, the presence or absence of preeclampsia can be diagnosed by performing PCR amplification using a sense and antisense primer that specifically binds to the one or more miRNAs to confirm the expression level. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The probe refers to a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or a long few tens of nucleotides and is labeled. The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. In the present invention, hybridization can be performed using a probe complementary to the one or more miRNAs, thereby confirming the expression level, thereby diagnosing the preeclampsia. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

Such primers or probes can be suitably designed by those skilled in the art based on the sequence of known miRNAs of the present invention.

For example, primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

According to another aspect of the present invention, there is provided a kit for the diagnosis of preeclampsia comprising the diagnostic composition.

The composition for diagnosing preeclampsia of the present invention may contain other components for making the kit suitable for use as a preclinical diagnostic kit in addition to the agent for measuring the expression level of the one or more miRNAs. In addition, the kit for the diagnosis of preeclampsia of the present invention may further include a composition commonly used in a diagnostic kit in addition to the above composition.

For example, the diagnostic kit of the present invention may be a kit containing necessary elements necessary for performing RT-PCR. RT-PCR kits can be used in addition to the respective primer pairs specific for the marker miRNA, as well as enzymes such as test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq polymerase and reverse transcriptase, DNases, RNAse inhibitors, DEPC-water, sterile water, and the like.

The diagnostic kit of the present invention may be a gene chip kit. The gene chip kit may include a substrate on which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. In addition, the substrate may contain a cDNA corresponding to a quantitative control gene or a fragment thereof.

The present invention also relates to a method of screening for a disease or condition selected from the group consisting of miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR-25, miR- Providing information necessary for the diagnosis of preeclampsia comprising measuring the expression of one or more miRNAs selected from the group consisting of miR-198, miR-202, miR-191, miR-95, miR-204, miR-21 and miR- ≪ / RTI >

In the information providing method of the present invention, the biological sample includes, but is not limited to, a tissue, a cell, a whole blood, a serum, plasma, or urine in which the level of expression of the at least one miRNA is different according to whether or not the preeclampsia is present . However, placenta or maternal blood may be preferable for rapid diagnosis.

In the information providing method of the present invention, the expression of the miRNA may be measured using a reverse transcriptase polymerase, a competitive reverse transcriptase polymerase, a real-time reverse transcriptase polymerase, an RNase protection assay, a Northern blotting or a gene chip have.

According to the present invention, when the expression level of the miRNA is significantly or lowly measured in the placenta of the preeclampsia compared to the expression level of the miRNA in the normal blood pressure control placenta, it is possible to provide information that it can be diagnosed as preeclampsia.

In accordance with another aspect of the present invention, there is provided a method of inhibiting miR-92b, miR-197, miR-296-5p, miR-26b, miR-25, miR- A pharmaceutical composition for preventing or treating preeclampsia comprising, as an active ingredient, an miRNA expression inhibitor selected from the group consisting of miR-198, miR-202, miR-191, miR-95, miR-204, miR-21 and miR- Lt; / RTI >

According to the experimental results of the present invention, the miRNAs are overexpressed in the preeclampsia patients compared to the normal blood pressure control owing to the miRNA regulation disorder in the placenta (see Table 2), so that the expression level of the over- The symptoms of the disease can be alleviated or treated.

In the pharmaceutical composition of the present invention, the miRNA expression inhibitor may be an antisense oligonucleotide consisting of a sequence complementary to the miRNA nucleotide sequence.

The 'antisense oligonucleotide' encompasses nucleic acid-based molecules that have a complementary sequence to the targeted miRNA sequence and can form duplexes with miRNAs.

Antisense oligonucleotides that may be used in the present invention include various molecules. Antisense oligonucleotides are DNA or RNA molecules, more preferably RNA molecules. For example, the antisense oligonucleotide may be a ribonucleotide (RNA), a deoxyribonucleotide (DNA), a 2'-O-modified oligonucleotide, a phosphorothioate-backbone deoxyribonucleotide, a PNA (peptide nucleic acid) )to be.

Inhibition of miRNA expression can be achieved by administering a typical antisense oligonucleotide. The length of the antisense oligonucleotide is 7-50 nucleotides, preferably 20-25 nucleotides.

In the present invention, another approach to inhibit expression of the miRNA is to administer an inhibitory RNA molecule, wherein the inhibitory RNA molecule comprises a sequence complementary to the sequence of the miRNA. Such inhibitory RNA molecules include small interfering RNA (siRNA), short hairpin RNA (shRNA) and ribozyme. The 'siRNA' is a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 and WO 00 / 44914). Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method.

According to still another aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating preeclampsia comprising miR-21 or miR-223 as an active ingredient.

