CN110922454B

CN110922454B - Immune application of pseudomonas aeruginosa toxin ExoS and ExoT and preparation method thereof

Info

Publication number: CN110922454B
Application number: CN201911232277.6A
Authority: CN
Inventors: 黄建东; 张宝中; 李文君
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2019-12-05
Filing date: 2019-12-05
Publication date: 2020-11-06
Anticipated expiration: 2039-12-05
Also published as: CN110922454A; WO2021109854A1

Abstract

The invention discloses immune application of pseudomonas aeruginosa toxins ExoS and ExoT and a preparation method thereof. Specifically discloses recombinant proteins of ExoS and ExoT, and application thereof in preparing immune compositions for preventing and treating pseudomonas aeruginosa infection. The recombinant protein has excellent immune effect and simple preparation method.

Description

Immune application of pseudomonas aeruginosa toxin ExoS and ExoT and preparation method thereof

Technical Field

The invention belongs to the field of biological pharmacy, and particularly discloses application of ExoS and ExoT as an anti-pseudomonas aeruginosa vaccine antigen.

Background

Pseudomonas aeruginosa (also known as Pseudomonas aeruginosa) is a gram-negative bacterium that is ubiquitous in the environment. The bacterium is a conditional pathogen and is one of three major pathogens causing complex and persistent infection in hospitals. Patients with metabolic diseases, hematologic diseases and malignancies, as well as patients after surgery or burns, are susceptible to this bacterium. The focus of pseudomonas aeruginosa infection can cause blood dissemination, serious patients can cause systemic septicemia, meningitis or multi-organ failure, once septicemia occurs, the mortality rate can reach 44% -81%, the multi-organ failure reaches 70%, and the overall mortality rate reaches 50%.

Due to natural drug resistance of pseudomonas aeruginosa and abuse of broad-spectrum antibiotics, multi-drug-resistant pseudomonas aeruginosa infection frequently occurs, particularly carbapenem-resistant pseudomonas aeruginosa (CRPsA) is rapidly disseminated and infected increasingly seriously in the world, and the public health is seriously harmed. In China, cases that the drug-resistant bacteria explode and become epidemic in hospitals due to unfavorable infection control are reported. According to the Chinese antibacterial drug management and bacterial drug resistance status report (2018), the data of the national bacterial drug resistance monitoring network (CARSS) in 2017 shows that the national average separation rate of the Chinese carbapenems drug-resistant pseudomonas aeruginosa is 20.7%, wherein the ICU ward separation rate is as high as 35.8%.

Pseudomonas aeruginosa encodes both type 3 and type 4 secretion systems, which are utilized to release infectious molecules and toxins into host cells. Unlike other secretion systems, the type 3 secretion system is able to infect toxins directly from the bacterial cell gel into the host cytoplasm, so strains that are able to encode the type 3 secretion system are the most dangerous. The Pseudomonas aeruginosa type 3 secretion system releases exotoxins (e.g., ExoU/T/S and Y) to the host. These exotoxins elicit a cytotoxic response and promote inhibition of the IL-17 signaling pathway by IL-18 and IL-1 b. The type 3 secretion system consists of a cyclic structure (PcrV and PopBD), a needle structure (PscF, PscC and PscN). And 4 major exotoxins that can be released: ExoT, ExoY, ExoS, and ExoU. The needle-like structure complex can be inserted into a host cell and release the exotoxin into the host cytoplasm. From a compositional standpoint, the type 3 secretion system consists of a regulatory module, a translocator, secreted exoenzymes, and a secretion apparatus. The ExoS regulator has the functions of regulating, transferring and secreting Pseudomonas aeruginosa type 3 secretion system genes. ExsA is used to regulate ExoS expression and related regulatory elements. The presence of a type 3 secretion system makes infection with pseudomonas aeruginosa an abnormal risk, and therefore antigenic molecules directed against a type 3 secretion system would be potential vaccine targets against pseudomonas aeruginosa infection. The majority of deaths caused by pseudomonas aeruginosa are due to organ failure and sepsis shock, the multiplication of the strain results in necrosis of the lung epithelium and the circulation of pathogens in the blood. Transmission of the pathogen results in the spread of exotoxins, which are released into the host cell by the type 3 secretory system.

There is a need for potential antigens in vaccines against pseudomonas aeruginosa. From a traditional antigen screening perspective, most vaccine candidates should be bacterial cell surface antigens. However, it has been shown that most toxins produced by bacteria are also potential candidates when secreted to attack host cells. Pseudomonas aeruginosa contains a large amount of toxins and attacks host cells by impairing their function, thereby providing a wide range of potential vaccines.

