KR101535704B1 - Method for production of vaccine against swine erysipelas by immobilization of antigenic protein - Google Patents

Abstract

The present invention relates to a method for producing a fusion protein in which an antigenic protein SpaA (surface protective antigen A) derived from Erysipellothrix rhusiophathiae and a cellulose binding domain (CBD) protein are linked; Immobilizing the fusion protein to a cellulose matrix; The present invention also relates to a method for preparing a vaccine against a mono-pathogenic disease by immobilizing an antigenic protein comprising the step of immobilizing an antigenic protein.

Description

Technical Field [0001] The present invention relates to a method for preparing a money-only vaccine by immobilizing an antigenic protein,

The present invention relates to a method for immobilizing an antigenic protein to produce a monocotyledonous vaccine and a vaccine prepared thereby.

Vaccination is known to be the most effective way to prevent various infectious diseases. In general, vaccination with intramuscular or subcutaneous injection is the most frequently used, and recently, the vaccine is effectively administered through oral, nasal, transdermal or sublingual routes. Vaccine delivery systems using micro-, nanoparticles, liposomes and virosomes have been found to improve vaccine efficacy.

In addition, various vaccine types have been developed to overcome the drawbacks of common vaccines. Of these vaccines, recombinant protein antigens or fragments thereof are being used as new vaccine candidates because they can avoid the safety of viral dilution and cell culture problems that occur when making common vaccines.

However, some recombinant protein antigens have a disadvantage of low stability and immunogenicity due to a deficiency of a major factor causing an immune response. So adjuvant is used in recombinant protein vaccines to improve immunogenicity. In addition to the use of adjuvants, studies have been carried out to improve immunogenicity and protect the antigen. As part of that effort, attempts have been made to express antigens on the cell surface (Georgiou, G., Stathopoulos, et al. 1997, Nature Biotechnology 15, 29-34).

Cellulose is the first component of the cell wall and is a linear polymer with a glucose moiety. Cellulose is insoluble and robust, is resistant to biological degradation, and cellulose chains tend to clump together to form long crystals. Because cellulose is chemically inert and pharmaceutically safe and economical, it has been used as a carrier material for immunoabsorbents, protein purification and immobilization.

The Cellulose Binding Domain (CBD) is a protein module that can bind tightly to a wide variety of celluloses and forms strong adsorption forces between cellulose. CBD is particularly applied to a variety of immunologically diverse fields.

Erysipelas is a serious swine disease causing great economic loss to the pig production industry. Erysipelothrix rhusiophathiae is a causative bacterium that is a non- cell -forming bacterial pathogen. Recently, herbal medicines have been used to control the disease by administering a recombinant vaccine, but the effect is not persistent. Therefore, the development of more effective advanced vaccines is needed to treat this disease.

The present inventors continued their study on this and continued the present invention on the immobilization of an antigen using a cellulose matrix.

Georgiou, G., Stathopoulos, et. al., 1997, Nature Biotechnology 15, 29-34

It is an object of the present invention to provide a method for preparing a money-only vaccine through immobilization of an antigenic protein.

Another object of the present invention is to provide a money-only vaccine prepared according to the above method.

The present invention

Preparing a fusion protein to which surface protective antigen A (SpaA) and cellulose binding domain (CBD) proteins derived from Erysipellothrix rhusiophathiae are linked;

Immobilizing the fusion protein to a cellulose matrix;

The method comprising the steps of immobilizing an antigenic protein comprising the steps of:

The Cellulose Binding Domain (CBD) is a protein module that can bind tightly to a wide variety of celluloses. The antigenic protein uses cellulose as an immunoadsorbent by immobilizing a recombinant fusion protein comprising SpaA and CBD in a cellulose matrix.

The fusion protein can be expressed in a soluble form in E. coli . Proteins in active form are all soluble, i.e., water soluble. There is a problem that separation and purification of a water-soluble protein is difficult. Therefore, in order to overcome this problem, an insoluble form inclusion body protein was conventionally prepared and separated and purified. However, since the inclusion body protein is an inactive form, it is troublesome to go through the refolding step again to make an active protein (see EP 1724342A1).

