KR101526054B1 - Use of the CnKTR3 gene encoding a mannoslytransferase for treating mycoses by Cryptococcus neoformans - Google Patents

Abstract

The present invention relates to the use of the glycosyltransferase gene CnKTR3 for use in the treatment of fungal infections by Cryptococcus neoformans . The present invention provides a method for producing a CnKTR3 protein comprising contacting a test substance with a cell comprising a CnKTR3 protein; Measuring the level of expression or activity of CnKTR3 protein in cells in contact with the test substance; And selecting a test substance in which the expression or activity level of the CnKTR3 protein is decreased as compared with a control sample. The present invention also provides a pharmaceutical composition for an antifungal agent comprising, as an active ingredient, a CnKTR3 protein expression or activity inhibitor. Since the homologous to the CnKTR3 protein of the present invention is not present in the human body, the fungal-specific α1,2-mannosyltransferase may be a useful target for the development of antifungal agents.

Description

Use of the glycosyltransferase gene CnKTR3 for the treatment of fungal infections caused by cryptococcus neoformans Use of the CnKTR3 gene encoding a mannosyltransferase for treating mycoses by Cryptococcus neoformans

The present invention relates to the use of the glycosyltransferase gene CnKTR3 for use in the treatment of fungal infections by Cryptococcus neoformans .

Cryptococcus neoformans , an opportunistic infectious human pathogen, is one of the fungi belonging to the heterotrophic bacillus, and is widely used in various natural environments such as seawater and fresh water, soil, trees, livestock, It is widely found. Cryptococcus spp. Is classified as Cryptococcus neoformans and Cryptococcus gatti (serotype B, C), while C. neoformans is classified as C. neoformans var. neoformans (serotype D), C. neoformans there is . grubii (serotype A). The first human infection was reported in 1894 and causes acute, subacute, and chronic lung, meningitis, and systemic infections. Cryptococcus neoformans infections are caused by inhalation of yeast-shaped cells into the lungs in the natural environment, and are often infected with immunocompromised patients, but patients without prior disease can also become infected. In a host with normal immunity, the initial infection produces granuloma and causes an antibody response. In patients with impaired immune function due to organ transplantation and acquired immunodeficiency syndrome (AIDS), the central nervous system (CNS) ), Leading to life-threatening meningitis, has been found to be a major cause of AIDS mortality in the world.

The fungal cell wall is a good target for the development of fungal infectious agents because it has the structural characteristics that are essential for the survival of fungi to protect the fungus from the immune system in the host and not exist in the host. At the outermost part of the cell wall are several proteins that are mostly attached to N-linked or O-linked glycans as well as proteins secreted out of the cell. Particularly, glycoproteins which play an important role in intercellular communication or pathogenicity of microorganisms have a large amount of O-sugar modification.

In general, O-glycosylation is shorter than N-glycosylation, and O-mannosylation, which is mainly composed of mannose residues in yeast and fungi, is accomplished through the following process: a new synthesis in the ER (Endoplasmic Reticulum) Mannose is added from Dol-P-Man by the Pmt protein, which is secreted considerably evolutionarily into the polypeptide serine / threonine residues as the secreted or membrane proteins are transferred into the endoplasmic reticulum or the endoplasmic reticulum Mannose is further added with the GTP-mannose as the substrate by the α1,2-mannosyltransferase which is synthesized by the core O-linked sugar chain and then transferred to the Golgi and coded by the KTR family ( KTR family) do. Traditional yeast Saccharomyces cerevisiae) the nine genes (KRE2 / MNT1, KTR1, KTR2 , KTR3, KTR4, KTR5, KTR6, KTR7, YUR1) belonging to KTR family are involved in extension of the O- linked sugar chains. Pathogenic fungi in Aspergillus Fu Micah Tuscan (Aspergillus. Fumigatus) are three KTR And a homologous gene (MNT1, MNT2, MNT3) exists, Candida albicans (Candida albicans ) have reported five KTR homologous genes ( MNT1 , MNT2 , MNT3 , KTR2 , and KTR4 ). The α1,2- of both pathogenic fungus which only KTR nosil transition encoding the enzyme Although genetic defects belonging to the family have been shown to cause pathogenic weakness, the KTR family-related genes in the pathogenic fungus Cryptococcus neoformans are not yet known. Since the homologous to the KTR family gene product, α1,2-mannosyltransferase, is not present in the human body, the fungal-specific α1,2-mannosyltransferase may be a useful target for development of antifungal agents.