In recent years, significant progress has been made in the identification of virulence factors of pseudomonas aeruginosa and their study in different infectious processes. It is now largely recognized that pseudomonas aeruginosa is a variable antigenic pathogen that readily adapts to different growth conditions and evades recognition by host immunity. The proteins associated with pseudomonas aeruginosa strains have high variability and can grow under complex and diverse environmental conditions, which makes it very difficult to develop a wide range of effective vaccines against pseudomonas aeruginosa. To date, classical approaches have been used to identify many surface proteins, oligosaccharides or some specific virulence factors as potential antigens for vaccines. Recently, there have been combined genomics and proteomics approaches to predict potential protective antigens against pseudomonas aeruginosa, and several vaccine candidates have entered clinical trials, such as: OprF-OprI fusion proteins, flagellins, O-antigen conjugate vaccines and high molecular weight alginates. Unfortunately, to date, no effective vaccine has been introduced into the market.

Traditional bacterial vaccines have focused on stimulating the production of antibodies in the host to combat pathogenic bacteria or enhance phagocytic capacity of macrophages, thereby preventing bacterial proliferation in patients. Since pseudomonas aeruginosa can deploy multiple virulence factors to evade killing by the host, one type of virulence factor is prevented, and other virulence factors may play a role instead. In addition to pseudomonas aeruginosa infection, the host can be infected by different routes, and the virulence factors that play a role in different infectious diseases may differ. In addition, during the course of infection, different toxic metabolites are produced, further exacerbating the complexity of clinical symptoms. Thus, vaccines targeting a single pathogenic mechanism have limited efficacy in preventing pseudomonas aeruginosa.

Disclosure of Invention

In order to solve the above problems, a novel immunization composition and an immunization method are provided for the problem of variable surface antigens of pseudomonas aeruginosa.

One aspect of the present invention provides a recombinant protein of pseudomonas aeruginosa toxin ExoS, having a sequence as shown in SEQ ID No.1, or having a sequence with 50% or more homology to SEQ ID No.1, or comprising a fragment of at least 7 contiguous amino acids of SEQ ID No.1, said fragment of 7 contiguous amino acids comprising an epitope from SEQ ID No. 1.

In the present invention, the more homologous sequence is a sequence having a homology of 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or more.

In another aspect of the invention there is provided a pseudomonas aeruginosa toxin ExoT recombinant protein having a sequence as shown in SEQ ID No.2, or having a sequence with 50% or more homology to SEQ ID No.2, or comprising a fragment of at least 7 contiguous amino acids of SEQ ID No.2, said fragment of 7 contiguous amino acids comprising an epitope from SEQ ID No. 2.

In another aspect, the invention provides a nucleic acid sequence encoding the recombinant protein of SEQ ID No. 1. The nucleic acid sequence is preferably SEQ ID No. 3.

In another aspect, the invention provides a nucleic acid sequence encoding the recombinant protein of SEQ ID No. 2. The nucleic acid sequence is preferably SEQ ID No. 4.

In a further aspect, the invention provides the use of a pseudomonas aeruginosa toxin, or a gene encoding a pseudomonas aeruginosa toxin, in the manufacture of an immune formulation for the prevention or treatment of a pseudomonas aeruginosa infection.

In the above embodiment, wherein the pseudomonas aeruginosa toxin is selected from ExoS, ExoT or a combination of one or more of recombinant proteins thereof.

IN the above scheme, the recombinant protein of ExoS has a sequence shown as SEQ IN No.1, and the recombinant protein of ExoT has a sequence shown as SEQ IN No. 2.

In a further aspect of the invention there is provided an immunogenic composition comprising an antigen and an adjuvant, wherein the antigen is selected from the group consisting of pseudomonas aeruginosa toxin ExoS or pseudomonas aeruginosa toxin ExoT, or a combination of one or more of their recombinant proteins.

In the technical scheme of the invention, the adjuvant is selected from aluminum adjuvant, calcium phosphate adjuvant, cholera toxin B subunit, keratin Q21, lipoid, monophosphoryl lipoid A, MF59 and escherichia coli thermolabile toxin; preferably, the aluminium adjuvant is selected from aluminium hydroxide, aluminium phosphate or aluminium sulphate.

In another aspect, the present invention provides a method for preparing a recombinant protein of pseudomonas aeruginosa toxin ExoS or ExoT, comprising the steps of:

coupling a nucleic acid sequence of coding pseudomonas aeruginosa toxin ExoS or ExoT with a plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into host bacteria, and obtaining recombinant protein after induced expression:

the nucleic acid sequence of the coding pseudomonas aeruginosa toxin ExoS is shown in SEQ ID No.3,

the nucleic acid sequence for coding the pseudomonas aeruginosa toxin ExoS is shown in SEQ ID No. 4.

Advantageous effects

The immune composition disclosed by the invention is excellent in immune effect, simple in preparation method and capable of avoiding the problem of poor immune effect caused by surface antigen variation of pseudomonas aeruginosa.

Drawings

FIG. 1 shows the purified recombinant proteins ExoS and ExoT after SDS-PAGE analysis. The target sizes were 40KDa and 43KDa.

Figure 2 is the results of ExoS and ExoT induced strong humoral immunity in mice. C57BL/6 mice were immunized sequentially on

days

0, 14 and 28 and bled on days 7, 21 and 35 and sera isolated. And the levels of IgG, IgG1 and IgG2a in serum were detected by enzyme-linked immunosorbent assay (ELISA).