The CBD-SpaA fusion protein immobilized on the cellulose matrix of the present invention is expressed in a water-soluble form and is easily separated and purified. Therefore, the use of the CBD-SpaA fusion protein immobilized on the cellulose matrix of the present invention does not require an additional process of forming an insoluble form of the protein and subjecting it to a refolding process.

The SpaA can be any of those known in the art. Specifically, it may be composed of the amino acid sequence represented by SEQ ID NO: 1, but is not always limited thereto.

The CBD can be any of those known in the art. Specifically, the amino acid sequence represented by SEQ ID NO: 2, but is not limited thereto.

The cellulose matrix may be any of those known in the art. Specifically, it may be avicel, but is not limited thereto.

In another aspect, the present invention provides a money-only vaccine prepared by the above method.

The vaccine according to the present invention can be administered in a variety of routes including parenteral, intradermal, transdermal (by use of sustained release polymers), intramuscular, intraperitoneal, intravenous, subcutaneous, oral and intranasal routes of administration . The vaccine is administered in an immunologically effective amount, and an "immunologically effective amount" is an amount sufficient to elicit an immune response. The dose depends on such factors as the age, weight and physical condition of the animal subject for vaccination and the ability of the animal's immune system to synthesize the antibody and the degree of protection desired. Effective doses can be easily set by a routine technician through routine attempts to set a dose response curve. Immunization may be provided by a single dose of the vaccine or may require administration of a multi-booster dose.

The vaccine may be formulated to be injectable, typically in the form of an aqueous solution or suspension, or it may be formulated in a solid form that is dissolved or suspended prior to use. In addition, it can be formulated into a non-intranasal preparation, an oral preparation or the like by a conventional method in the art. Intranasal formulations may include excipients that do not irritate the nasal mucosa or that do not significantly interfere with ciliary function, and may include diluents such as water, saline, and the like. The intranasal formulation may also contain preservatives such as chlorobutanol and benzalkonium chloride. It may contain a surfactant to improve the absorption of the protein antigen by the nasal mucosa. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or they may be in dry form, either as tablets or preparations for reconstitution with water or other suitable excipients prior to use have. The liquid preparation may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include cooking oil), or preservatives.

The monocot vaccine prepared by immobilizing the antigenic protein according to the present invention does not require an antigen purification step, so that the preparation method is simple and the immune response ability is improved when the antigen is immobilized.

Figure 1 shows the expression vector of CBD-SpaA-H6 fusion protein.
Figure 2 shows the results of SDS-PAGE and Western blot analysis of CBD-SpaA-H6 expressed in E. coli according to one embodiment of the present invention. (A) is SDS-PAGE, (B) is an anti-histidine antibody, and (C) is a Western blot using mouse-derived antiserum immunized with monocyte. Lane M is the standard molecular weight marker, T is the total cell lysate, and S is the soluble protein fraction. The arrow is the CBD-SpaA fusion protein.
Figure 3 is CBD-SpaA-H6 immobilized on Avicel according to one embodiment of the present invention. Lanes 1-3 are the results of using crude soluble CBD-SpaA and lanes 4 and 5 are results of Avicel immobilization experiments using CBD-SpaA purified by Histag affinity column. Lane M is a standard molecular weight marker, lanes 1 and 4 are samples before and after the reaction with Avicel, lane 2 is CBD-SpaA immobilized on avicel, and lanes 3 and 5 on avicel.
4 is a confocal microscope image of CBD-SpaA-H6 immobilized on Avicel. (A) is a DIC image (Differential interference contrast image), (B) is FITC fluorescence, and (C) is a photograph incorporating two separate images.
Figure 5 shows the results of ELISA analysis of SpaA and CBD-SpaA.
Figure 6 shows geometric mean antibody titers of SpaA and CBD-SpaA. The antibody titer was expressed as the maximum dilution factor at which the OD 450 was at least 2 times the PBS control.
7 shows the results of ELISA analysis of CBD-SpaA-H6 immobilized on avicel.
8 is a graph showing survival results of vaccinated mice.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

Example 1: Materials and Methods

1-1: Bacterial strain and culture conditions

Eight strains of E. rhusiophathiae serotype 15 isolated from diseased Korean piglets were used. E. coli DH5α [F-, Φ80dlacZΔM15, endA1 hsdR17 (rK-, mK +), supE44, thi-1, λ-, recA1, gyrA96] were used for host cloning and plasmid maintenance. E coli BL21 [F-, hsdS, gal, ompT, rB-, mB-] (Novagen, USA) was planted in lambda derivative DE3 and used as host strain for gene expression.