Korean Patent Publication No. 2012-0053321 discloses a novel strain producing an antifungal substance, which comprises Streptomyces javancis MJEMM 5508 which produces an antifungal substance and a composition for controlling phytopathogenic fungi comprising the same as an effective ingredient thereof, A pharmaceutical composition for treating an infectious disease caused by a pathogenic yeast and a pathogenic fungus containing an effective ingredient, and a method for controlling a causative agent of a fungus caused by a plant growing therefrom, There is no mention of CnKTR3 , a novel gene for mannosyltransferase .

Accordingly, the present inventors have carried out studies on the sugar chain structure of cell wall proteins of Cryptococcus neoformans and their biosynthesis. As a part of this research, we have searched for genes involved in the extension of O-glycosylation of Cryptococcus neoformans and tried to clarify the linkage of the pathogenicity. As a result, a novel gene of α1,2-mannosyltransferase of Cryptococcus neoformans was identified and its function in the synthesis of O-oligosaccharide was identified. When the gene was defected, the pathogenicity of Cryptococcus neoformans And the present invention has been completed.

It is an object of the present invention to provide a method for producing a CnKTR3 protein comprising contacting a test substance with a cell comprising a CnKTR3 protein; Measuring the level of expression or activity of CnKTR3 protein in cells in contact with the test substance; And a step of selecting a test substance in which the degree of expression or activity of the CnKTR3 protein is decreased as compared with a control sample.

It is another object of the present invention to provide a pharmaceutical composition for an antifungal agent comprising, as an active ingredient, a CnKTR3 protein expression or activity inhibitor.

In order to accomplish the above object, the present invention provides a method for screening a test substance comprising contacting a cell comprising a CnKTR3 protein with a test substance; Measuring the level of expression or activity of CnKTR3 protein in cells in contact with the test substance; And selecting a test substance in which the expression or activity level of the CnKTR3 protein is decreased as compared with a control sample. Preferably, the CnKTR3 protein is represented by SEQ ID NO: 1.

Preferably, the expression or activity level of the CnKTR3 protein is determined by reverse transcription-polymerase chain reaction (RT-PCR), enzyme immunoassay (ELISA), immunohistochemistry, Western blotting or flow cytometry (FACS). ≪ / RTI >

In detail, the fungus is characterized by being Cryptococcus neoformans .

The term "test substance" used in reference to the screening method of the present invention refers to an unknown candidate substance used in screening in order to examine whether it affects the expression amount of a gene or affects the expression or activity of a protein. do. Such samples include, but are not limited to, chemicals, nucleotides, antisense-RNA, siRNA (small interference RNA) and natural extracts.

The present invention also provides a pharmaceutical composition for an antifungal agent comprising, as an active ingredient, a CnKTR3 protein expression or activity inhibitor.

Specifically, the CnKTR3 protein expression inhibitor may be selected from the group consisting of an antisense nucleotide complementary to mRNA of CnKTR3 gene, a small interfering RNA (siRNA) and a short hairpin RNA (shRNA) Wherein the CnKTR3 protein activity inhibitor is any one selected from the group consisting of a compound that specifically binds to the CnKTR3 protein, a peptide, a peptide mimetic, an aptamer, an antibody, and a natural product.

The term "antisense nucleotide " in the present invention means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and binds to a complementary sequence in mRNA to inhibit translation of mRNA into a protein .

The term "small interfering RNA (siRNA)" in the present invention means a nucleic acid molecule capable of mediating RNA interference or gene silencing. Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method.