FIG. 3 shows the results of the IFN-. gamma.IL-4 and IL-17A responses induced by ExoS and ExoT in mice. The number of cells specifically secreting IFN-. gamma.IL-4 and IL-17A in spleen cells of immunized mice was examined by enzyme-linked immunospot assay (ELISPOT). Data are presented as mean ± SD. SFU: a dot forming unit; and (3) SI: splenocytes from an antigen-stimulated immunized mouse; SM: antigen-stimulated splenocytes from mock-immunized mice; UI (user interface): splenocytes from immunized mice without antigen stimulation. Statistical significance was analyzed by T-test, compared to saline-immunized control mice (mean ± standard error). P <0.05, P <0.001 and P < 0.0001.

Figure 4 is that ExoS and ExoT induced protection against pseudomonas aeruginosa in a blood infection model. (A) A lethal dose of pseudomonas aeruginosa PA01 challenged immunized mice (n ═ 10, two independent experiments). Statistical analysis was by log rank (Mantel-Cox) test, compared to saline control mice. P <0.05, P <0.001 and P < 0.0001.

FIG. 5 is a graph showing the results of the experiment of bacterial load. C57-hour mice immunized with the two prototype vaccines had bacterial loads in different organs four days after intravenous challenge with a sub-lethal dose of pseudomonas aeruginosa PA 01. Statistical significance was analyzed by T-test, compared to saline-immunized control mice (mean ± standard error). P <0.05, P <0.001 and P < 0.0001.

FIG. 6 is a graph showing the results of the serum transplant protection experiment. Immunodeficient mice receiving ExoS or ExoT antisera were more effective against challenge with p.aeruginosa PA01 in a blood infection model. Statistical analysis was by log rank (Mantel-Cox) test.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, specific embodiments accompanied with figures are described in detail below, but the present invention is not to be construed as limiting the implementable range thereof.

Example 1: expression and purification of recombinant proteins and study of protein properties

The commercially synthesized genes ExoS and ExoT are respectively connected with a commercially available vector pET28a through double enzyme digestion and T4 DNA ligase to obtain recombinant plasmids pET28a-ExoS and pET28 a-ExoT. The recombinant plasmids pET28a-ExoS and pET28a-ExoT were transformed into E.coli BL21(DE3), and each was selected to be monoclonal to a kanamycin-resistant LB (broth) medium and cultured overnight in a shaker at 37 ℃ and 200 rpm. The bacterial liquid 1: 100 to 1L of kanamycin-resistant LB medium, incubated at 37 ℃ for 3 hours on a shaker at 200rpm until the OD rises to 0.5-0.8, added with 0.5mM/L of IPTG (isopropyl-. beta. -D-thiogalactoside) to the culture broth, and incubated on a shaker under the same conditions for 4 hours to induce expression of ExoS and ExoT. After induction of expression, SDS-PAGE results showed: the recombinant proteins ExoS and ExoT have obvious expression bands at about 40KDa and 43KDa respectively, and the sizes of the expression bands accord with theoretical values.

The recombinant protein expression bacteria are subjected to SDS-PAGE electrophoresis on the lysed supernatant and the precipitate at the same time, and most of the target protein is expressed in a soluble form. The data indicate that the recombinant proteins ExoS and ExoT disclosed in the present invention can be expressed in a soluble form by optimization of different induction conditions.

After induction expression, cells were recovered by centrifugation at 7000rpm, 4 ℃ and 5min, and each recovered cell (1L of the cell suspension) was divided into two equal portions, each of which was added with 30ml of lysis buffer (50mM NaH)₂PO₄300mM NaOH, pH8.0) was sonicated at 25% power for 30min (once every 9 seconds, 9 seconds for each disruption), the disrupted broth was centrifuged at 8000rpm, 4 ℃ and 30min, and the supernatant was collected. And adsorbing the target protein with the HIS label in the supernatant by using a nickel column capable of binding the HIS label, and binding twice. For ExoS, 20mM/L imidazole solution (20mM/50mM Mimidazole,50mM NaH) was used sequentially because the target protein was tightly bound to the nickel column₂PO₄300mM NaOH, pH8.0) 200ml of each column was used to wash the heteroproteins, and 10ml of a 250mM/L imidazole solution (250mM imidazole,50mM NaH) was used to wash the heteroproteins₂PO₄300mM NaOH, pH8.0) to elute the target protein; ExoT has slightly less binding force with nickel column, 400ml of 20mM/L imidazole solution is used for passing through the column to wash the hybrid protein, and finally 10ml of 250mM/L imidazole solution is used for eluting the target protein. The target protein dissolved in the high concentration imidazole solution was concentrated by centrifugal filtration using an ultrafiltration tube at 4000rpm at 4 ℃ for 15 minutes, 15ml of PBS (phosphate buffer) was added instead of the solution, the solution was centrifuged three times under the same conditions, and after three additions of PBS, the solution was changed to PBS in its entirety. Purifying by centrifugal exchange and affinity chromatographyThe vaccine antigen prepared by chemical technology has protein purity up to 98% and endotoxin content less than 10EU/mg (figure 1). The purified fusion protein reaches the condition of animal in vivo experimental research. Sequencing of recombinant proteins ExoS and ExoT:

recombinant protein ExoS SEQ ID No.1

MSSAVVFKQMVLQQALPMTLKGLDKASELATLTPEGLAREHSRLASGDGALRSLSTALAGIRAGSQVEESRIQAGRLLERSIGGIALQQWGTTGGAASQLVLDASPELRREITDQLHQVMSEVALLRQAVESEVSRVSADKALADGLVKRFGADAEKYLGRQPGGIHSDAEVMALGLYTGIHYADLNRALRQGQELDAGQKLIDQGMSAAFEKSGQAEQVVKTFRGTRGGDAFNAVEEGKVGHDDGYLSTSLNPGVARSFGQGTISTVFGRSGIDVSGISNYKNEKEILYNKETDMRVLLSASDEQGVTRRVLEEAALGEQSGHSQGLLDALDLASKPERSGEVQEQDVRLRMRGLDLA

Recombinant protein ExoT SEQ ID No.2

MHIQSSQQNPSFVAELSQAVAGRLGQVEARQVATPREAQQLAQRQEAPKGEGLLSRLGAALARPFVAIIEWLGKLLGSRAHAATQAPLSRQDAPPAASLSAAEIKQMMLQKALPLTLGGLGKASELATLTAERLAKDHTRLASGDGALRSLATALVGIRDGSRIEASRTQAARLLEQSVGGIALQQWGTAGGAASQHVLSASPEQLREIAVQLHAVMDKVALLRHAVESEVKGEPVDKALADGLVEHFGLEAEQYLGEHPDGPYSDAEVMALGLYTNGEYQHLNRSLRQGRELDAGQALIDRGMSAAFEKSGPAEQVVKTFRGTQGRDAFEAVKEGQVGHDAGYLSTSRDPGVARSFAGQGTITTLFGRSGIDVSEISIEGDEQEILYDKGTDMRVLLSAKDGQGVTRRVLEEATLGERSGHGEGLLDALDLATGTDRSGKPQEQDLRLRMRGLDLA

The nucleic acid sequence of the coding recombinant protein ExoS is SEQ ID No.3

ATGTCCTCGGCCGTCGTGTTCAAGCAGATGGTGCTGCAGCAGGCATTGCCCATGACCTTGAAGGGACTCGACAAGGCGAGCGAGCTGGCGACCCTGACACCGGAAGGACTGGCCCGGGAGCACTCCCGCCTGGCCAGCGGAGATGGGGCGCTGCGTTCGCTGAGCACCGCCTTGGCCGGCATTCGTGCCGGCAGCCAGGTCGAGGAGTCCCGTATCCAGGCTGGCCGCCTGCTCGAACGGAGCATCGGCGGGATCGCGCTGCAGCAGTGGGGCACCACCGGCGGTGCCGCGAGTCAACTGGTGCTCGACGCAAGCCCGGAACTGCGGCGCGAAATCACCGACCAGTTGCATCAGGTAATGAGCGAGGTCGCACTGTTGCGCCAAGCGGTAGAGAGCGAGGTCAGCAGAGTATCGGCCGACAAGGCGCTGGCGGATGGCCTGGTGAAGCGGTTCGGGGCGGATGCGGAAAAGTACCTGGGCAGACAGCCTGGTGGCATCCACAGTGACGCCGAAGTGATGGCGCTTGGTCTCTACACCGGCATTCACTACGCGGACCTGAATCGCGCTCTGCGTCAGGGGCAGGAGCTGGATGCGGGACAAAAGCTGATCGACCAAGGTATGTCCGCGGCCTTCGAGAAGAGCGGACAGGCTGAACAGGTAGTGAAGACTTTCCGTGGCACCCGTGGCGGGGATGCCTTCAACGCCGTGGAAGAGGGCAAGGTTGGCCACGACGACGGCTATCTCTCCACCTCCCTGAACCCCGGTGTCGCGAGGAGCTTCGGGCAGGGCACGATATCCACCGTGTTCGGCAGGTCCGGAATCGATGTCAGCGGGATATCGAACTACAAGAATGAAAAAGAGATTCTCTATAACAAAGAGACCGACATGCGCGTGCTGCTGAGCGCCAGCGATGAGCAGGGAGTGACCCGCCGGGTCCTCGAAGAGGCGGCCCTGGGGGAGCAGAGTGGCCATAGCCAGGGACTGCTCGATGCTCTCGACCTGGCAAGCAAACCGGAACGTTCAGGCGAGGTCCAGGAACAGGATGTACGCCTGAGGATGCGCGGCCTTGATCTGGCC