1-2: Cloning and Construction of Recombinant Plasmids

The gene encoding T. harizaium endoglucanase II with an artificial S3N10 linker was amplified from pEKPM-EcGAD-Lk-H6 (Park, Int. J. Mol. Sci., 2012, 13, 358-368). The following primers were used:

- forward primer (SEQ ID NO: 3):

5'- GAAGGAGATATA CATATG CAGCAAACTGTTTGGGGG-3 '

- reverse primer (SEQ ID NO: 4):

5'- CTTCTTATC GGATCC GTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGCTGCTGCTAATG CATTGAGCGTAGTA-3 '

The underlined portion of the primer was introduced into the In-fusion ™ Advantage PCR cloning kit (Clontech, USA), and the italic part means the restriction enzyme site. Polymerase chain reaction (PCR) products with S3N10 linkers were introduced into pEKPM-EcGAD-Lk-H6 (Park, Int. J.Mol.Sci . 2012,13, 358-368) digested with NdeI and BamHI. DNeasy Blood & Tissue Kit (Qiagen, Germany) was used according to the manufacturer's instructions to isolate E. rhusiophathiae genomic DNA. The gene for SpaA (surface protective antigen A) was amplified by PCR from E. rhusiophathia genomic DNA. The primers used were as follows.

- forward primer (SEQ ID NO: 5):

5'- ACTCCGCCAA CTAGCTCT GGATCC GATTCGACAGATATTTCTG-3 '

- reverse primer (SEQ ID NO: 6):

5'- GTGGTGGTGGTGGTGGTG CTCGAG TTTTAA ACTTCCATCGTTC-3 '

The underlined portion of the primer was introduced into the In-fusion ligation and the italicized BamH I and Xho I sites. The finally prepared expression vector was named pKPM-CBD-Lk-SpaA-H6.

1-3: Expression and purification of CBD-SpaA fusion protein

Plasmid pKPM-CBD-Lk-SpaA-H6 was transformed into E. coli BL21 (DE3). The transformants were cultured at 37 ° C in 2YT medium containing 50 μg / ml kanamycin. When A600 of 0.5 was reached, 0.5 mM IPTG (isopropyl-β-thio-D-galactopyranoside) was added and the culture was further incubated at 37 ° C for 3 hours. For further analysis, the cells were collected by centrifugation and the pellet was destroyed by sonication. Recombinant fusion protein from the supernatant was purified by Ni-NTA agarose (Qiagen, Germany), Econo-Pac Chromatography Column (Bio-Rad, USA) according to manufacturer's instructions. Protein concentrations were measured with the BCA protein assay kit (Pierce, USA).

1-4: CBD-SpaA immobilization

Binding assays were performed with minor modifications to the existing literature (Enzyme and Microbial Technology 40, 5). Briefly, Avicel (PH-101, Sigma) (0.1 mg) was mixed with 500 μg of soluble CBD-SpaA or purified CBD-SpaA at 4 ° C for 2 hours. The supernatant was collected by centrifugation and unbound protein was measured using BCA protein assay kit. The protein bound to the avicel was measured as the difference between the initial and final values of the supernatant. Proteins bound nonspecifically to Avicel were removed by washing with 0.5 M NaCl.