The term "short hairpin RNA (shRNA)" in the present invention refers to an oligonucleotide synthesizing oligonucleotides connecting 3-10 base linkers between the sense of the target gene siRNA sequence and the complementary nonsense, Or by shRNA insertion into retroviruses such as lentivirus and adenovirus, the short hairpin RNA with a looped hairpin structure is produced and converted into siRNA by intracellular Dicer to produce an RNAi effect It says. The shRNA shows a relatively long-term RNAi effect as compared to siRNA.

The term "Peptide Minetics" in the present invention is a peptide or nonpeptide that inhibits the binding domain of the CnKTR3 protein leading to CnKTR3 activity.

In the present invention, the term "Aptamer" is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure and capable of binding to a target molecule with high affinity and specificity. Aptamers are comparable to monoclonal antibodies due to their inherent high affinity (usually pM levels) and their ability to bind to target molecules with specificity, and there is a high likelihood of being an alternative antibody, especially as a "chemoantibody".

"Antibody" of the present invention can be prepared either through CnKTR3 injection or commercially available. In addition, the antibody includes a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope.

The polyclonal antibody can be produced by a conventional method of injecting the CnKTR3 into an animal and collecting blood from the animal to obtain a serum containing the antibody. Such polyclonal antibodies can be purified by any method known in the art and can be made from any animal species host such as goats, rabbits, sheep, monkeys, horses, pigs, cows, dogs and the like.

Monoclonal antibodies can be prepared using any technique that provides for the generation of antibody molecules through the cultivation of continuous cell lines. Such techniques include, but are not limited to, hybridoma technology, human B-cell line hybridoma technology, and EBV-hybridoma technology.

The pharmaceutical composition of the present invention may contain a chemical substance, a nucleotide, an antisense, an siRNA oligonucleotide and a natural product extract as an active ingredient. The pharmaceutical composition or the combined preparation of antifungal compounds of the present invention may be prepared by using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the active ingredients. Examples of the adjuvants include excipients, disintegrants, sweeteners, binders, A solubilizing agent such as a lubricant, a lubricant, or a flavoring agent may be used. The antifungal drug composition of the present invention may be formulated into a pharmaceutical composition containing at least one pharmaceutically acceptable carrier in addition to the active ingredient for administration. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile solutions suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

The pharmaceutical preparation forms of the pharmaceutical composition of the present invention may be granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions, . The pharmaceutical composition of the present invention can be administered orally, intravenously, intramuscularly, intraarterally, intraperitoneally, intrasternally, transdermally, intranasally, by inhalation, topically, rectally, ≪ / RTI > The effective amount of the active ingredient of the pharmaceutical composition of the present invention means the amount required for prevention or treatment of the disease. Accordingly, the present invention is not limited to the particular type of the disease, the severity of the disease, the kind and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, body weight, general health status, sex and diet, Rate of administration, duration of treatment, concurrent medication, and the like. For example, in the case of an adult, the inhibitor of the present invention may be administered at a dose of 0.1 ng / kg to 10 g / kg when the compound is administered once to several times a day, a polypeptide, In the case of protein or antibody, 0.1 ng / kg to 10 g / kg, antisense nucleotide, siRNA, shRNAi or miRNA can be administered at a dose of 0.01 ng / kg to 10 g / kg.

The present invention relates to the use of the glycosyltransferase gene CnKTR3 for the treatment of fungal infections caused by cryptococcus neoformans, and relates to a method for the treatment of fungal infections by inhibiting the activity of a glycosyltransferase involved in the elongation of fungal- Can be provided. Since the homologous to the KTR family gene product, α1,2-mannosyltransferase, is not present in the human body, the fungal-specific α1,2-mannosyltransferase may be a useful target for development of antifungal agents.

