CN117018014B - Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion - Google Patents

Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion Download PDF

Info

Publication number
CN117018014B
CN117018014B CN202311210059.9A CN202311210059A CN117018014B CN 117018014 B CN117018014 B CN 117018014B CN 202311210059 A CN202311210059 A CN 202311210059A CN 117018014 B CN117018014 B CN 117018014B
Authority
CN
China
Prior art keywords
fam95b1
expression
lncrna
igf2
adhesion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311210059.9A
Other languages
Chinese (zh)
Other versions
CN117018014A (en
Inventor
巫剑红
代荫梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY
Original Assignee
BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY filed Critical BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY
Priority to CN202311210059.9A priority Critical patent/CN117018014B/en
Publication of CN117018014A publication Critical patent/CN117018014A/en
Application granted granted Critical
Publication of CN117018014B publication Critical patent/CN117018014B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G01N2800/367—Infertility, e.g. sperm disorder, ovulatory dysfunction
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Reproductive Health (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Endocrinology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses application of LncRNA FAM95B1 in preparing medicaments for treating intrauterine adhesion, and the invention discovers the correlation between FAM95B1 expression and intrauterine adhesion treatment for the first time, inhibits the expression of FAM95B1, can inhibit an epithelial-mesenchymal transition process by down-regulating IGF2 expression, plays an anti-fibrosis role, namely, a reagent for inhibiting FAM95B1 expression can inhibit occurrence and development of intrauterine adhesion by down-regulating IGF2 expression.