The nucleic acid sequence of the coding recombinant protein ExoT is SEQ ID No.4

ATGCATATTCAATCATCTCAGCAGAACCCGTCTTTCGTGGCTGAGTTGAGCCAGGCCGTGGCCGGGCGCCTGGGACAGGTCGAGGCCCGCCAGGTGGCCACTCCCCGGGAGGCGCAACAACTGGCCCAGCGCCAGGAAGCACCGAAGGGCGAGGGCCTGCTCTCCCGCCTGGGGGCTGCCCTCGCGCGTCCCTTCGTGGCGATCATCGAGTGGCTGGGCAAACTGCTGGGGAGCCGTGCCCACGCCGCCACCCAGGCGCCGCTCTCCCGTCAGGACGCGCCGCCTGCCGCCAGTCTCTCTGCCGCCGAGATCAAGCAGATGATGCTGCAAAAGGCACTGCCCCTGACCTTGGGCGGACTTGGCAAGGCGAGCGAGCTGGCGACTTTGACAGCGGAGAGGCTGGCGAAGGATCACACGCGCCTGGCCAGCGGCGACGGCGCTCTGCGATCGCTGGCCACCGCCCTGGTCGGGATTCGCGATGGCAGCCGGATCGAGGCTTCCCGTACCCAGGCTGCCCGCCTGCTCGAACAGAGCGTTGGGGGGATCGCGCTGCAACAGTGGGGGACCGCGGGCGGTGCCGCCAGCCAGCATGTACTCAGCGCAAGCCCGGAGCAACTGCGCGAAATCGCCGTCCAACTGCATGCGGTAATGGACAAGGTCGCCCTGTTGCGCCACGCGGTAGAGAGCGAGGTAAAGGGCGAGCCTGTCGACAAGGCGCTGGCGGATGGCCTGGTGGAGCACTTCGGGCTGGAGGCGGAGCAGTACCTCGGCGAACACCCGGACGGGCCGTACAGCGATGCCGAGGTGATGGCGCTCGGTCTCTATACCAACGGCGAGTACCAGCACCTGAATCGGTCCCTGCGTCAGGGACGGGAGCTGGATGCGGGCCAGGCGTTGATCGACCGGGGCATGTCTGCCGCGTTCGAAAAGAGCGGACCGGCTGAACAGGTCGTGAAGACCTTCCGCGGCACCCAGGGCAGGGATGCCTTCGAGGCGGTGAAAGAGGGCCAGGTCGGCCACGACGCCGGCTATCTCTCCACCTCCCGGGACCCCGGCGTTGCCAGGAGCTTCGCGGGCCAGGGCACGATAACCACCCTGTTCGGCAGATCCGGGATCGATGTCAGCGAGATATCGATCGAGGGCGATGAGCAGGAGATCCTCTACGACAAGGGGACCGACATGCGCGTGCTTCTCAGTGCCAAGGATGGGCAGGGTGTGACCCGTCGGGTGCTCGAAGAGGCCACGCTGGGGGAACGGAGCGGCCACGGCGAGGGACTGCTCGATGCCCTGGACCTGGCAACCGGGACGGATCGTTCAGGCAAGCCCCAGGAACAGGACCTGCGCCTGAGAATGCGCGGCCTCGACCTGGCC

Example 2: identification of immunogenicity of recombinant proteins ExoS and ExoT

Preparing an immune preparation for injection, wherein the immune preparation comprises fusion protein ExoS or ExoT and an aluminum adjuvant, each dose is 100ul, the immune preparation comprises 25ug of antigen protein, and the concentration of aluminum element in the immune preparation is 1 mg/ml. Each mouse was injected subcutaneously through the neck with the immunization preparation, each injection amounting to 100 ul. Immunizations were performed every 14 days for a total of three times. The negative control is 90% PBS added with 10% aluminum adjuvant, the concentration of aluminum element in the negative control is 1mg/ml, and the total amount of each injection is 100 ul. And blood was taken and serum was isolated on days 7, 21 and 35, and whether recombinant proteins ExoS and ExoT could induce B cell responses was evaluated using enzyme-linked immunosorbent assay (ELISA). The test results show that: the mice in the immunized group all activated significantly the IgG/IgG1/IgG2a antibody levels (FIG. 2).

Furthermore, 72 hours after the third booster immunization, the test animals were euthanized, spleen tissues were aseptically taken out, and after grinding, monocytes were isolated using a lymphocyte separation medium. Monocytes were incubated in enzyme-linked immunospot assay (ELISPOT) plate wells and stimulated simultaneously. Incubation in 37 ℃ incubator and cytokine capture. The formation of spots was detected after 24 hours. The data show that mice immunized with the recombinant proteins ExoS and ExoT can induce cellular immune responses that produce Th1, Th2 and Th17 associated with IFN- γ, IL-4 and IL17a (fig. 3).

Example 3: toxicity attack protective test

Immunized mice were injected 2X 10 by tail vein⁷CFU/lethal dose of pseudomonas aeruginosa, a bacteremia model was prepared. The conditions of the immunized group and the negative control group were observed, the mice in the negative control group all died within one week after injection, and the protection rate of the mice immunized with ExoS or ExoT reached 100% (fig. 4).