1 is a comparative analysis of amino acid sequence homology with a protein encoded by Cryptococcus neoformans CnKTR3 gene and a KTR protein family of Saccharomyces cerevisiae.
Figure 2A shows a schematic diagram of the introduction of a gene disruption cassette by DNA cassette and intracellular gene homologous recombination for Cryptococcus neoformans CnKTR3 gene disruption. The probes used in the Southern blot are indicated by gray squares. FIG. 2B is a graph showing the relationship between the wild-type strain and Cn KTR3 The genomic DNA of the transformed strain (Cn ktr3 ?) With the gene was cut out with Bgl II and confirmed by Southern blot. The wild type (WT) will have a band of 4,398 bp, and the crushed strain (Mu) will have a band of 1,177 bp.
3 is Cryptococcal kusu neo satiety's wild-type (H99), CnKTR3 gene-deficient mutant (CnKTR3 D), CnKTR3 D mutants with CnKTR3 gene was re-introduced (CnKTR3 D + CnKTR3), my process as Saccharomyces celebrity bicyclic Ke wild type (BY4742) Derived O-sugar profile. (A) and (B) before and after treatment with α1-2,3,6 mannosidase (JBM).
FIG. 4 shows the results of analysis of physiological characteristics of the CnKTR3 gene deletion mutant ( CnKTR3 D) of Cryptococcus neoformans. Hypromycin B, 0.05% SDS (sodium dodecyl sulfate), 0.05% SDS (sodium dodecyl sulphate), and 30 μg / ml of YPD (1% yeast extract, + 1 M sorbitol, 1 M NaCl, 1 M NaCl + 1 M sorbitol. The strains used in the experiments were wild type (WT), Cn ktr3 Δ, Cn ktr3 Δ + Cn KTR3 , Cn hxl1 Δ.
Figure 5 is a defect of CnKTR3 genes involved in the sugar chain in the extension of O- This is a schematic analysis of the survival rate by infecting the model mouse with the effect on the pathogenicity in vivo . The strains used in the experiments were wild type (WT), Cn ktr3 Δ, Cn ktr3 Δ + Cn KTR3 .

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example  One : in silico  O- Sugar chain  Biosynthetic pathway related Transglycosylase  Gene identification

Cryptococcal Syracuse Neo's satiety KRE2 of Saccharomyces Isis in Rome in order to find the genes involved in the biosynthesis of oligosaccharides from O- / MNT1 genes (KRE2 / MNT1, KTR1, KTR2 , KTR3, KTR4, KTR5, KTR6, KTR7, YUR1) homology the visible result of search in the gene database (http://www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html) of C. neoformans serotype a strain of the H99 gene were selected CNAG_03832.2 candidate genes. Only this gene was the only gene homologous to the KRE2 / MNT1 gene group, and the sequence corresponding to the a-1,2-mannosyltransferase domain was partially conserved, resulting in Cn KTR3 (Fig. 1).

Example  2 : Cn KTR3  Genetically-modified mutants and re-introduced strains

1. Strain and culturing conditions

In the present invention, Cryptococcus neoformans shown in Table 1 below was used as a strain. As the liquid medium, yeast extract-peptone-dextrose (YPD) was used and the strains were cultured at 30 DEG C at 220 rpm.

Strain Genotype References C. neoformans
H99 Anti-circular A MAT α J. Clin. Microbiol.
31 (12), 3305-3309 Cn ktr3 ? MAT αCn03832.2 :: NAT # 159 Invention Cn ktr3 ? + Cn KTR3 MAT αCn03832.2 :: NAT # 159Cn03832.2- NEO Invention Cn hxl1 ? MAT α hxl1 Δ :: NAT # 229 PLoS Pathog 7 (8): e1002177

* Each NAT # signifies a Nat ^r marker with a unique signature tag.

2. Results

In accordance with the previously reported method (Microbiology (2002) 148: 2607-2615, Biochem Biophys Res Commun (2009) 390: 983-988) to analyze growth characteristics and pathogenic changes caused by CnKTR3 gene deletion, Split-marker and biolistic transformation were performed by double-joint PCR using Cn KTR3 from C. neoformans antigen A H99 strain The gene was disrupted (Fig. 2A). Primers necessary for gene disruption are shown in Table 2 below. Cn KTR3, which was isolated and purified by double- stranded PCR on gold microcarrier beads (0.6 μm [Bio-Rad]) The gene disruption cassette was coated and transformed with the antigen A H99 strain. The strains that were able to grow in YPD medium containing 100 μg / ml of Nourseothricin were selected and used for diagnostic PCR. Southern blot analysis using gene-specific probes revealed that Cn KTR3 It was confirmed that the gene was a disrupted transformant strain (Cn ktr3 ?) (Fig. 2B).