Description

Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to application of LncRNA FAM95B1 in preparation of a medicine for treating intrauterine adhesion.
Background
Endometrial dysplastic diseases mainly include intrauterine adhesions and thin endometrium, where intrauterine adhesions (intrauterine adhesion, IUA) are a disease that results in occlusion of the uterine cavity due to endometrial lesions, the formation of which is the process of fibrosis, in which endometrial stromal cells are transformed into fibroblasts, i.e. the process of epithelial-to-mesenchymal transition (EMT) occurs. In recent years, with the increase of various uterine cavity operations, the incidence of uterine cavity adhesions has been on the rise (Barel O, krakov A, pansky M, et al, intracerile adhesions after hysteroscopic treatment for retained products of conception: what are the risk factors [ J ] Fertil Steril,2015,103 (3): 775-779.). Hysteroscopy is a gold standard for diagnosing intrauterine adhesion, and hysteroscopic intrauterine adhesion separation is the most important treatment mode for intrauterine adhesion. However, the recurrence rate of postoperative intrauterine adhesions is as high as 3.1% -23.5%, especially in severe cases of intrauterine adhesions (20% -62.5%) (Shi X, saraveros SH, zhou Q, et al, pre of postoperative adhesion reformation by intermittent intrauterine balloon therapy: a randomised controlled trial [ J ]. BJOG,2019,126 (10): 1259-1266.), and therefore active search for effective intrauterine adhesion treatment, especially targeted treatment against pathogenesis, has become a problem to be solved in clinical urgent.
LncRNA is a non-coding RNA greater than 200bp in length. In recent years, the involvement of LncRNA in the development of organ fibrosis has become an increasingly popular research point, providing the possibility of clinically targeted therapy of organ fibrosis (Yang Z, jiang S, shang J, et al LncRNA: shedding light on mechanisms and opportunities in fibrosis and aging [ J ]. Ageing Research Reviews,2019,52:17-31.; henderson NC, rieder F, wynn TA. Fibrisis: from mechanisms to medicines [ J ]. Nature,2020,587 (7835):555-566.). The inventor discovers that LncRNA FAM95B1 and protein coding gene insulin-like growth factor 2 (insulin-like growth factor, IGF 2) are highly expressed in uterine cavity adhesion tissues through RNA high-throughput sequencing in the early stage; further by bioinformatic analysis, IGF2 was found to be a protein-encoding target gene for LncRNA FAM95B1 trans-acting. At present, research or report on LncRNA FAM95B1 and intrauterine adhesion are not yet found at home and abroad. The invention aims at discussing the expression, function and action mechanism of LncRNA FAM95B1 in intrauterine adhesion, thereby providing a new idea for preventing and treating intrauterine adhesion.
Disclosure of Invention
Accordingly, the present invention is directed to the use of LncRNA FAM95B1 in the preparation of a medicament for treating intrauterine adhesion.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
in a first aspect, the invention provides the use of an agent that inhibits FAM95B1 expression in the manufacture of a medicament for the treatment of uterine adhesion.
Further, the agent that inhibits FAM95B1 expression includes an interfering molecule that inhibits FAM95B1 expression or transcription.
Further, the agent for inhibiting FAM95B1 expression includes any one or more of siRNA, shRNA, dsRNA, microrna, antisense nucleic acid targeting FAM95B1.
Further, the agent for inhibiting FAM95B1 expression is an siRNA targeting FAM95B1, and the sequence of the siRNA is shown as SEQ ID NO. 11-12 or SEQ ID NO. 13-14.
In some embodiments, the agents of the present invention that inhibit FAM95B1 expression include any biosynthetic substance, chemical synthetic substance, natural purified substance, modified natural purified substance, semisynthetic substance, and/or any combinations thereof capable of inhibiting FAM95B1 expression levels, including, but not limited to: siRNA, shRNA, dsRNA, micrornas, antisense nucleic acids targeting FAM95B1, constructs, small molecule compounds, and the like capable of expressing or forming the siRNA, shRNA, dsRNA, micrornas, antisense nucleic acids. The agent for inhibiting FAM95B1 expression is not limited to the siRNA targeting FAM95B1 shown in SEQ ID NO. 11-12 or SEQ ID NO. 13-14 used in the specific examples of the present invention.
In some embodiments, the intrauterine adhesions described herein include intrauterine adhesions and various diseases caused by intrauterine adhesions. Various diseases caused by the intrauterine adhesion include, but are not limited to: infertility caused by intrauterine adhesion, recurrent abortion, placenta adhesion, implantation, etc.
In the present invention, the FAM95B1 is an LncRNA, and the FAM95B1 has a sequence known in the art or is a derivative molecule thereof. In some embodiments, the FAM95B1 is a molecule comprising the sequence: (a) FAM95B1 having a sequence such as that shown in Gene ID 100133036 (human); (b) A molecule which hybridizes under stringent conditions to the sequence defined in (a); (c) A molecule having a sequence homology of 70% or more (e.g. 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5% or more, or any value or range of values therebetween) to the sequence of the molecule shown in (a) or (B), e.g. FAM95B1 obtained by codon optimisation.
In a second aspect, the invention provides the use of a reagent for detecting FAM95B1 expression levels in the preparation of a diagnostic product for uterine cavity adhesion.
Further, the reagent for detecting the expression level of FAM95B1 includes a primer for specifically amplifying FAM95B1 and/or a probe for specifically recognizing FAM95B1.
Further, the sequence of the primer for specifically amplifying FAM95B1 is shown as SEQ ID NO. 1-2.
Further, mRNA expression levels of LncRNA FAM95B1 in uterine cavity adhesion tissue were significantly up-regulated compared to LncRNA FAM95B1 in normal endometrial tissue.
In the present invention, the detection of FAM95B1 expression level can be performed by any method for detecting LncRNA expression level known to those skilled in the art. In some embodiments, the method of detecting LncRNA transcripts comprises sequencing techniques, nucleic acid hybridization techniques, nucleic acid amplification techniques. Wherein the nucleic acid amplification technique is selected from the group consisting of polymerase chain reaction, reverse transcription polymerase chain reaction, transcription mediated amplification, ligase chain reaction, strand displacement amplification and nucleic acid sequence based amplification, wherein the polymerase chain reaction is preferably a real-time fluorescent quantitative PCR reaction.
In a third aspect, the invention provides the use of FAM95B1 in screening candidate drugs for the treatment of uterine cavity adhesions.
Further, candidate drugs that can be used to treat intrauterine adhesions are screened by detecting whether the test substance is capable of inhibiting FAM95B1 expression.
In some embodiments, the screening is performed using a method of screening a candidate drug for treating a uterine cavity adhesion as described in the fifth aspect of the invention.
A fourth aspect of the invention provides any one of the following products comprising:
(1) A pharmaceutical composition for use in the treatment of uterine cavity adhesions, said pharmaceutical composition comprising an agent for inhibiting FAM95B1 expression as described in the first aspect of the invention;