With non-lethal dose 1X10⁷Four days after the mice immunized with cfu of pseudomonas aeruginosa were infected, different tissues were used to examine bacterial load, and as a result, it was found that the bacterial load in the lung, kidney and spleen was significantly reduced in the mice of the immunized group (fig. 5).

Example 4: passive immune protection test

To further explore the protective mechanisms of ExoS and ExoT, post-immune mouse serum or normal mouse serum was intravenously infused back into immunodeficient NCG mice. After 2 hours, a lethal dose of pseudomonas aeruginosa was intravenously injected. The results show that mice injected with normal mouse serum die 100% within an observation period of 40 days, whereas test animals reinfused with immunized mouse serum can achieve protection of 80% (ExoS group) and 100% (ExoT group), respectively (fig. 6).

SEQUENCE LISTING

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> immune application of pseudomonas aeruginosa toxin ExoS and ExoT and preparation method thereof

<130>CP119011204C

<160>4

<170>PatentIn version 3.3

<210>1

<211>359

<212>PRT

<213> recombinant protein ExoS

<400>1

Met Ser Ser Ala Val Val Phe Lys Gln Met Val Leu Gln Gln Ala Leu

1 5 10 15

Pro Met Thr Leu Lys Gly Leu Asp Lys Ala Ser Glu Leu Ala Thr Leu

20 25 30

Thr Pro Glu Gly Leu Ala Arg Glu His Ser Arg Leu Ala Ser Gly Asp

35 40 45

Gly Ala Leu Arg Ser Leu Ser Thr Ala Leu Ala Gly Ile Arg Ala Gly

50 55 60

Ser Gln Val Glu Glu Ser Arg Ile Gln Ala Gly Arg Leu Leu Glu Arg

65 70 75 80

Ser Ile Gly Gly Ile Ala Leu Gln Gln Trp Gly Thr Thr Gly Gly Ala

85 90 95

Ala Ser Gln Leu Val Leu Asp Ala Ser Pro Glu Leu Arg Arg Glu Ile

100 105 110

Thr Asp Gln Leu His Gln Val Met Ser Glu Val Ala Leu Leu Arg Gln

115 120 125

Ala Val Glu Ser Glu Val Ser Arg Val Ser Ala Asp Lys Ala Leu Ala

130 135 140

Asp Gly Leu Val Lys Arg Phe Gly Ala Asp Ala Glu Lys Tyr Leu Gly

145 150 155 160

Arg Gln Pro Gly Gly Ile His Ser Asp Ala Glu Val Met Ala Leu Gly

165 170 175

Leu Tyr Thr Gly Ile His Tyr Ala Asp Leu Asn Arg Ala Leu Arg Gln

180 185 190

Gly Gln Glu Leu Asp Ala Gly Gln Lys Leu Ile Asp Gln Gly Met Ser

195 200 205

Ala Ala Phe Glu Lys Ser Gly Gln Ala Glu Gln Val Val Lys Thr Phe

210 215 220

Arg Gly Thr Arg Gly Gly Asp Ala Phe Asn Ala Val Glu Glu Gly Lys

225 230 235 240

Val Gly His Asp Asp Gly Tyr Leu Ser Thr Ser Leu Asn Pro Gly Val

245 250 255

Ala Arg Ser Phe Gly Gln Gly Thr Ile Ser Thr Val Phe Gly Arg Ser

260 265 270

Gly Ile Asp Val Ser Gly Ile Ser Asn Tyr Lys Asn Glu Lys Glu Ile

275 280 285

Leu Tyr Asn Lys Glu Thr Asp Met Arg Val Leu Leu Ser Ala Ser Asp

290 295 300

Glu Gln Gly Val Thr Arg Arg Val Leu Glu Glu Ala Ala Leu Gly Glu

305 310 315 320

Gln Ser Gly His Ser Gln Gly Leu Leu Asp Ala Leu Asp Leu Ala Ser

325 330 335

Lys Pro Glu Arg Ser Gly Glu Val Gln Glu Gln Asp Val Arg Leu Arg

340 345 350

Met Arg Gly Leu Asp Leu Ala

355

<210>2

<211>457

<212>PRT

<213> recombinant protein ExoT

<400>2

Met His Ile Gln Ser Ser Gln Gln Asn Pro Ser Phe Val Ala Glu Leu

1 5 10 15

Ser Gln Ala Val Ala Gly Arg Leu Gly Gln Val Glu Ala Arg Gln Val

20 25 30

Ala Thr Pro Arg Glu Ala Gln Gln Leu Ala Gln Arg Gln Glu Ala Pro

35 40 45

Lys Gly Glu Gly Leu Leu Ser Arg Leu Gly Ala Ala Leu Ala Arg Pro

50 55 60

Phe Val Ala Ile Ile Glu Trp Leu Gly Lys Leu Leu Gly Ser Arg Ala

65 70 75 80

His Ala Ala Thr Gln Ala Pro Leu Ser Arg Gln Asp Ala Pro Pro Ala