primer The sequence (5 ' to  3 ') ^a purpose M13Fe GTAAAACGACGGCCAGTGAGC Production of gene disruption cassette M13Re CAGGAAACAGCTATGACCATG Production of gene disruption cassette NSL2 AACTCCGTCGCGAGCCCCATCAAC Production of gene disruption cassette NSR2 AAGGTGTTCCCCGACGACGAATCG Production of gene disruption cassette CN_3832.2D_L1 TAAGTAAGACGGTGTGCG Cn KTR3 crushing cassette production CN_3832.2D_L2 GCTCACTGGCCGTCGTTTTACGGAATCATCATCTTGGCC Cn KTR3 crushing cassette production CN_3832.2D_R1 CATGGTCATAGCTGTTTCCTGGGTAACAGATGGAGTGTC Cn KTR3 crushing cassette production CN_3832.2D_R2 TTGCTCTGTGGCAGACTA Cn KTR3 crushing cassette production CN_3832.2D_Sc_F GGCTAGTATCAAAGCGGT Cn KTR3 Fracture diagnosis CnD-ACTsqB (B79y) TGTGGATGCTGGCGGAGGATA Cn KTR3 Fracture diagnosis CN_03832_cp_F2_Sal1 CCACGTCGACCTGACATCGCTTGAGTTG Reintroduction of CnKTR3 CN_03832_cp_B_Bgl2 ATGCGGCCGCAGAACGAGAATGGTGGCA CnKTR3 Reintroduction

In order to prepare the re-introduction strain (Cn ktr3 ? + Cn KTR3 ) having the Cn KTR3 gene mutant activity in the Cnktr3 ? Mutant, the 1.2 kb promoter, 1.7 kb ORF (Open Reading Frame), and 0.8 kb A Cn KTR3 containing a terminator Gene fragments were amplified by PCR using primers CN_03832_cp_F2_Sal1 and CN_03832_cp_B_Bgl2 containing restriction enzyme sites and pJAFS1 vector with NEO marker (Neomycin / G418-resistant marker) (provided by James A. Fraser, Center for Infectious Disease Research, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, QLD 4072, Australia) to construct pJAFS1-CnKTR3. After cutting the pJAFS1-CnKTR3 confirmed by sequencing to BstZ17Ⅰ restriction enzyme by transforming the mutant strain disrupted KTR3 Cn Cn KTR3 Re-introduction strain (Cn ktr3 ? + Cn KTR3 ).

Example  3: Cn ktr3 Δ Mutant  O- Sugar chain  Profile Analysis

1. O-oligosaccharide analysis of cell wall proteins

Each strain was cultured in 100 ml YPD medium at 220 rpm at 30 ° C for 24 hours, and then suspended in DMSO (dimethyl sulfoxide, Sigma) to remove the capsular polysaccharide. The cells were washed and fixed in 10-ml citrate buffer (0.1 M, pH 7.0) Resurrection. High-pressure steam sterilization was performed at 121 ° C for 2 hours. Cell surface proteins were purified and purified with Concanavalin A to obtain mannose-bound proteins. Hydrazine monohydrate (TCI) was added thereto and reacted at 60 ° C for 4 hours to obtain O- Respectively. The separated oligosaccharides were labeled with 2-aminobenzoic acid (2-AA) at 80 ° C for 45 min and labeled on a reducing end. A column of TSK-gel amide (4.6 x 250 mm, (Waters 2690) using solvent B (5% acetic acid, 3% triethylamine, 1% tetrahydrofuran in water) and% tetrahydrofuran in acetonitrile. The detected O-glycosides were treated with jack bean α-mannosidase (JBM, 150 mU / μL, Prozyme) to confirm the cleavage of the oligosaccharide.