in some embodiments, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier and/or adjuvant. In other embodiments, the pharmaceutical composition may further comprise any one or more of other drugs or agents that can be used to treat and/or prevent uterine adhesion.
In some embodiments, the pharmaceutically acceptable carrier and/or adjuvant is described in detail in Remington's Pharmaceutical Sciences (19 th ed., 1995) which is used as needed to aid stability of the formulation or to aid in improving activity or its bioavailability or to produce an acceptable mouthfeel or odor in the case of oral administration. The pharmaceutical composition so formulated may be administered to a subject in need thereof by any suitable means known to those skilled in the art, as desired. In a specific embodiment of the invention, the subject is preferably a human.
In some embodiments, the pharmaceutically acceptable carrier and/or adjuvant includes, but is not limited to: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifying agents, such as wetting agents, e.g., sodium lauryl sulfate; a colorant; a flavoring agent; tabletting and stabilizing agent; an antioxidant; a preservative; non-thermal raw water; isotonic saline solution; and phosphate buffer, etc.
In some embodiments, the other drugs or agents that can be used to treat and/or prevent uterine cavity adhesions include, but are not limited to: estrogen, antibiotic, aspirin, gonadotrophin releasing hormone, growth hormone, anti-adhesion liquid, bighead atractylodes rhizome, chinese yam, ginseng, white peony root, rhizoma atractylodis, liquorice, dried orange peel, black buckwheat ear, radix bupleuri, semen plantaginis, cherokee rose, semen euryales, dragon bone, mugwort leaf, combined spicebush root and the like.
In some embodiments, the pharmaceutical composition may be prepared as needed in a variety of clinical pharmaceutical dosage forms as a medicament for treating intrauterine adhesions or various diseases caused by intrauterine adhesions, including, but not limited to: parenteral dosage forms or oral formulations, including injection, aerosol, suppository or subcutaneous dosage forms; the oral preparation comprises tablets, capsules, pills, granules, micro-caplets, suspension, dripping pills and oral liquid preparations.
In some embodiments, the pharmaceutical composition is suitably administered in an amount (or a therapeutically and/or prophylactically effective amount) that allows for a variety of prescriptions depending on factors such as the method of formulation, the mode of administration, the age, weight, sex, condition, diet, time of administration, route of administration, rate of excretion and sensitivity of the patient, and typically, the prescription and the amount of the drug administered in the prescription effective for the desired treatment and/or prophylaxis will be readily determined by the skilled practitioner.
In some embodiments, the route of administration of the pharmaceutical composition is not limited as long as it is capable of exerting a desired therapeutic or prophylactic effect. In other embodiments, the route of administration includes, but is not limited to: topical, transdermal, intravenous, intraperitoneal, intraocular, intraarterial, intrapulmonary, oral, intrathecal, intramuscular, intratracheal, subcutaneous, inhalation, pleural, mucosal, dermal, gastrointestinal, intra-articular, intraventricular, rectal, vaginal, intracranial, intraurethral, intrahepatic. In some cases, the administration may be systemic, in some cases, local.
(2) A diagnostic product for diagnosing a uterine cavity adhesion, said diagnostic product comprising an agent for detecting FAM95B1 expression level as described in the second aspect of the invention;
in some embodiments, the diagnostic product comprises a kit, a chip, and/or a test strip. The diagnostic product diagnoses intrauterine adhesion by detecting the expression level of FAM95B1 in a sample to be tested.
In some embodiments, the kit is an RT-PCR kit, which may further comprise the elements necessary for reverse transcription polymerase chain reaction. The RT-PCR kit contains a pair of primers specific for FAM95B1. The primer is a nucleotide having a nucleic acid sequence specific for the FAM95B1, and may be about 7-50bp in length, more particularly about 10-39bp.
In some embodiments, the RT-PCR kit may further comprise a test tube or suitable vessel, reaction buffers (different pH values and magnesium concentrations), deoxynucleotides (dntps), enzymes (e.g., taq polymerase and reverse transcriptase), deoxyribonuclease inhibitors, ribonuclease inhibitors, DEPC-water, and sterile water.
In some embodiments, the kit is a DNA chip kit, which may further comprise elements necessary for manipulating a DNA chip. The DNA chip kit may comprise a substrate to which a cDNA corresponding to FAM95B1 or an oligonucleotide corresponding to a fragment thereof is bound, and reagents, agents and enzymes for constructing a fluorescent-labeled probe. In addition, the substrate may comprise a control cDNA or an oligonucleotide corresponding to a fragment thereof.
A fifth aspect of the invention provides a method comprising:
(1) A method of screening for a candidate drug for treating a uterine cavity adhesion, the method comprising the steps of: treating the system expressing or containing FAM95B1 with a test substance, detecting the expression of FAM95B1 in the system, and selecting the test substance capable of inhibiting the expression of FAM95B1 as a candidate drug;
further, the system is selected from: a cellular system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.
Further, the test substances include, but are not limited to: interfering molecules, nucleic acid inhibitors, small molecule compounds, etc. designed for FAM95B1.
Further, methods for detecting FAM95B1 expression in the system include, but are not limited to: reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, ribonuclease Protection Assay (RPA), northern blotting, and DNA chip.
Further, reagents for detecting FAM95B1 expression include, but are not limited to: primers, probes or antisense nucleotides. One skilled in the art can design primers, probes, or antisense nucleotides capable of specifically binding to FAM95B1 based on the sequence information of FAM95B1.
Further, the candidate drug selected is a test substance capable of inhibiting the expression level of FAM95B1 in the presence of the candidate drug compared to the expression level of FAM95B1 detected in the absence of the candidate drug.
(2) A method of inhibiting in vitro the transformation of endometrial stromal cells into fibroblasts, said method comprising the steps of: administering to an in vitro endometrial stromal cell system an effective amount of an agent that inhibits FAM95B1 expression as described in the first aspect of the invention.
Furthermore, the present invention provides a method for treating and/or preventing uterine adhesion, the method comprising the steps of: administering to a subject in need thereof a therapeutically and/or prophylactically effective amount of an agent that inhibits FAM95B1 expression as described in the first aspect of the invention, and/or a pharmaceutical composition as described in the fourth aspect of the invention.
In some embodiments, the subject refers to any animal, and also refers to human and non-human animals. The non-human animals include all vertebrates, for example, mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any domestic animals or pets; and non-mammals, such as chickens, amphibians, reptiles, etc., in preferred embodiments, the subject is a human.