85 90 95

Ala Ser Leu Ser Ala Ala Glu Ile Lys Gln Met Met Leu Gln Lys Ala

100 105 110

Leu Pro Leu Thr Leu Gly Gly Leu Gly Lys Ala Ser Glu Leu Ala Thr

115 120 125

Leu Thr Ala Glu Arg Leu Ala Lys Asp His Thr Arg Leu Ala Ser Gly

130 135 140

Asp Gly Ala Leu Arg Ser Leu Ala Thr Ala Leu Val Gly Ile Arg Asp

145 150 155 160

Gly Ser Arg Ile Glu Ala Ser Arg Thr Gln Ala Ala Arg Leu Leu Glu

165 170 175

Gln Ser Val Gly Gly Ile Ala Leu Gln Gln Trp Gly Thr Ala Gly Gly

180 185 190

Ala Ala Ser Gln His Val Leu Ser Ala Ser Pro Glu Gln Leu Arg Glu

195 200 205

Ile Ala Val Gln Leu His Ala Val Met Asp Lys Val Ala Leu Leu Arg

210 215 220

His Ala Val Glu Ser Glu Val Lys Gly Glu Pro Val Asp Lys Ala Leu

225 230 235 240

Ala Asp Gly Leu Val Glu His Phe Gly Leu Glu Ala Glu Gln Tyr Leu

245 250 255

Gly Glu His Pro Asp Gly Pro Tyr Ser Asp Ala Glu Val Met Ala Leu

260 265 270

Gly Leu Tyr Thr Asn Gly Glu Tyr Gln His Leu Asn Arg Ser Leu Arg

275 280 285

Gln Gly Arg Glu Leu Asp Ala Gly Gln Ala Leu Ile Asp Arg Gly Met

290 295 300

Ser Ala Ala Phe Glu Lys Ser Gly Pro Ala Glu Gln Val Val Lys Thr

305 310 315 320

Phe Arg Gly Thr Gln Gly Arg Asp Ala Phe Glu Ala Val Lys Glu Gly

325 330 335

Gln Val Gly His Asp Ala Gly Tyr Leu Ser Thr Ser Arg Asp Pro Gly

340 345 350

Val Ala Arg Ser Phe Ala Gly Gln Gly Thr Ile Thr Thr Leu Phe Gly

355 360 365

Arg Ser Gly Ile Asp Val Ser Glu Ile Ser Ile Glu Gly Asp Glu Gln

370 375 380

Glu Ile Leu Tyr Asp Lys Gly Thr Asp Met Arg Val Leu Leu Ser Ala

385 390 395 400

Lys Asp Gly Gln Gly Val Thr Arg Arg Val Leu Glu Glu Ala Thr Leu

405 410 415

Gly Glu Arg Ser Gly His Gly Glu Gly Leu Leu Asp Ala Leu Asp Leu

420 425 430

Ala Thr Gly Thr Asp Arg Ser Gly Lys Pro Gln Glu Gln Asp Leu Arg

435 440 445

Leu Arg Met Arg Gly Leu Asp Leu Ala

450 455

<210>3

<211>1077

<212>DNA

<213> nucleic acid sequence encoding recombinant protein ExoS

<400>3

atgtcctcgg ccgtcgtgtt caagcagatg gtgctgcagc aggcattgcc catgaccttg 60

aagggactcg acaaggcgag cgagctggcg accctgacac cggaaggact ggcccgggag 120

cactcccgcc tggccagcgg agatggggcg ctgcgttcgc tgagcaccgc cttggccggc 180

attcgtgccg gcagccaggt cgaggagtcc cgtatccagg ctggccgcct gctcgaacgg 240

agcatcggcg ggatcgcgct gcagcagtgg ggcaccaccg gcggtgccgc gagtcaactg 300

gtgctcgacg caagcccgga actgcggcgc gaaatcaccg accagttgca tcaggtaatg 360

agcgaggtcg cactgttgcg ccaagcggta gagagcgagg tcagcagagt atcggccgac 420

aaggcgctgg cggatggcct ggtgaagcgg ttcggggcgg atgcggaaaa gtacctgggc 480

agacagcctg gtggcatcca cagtgacgcc gaagtgatgg cgcttggtct ctacaccggc 540

attcactacg cggacctgaa tcgcgctctg cgtcaggggc aggagctgga tgcgggacaa 600

aagctgatcg accaaggtat gtccgcggcc ttcgagaaga gcggacaggc tgaacaggta 660

gtgaagactt tccgtggcac ccgtggcggg gatgccttca acgccgtgga agagggcaag 720

gttggccacg acgacggcta tctctccacc tccctgaacc ccggtgtcgc gaggagcttc 780

gggcagggca cgatatccac cgtgttcggc aggtccggaa tcgatgtcag cgggatatcg 840

aactacaaga atgaaaaaga gattctctat aacaaagaga ccgacatgcg cgtgctgctg 900

agcgccagcg atgagcaggg agtgacccgc cgggtcctcg aagaggcggc cctgggggag 960

cagagtggcc atagccaggg actgctcgat gctctcgacc tggcaagcaa accggaacgt 1020

tcaggcgagg tccaggaaca ggatgtacgc ctgaggatgc gcggccttga tctggcc 1077

<210>4

<211>1371

<212>DNA

<213> nucleic acid sequence encoding recombinant protein ExoT

<400>4

atgcatattc aatcatctca gcagaacccg tctttcgtgg ctgagttgag ccaggccgtg 60

gccgggcgcc tgggacaggt cgaggcccgc caggtggcca ctccccggga ggcgcaacaa 120