1-5: SDS-PAGE and Western blot assay

SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) was performed according to the method of Laemmle (Laemmli, UK 1970, Nature 227: 680-685). For Western blot assay, the proteins separated by 10% SDS-PAGE gel were transferred to a nitrocellulose membrane. The nitrocellulose membrane was blocked with PBS (phosphate buffered saline) containing 5% defatted milk powder and washed three times with PBST (0.1% Tween 20 in PBS). The membranes were incubated for 1 hour at room temperature with mouse-derived antiserum prepared as His-probe monoclonal antibody (Santa Cruz Biotechnology, USA) or whole bacillus of E. rhusiophathiae . Antigen specifically reactive with IgG AP (alkaline phosphatase) antibody (Sigma, USA) appeared in the AP binding substrate kit (Bio-rad, USA).

1-6: Preparation of polyclonal mouse antiserum

To prepare mouse polyclonal antiserum against E. rhusiophathiae , 5-week-old specific-pathogen-free (SPF) mice were dosed subcutaneously every two weeks with a preformalized cell vaccine of E. rhusiophathiae . Two weeks later, blood samples were collected and the serum antibody titer was measured by ELISA (enzyme-linked immunosorbent assay).

1-7: Evaluation of Immune Characteristics

To evaluate the immunological properties of CBD-Spa A, a microtiter assembly strip (Thermo scientific, Finland) was coated at 4 ° C overnight with 100 μl per well of CBD-SpaA immobilized on Avicel. Serial dilutions (1 x 10 ⁴ , 5 x 10 ⁴ , 1 x 10 ⁵ , and 5 x 10 ⁵ Avicel particles) of the protein immobilized on the avicell particles were tested three times. Plates were washed three times with PBST and blotted for 1 hour in PBST with 5% skim milk powder. Mouse-derived antiserum against E. rhusiophathiae (1: 500) was added to the plate and placed on the rocker platform at room temperature for 2 hours. To detect immunogenicity, the plate was incubated with 1: 2,000 diluted HRP (horseradish peroxidase) anti-mouse IgG whole antibody (GE Healthcare, UK) for 1 hour at room temperature. OD was read at 450 nm using a TECAN Infinity 2000 PRO plate reader (TECAN, Austria).

1-8: Confocal Laser Scanning Microscope (CSLM)

Immobilized CBD-SpaA Abixel particles (1 × 10 ⁵ ) were incubated with antiserum against E. rhusiophathiae (1: 500) at room temperature for 2 hours. After washing three times with PBST, immobilized CBD-SpaA was incubated with Fluorescein (FITC) -AffiniPure F (ab ') 2 Fragment Goat anti Mouse IgG (H + L) (Jackson ImmunoResearch Lab, USA) . After washing again, the CBD-SpaA Abixel particles were immobilized for 10 minutes at room temperature with 3.7% paraformaldehyde (Ordonez-Moran et al, 2008, The Journal of Biology , 183 (4), 697-710) (Vector Lab., USA). Immunofluorescence was measured using a LSM 510 META Laser Scanning Microscope (Carl Zeiss, Germany).

1-9: Mouse immunization and attack inoculation

Forty SPF mice (5 weeks old) were randomly allocated to 5 groups of 8 each, and were administered with 4 μg of soluble SpaA, soluble CBD-SpaA, Avicel fixed CBD-SpaA, and SpaA, (Korea), ERT2T-1 (positive control), was administered subcutaneously. Two weeks after administration, mice of all groups were challenged with 1 x 10 ⁷ CFU of E. rhusiophathiae (serovar 15). Mouse survival was monitored daily for 10 days.

Example 2: Expression of CBD-SpaA fusion protein in E. coli

Figure 1 shows the SpaA protein fused with CBD at the N- and C-terminal 6 histides and the S3N10 linker of T. harizaium endoglucanase II. The CBD-SpaA fusion protein was expressed via IPTG induction in E. coli BL21 (DE3) with pKPM-CBD-Lk-SpaA-H6. Western blot analysis using SDS-PAGE (FIG. 2A) and antihistidine antibody (FIG. 2B) or immunized mouse-derived antiserum (FIG. 2C) showed that the CBD- SpaA fusion protein was expressed at the same molecular weight as the predicted molecular weight (77.8 kDa) And showed a high expression level of about 35% of the total cellular protein. In addition, most CBD-SpaA proteins were expressed in soluble form, indicating that the binding of CBD to SpaA is superior in expression in E. coli.