Furthermore, the present invention provides a method for diagnosing and/or aiding in the diagnosis of uterine adhesion, the method comprising the steps of: detecting the expression level of FAM95B1 in a subject-derived sample, wherein the subject is diagnosed as having a uterine adhesion or as having a suspected patient at higher risk of having a uterine adhesion if the expression level of FAM95B1 in the subject-derived sample is significantly increased compared to a normal human.
In some embodiments, the sample refers to a composition obtained or derived from a subject of interest comprising cellular entities and/or other molecular entities to be characterized and/or identified, e.g., based on physical, biochemical, chemical, and/or physiological characteristics. The sample may be obtained from blood and other fluid samples of biological origin and tissue samples of the subject, such as biopsy tissue samples or tissue cultures or cells derived therefrom. The source of the tissue sample may be solid tissue, such as tissue from fresh, frozen and/or preserved organs or tissue samples, biopsy tissue or aspirates; blood or any blood component; body fluid; cells from any time of gestation or development of an individual; or plasma. The sample includes biological samples that have been treated in any way after they have been obtained, such as by treatment with reagents, stabilization, or enrichment for certain components (such as proteins or polynucleotides), or embedding in a semi-solid or solid matrix for sectioning purposes. Samples described in the present invention include, but are not limited to: tissue, blood, serum, blood-derived cells, plasma, lymph fluid, synovial fluid, cell extracts, and combinations thereof.
Compared with the prior art, the invention has the advantages and beneficial effects that:
the invention provides the application of LncRNA FAM95B1 in treating uterine cavity adhesion for the first time. The invention discovers the relativity between FAM95B1 expression and intrauterine adhesion treatment for the first time, inhibits the expression of FAM95B1, can inhibit the epithelial-mesenchymal transition process by down-regulating the expression of protein coding gene insulin-like growth factor 2 (insulin-like growth factor, IGF 2), exerts the anti-fibrosis effect, namely, the reagent for inhibiting FAM95B1 expression can inhibit the occurrence and development of intrauterine adhesion by down-regulating the expression of IGF2.
Drawings
FIG. 1 is a graph showing the results of mRNA expression levels of LncRNA FAM95B1 in uterine cavity adhesion tissue;
FIG. 2 is a graph showing the results of protein expression levels of IGF2, alpha-SMA, COL1A1 in uterine cavity adhesion tissue;
FIG. 3 is a graph showing the results of mRNA expression levels of LncRNA FAM95B1, IGF2, alpha-SMA, COL1A1 during the conversion of ESCs into fibroblasts;
FIG. 4 is a graph showing the results of down-regulating FAM95B1 and down-regulating mRNA expression levels of LncRNA FAM95B1 and IGF2 after IGF2, wherein, panel A: FAM95B1 mRNA expression level, panel B: IGF2 mRNA expression level;
FIG. 5 is a graph showing the results of si-FAM95B1 inhibiting the conversion of ESCs to fibroblasts by down-regulating IGF2 expression;
FIG. 6 is a graph of diagnostic efficacy results of LncRNA FAM95B1 on normal endometrial tissue and uterine cavity adhesion tissue differentiation.
Detailed Description
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition, some terms are explained as follows.
As used herein, the term "primer" refers to a single stranded oligonucleotide capable of binding to a target nucleic acid. Typically, the binding is selective. The exact length of the primer will vary depending on the particular application, but is typically about 15 to about 120 nucleotides. The primer need not reflect the exact sequence of the target nucleic acid template, but must be sufficiently complementary to bind to the template. The oligonucleotides for use as primers can be selected using software known in the art for this purpose. For example, OLIGO4.06 primer analysis software (available from National Biosciences, plymouth, MN) can be used to select primers each up to 30-100 nucleotides, and to analyze larger polynucleotides up to 5,000 nucleotides from an input polynucleotide sequence up to 32 kilobases. Similar primer selection procedures have incorporated additional features to extend performance. For example, the Primou primer selection program (publicly available from Genome Center at University of Texas South WestMedical Center (Dallas TX)) is capable of selecting specific primers from megabase sequences and thus can be used to design primers in a Genome-wide manner. Primer3 Primer selection procedure (publicly available from whitehead institute/MITCenter for Genome 5Research,Cambridge MA) allows the user to input "mispriminiband", wherein the sequences to be avoided as Primer binding sites are user-specified. Primer3 is particularly useful for selecting nucleotides for microarrays. The PrimeGen program (publicly available from UK Human GenomeMappingProjectResource Centre, cambridge UK) designs primers based on multiple sequence alignments, allowing the selection of primers that bind or hybridize to the most conserved or least conserved regions of aligned nucleic acid sequences. Thus, this procedure can be used to identify unique and conserved nucleotides as well as polynucleotide fragments.
As used herein, the term "probe" refers to a substance that can specifically bind to a target substance to be detected in a sample to be tested, and refers to a substance that can confirm the presence of the target substance in the sample to be tested by the above-mentioned binding specificity. The type of the probe is not particularly limited and may be, for example, peptide nucleic acid (PNA, peptide nucleic acid), locked nucleic acid (LNA, lockednucleic acid), peptide, polypeptide, protein, ribonucleic acid, deoxyribonucleic acid, or the like, which are commonly used by those skilled in the art.
As used herein, the term "siRNA" refers to small interfering ribonucleic acids, i.e., double stranded nucleic acids of relatively short length or optionally longer precursors thereof. In some embodiments, the length of the siRNA useful in the present invention is preferably about 20 to 50bp in length. However, there is no particular limitation on the length of the usable siRNA herein. For example, the siRNA may initially be present in the cell in a precursor form that is substantially different from the final or processed form of the siRNA that exhibits and exerts gene silencing activity upon or after delivery to the target cell. For example, a precursor form of an siRNA can include a precursor sequence element that is processed, degraded, altered, or cleaved upon or after delivery to produce an siRNA that has mediated gene silencing activity in a cell. In some embodiments, useful siRNAs have precursors of length of, for example, about 100 to 200 base pairs or 50 to 100 base pairs or less than about 50 base pairs that produce active, processed siRNAs within target cells. In other embodiments, useful siRNAs or siRNA precursors are about 10 to 49bp or 15 to 35bp or about 21 to 30bp in length.