ctggcccagc gccaggaagc accgaagggc gagggcctgc tctcccgcct gggggctgcc 180

ctcgcgcgtc ccttcgtggc gatcatcgag tggctgggca aactgctggg gagccgtgcc 240

cacgccgcca cccaggcgcc gctctcccgt caggacgcgc cgcctgccgc cagtctctct 300

gccgccgaga tcaagcagat gatgctgcaa aaggcactgc ccctgacctt gggcggactt 360

ggcaaggcga gcgagctggc gactttgaca gcggagaggc tggcgaagga tcacacgcgc 420

ctggccagcg gcgacggcgc tctgcgatcg ctggccaccg ccctggtcgg gattcgcgat 480

ggcagccgga tcgaggcttc ccgtacccag gctgcccgcc tgctcgaaca gagcgttggg 540

gggatcgcgc tgcaacagtg ggggaccgcg ggcggtgccg ccagccagca tgtactcagc 600

gcaagcccgg agcaactgcg cgaaatcgcc gtccaactgc atgcggtaat ggacaaggtc 660

gccctgttgc gccacgcggt agagagcgag gtaaagggcg agcctgtcga caaggcgctg 720

gcggatggcc tggtggagca cttcgggctg gaggcggagc agtacctcgg cgaacacccg 780

gacgggccgt acagcgatgc cgaggtgatg gcgctcggtc tctataccaa cggcgagtac 840

cagcacctga atcggtccct gcgtcaggga cgggagctgg atgcgggcca ggcgttgatc 900

gaccggggca tgtctgccgc gttcgaaaag agcggaccgg ctgaacaggt cgtgaagacc 960

ttccgcggca cccagggcag ggatgccttc gaggcggtga aagagggcca ggtcggccac 1020

gacgccggct atctctccac ctcccgggac cccggcgttg ccaggagctt cgcgggccag 1080

ggcacgataa ccaccctgtt cggcagatcc gggatcgatg tcagcgagat atcgatcgag 1140

ggcgatgagc aggagatcct ctacgacaag gggaccgaca tgcgcgtgct tctcagtgcc 1200

aaggatgggc agggtgtgac ccgtcgggtg ctcgaagagg ccacgctggg ggaacggagc 1260

ggccacggcg agggactgct cgatgccctg gacctggcaa ccgggacgga tcgttcaggc 1320

aagccccagg aacaggacct gcgcctgaga atgcgcggcc tcgacctggc c 1371

Claims

1. A recombinant protein of Pseudomonas aeruginosa toxin ExoS has an amino acid sequence shown in SEQ ID No. 1.

2. A nucleic acid encoding the recombinant protein of claim 1.

3. Use of a Pseudomonas aeruginosa toxin or a gene encoding a Pseudomonas aeruginosa toxin in the preparation of an immune preparation against Pseudomonas aeruginosa infection,

the pseudomonas aeruginosa toxin is selected from one or more combinations of recombinant proteins of ExoS or recombinant proteins of ExoT, the amino acid sequence of the recombinant proteins of ExoS is shown in SEQ ID No.1, and the amino acid sequence of the recombinant proteins of ExoT is shown in SEQ ID No. 2.

4. The immune composition comprises an antigen and an adjuvant, and is characterized in that the antigen is selected from one or more of a recombinant protein of pseudomonas aeruginosa toxin ExoS or a recombinant protein of pseudomonas aeruginosa toxin ExoT, the amino acid sequence of the recombinant protein of ExoS is shown in SEQ ID No.1, and the amino acid sequence of the recombinant protein of ExoT is shown in SEQ ID No. 2.

5. The immunogenic composition of claim 4, wherein the adjuvant is selected from the group consisting of aluminum adjuvants, calcium phosphate adjuvants, cholera toxin B subunits, saporin Q21, liposomes, monophosphoryl lipid A, MF59, E.

6. The immunogenic composition according to claim 5, wherein the aluminum adjuvant is selected from aluminum hydroxide, aluminum phosphate or aluminum sulfate.

7. A method for preparing a recombinant protein of pseudomonas aeruginosa toxin ExoS according to claim 1, comprising the steps of:

coupling a nucleic acid sequence for coding pseudomonas aeruginosa toxin ExoS with a plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into host bacteria, and performing induced expression to obtain recombinant protein; the nucleic acid sequence for coding the pseudomonas aeruginosa toxin ExoS is shown in SEQ ID No. 3.