According to the experimental results of the present invention, since the miRNAs are low expressed in the preeclampsia patients compared with the normal blood pressure control group due to the miRNA regulation disorder in the placenta (see Table 2), the miRNA expression level of low expression is restored to normal level The symptoms of pre-eclampsia can be alleviated or treated.

In the pharmaceutical composition of the present invention, a gene encoding the nucleotide sequence of miR-21 or miR-223 may be inserted into an expression vector.

MiRNA expression vectors can be transformed into or infected into cells so that the miRNA of the present invention can be transiently or permanently expressed in the cells. The expression vector of the present invention can be constructed by a recombinant DNA method known in the art.

The expression vector may be selected from the group consisting of plasmids, lentiviral vectors, retroviral vectors, and adenoviral vectors known in the art, which are used for replication and expression of mammalian cells or other target cell types. In the present invention, viral vectors are particularly preferred. This is because the effect of the viral vectors is considered to be high because the efficiency of nucleic acid delivery in vivo is high.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carriers are those conventionally used in the field of manufacture and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, But are not limited to, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally. In the case of parenteral administration, the composition can be administered by intravenous infusion, local injection, intracerebral infusion, spinal cord infusion, subcutaneous infusion, intraperitoneal injection, .

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-100 mg / kg.

The pharmaceutical composition of the present invention may be prepared in a unit dosage form by formulating it with a pharmaceutically acceptable carrier or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs Into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

According to another aspect of the present invention, there is provided a pharmaceutical composition comprising a) miR-92b, miR-197, miR-342-3p, miR-296-5p, miR- The cells containing the nucleotide sequence encoding miRNAs selected from the group consisting of miR-198, miR-198, miR-202, miR-191, miR-95, miR-204, miR-21 and miR- ; MiR-296-5p, miR-26b, miR-25, miR-296-3p, and miR-26a , the test substance is judged to be a therapeutic agent for preeclampsia when the expression of miR-198, miR-202, miR-191, miR-95 or miR-204 is decreased or the expression of miR-21 or miR- The present invention provides a screening method for a therapeutic agent for preeclampsia.

In the screening method of the present invention, first, a sample to be analyzed is brought into contact with cells containing the nucleotide sequence of the miRNA. The cell containing the miRNA nucleotide sequence of the present invention is not particularly limited, and preferably is a cell transformed by inserting the nucleotide sequence of the aforementioned miRNA into an expression vector.

In the screening method of the present invention, the measurement of the expression level of the miRNA may be performed by a reverse transcriptase polymerase reaction, a competitive reverse transcriptase polymerase reaction, a real-time reverse transcriptase polymerase reaction, an RNase protection assay, a Northern blotting, Gene chip or the like.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.

Example  1. Sample Preparation

Patients diagnosed with PE from 1998 to 2009 in Chungnam National University Hospital were searched. A total of 95 PE cases were identified, of which 21 cases of severe PE were selected according to exclusion criteria for twin pregnancy, gestational diabetes, no decidual portion and incomplete clinical information. According to the American College of Obstetricians and Gynecologists, severe preeclampsia is defined as the presence of one or more of the following criteria: Severe gestational hypertension (maximum blood pressure> 160 mmHg or minimum blood pressure > 110 mmHg) or 24 h urine samples with protein ≥ 5 g (Choudhury M, et al., Clin Exp Hypertens 2012; 34 (5): 334-41). Twenty placenta samples from normal blood pressure pregnancies with uncomplicated proteinuria were selected as controls. For normal histological examination, full thickness sections were sampled from the center of a placental disc approximately 2 cm in umbilical cord insertion. Placental tissue was fixed overnight in 4% buffered formalin and then embedded in paraffin. Demographic and clinicopathological characteristics of the study population are shown in Table 2 below. The present inventors divided the samples into two groups, a training set and a validation set, as shown in Table 2 below.

Example  2. Clinical pathological characteristics

The present inventors confirmed maternal age, gestational age, parity, blood pressure, placental weight, fetal sex, and neonatal weight. Small for gestational age (SGA) is defined as a newborn infant with a gestational age of less than 10%. The present inventors have found that in four categories of decidual vasculopathy (lack of physiologic conversion, atherosis, thrombosis, fibrinoid necrosis), infarct, placenta abruption and villous maldevelopment, Histological features were investigated. Immunohistochemical (IHC) studies were performed to support histopathologic results. IHC staining of alpha-smooth muscle actin (SMA) was performed to confirm the absence of physiologic conversion in the retained muscle layer. IHC staining for alpha-SMA and CD68 was performed to confirm atherosclerosis of decidual vessels. All research courses were approved by the Audit Committee of Chungnam National University Hospital.