Example 3: Immobilization of CBD-SpaA on a cellulose matrix

Soluble CBD-SpaA was adsorbed to Avicel and the binding capacity was measured as 1.92 ± 0.001 mg CBD-SpaA / gAvicel with a purity of 81%. In the present invention, the expression of SpaA in a water-soluble form is maintained, and the protein is adsorbed to Avicel, which is a cellulose carrier, so that CBD-SpaA fusion protein is easily purified while maintaining high purity. After purification of the soluble CBD-SpaA protein, the avicel immobilization ability of purified CBD-SpaA (purity 85.1%) was measured with 3.11 0.015 mg CBD-SpaA / gAvicel with purity of 94% (Table 1). The CBD-SpaA fusion protein of the present invention has a molecular weight of 77.8 kDa, which indicates that it binds well to Avicel despite its large size (FIG. 3). In addition, it was confirmed that CBD-SpaA was immobilized on the avicel using a confocal laser scanning microscope (Fig. 4). The CBD-SpaA protein immobilized on the avicel of the present invention is expressed in a soluble form and thus can be directly used as an active protein.

Soluble CBD-SpaA Tablet CBD-SpaA CBD-SpaA / g _Avicel 1.92 + - 0.01 mg 3.11 ± 0.015 mg

Test Example 1: CBD-S

SpaA  In vitro immunological properties of fusion proteins

In order to analyze the immunogenicity of CBD-SpaA in the form of the fusion protein, ELISA and immunofluorescence were performed using immunized mouse-derived antiserum. To evaluate immunogenicity in vitro, ELISA was performed. The test vaccine having the composition shown in the following Table 2 was inoculated into the mice by the method shown in Table 3 below, and 5 kinds of blood samples, in which the amount of hemolysis in the mouse serum was small, were collected and subjected to ELISA. The antigen was coated with 100 μl of 0.96 μg / ml Crude-soluble Spa A, and the serum was diluted to 1/100 and tested by 2-fold dilution.

As shown in FIG. 5, the fusion protein (CBD-SpaA) to which CBD was attached showed higher antibody titer than the protein (SpaA) to which CBD was not attached. 6, when antibody titers were analyzed using the geometric mean values, antibody titers of serum derived from CBD-SpaA-injected mice were 9600 ± 2023 and those of SpaA without CBD (3840 ± 1085) Induced antibody titers that were more than two times higher than that of the control.

Sample One 2 3 Solubility
Spae Soluble CBD-SpaA PBS
Control group Antigen concentration
(ug / ml) 20 20 - Antigen volume
(ml) 0.6 0.6 - Come (20%) 6ml 6ml - Eungene (10%) 3ml 3ml - Total volume 30ml 30ml 30ml

group Inoculation method Inoculation amount Inoculation number One Solubility Spa A Avoid 0.2 ml 15 2 Soluble CBD Spa A Avoid 0.2 ml 15 3 PBS control group Avoid 0.2 ml 15

Test Example 2 Immune Characteristic of Immobilized CBD-SpaA in Vitro

To analyze the immunogenicity of immobilized CBD-SpaA, ELISA and immunofluorescence were performed using immunized mouse-derived antiserum. To evaluate immunogenicity in vitro, ELISA was performed. As shown in FIG. 7, the fusion protein immobilized on the avicel increased in immunogenicity in proportion to the number of avicel immobilized with the CBS-SpaA fusion protein. The purified fusion protein (1x10 ⁵ Avicel particles) bound to the avicel and incubated with the whole E. rhusiopathiae antiserum and then goto-mouse IgG-FITC. The confocal microscope image shows green fluorescent particles uniformly dispersed on the Avicel surface, which is a CBD-SpaA immobilized on Avicel, showing high immunogenicity against E. rhusiopathiae .

Test Example 3: Protective immunity of immunized mice [

Immunization proteins were constructed as shown in Table 4, and soluble CBD-SpaA, Avicel-fixed CBD-SpaA and ERT2T-1 (negative control) were administered to mice Eight populations per population) were inoculated against E. rhusiopathiae .