As used herein, the term "shRNA" refers to short hairpin RNAs, which include two short inverted repeats. shRNA cloned into shRNA expression vectors comprises two short inverted repeats, separated by a stem-loop (loop) sequence in the middle, constituting a hairpin structure, controlled by the pol iii promoter. Then, 5-6T's are attached as transcription terminators for RNA polymerase III. shRNA can be stably integrated into the genome of the cell, allowing for long-term gene knockout.
As used herein, the term "dsRNA" refers to double-stranded ribonucleic acid, an RNA molecule formed by the renaturation of two complementary strands, which can be cleaved by Dicer enzyme to form siRNA. dsRNA inhibits gene expression by RNA interference (RNAi), and dsRNA does not need to have 100% homology with the target gene sequence, so long as it can inhibit target gene expression.
As used herein, the term "microrna" refers to a microribonucleic acid (miRNA), a non-coding RNA that is about 22nt long, widely found in a variety of organisms, from viruses to humans. Mature mirnas are mainly responsible for negative regulation of post-transcriptional levels of genes, involved in many life processes such as cell proliferation, apoptosis, immunity, neuroendocrine, and stem cell differentiation by causing degradation of their target mRNA or disruption of the translation process.
As used herein, the term "antisense nucleic acid" refers to a nucleic acid that contains complementarity to a sequence encoding FAM95B1, and is used interchangeably with "antisense nucleotide". Antisense nucleic acids can be composed of DNA, RNA, or both. The antisense nucleic acid can contain non-complementary bases so long as it is capable of specifically hybridizing under stringent conditions. When an antisense nucleic acid is introduced into a cell, it binds to a target polynucleotide and inhibits transcription, RNA processing, or stability. In addition to antisense polynucleotides, antisense nucleic acids also include polynucleotide mimics that contain a modified backbone, and 3 'and 5' end portions. Such antisense nucleic acids can be appropriately designed based on the sequence information of FAM95B1 and generated using methods well known to those skilled in the art.
The invention is further illustrated below in conjunction with specific examples, which are intended to illustrate the invention and are not to be construed as limiting the invention. One of ordinary skill in the art can appreciate that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents. The experimental procedure, in which no specific conditions are noted in the examples below, is generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer.
Example LncRNA FAM95B1 application in treatment or diagnosis of uterine adhesion
1. Materials and methods
1.1 Material
1.1.1 clinical specimens
20 cases of uterine cavity adhesion patients with fertility requirements of uterine cavity adhesion loosening operation under a hysteroscope and 20 cases of patients with normal endometrial tissues can be provided by infertility and uterine cavity joint operation in Beijing women obstetric hospital from 2021 month 1 to 2021 month 12 are selected. All patients were in the early proliferative phase of the menstrual cycle, with age < 40 years. The severity of intrauterine adhesions was measured using American reproduction Association scoring criteria (The American Fertility Society classifications of adnexal adhesions, distal tubal occlusion, tubal occlusion secondary to tubal ligation, tubal pregnancies, mu llerian anomalies and intrauterine adhesions [ J ]. Feril Steril,1988,49 (6): 944-955.), and all patients were moderate-severe. Informed consent was given to the patient by the unit ethical committee's censored consent (IEC-B-03-V01-FJ 1), informed by the declaration of helsinki, and written informed consent was signed and entered into the group. Patients with connective tissue disease, endometrium disease and endocrine disease are all excluded.
1.1.2 cell specimens
Endometrial stromal cells (endometrial stromal cells, ESCs) were purchased from north nanobiotechnology limited.
1.1.3 major reagents and instruments
DMEM/F-12 medium, 10% foetal calf serum, available from Shanghai Thermo Fisher technologies Co., ltd; TRIzol extract was purchased from Shanghai Thermo Fisher technologies Co., ltd; hiScript Q Select RT SuperMix, SYBR Green Master Mix Kit are available from Nanjinouzan biotechnology Co., ltd; small interference FAM95B1 (small interfering FAM B1, si-FAM95B 1), small interference IGF2 (small interfering IGF, si-IGF 2), siControl is available from the company, sharp boy, inc; anti- αsma antibodies, anti-COL 1A1 antibodies, anti-IGF2 antibodies, western Blot secondary antibodies, igG antibodies were all purchased from Abcam corporation, uk; real-time fluorescent quantitative PCR instrument (Applied Biosystems,7500Real Time PCR System) was purchased from Thermo Fisher technologies ltd.
1.2 method
1.2.1 sample collection and processing methods
(1) Collection of uterine cavity adhesion tissue: in the intrauterine adhesion loosening operation, about 0.5cm of the intrauterine device is obtained by utilizing an electrotome 3 The uterine cavity adheres to tissue. (2) collection of normal endometrial tissue: in hysteroscopy, a small curet is curetted about 0.5cm 3 Normal endometrium. All specimens were isolated and placed in a freezer tube for storage in a-80 ℃ refrigerator within 30 minutes.
1.2.2 RNA extraction and reverse transcription real-time quantitative polymerase chain reaction (Reverse transcription-quantitative polymerase chain reaction, RT-qPCR)
Extracting total RNA of cells according to the Trizol Regent kit instruction method, and measuring the purity and concentration of the RNA by an ultraviolet spectrophotometer. cDNA was synthesized using HiScript Q Select RT SuperMix reverse transcription kit and stored in-80℃refrigerator for further use. RT-qPCR primers were synthesized by Beijing micro-spin Gene technologies Co., ltd, and the sequences of each primer are shown in Table 1. The reaction mixture was purified by SYBR Green I10. Mu.L, primer F (10. Mu.M) 1. Mu.L, primer R (10. Mu.M) 1. Mu. L, ddH 2 The reaction system was configured with O8. Mu.L. PCR amplification reaction conditions: the mixture was subjected to denaturation at 95℃for 2min, denaturation at 95℃for 30s, annealing at 58℃for 30s and elongation at 72℃for 30s, and 40 cycles were performed. And after the amplification is finished, determining the accuracy of the result by checking the dissolution curve and the amplification curve. GAPDH is used as an internal reference, 2 -△△ct The RNA expression level was calculated by the method of (2).
TABLE 1 primer sequences for RT-qPCR
1.2.3 cell culture and TGF-beta 1 treatment
After resuscitating the purchased hESCs, adding DMEM medium containing 10% fetal calf serum and 1% double antibody solution, and placing at 37deg.C and 5% CO 2 Cell culture was performed in an incubator with 95% humidity. When the cell fusion reaches 80% -90% under the observation of a microscope, the cell can be subjected to passage, and the cell can be subjected to passage culture according to the ratio of 1:2 or 1:3. And taking ESCs of the 3 rd generation to the 6 th generation, and carrying out cell cryopreservation by adopting a gradient cooling cryopreservation principle. ESCs were starved for 24 hours prior to tgfβ1 treatment, the original medium (bovine serum medium) was removed, and serum-free medium was added. ESCs were then plated on 6-well plates with a cell density of 2X 10 per well 5 L, TGF at 10ng/mLβ1 treatment of hESCs for 48 hours.
1.2.4 Co-immunoprecipitation experiments