Example  3. miRNA  Array

miRNA profiling was performed using a training set (10 plaques from severe PE and 10 plaques from control). Total RNA was obtained from 10 mm sections of formalin-fixed and paraffin-embedded (FFPE) blocks according to the manufacturer's protocol using Trizol reagent (Invitrogen, CA). High purity total RNA was identified using a NanoDrop Spectrophotometer. A total of 400 ng of RNA was used from each sample. miRNAs were labeled according to the instruction manual using a profiling kit (PANArray ^™ miRNA expression profiling kit; PNANGENE Inc., Daejeon, South Korea). The profiling kit is a peptide nucleic acid (PNA) -based microarray. Each microarray contained 158 human miRNAs. Hybridization images were obtained using a scanner (GenePix 4000B scanner; Axon Instruments, Foster City, Calif.). Over-expressing miRNAs were identified when the ratio of miRNA expression levels in PE to control was greater than 2 and underexpression was observed when the ratio was less than 0.5.

Example  4. Real-time quantitative RT - PCR Micro using RNA  Expression verification

Real-time RT-PCR was performed for the verification of miRNA microarray results using total samples including population and validation population. Total RNA was inverted into cDNA using a reverse transcription kit (TaqMan MicroRNA Reverse Transcription Kit; ABI, Applied Biosystems, USA) according to the manufacturer's protocol. The specific miRNA primers were designed using a commercial Taqman probe based on the sequence of the miRNA and provided to a TaqMan MicroRNA Assay Kit (Applied Biosystems). Using the small nuclear RNA (small nuclear RNA) U6 is universal expressed is used as an endogenous control, Comparative C _T method (comparative C _T method) was used to calculate the miRNA expression.

Example  5. Micro RNA Target gene and function analysis

Algorithm Algorithms TargetScan (http://www.targetscan.org/), miRanda (http://microrna.sanger.ac.uk/targets), PicTar (http://pictar.bio.nyu.edu/) and mirTarget2 (http://www.mirdb.org/miRDB) was used. To reduce the number of false positives, only mRNA targets expected by at least three of the four programs were selected. The expected target genes were entered into DAVID (bioinformatics resources) for extraction of biological features and meanings associated with large gene lists. The statistical significance of the paths was determined based on p-value <0.05.

Statistical analysis

miRNA expression levels were compared between PE and control using the Mann-Whitney U- test of SPSS 16.0.

Results 1. Clinical pathology

In the present invention, 21 severe PE pregnant women and 20 normal blood pressure control groups were tested. Gestational periods in both groups were compared in the population because of the choice to exclude gestational age effects. However, gestational age of PE group was shorter than control group. The PE group included more cases of nulliparous pregnancy and the female fetus was compared to the control group in both population and validation groups. All PE pregnancies were accompanied by SGA. According to histopathological results, most PE placenta was decidual vasculopathy or villous maldevelopment (Fig. 1), which did not occur in the control group.

Figure 1 is a diagram showing the histopathological characteristics of placenta preeclampticus. In most cases, decidual vasculopathy (AD) and poorly formed villi (EF) develop. (A) Normal decidual blood vessels show large and serpentine features. (B) a lack of physiological conversion; In the decidua, the small artery maintains a small lumen with a muscle layer, and (C) immunohistological staining for alpha-smooth muscle actin is highlighted around the muscle layer. (D) arteriosclerosis in decidual vasculature; The inner membrane is replaced by a cholesterol-rich macrophage (arrow). (E) thrombosis (arrow), (F) fibrinoid necrosis in the decidual vasculature, and (G) tertiary villi with a trophoblastic feeder. (H) Happosite tuberculosis; Arrows indicate increased haploid nodules (> 30% of villi). (I) high branching angiogenesis; The PE placental villus represents an increased number of branches and (G) an increased number of villous capillaries compared to normal placenta.

Results 2. In the placenta miRNA Control disorder

We measured the level of expression of 158 miRNAs for each profile using a commercially available hybridization-based microarray. 15 miRNAs were differentially expressed between the PE placenta and the control group. 13 miRNAs (miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR-25, miR-296-3p, miR- miR-191, miR-95 and miR-204) were overexpressed in the PE placenta compared with normal blood pressure placenta. Two miRNAs (miR-21 and miR-223) were down-regulated in the PE placenta compared to normotensive placenta (Table 3).

To verify microarray data, seven miRNAs (miR-92b, miR-197, miR-342-3p, miR-296-5p, miR-26b, miR- 25, miR-296-3p) were tested using real-time RT-PCR. 21 PEs and 20 control samples (population + validation group) were evaluated. According to microarray results, all 7 miRNAs were significantly increased in PE placenta ( p? 0.001, Mann-Whitney U- test; Fig. 2).