2. Results

The function of CnKTR3 in Cryptococcus neoformans O- glycosylation , the O-sugar profile attached to the cell wall proteins of the Cnktr3 ? Mutant strain was analyzed. In comparison with the O-oligosaccharide extracted from the wild-type strain, O- glycosides of the Cn ktr3 Δ mutant strain mainly showed that only one mannose was bound to the cell wall protein, and the Cn KTR3 gene was reintroduced into the Cn ktr3 Δ mutant strain Cn ktr3 Δ + Cn In KTR3 strain, extension of O-oligosaccharide was recovered again. This indicates that O-glycosylation by CnKTR3p was not achieved after mannose was bound by the PMT gene group (Fig. 3A). In addition, the O-oligosaccharide extracted from the wild-type strain has the same oligosaccharide length as the mutant strain when treated with the jack bean α-mannosidase, and the O-oligosaccharide extracted from the mutant strain is further supported by the result that there is no change (FIG. 3B) .

Example  4 : Cn ktr3 Stress Sensitivity Analysis of Delta Mutant Strain

1. Stress sensitivity analysis

Each strain was preincubated in 2 ml of YPD medium at 220 rpm at 30 ° C for 16 hours, and 100 μl of the aseptic solution was diluted with a 1/10 ratio starting from the initial OD ₆₀₀ value of 1.0 at the beginning, and 30 μg / 2 μl each of YPD medium supplemented with Hygromycin B, 0.05% sodium dodecyl sulfate (SDS), 0.05% SDS + 1 M sorbitol, 1 M NaCl and 1 M NaCl + 1 M sorbitol was inoculated at 30 ° C. And cultured for 2 days.

2. Results

The phenotypic analysis of the Cnktr3 Δ mutant strains showing a clear oligosaccharide deficiency showed that the Cn ktr3 Δ mutant strain was slightly slower at 39 ° C and was highly sensitive to NaCl and SDS. In particular, the sensitivity to NaCl was restored by the addition of sorbitol, but the sensitivity to SDS was increased by the addition of sorbitol. Cn ktr3 Δ mutant strain Cn KTR3 Growth was restored to the wild-type level in the transformant strains into which the gene was re-introduced (Fig. 4). This suggests that the Cn KTR3 gene involved in O-chain extension of cell wall proteins is important for the synthesis and maintenance of cell wall.

Example  5: Cn KTR3 Gene deletion in vivo  Analysis of the effect on pathogenicity

1. Cn KTR3 through cryptococcus mouse model Pathogenicity analysis of gene deletion mutations

Wild type, Cn ktr3 ? Mutant strain and Cn KTR3 The reintroduced strain (Cn ktr3 Δ + Cn KTR3 ) was cultured in YPD medium at 30 ° C. for 16 hours, washed in phosphate buffered saline (PBS) buffer solution, and the number of yeast cells was adjusted to 2 × 10 ⁶ cells / I gave it. Infection was performed by injecting 10 ⁵ cells into each of the nasal cavities of four to six weeks of A / J mice (Jackson Laboratory, 18-22 g), 10 per each wild type, mutant strain, and re-introduced strain. Survival of the mice was observed once a day for 8 weeks.

2. Results

To investigate the effect of CnKTR3 , a gene involved in O-chain extension of cell wall proteins, on the pathogenicity in vivo, the pathogenicity of the Cn ktr3 Δ mutant strain was investigated through a mouse model. As a result, it was confirmed that the virulence of Cn ktr3 Δ mutant strain was significantly lower than that of wild type strain. In contrast, the Cn ktr3 Δ + Cn KTR3 strain reintroduced the Cn KTR3 gene showed almost the same virulence as the wild type strain. These results suggest that Cn KTR3, which has major functions for O- Indicating that the gene has a great influence on the virulence of Cryptococcus (Fig. 5). Cn KTR3 Since the homologous to the α1,2-mannosyltransferase gene, which is a gene product, is not present in the human body, the fungal-specific α1,2-mannosyltransferase, which has an important influence on the pathogenicity, will be used as a very useful target for the development of antifungal agents .