Sample Solubility
CBD-SpaA Immobilization
CBD-SpaA ERT2T-1 (-) control group Antigen concentration (μg / ml) 20 20 100 - Antigen volume ml) 0.6 0.6 0.125 - Come (20%) 6 ml 6 6 ml - Eungene (10%) 3 ml 3 ml 3 ml - Total volume 30 ml 30 ml 30 ml 30 ml

All non-immune control mice died 7 days after challenge. As shown in FIG. 8, 50% in the ERT2T-1 immunized group and 75% in the soluble CBD-SpaA immunized group (free CBD-SpaA), which is a conventional product of Korea Central Vaccine Institute (Korea) Respectively. Avicel immobilized CBD-SpaA (Avicel CBD-SpaA) immunized group survived 100% of the challenge inoculation against E. rhusiopathiae .

From the above results, it can be seen that CBD-SpaA immobilized on avicel increases immunoreactivity compared to CBD-SpaA fusion protein not immobilized on avicel. This shows that Avicel is useful as a vaccine component that can increase immunogenicity against E. rhusiopathiae .

<110> Korea Research Institute of Bioscience & Biotechnology <120> METHOD FOR PRODUCTION OF VACCINE AGAINST SWINE ERYSIPELAS BY          IMMOBILIZATION OF ANTIGENIC PROTEIN <130> P120608 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 597 <212> PRT <213> SpaA <400> 1 Asp Ser Thr Asp Ile Ser Val Ile Pro Leu Ile Gly Glu Gln Val Gly   1 5 10 15 Leu Leu Pro Val Leu Pro Gly Thr Gly Val His Ala Gln Glu Tyr Asn              20 25 30 Lys Met Thr Asp Ala Tyr Ile Glu Lys Leu Val Ser Leu Ile Asn Gln          35 40 45 Lys Val Lys Pro Phe Leu Ile Asn Glu Pro Lys Gly Tyr Gln Ser Phe      50 55 60 Glu Ala Val Asn Glu Glu Ile Asn Ser Ile Val Ser Glu Leu Lys Asn  65 70 75 80 Glu Gly Met Ser Leu Gln Asn Ile His His Met Phe Lys Gln Ser Ile                  85 90 95 Gln Asn Leu Ala Thr Arg Ile Gly Tyr Arg Ser Phe Met Gln Asp Ala             100 105 110 Met Tyr Leu Glu Asn Phe Glu Arg Leu Thr Ile Pro Glu Leu Asp Glu         115 120 125 Ala Tyr Val Asp Leu Leu Val Asn Tyr Glu Val Lys His Arg Ile Leu     130 135 140 Val Lys Tyr Glu Gly Lys Val Lys Gly Arg Ala Pro Leu Glu Ala Phe 145 150 155 160 Ile Val Pro Leu Arg Asp Arg Ile Arg Ser Met Asn Glu Ile Ala Ala                 165 170 175 Glu Val Asn Tyr Leu Pro Glu Ala His Glu Asp Phe Leu Val Ser Asp             180 185 190 Ser Ser Glu Tyr Asn Asp Lys Leu Asn Asn Ile Asn Phe Ala Leu Gly         195 200 205 Leu Gly Val Ser Glu Phe Ile Asp Tyr Asn Arg Leu Glu Asn Met Met     210 215 220 Glu Lys Glu Leu His Pro Leu Tyr Leu Glu Leu Tyr Ala Met Arg Arg 225 230 235 240 Asn Arg Gln Ile Gln Val Val Arg Asp Val Tyr Pro Asn Leu Glu Arg                 245 250 255 Ala Asn Ala Val Val Glu Ser Leu Lys Thr Ile Lys Asp Ile Lys Gln             260 265 270 Arg Gly Lys Lys Leu Gln Glu Leu Leu Glu Ile Tyr Ile Gln Arg Ser         275 280 285 Gly Asp Val Arg Lys Pro Asp Val Leu Gln Arg Phe Ile Gly Lys Tyr     290 295 300 Gln Ser Val Val Asp Glu Glu Lys Asn Lys Leu Gln Asp Tyr Leu Glu 305 310 315 320 Ser Asp Ile Phe Asp Ser Tyr Ser Val Asp Gly Glu Lys Ile Arg Asn                 325 330 