Figure 2 shows the expression of miRNAs using real-time RT-PCR analysis. All values were normalized to the level of U6. In the microarray results, seven miRNAs showing over 3-fold change compared to the control were significantly overexpressed in PE. Results are consistent with microarray results.

Experimental results 3. Expected target gene and functional analysis

We obtained 893 genes predicted by at least three of the four math algorithms (data not shown). The results of the target gene function analysis based on KEGG (Kyoto Encyclopedia of Genes and Genomes) and the Biocarta pathway are shown in Table 4 below.

The target genes of 15 significant miRNAs are composed of various signaling pathways, adherence junctions, focal adhesion, regulation of the actin cytoskeleton, and pathways in the cancers along the KEGG pathway . In addition, target genes are associated with Rac 1 cell motility signaling pathways according to PDGF (platelet-derived growth factor), EGF (epidermal growth factor), IL-6 (interleukin-6) there was. Common target genes, a common target of three or more over-expressed miRNAs and a common target of two less expressed miRNAs, are shown in Table 5 below.

Seventeen genes were commonly targeted by three or more over-expressed miRNAs, and two genes were commonly targeted by two low-expressed miRNAs (miR-21 and miR-223).

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Compositions for diagnosis and treatment of preeclampsia          comprising miRNA <130> NP13-1402 <160> 15 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 agggacggga cgcggugcag ug 22 <210> 2 <211> 23 <212> RNA <213> Homo sapiens <400> 2 cggguagaga gggcaguggg agg 23 <210> 3 <211> 23 <212> RNA <213> Homo sapiens <400> 3 ucucacacag aaaucgcacc cgu 23 <210> 4 <211> 21 <212> RNA <213> Homo sapiens <400> 4 agggcccccc cucaauccugu 21 <210> 5 <211> 21 <212> RNA <213> Homo sapiens <400> 5 uucaaguaau ucaggauagg u 21 <210> 6 <211> 21 <212> RNA <213> Homo sapiens <400> 6 aggcggagac uugggcaauu g 21 <210> 7 <211> 22 <212> RNA <213> Homo sapiens <400> 7 gaggguuggg uggaggcucu cc 22 <210> 8 <211> 22 <212> RNA <213> Homo sapiens <400> 8 uucaaguaau ccaggauagg cu 22 <210> 9 <211> 22 <212> RNA <213> Homo sapiens <400> 9 gguccagagg ggagauaggu uc 22 <210> 10 <211> 22 <212> RNA <213> Homo sapiens <400> 10 uuccuaugca uauacuucuu ug 22 <210> 11 <211> 23 <212> RNA <213> Homo sapiens <400> 11 caacggaauc ccaaaagcag cug 23 <210> 12 <211> 21 <212> RNA <213> Homo sapiens <400> 12 ucaauaaaug ucuguugaau u 21 <210> 13 <211> 22 <212> RNA <213> Homo sapiens <400> 13 uucccuuugu cauccuaugc cu 22 <210> 14 <211> 22 <212> RNA <213> Homo sapiens <400> 14 uagcuuauca gacugauguu ga 22 <210> 15 <211> 22 <212> RNA <213> Homo sapiens <400> 15 cguguauuug acaagcugag uu 22

Claims (11)

A composition for diagnosing preeclampsia comprising an agent for measuring the expression level of miR-197 represented by the nucleotide sequence of SEQ ID NO: 2.
2. The composition of claim 1, wherein the expression level of the miRNA is measured in placenta or maternal blood of a subject suspected of having preeclampsia.
2. The composition of claim 1, wherein the agent is a primer or a probe that specifically binds to a miRNA.
A kit for the diagnosis of preeclampsia comprising the composition according to claim 1.
Comprising measuring the expression of miR-197 represented by the nucleotide sequence of SEQ ID NO: 2 from the biological sample of the subject to be diagnosed.
The method according to claim 5, wherein the expression of the miRNA is measured using a reverse transcriptase polymerase, a competitive reverse transcriptase polymerase, a real-time reverse transcriptase polymerase, an RNase protection assay, a Northern blotting or a gene chip Way.
A pharmaceutical composition for preventing or treating preeclampsia comprising an inhibitor of expression of miR-197 represented by the nucleotide sequence of SEQ ID NO: 2 as an active ingredient.
8. The pharmaceutical composition according to claim 7, wherein the miRNA expression inhibitor is an antisense oligonucleotide consisting of a sequence complementary to the miRNA nucleotide sequence.
delete delete a) treating the test substance with a cell comprising a nucleotide sequence encoding miR-197 represented by the nucleotide sequence of SEQ ID NO: 2; And
b) determining the test substance as a treatment for preeclampsia when the expression of miR-197 represented by the nucleotide sequence of SEQ ID NO: 2 is decreased in the cell as compared with the untreated control group.

Images