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Use of the CnKTR3 gene encoding a mannoslytransferase for          treating mycoses by Cryptococcus neoformans <130> ADP-2013-0292 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 374 <212> PRT <213> Cryptococcus neoformans <400> 1 Met Ala Gly Gly Leu Val Phe Leu Leu His Val Leu Leu Ser Val His   1 5 10 15 Pro Thr Tyr Arg Glu Lys Thr Ser Ile Leu Asn Leu Leu Pro Gln Gln              20 25 30 Asp Gly Trp Arg Glu Gly Gln Pro Pro Pro Asn Ser Ala Ile Pro Pro          35 40 45 Val Val Gly Asp Leu Ala Glu Asn Glu Ala Ala Leu Glu Gly Arg Arg      50 55 60 Lys Ala Asn Ala Val Phe Val Val Leu Ala Arg Asn Ser Asp Leu Trp  65 70 75 80 Pro Phe Leu Asp Ser Met Arg Gln Met Glu Asp Arg Phe Asn His Trp                  85 90 95 Ala Lys Tyr Asp Tyr Val Phe Leu Asn Glu Glu Asp Phe Ser Asp Glu             100 105 110 Phe Lys Arg Tyr Thr Gln Ser Met Thr Lys Ala Lys Cys Tyr Tyr Gly         115 120 125 Lys Ile Asp Pro Glu His Trp Tyr Gln Pro Glu Trp Ile Asp Glu Asp     130 135 140 Lys Ala Ser Lys Ala Arg Glu Glu Met Ile Arg Lys Lys Val Ile Tyr 145 150 155 160 Gly His Ser Val Pro Tyr Arg Asn Met Cys Arg Phe Asn Ser Gly Phe                 165 170 175 Phe Phe Arg His Pro Leu Leu Ala Asn Tyr Asp Tyr Tyr Trp Arg Ile             180 185 190 Glu Pro Ser Val Lys Phe Phe Cys Asp Leu Ala Tyr Asp Pro Phe Leu         195 200 205 Val Met Gln Asp Gln Asn Lys Val Tyr Gly Phe Thr Leu Ser Leu Phe     210 215 220 Glu Tyr Ile Glu Thr Ile Pro Thr Leu Trp Asp Ala Val Lys Glu Phe 225 230 235 240 Ile Gly Glu His Pro Asp Tyr Leu Pro Glu Gly Asn Ala Met Gln Phe                 245 250 255 Leu Ser Asp Asp Gly Gly Glu Thr Tyr Asn Lys Cys His Phe Trp Ser             260 265 270 Asn Phe Glu Ile Gly Asp Leu Asn Phe Trp Arg Ser Gln Pro Tyr Met         275 280 285 Glu Phe Phe Asp Phe Leu Asp Lys Lys Gly Gly Phe Tyr Tyr Glu Arg     290 295 300 Trp Gly Asp Ala Pro Val His Ser Ile Gly Ala Ala Leu Phe Ala Lys 305 310 315 320 Lys Glu Gln Ile His Phe Phe Asp Asp Ile Gly Tyr Arg His Glu Pro                 325 330 335 Phe Gln His Cys Pro Gln Gly Asp Ala His Thr Arg Gly Asn Cys Trp             340 345 350 Cys Asp Gln Ala Asn Asn Phe Asp Trp Glu Trp Tyr Ser Cys Thr Lys         355 360 365 Lys Tyr Thr Glu Met Phe     370 <210> 2 <211> 1727 <212> DNA <213> Cryptococcus neoformans <400> 2 atggctggag gattagtcgt cagtcctcag ctatccatca tctagtgaaa tcaggcgttg 60 atgtccccta cagttcctcc tccacgtcct cctatccgtt caccctactt accgagagaa 120 aacctcaatc ttgaatcttt tgcctcaaca agacgggtgg cgtgagggcc aaccacctcc 180 caattccgcc atccctccag tcgttggcga tctggcagaa aatgaggccg ctttggaggg 240 aagaagaaaa gccaacgcgg tcttcgtcgt tttgggtgag tacctcgcag ccatgcttgt 300 aaaaggttgt ctcgcacaat atttaattat gaatcgctgc ttagcccgga attcggattt 360 gtggccgttc ctcgactcta tgcgacagat ggaggatcga ttcaatcact gggctaaata 420 tgattatgtt tttttgaacg aggaggtaaa tatcgtattt tggtcggaat ggggacaatc 480 ggctgaatca ataattttag gacttctctg acgagttcaa gcggtacact caatcaatga 540 ccaaagccaa atgttactac ggcaagattg atcccgaaca ttggtaccag cctgaatggt 600 aagacggata tgatgtttcc cattgttgga acctctattg atgattttca tcgtaggatc 660 gatgaagaca aggctagcaa ggctcgagag gaaatgataa ggaaaaaggt catttacggc 720 cactctgtcc cttaccgaaa catgtgccga ttcaactctg gcgtacgtac gatcatgtga 780 agcttcgatg aagagactaa cagctcatca gttcttcttc cgacaccccc ttctcgccaa 840 ttatgattac tactggcgaa tcgagccctc tgtcaagttc ttttgtgatc tcggtaagtc 900 aaagagctct tacgttaaac ttgtctttgc taatatcatc gcgctacggc tagcctacga 960 ccccttcctt gtcatgcagg atcagaataa ggtgtatggc ttcacccttt ccctgttcga 1020 gtacatcgag accattccca ctctctggga tgccgtcaaa ggtaaggtaa tataacgcga 1080 aatctgacag ttgctgatac gagaaatgaa gaattcatcg gagaacatcc cgattatctt 1140 cctgaaggca atgcaatgca attcctaagc gatgacggcg gtgagaccta caacaagtgc 1200 cactgtgagt ctgaatgtat ctatcacttc aatgtaatgt gtgattgatc attgccaaag 1260 tctggtccaa ctttgagatt ggggacctta acttctggcg atctcagcct tacatggagt 1320 tctttgattt ccttgacaag aagggtggat tctattacga gcggtgggga gatgcgcccg 1380 tgcactcaat cggtgccgca ctcttcgcta agaaggagca gatccatttc tttgatgaca 1440 ttggctacag gcacgaaccg ttccaggtaa ggaaattctc tctggactag tcgtgaagtt 1500 gctcctgaca atcatcgtag cattgccctc aaggtgacgc tcataccagg ggtaactgtt 1560 ggtgtgatca agccaataac tttgattggg aatggtgagt tgttgtgttg tgtcgatttc 1620 aggcctttac atgtaaacgt gctgattttg tcttcatagg tactcttgca ctaagaaata 1680 tacagaaatg ttctaatatg tttatttgca tgaatttaac gcgcttg 1727

Claims (8)

Contacting a test substance with a cell comprising the CnKTR3 protein;
Measuring the level of expression or activity of CnKTR3 protein in cells in contact with the test substance; And
A screening method for antifungal compared to control samples to the crypto system Imperial neo's satiety (Cryptococcus neoformans), comprising the step of selecting the test substance, the expression or activity level of the protein CnKTR3 decreased. The method according to claim 1, wherein the expression or activity level of the CnKTR3 protein is determined by reverse transcription-polymerase chain reaction (RT-PCR), enzyme immunoassay (ELISA), immunohistochemistry, Western blotting, And flow cytometry (FACS). The method of screening for antifungal agents against Cryptococcus neoformans . 2. The method according to claim 1, wherein the CnKTR3 protein is represented by SEQ ID NO: 1. 2. A method for screening for Cryptococcus neoformans according to claim 1, delete A pharmaceutical composition for an antifungal against Cryptococcus neoformans comprising as an active ingredient a CnKTR3 protein expression or activity inhibitor. 6. The method according to claim 5, wherein the CnKTR3 protein expression inhibitor is selected from the group consisting of an antisense nucleotide complementary to mRNA of CnKTR3 gene, a small interfering RNA (siRNA) and a short hairpin RNA (shRNA) ( Cryptococcus neoformans ). &Lt; RTI ID = 0.0 &gt; 5. &lt; / RTI &gt; [Claim 7] The CnKTR3 protein activity inhibitor according to claim 5, wherein the CnKTR3 protein activity inhibitor is any one selected from the group consisting of a compound specifically binding to CnKTR3 protein, a peptide, a peptide mimetic, an aptamer, A pharmaceutical composition for an antifungal against Cryptococcus neoformans . delete

Images