335 Lys Glu Ile Thr Leu Ile Asn Arg Asp Ala Tyr Leu Ser Met Ile Tyr             340 345 350 Arg Ala Gln Ser Ile Ser Glu Ile Lys Thr Ile Arg Ala Asp Leu Glu         355 360 365 Ser Leu Val Lys Ser Phe Gln Asn Glu Glu Ser Asp Ser Lys Val Glu     370 375 380 Pro Glu Ser Pro Val Lys Val Glu Lys Pro Val Asp Lys Glu Lys Pro 385 390 395 400 Lys Asp Gln Lys Lys Pro Val Asp Gln Ser Lys Pro Glu Ser Asn Ser                 405 410 415 Lys Glu Gly Trp Ile Lys Lys Asp Asn Lys Trp Phe Tyr Ile Glu Lys             420 425 430 Ser Gly Gly Met Ala Thr Gly Trp Lys Lys Val Ala Asp Lys Trp Tyr         435 440 445 Tyr Leu Asp Asn Thr Gly Ala Ile Val Thr Gly Trp Lys Lys Val Ala     450 455 460 Asn Lys Trp Tyr Tyr Leu Glu Lys Ser Gly Ala Met Ala Thr Gly Trp 465 470 475 480 Lys Lys Val Ser Asn Lys Trp Tyr Tyr Leu Glu Asn Ser Gly Ala Met                 485 490 495 Ala Thr Gly Trp Lys Lys Val Ser Asn Lys Trp Tyr Tyr Leu Glu Asn             500 505 510 Ser Gly Ala Met Ala Thr Gly Trp Lys Lys Val Ser Asn Lys Trp Tyr         515 520 525 Tyr Leu Glu Asn Ser Gly Ala Met Ala Thr Gly Trp Lys Lys Val Ser     530 535 540 Asn Lys Trp Tyr Tyr Leu Glu Asn Ser Gly Ala Met Ala Thr Gly Trp 545 550 555 560 Lys Lys Val Ala Asn Lys Trp Tyr Tyr Leu Asp Lys Ser Gly Met Met                 565 570 575 Val Thr Gly Ser Lys Ser Ile Asp Gly Lys Lys Tyr Ala Phe Lys Asn             580 585 590 Asp Gly Ser Leu Lys         595 <210> 2 <211> 36 <212> PRT <213> cellulose bindig domain <400> 2 Gln Gln Thr Val Trp Gly Gln Cys Gly Gly Gln Gly Trp Ser Gly Pro   1 5 10 15 Thr Ser Cys Val Ala Gly Ser Ala Cys Ser Thr Leu Asn Pro Tyr Tyr              20 25 30 Ala Gln Cys Ile          35 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 gaaggagata tacatatgca gcaaactgtt tggggg 36 <210> 4 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 cttcttatcg gatccgttgt tgttgttgtt gttgttgttg ttgttgctgc tgctaatgca 60 ttgagcgtag ta 72 <210> 5 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 actccgccaa ctagctctgg atccgattcg acagatattt ctg 43 <210> 6 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 gtggtggtgg tggtggtgct cgagttttaa acttccatcg ttc 43

Claims (6)

Preparing a fusion protein to which surface protective antigen A (SpaA) and cellulose binding domain (CBD) proteins derived from Erysipellothrix rhusiophathiae are linked;
Immobilizing the fusion protein to a cellulose matrix;
&Lt; / RTI &gt; wherein the method comprises the step of immobilizing an antigenic protein.
The method according to claim 1,
Wherein the fusion protein is expressed in a soluble form in E. coli in the step of producing the fusion protein.
The method according to claim 1,
Wherein the SpaA comprises the amino acid sequence of SEQ ID NO: 1.
The method according to claim 1,
Wherein the CBD is composed of the amino acid sequence shown in SEQ ID NO: 2.
The method according to claim 1,
Wherein the cellulosic matrix is Avicel.
A money-only vaccine prepared according to any one of claims 1 to 5.

Images