LncRNA FAM95B1 capable of binding to IGF2 protein was detected in TGF-beta 1 treated ESCs according to the protocol of the RNA co-precipitation kit instructions. With IgG as a control, 5 μg of IGF2 antibody was added to the reaction tube. LncRNAFAM95B1 in anti-IGF2 and IgG pellet were then assayed as in 1.2.2, lncRNA FAM95B1 of the IgG group as a control.
1.2.5 construction of si-FAM95B1, si-IGF2 and cell transfection
According to the design principle of siRNA, 3 si-FAM95B1 and 3 si-IGF2 are constructed by designing the siRNA sequence aiming at the target gene. These small interfering RNA by Guangzhou Ruibo biological limited synthesis. The transfection was performed according to lipo3000 transfection kit instructions, and the transfected cells were placed in a 37℃cell incubator for 4 hours, after which the complete medium was changed and after 48 hours of incubation the cells were harvested for the experiment. The specific sequence information of 3 si-FAM95B1 and 3 si-IGF2 obtained by construction is as follows:
si-FAM95B1-1 F：AGAGUUUAGGUUUACCUAGGA(SEQ ID NO:11)
si-FAM95B1-1 R：CUAGGUAAACCUAAACUCUUU(SEQ ID NO:12)
si-FAM95B1-2 F：UCAAAGAGUUUAGGUUUACCU(SEQ ID NO:13)
si-FAM95B1-2 R：GUAAACCUAAACUCUUUGAGG(SEQ ID NO:14)
si-FAM95B1-3 F：UGCAAAACGGCAUUCAAUGUC(SEQ ID NO:15)
si-FAM95B1-3 R：CAUUGAAUGCCGUUUUGCACA(SEQ ID NO:16)
si-IGF2-1 F：AAUUAAUCCACUUUGGUUCGG(SEQ ID NO:17)
si-IGF2-1 R：GAACCAAAGUGGAUUAAUUAC(SEQ ID NO:18)
si-IGF2-2 F：UGUAAUUAAUCCACUUUGGUU(SEQ ID NO:19)
si-IGF2-2 R：CCAAAGUGGAUUAAUUACACG(SEQ ID NO:20)
si-IGF2-3 F：AAAGGUAUCGGGAAAUGAGGU(SEQ ID NO:21)
si-IGF2-3 R：CUCAUUUCCCGAUACCUUUUC(SEQ ID NO:22)
1.2.6 Western blot method for detecting protein expression levels of IGF2, alpha-smooth muscle actin (alpha-smooth muscle actin, alpha-SMA) and type I collagen (collagen type I alpha 1 chain protein,COL1A1) in tissues and cells
Collecting ESCs treated by TGF beta 1 with good growth state, subjecting to cleavage centrifugation, collecting supernatant, quantifying protein with BCA kit, adding sample buffer solution, metal bath for 10min, separating with SDS-PAGE, transferring membrane, and sealing with 50g/L skimmed milk powder; incubation was carried out overnight at 4℃after the addition of primary antibody, and then the next day at room temperature for 2h with goat anti-rabbit IgG (dilution ratio 1:2000) followed by detection by enhanced chemiluminescence. The gray value of the protein band is analyzed by Image J software, beta-actin is taken as an internal reference, and the relative expression amounts of IGF2 protein, COL1A1 protein and alpha-SMA protein are respectively expressed by the ratio of the gray value of the protein band of IGF2 protein, COL1A1 protein and alpha-SMA protein to the gray value of the protein band of beta-actin.
1.3 statistical methods
All quantitative data measurements were repeated 3 times and all data were expressed as mean ± standard deviation (X ± s). Experimental data were statistically processed using GraphPad prism8.0 software. The statistical analysis adopts t test, and P < 0.05 is statistically significant for the difference.
2 experimental results
2.1 upregulation of LncRNA FAM95B1, IGF2 and fibrosis marker alpha-SMA, COL1A1 expression levels in intrauterine adhesion tissue
mRNA expression level of LncRNA FAM95B1 is detected in 20 pairs of normal endometrial tissues and uterine cavity adhesion tissues by adopting an RT-qPCR method, and protein expression levels of IGF2 and fibrosis markers alpha-SMA and COL1A1 are detected by adopting Western blot. RT-qPCR results show that the average expression level of LncRNA FAM95B1 mRNA in the uterine cavity adhesion tissue is 4.16+/-2.74 (0.78-11.92), the average expression level of LncRNA FAM95B1 mRNA in the normal endometrial tissue is 1.11+/-0.86 (0.04-3.07), and statistical analysis shows that the expression level of LncRNA FAM95B1 mRNA in the uterine cavity adhesion tissue is significantly increased (P < 0.001) (see figure 1). Western blot results show that the protein expression levels of IGF2, alpha-SMA and COL1A1 in uterine cavity adhesion tissues are remarkably increased compared with normal endometrium, and the difference is statistically significant (P < 0.01) (see figure 2).
In addition, the invention further verifies the diagnostic efficacy of the differential expression LncRNA FAM95B1 on 20-pair normal endometrial tissue and uterine cavity adhesion tissue, the analysis result is shown in figure 6, and the result shows that the LncRNA FAM95B1 has higher diagnostic efficacy (AUC=0.910) on uterine cavity adhesion and can be used for early diagnosis or screening of uterine cavity adhesion.
2.2 upregulation of LncRNA FAM95B1, IGF2 and fibrosis marker α -SMA, COL1A1 expression levels during differentiation of ESCs into fibroblasts
In the process of converting ESCs into fibroblasts, the RT-qPCR method is adopted to detect the mRNA expression levels of LncRNA FAM95B1 and IGF2 and fibrosis markers alpha-SMA and COL1A 1. Statistical analysis showed that mRNA expression levels of LncRNA FAM95B1, IGF2, and fibrosis markers α -SMA, COL1A1 were significantly elevated (P < 0.01) after 48 hours of tgfβ1 treatment of ESCs (see fig. 3). Indicating that EMT process occurs after ESCs are treated with tgfβ1, during which LncRNA FAM95B1 and IGF2 expression levels are up-regulated.
2.3 Interactions between LncRNA FAM95B1 and IGF2
si-FAM95B1 down-regulates FAM95B1 mRNA expression in ESCs, qRT-PCR further detects LncRNA FAM95B1 and IGF2 mRNA expression; si-IGF2 was then transfected into ESCs and qRT-PCR was used to further detect mRNA expression levels of LncRNA FAM95B1 and IGF2. Statistical results show that compared with siControl, si-FAM95B1-1 and si-FAM95B1-2 can significantly inhibit mRNA expression of FAM95B1 (P < 0.001), while mRNA expression of si-FAM95B1-3 is not significantly reduced (P > 0.05); IGF2 is correspondingly changed along with the change of LncRNA FAM95B1, and has statistical difference; and LncRNA FAM95B1 has no obvious change after IGF2 is down-regulated, and has no statistical significance (see FIG. 4A and FIG. 4B), and the fact that LncRNA FAM95B1 positively regulates IGF2 is proved. After EMT process of ESCs, lncRNA FAM95B1 levels of IgG and anti-IGF2 groups were detected by co-immunoprecipitation. The results showed that LncRNA FAM95B1 expression levels of the anti-IGF2 group were significantly higher than those of the IgG group (P < 0.05) (see Table 2).
TABLE 2 LncRNA FAM95B1 binding to IGF2 in TGF-beta 1 treated endometrial stromal cells
2.4 si-FAM95B1 inhibits IGF2 expression in ESCs differentiation process to fibroblast, and plays an anti-fibrosis role
The invention selects the si-FAM95B1-1 and the si-FAM95B1-2 with better gene knockdown effect for the next experiment. si-FAM95B1-1 and si-FAM95B1-2 were transfected into ESCs and treated with 10ng/mL TGF-beta 1 for 48 hours, and then protein expression levels of IGF2, alpha-SMA, COL1A1 were detected. It was found that si-FAM95B1-1 and si-FAM95B1-2 significantly inhibited protein expression levels of IGF2 and the fibrosis markers α -SMA, COL1A1, compared to the siControl+TGF- β1 group, the differences were statistically significant (see FIG. 5) (P < 0.001). These data indicate that si-FAM95B1 exerts an anti-fibrotic effect by down-regulating IGF2 expression during ESCs differentiation into fibroblasts.
The above description of the embodiments is only for the understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present invention without departing from the principle of the invention, and these improvements and modifications will fall within the scope of the claims of the invention.

Claims (4)

1. Use of an agent that inhibits FAM95B1 expression in the manufacture of a medicament for treating uterine adhesion;
the reagent for inhibiting FAM95B1 expression is an siRNA targeting FAM95B1, and the sequence of the siRNA is shown as SEQ ID NO. 11-12 or SEQ ID NO. 13-14.
2. Application of reagent for detecting FAM95B1 expression level in preparing uterine cavity adhesion diagnosis product;
the reagent for detecting the expression level of FAM95B1 is a primer for specifically amplifying FAM95B1;
the sequence of the primer for specifically amplifying FAM95B1 is shown as SEQ ID NO. 1-2.
3. A method of screening for a candidate drug for treating a uterine cavity adhesion, the method comprising the steps of: treating the system expressing or containing FAM95B1 with a test substance, detecting the expression of FAM95B1 in the system, and selecting the test substance capable of inhibiting the expression of FAM95B1 as a candidate drug.
4. A method of inhibiting in vitro the transformation of endometrial stromal cells into fibroblasts, said method comprising the steps of: administering to an in vitro endometrial stromal cell system an effective amount of an agent that inhibits expression of FAM95B1 as described in claim 1.
CN202311210059.9A 2023-09-19 2023-09-19 Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion Active CN117018014B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311210059.9A CN117018014B (en) 2023-09-19 2023-09-19 Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311210059.9A CN117018014B (en) 2023-09-19 2023-09-19 Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion

Publications (2)

Publication Number Publication Date
CN117018014A CN117018014A (en) 2023-11-10
CN117018014B true CN117018014B (en) 2024-02-02

Family

ID=88633971

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311210059.9A Active CN117018014B (en) 2023-09-19 2023-09-19 Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion

Country Status (1)

Country Link
CN (1) CN117018014B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114517226A (en) * 2021-12-24 2022-05-20 南京鼓楼医院 Application of AXL as uterine cavity adhesion diagnosis and treatment target

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114517226A (en) * 2021-12-24 2022-05-20 南京鼓楼医院 Application of AXL as uterine cavity adhesion diagnosis and treatment target

Also Published As

Publication number Publication date
CN117018014A (en) 2023-11-10

Similar Documents

Publication Publication Date Title
JP2011510623A (en) Methods and compositions for diagnosing complications of pregnancy
CN109666743B (en) A kind of cervical carcinoma molecular marker and its application
CN107519193B (en) Molecular diagnostic marker for early stage esophageal squamous carcinoma and application thereof
CN110201172B (en) Application of YY1 expression inhibitor in preparation of medicine for treating breast cancer
CN116808065B (en) Use of lncRNA in the treatment of obesity
CN111893188B (en) Application of biomarker LINC01356 in diagnosis and treatment of cervical cancer
CN111172290B (en) MiRNA for diagnosis and treatment of hepatocellular carcinoma
CN117018014B (en) Application of LncRNA FAM95B1 in preparation of medicine for treating intrauterine adhesion
CN111455060A (en) Related biomarker for diagnosing and treating oral squamous cell carcinoma and application
CN111455061A (en) Application of lncRNA biomarker in oral squamous cell carcinoma diagnosis and treatment
CN111440874A (en) Biomarker for diagnosing and treating oral squamous cell carcinoma
CN110923324A (en) Breast cancer miRNA marker and application thereof
CN107236799B (en) Kidney fibrosis miRNA marker
CN107858355B (en) miRNA marker of non-alcoholic fatty liver disease and application thereof
CN115666590B (en) Oral squamous carcinoma related biomarker and diagnostic and therapeutic methods
CN109593845A (en) Purposes of the miRNA as the marker of diagnosis of endometriosis
CN112662755B (en) Diagnosis marker for preeclampsia and application of diagnosis marker in preparation of target spot medicine
CN111172161B (en) Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia
CN113528646A (en) Diagnosis marker for preeclampsia and application of diagnosis marker in preparation of target spot medicine
CN111440875A (en) Biomarker-based diagnosis and use for treating cancer
CN111154863A (en) Application of lncRNA in preparation of product for diagnosing and/or treating osteoarthritis
CN117695396B (en) New application of miR-3104-5p inhibitor in diabetes treatment
KR101535737B1 (en) Compositions for diagnosis and treatment of preeclampsia comprising miRNA
CN110607365B (en) Application of nucleic acid molecule in preparation of product for diagnosing orthopedic diseases
CN113699234B (en) Application of long-chain non-coding RNA Linc01605 as gastric cancer diagnostic kit and targeted drug development

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant