KR20120072096A - Use of ire1 gene and hxl1 gene in upr signal pathway for treating mycoses or meningoencephalitis - Google Patents

Abstract

PURPOSE: UPR signal transduction genes, Ire1 and Hxl1, are provided to improve antibacterial effect and to treat encephalomenigitis. CONSTITUTION: A method for screening an antibacterial agent comprises: a step of contacting a sample with cells containing Hxl1 proteins of sequence number 1 or Ire1 proteins of sequence number 3; a step of measuring the amount or activity of the proteins; and a step of determining the same is an antibacterial agent in case that the amount or activity of Hxl1 protein is down-regulated. An antibacterial pharmaceutical composition contains an antisense which is complement to a nucleotide sequence of sequence number 2 or 4 or siRNA oligonucleotide as an active ingredient.

Description

Use of IRE1 gene and HXL1 gene in UPR signal pathway for treating mycoses or meningoencephalitis}

The present invention relates to the use of the UPR signaling genes Ire1 and Hxl1 for the treatment of fungal infections or meningitis.

Unfolded protein response (UPR) signaling pathways play an important role in maintaining the endoplasmic reticulum's homeostasis against various environmental conditions that cause vesicle stress in eukaryotic cells. In the yeast UPR signaling pathway, cell membrane Ser / Thr kinase and endoribonuclease Ire1 detects endoplasmic reticulum and self-phosphorylates for activation and then removes the unique introns of HAC1 mRNA encoding bZIP transcription factors. Activate transcription factors to counteract vesicle stress On the other hand, when the pathogenic fungi of Aspergillus Fu Micah Tuscan (Aspergillus. Fumigatus) HacA (Hac1 Homologous to transcription factor of S. cerevisiae) associated with the UPR pathway in the deletion showed a sensitivity to antifungal agents (PLoS Pathogens1, Vol 5, Issue 1, January 2009). However, there was no known bar against the pathogenic fungi of Cryptococcal kusu neo satiety Ire1's purpose or transcription factors involved in the UPR (C.neoformans).

In the past, fungal infections have been associated with many local infections such as leukoplakia, erythematosus, thrush, and thrush. Systemic fungal infections have rarely occurred, but recently, they have become the fourth most common infection in all hospitals. Antifungal agents developed to date can be classified into antifungal agents having chemically azole structures and antifungal agents having no azole structure. The azole antifungal agents include ketoconazole, fluconazole, itraconazole and voriconazole, and the non-azole antifungal agents are terbinafine and flucytosine. , Amphotericin B, caspofungin, and the like. Ketoconazole, fluconazole, itraconazole, voriconazole, and allylamine-based naphthypine and terbinapine having an azole structure have similar mechanisms of action. Both classes of antifungal agents inhibit the enzymes necessary for the conversion of lanosterol to ergosterol, a major component of fungal cell membranes. The azole antifungal agent inhibits microsomal enzymes, and the allylamine antifungal agent inhibits squalene epoxidase, thereby exhibiting the above effects. Flucytosine (5-FC) is a metabolic antagonist that inhibits nucleic acid synthesis, and has antifungal action by uncompromising antagonism of fungal RNA and DNA synthesis, and shows antifungal action, and has a polyene structure. Binds to ergosterol inside the fungal cell membrane to induce depolarization of the cell membrane, forms pores, and causes loss of intracellular contents, thereby exhibiting antifungal action. Caspofungin, an antifungal agent of the Echinocandins family, reversibly inhibits the formation of fungal cell walls and differs from the antifungal agents acting on the cell membranes in that they act on the cell walls. Since azole drugs may cause hepatitis death when used in patients with reduced liver function, hepatic function tests must be performed prior to administration. Flucytosine has been reported to be dose-dependently inhibiting myelosuppression, hepatotoxicity, and small intestinal colitis, and this side effect increases when renal function is lowered. Therefore, monitoring renal function of patients is very important. It is also contraindicated in pregnant women. Representative toxicity of amphotericin B is glomerular neotoxicity following renal artery contraction, which is dose dependent, resulting in an increased incidence of permanent renal insufficiency at lifetime cumulative doses of 4-5 g or more. In addition, nephrotoxicity such as excessive loss of potassium, magnesium, and bicarbonate due to tubular toxicity and a decrease in hematopoietic hormone production may occur. In addition, acute reactions may cause symptoms such as thrombophlebitis, chills, tremors and hyperventilation.

As described above, the antifungal agents developed in the past have various side effects according to the types of drugs, and thus, the development of new therapies that can lower the side effects and enhance the antifungal effect is required. The invention was completed by newly identifying Ire I and related transcription factors in C. neoformans and confirming its effectiveness in antibacterial and meningitis.

The present invention aims to provide a gene encoding the novel protein and Ire1 and Hxl1 (H AC1 and X BP1- L ike gene 1), provides a method for screening new antimicrobial therapeutic agent, or meningitis.

In addition, an object of the present invention is to provide a screening method that can have a synergistic effect when co-administered with an existing antimicrobial or meningitis treatment.

In addition, the present invention aims to inhibit the gene and protein encoding the novel Ire1 and Hxl1 (AC1 H and X L BP1- ike gene 1) provides a pharmaceutical composition with antimicrobial or therapeutic effects of meningitis.

As used to refer to the screening methods of the present invention, the term "sample" refers to an unknown candidate used in screening to test whether it affects the expression level of a gene or affects the amount or activity of a protein. . The sample includes, but is not limited to, chemicals, nucleotides, antisense-RNAs, small interference RNAs (siRNAs), and natural extracts.

Measurement of the change in the expression level of the gene can be carried out through various methods known in the art. For example, RT-PCR (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine , 102-108, CRCpress), hybridization reactions using cDNA microarrays (Sambrook et al., Molecular Cloning.A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) or in situ hybridization reactions (Sambrook et al., Molecular Cloning.A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)).

When performed according to the RT-PCR protocol, first, total RNA is isolated from cells treated with a sample, and then single-stranded cDNA is prepared using oligo dT primers and reverse transcriptase. Then, single-stranded cDNA is used as a template, and PCR reaction is performed using a gene-specific primer set. Gene-specific primer sets are listed in Table 2 below. Then, the PCR amplification product is electrophoresed, and the formed band is analyzed to measure the change in the expression level of the gene.

Changes in the amount of protein can be carried out through various immunoassay methods known in the art. Examples include, but are not limited to, radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbentassay (ELISA), capture-ELISA, inhibition or hardwood assays, and sandwich assays. The immunoassay or method of immunostaining is described in Enzyme Immunoassay, ET Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, JM ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999. For example, when the method of the present invention is carried out in accordance with radioimmunoassay methods, protein-specific antibodies labeled with radioisotopes (eg, C ¹⁴ , I ¹²⁵ , P ³² and S ³⁵ ) can be used. When the method of the invention is carried out in an ELISA mode, certain embodiments of the invention comprise (i) coating an extract from the cells treated with the sample onto the surface of a solid substrate (ii) an Ire1 or protein-specific antibody as a primary antibody. And (i) reacting the resultant of step (ii) with the secondary antibody to which the enzyme is bound, and (iii) measuring the activity of the enzyme. Suitable as the solid substrate are hydrocarbon polymers (eg polystyrene and polypropylene), glass, metal or gel, most preferably microtiter plates. Enzymes bound to the secondary antibody include, but are not limited to, enzymes catalyzing color reaction, fluorescence, luminescence or infrared reaction, for example, alkaline phosphatase, β-galactosidase, hose Radish peroxidase, luciferase and cytochrome P450. When alkaline phosphatase is used as the enzyme binding to the secondary antibody, bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-ASB1-phosphate (naphthol-AS-B1) as a substrate chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N) when colorimetric substrates such as -phosphate) and enhanced chemifluorescence (ECF) are used, and horse radish peroxidase is used. -Methylacridinium nitrate), resorupin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), TMB (3,3,5,5-tetramethylbenzidine), ABTS Substrates such as (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]) and o-phenylenediamine (OPD) can be used. Measurement of the final enzyme activity or signal in the ELISA method can be carried out according to various methods known in the art. If biotin is used as a label, the signal can be easily detected with streptavidin and luciferase if luciferase is used.

The pharmaceutical composition of the present invention may include chemicals, nucleotides, antisenses, siRNA oligonucleotides, and natural extracts as active ingredients. The antifungal pharmaceutical composition or antifungal complex preparation of the present invention may be prepared using a pharmaceutically acceptable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant may include excipients, disintegrants, sweeteners, binders, coatings, Solubilizers such as swelling agents, lubricants, lubricants or flavoring agents can be used. The antifungal pharmaceutical composition of the present invention can be preferably formulated into a pharmaceutical composition comprising one or more pharmaceutically acceptable carriers in addition to the active ingredient for administration. Acceptable pharmaceutical carriers in compositions formulated in liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary. Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Furthermore, the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA can be formulated according to each disease or component according to the appropriate method in the art. Pharmaceutical formulation forms of the pharmaceutical compositions of the present invention may be granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained release formulations of the active compounds, and the like. Can be. The pharmaceutical compositions of the present invention may be administered in a conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, sternum, transdermal, nasal, inhalation, topical, rectal, oral, intraocular or intradermal routes. Can be administered. An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required to prevent or treat a disease. Thus, the type of disease, the severity of the disease, the type and amount of the active and other ingredients contained in the composition, the type of formulation and the age, weight, general health, sex and diet, sex and diet, time of administration, route of administration and composition of the patient. It can be adjusted according to various factors including the rate of secretion, the duration of treatment, and the drug used concurrently. For example, in adults, when administered once or several times a day, the inhibitor of the present invention is administered once or several times a day, when the compound is 0.1ng / kg to 10g / kg, a polypeptide, In the case of protein or antibody, 0.1ng / kg ~ 10g / kg, antisense oligonucleotide, siRNA, shRNAi, miRNA can be administered at a dose of 0.01ng / kg ~ 10g / kg.

In the present invention, the subject includes, but is not limited to, humans, orangutans, chimpanzees, mice, rats, dogs, cattle, chickens, pigs, goats, sheep, and the like.

As used herein, the term "antisense oligonucleotide" means a DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a sequence of a particular mRNA, and binds to the complementary sequence in the mRNA to inhibit translation of the mRNA into a protein. It works. The antisense nucleic acid has a length of 6 to 100 bases, preferably 8 to 60 bases, and more preferably 10 to 40 bases. The antisense nucleic acid can be modified at the position of one or more bases, sugars or backbones to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5 (3): 343-55 (1995)). . The nucleic acid backbone can be modified with phosphorothioate, phosphoroester, methyl phosphonate, short chain alkyl, cycloalkyl, short chain heteroatomic, heterocyclic intersaccharide linkages and the like. In addition, antisense nucleic acids may comprise one or more substituted sugar moieties. Antisense nucleic acids can include modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-Me pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine, etc. There is this. In addition, the antisense nucleic acids of the present invention may be chemically bound to one or more moieties or conjugates that enhance the activity and cellular adsorption of the antisense nucleic acids. Cholesterol moieties, cholesteryl moieties, cholic acid, thioethers, thiocholesterols, fatty chains, phospholipids, polyamines, polyethylene glycol chains, adamantane acetic acid, palmityl moieties, octadecylamine, hexylamino-carbonyl-oxy Fat-soluble moieties such as a cholesterol ester moiety, and the like. Oligonucleotides comprising fat-soluble moieties and methods of preparation are already well known in the art (see US Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleic acid can increase stability to nucleases and increase the binding affinity of the antisense nucleic acid with the target mRNA. Antisense oligonucleotides can be synthesized in vitro by conventional methods to be administered in vivo or to allow antisense oligonucleotides to be synthesized in vivo. One example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose origin is in the opposite direction of the recognition site (MCS). Such antisense RNA is desirable to ensure that there is a translation stop codon in the sequence so that it is not translated into the peptide sequence.

As used herein, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO00 / 44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409). And WO 00/44914). siRNA is provided as an efficient gene knockdown method or gene therapy method because it can inhibit the expression of the target gene. siRNA was first discovered in plants, worms, fruit flies, and parasites, but recently has been applied to mammalian cell research by developing / using siRNA (8-10). The siRNA molecule of the present invention may have a structure in which a sense strand (a sequence corresponding to an mRNA sequence) and an antisense strand (a sequence complementary to an mRNA sequence) are positioned opposite to each other to form a double strand. In addition, according to another embodiment, siRNA molecules of the present invention may have a single chain structure having self-complementary sense and antisense strands. siRNAs are not limited to completely paired double-stranded RNA moieties paired with RNA, but paired by mismatches (the corresponding bases are not complementary), bulges (there are no bases corresponding to one chain), and the like. May be included. The total length is 10 to 100 bases, preferably 15 to 80 bases, more preferably 20 to 70 bases. The siRNA terminal structure can be either blunt or cohesive, as long as the expression of the gene can be inhibited by the RNAi effect. The cohesive end structure is possible for both 3'-end protrusion structures and 5'-end protrusion structures. The siRNA molecules of the invention may have a form in which a short nucleotide sequence (eg, about 5-15 nt) is inserted between a self-complementary sense and an antisense strand, in which case by expression of the nucleotide sequence The formed siRNA molecules form a hairpin structure by intramolecular hybridization, and form a stem-and-loop structure as a whole. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

Meanwhile, in the present invention, the term "shRNA (small hairpin RNA)" refers to a oligo DNA linking 3-10 base linkers between the sense of the target gene siRNA and the complementary nonsense, and then cloned into a plasmid vector. Or expressing by inserting shRNA into the retroviruses lentivirus and adenovirus, a looped hairpin structured shRNA (short hairpin RNA) is produced and converted into siRNA by Dicer in the cell Say what it represents. The shRNA has a relatively long RNAi effect compared to siRNA.

In one embodiment, the present invention comprises the steps of (a) contacting a sample to be analyzed with a cell comprising an Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3, (b) measuring the amount or activity of the protein And (c) determining that the sample is an antimicrobial agent when the amount or activity of the Hxl1 protein is measured to be down regulated. In one embodiment, the present invention comprises the steps of (a) contacting a sample to be analyzed with a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, (b) the expression amount of the gene It provides a method for screening antimicrobials comprising the step of measuring and (c) determining that the sample is an antimicrobial agent when it is determined that the expression level of the gene is down-regulated. In another embodiment, the present invention provides a method of contacting a cell comprising (a) an Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3, wherein the first antimicrobial agent measures the amount or activity of the protein. Measurement step (b) a second measurement step of contacting a sample to be analyzed and the antimicrobial agent to a cell comprising the Hxl1 protein represented by SEQ ID NO: 1 or the Ire1 protein represented by SEQ ID NO: 3, and measuring the amount or activity of the protein And (c) comparing the measured values of the first and second measuring steps such that when the measured value of the second measuring step is down-regulated than the measured value of the first measuring step, Provided are antimicrobial screening methods for concomitant administration for determining antimicrobial agents. In another embodiment, the present invention is (a) a first measurement of contacting an antimicrobial agent to a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, and measuring the expression level of the gene Step (b) a second measurement step of contacting a sample to be analyzed and the antimicrobial agent to a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, and measuring the expression level of the gene; c) comparing the measured values of the first and second measuring steps so that the sample is an antimicrobial agent for concomitant administration when the measured value of the second measuring step is down-regulated from the measured value of the first measuring step. Provided are antimicrobial screening methods for concomitant administration. At this time, SEQ ID NO: 1 is the amino acid sequence of the protein is translated by the mRNA splicing UPR is induced, SEQ ID NO: 2 is cDNA of the mRNA spliced by UPR is induced. SEQ ID NO: 3 is the amino acid sequence of the Ire1 protein, and SEQ ID NO: 4 is the gene nucleotide sequence encoding the Ire1 protein.

In one embodiment, the antimicrobial agent of the screening method of the present invention improves a method of screening a concomitant antimicrobial agent that is an azole or non-azole antibacterial agent. In this embodiment, the azole-based antimicrobial agent of the present invention provides a method for screening a concomitant antimicrobial agent of any one or more of fluconazole, itraconazole, voriconazole and ketoconazole. In addition, in this embodiment, the non-azole based antimicrobial agent of the present invention provides a method for screening a concomitant antimicrobial agent that is amphotericin B or fludioxonil.

In one embodiment, the screening method of the present invention provides an antimicrobial screening method of performing step (a) at 35 ° C. to 40 ° C., and the cell of step (a) provides an antimicrobial screening method of Cryptococcus neoforms. .

In one embodiment, the present invention provides an antimicrobial pharmaceutical composition comprising an antisense or siRNA (small interference RNA) oligonucleotide having a sequence complementary to the nucleotide sequence represented by SEQ ID NO: 2 or 4 as an active ingredient, and The antisense or siRNA oligonucleotide provides a pharmaceutical composition for antimicrobial having a sequence complementary to the nucleotide sequence 88-617th nucleotide of SEQ ID NO: 2, wherein the antisense or siRNA oligonucleotide is the nucleotide sequence 1935-2421th nucleotide of SEQ ID NO: 4 It provides a pharmaceutical composition for antimicrobial having a sequence complementary to.

In one embodiment, the present invention comprises the steps of (a) contacting a sample to be analyzed with a cell comprising an Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3, (b) measuring the amount or activity of the protein And (c) determining that the sample is a meningitis therapeutic agent when the amount or activity of the Hxl1 protein is measured to be down regulated. In one embodiment, the present invention comprises the steps of (a) contacting a sample to be analyzed with a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, (b) the expression amount of the gene It provides a method for screening a meningitis therapeutic agent comprising the step of determining and (c) when the expression level of the gene is determined to be down-regulation, the sample is a meningitis therapeutic agent. In another embodiment, the present invention provides an agent for (a) contacting a cell comprising the Hxl1 protein represented by SEQ ID NO: 1 or the Ire1 protein represented by SEQ ID NO: 3, and measuring the amount or activity of the meningitis therapeutic agent. 1 Measurement step (b) A second step of contacting a sample to be analyzed with a cell containing the Hxl1 protein represented by SEQ ID NO: 1 or the Ire1 protein represented by SEQ ID NO: 3 and the therapeutic agent for meningitis, and measuring the amount or activity of the protein The sample is used in combination when the measured value of the second measuring step is down-regulated compared to the measured value of the first measuring step by comparing the measured values of the measuring step and (c) the first and second measuring steps. The present invention provides a method for screening a concomitant meningitis therapeutic agent for discriminating that it is a therapeutic meningitis therapeutic agent. In another embodiment, the present invention is (a) a first method for contacting a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4 to the meningitis therapeutic agent, and measuring the expression level of the gene Measurement step (b) a second measurement step of contacting a sample to be analyzed with a cell containing the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 2 and the therapeutic agent for meningitis, and measuring the expression level of the gene And (c) comparing the measured values of the first and second measuring steps such that when the measured value of the second measuring step is down-regulated than the measured value of the first measuring step, The present invention provides a method for screening a meningitis therapeutic agent for concomitant administration to determine whether a meningitis therapeutic agent is used.

In one embodiment, the meningitis therapeutic agent of the screening method of the present invention improves a method of screening a concomitant meningitis therapeutic agent that is an azole or non-azole type meningitis therapeutic. In this embodiment, the azole-based meningitis therapeutic agent of the present invention provides a method for screening a concomitant meningitis therapeutic agent which is any one or more of fluconazole, itraconazole, voriconazole, and ketoconazole. . Also in this embodiment, the non-azole-based meningitis therapeutic agent of the present invention provides a method for screening a concomitant meningitis therapeutic agent which is amphotericin B or fludioxonil.

In one embodiment, the screening method of the present invention provides a method for screening a meningitis therapeutic agent which performs step (a) at 35 ° C to 40 ° C, and the cell of step (a) is a method for screening a meningitis therapeutic agent that is Cryptococcus neoformus to provide.

In one embodiment, the present invention provides an antimicrobial pharmaceutical composition comprising an antisense or siRNA (small interference RNA) oligonucleotide having a sequence complementary to the nucleotide sequence represented by SEQ ID NO: 2 or 4 as an active ingredient, and The antisense or siRNA oligonucleotide provides a pharmaceutical composition for antimicrobial having a sequence complementary to the nucleotide sequence 88-617th nucleotide of SEQ ID NO: 2, wherein the antisense or siRNA oligonucleotide is the nucleotide sequence 1935-2421th nucleotide of SEQ ID NO: 4 It provides a pharmaceutical composition for antimicrobial having a sequence complementary to.

In one embodiment, the present invention provides a Hxl1 (H AC1 and X BP1 L ike gene 1) protein shown in SEQ ID NO: 1 and provide, HXL1 yujeonjaeul coding for the protein, the HXL1 gene shown in SEQ ID NO: 2 Providing a host from which this gene has been deleted.

The "antibacterial agent" of the present invention inhibits the propagation of bacteria and / or fungi, and includes an inorganic antibacterial agent, an organic natural product extraction antimicrobial agent, an organic aliphatic compound antimicrobial agent, and an organic aromatic compound antimicrobial agent. In addition, the inorganic antibacterial agent includes, but is not limited to, a chlorine compound represented by sodium hypochlorite, a peroxide represented by hydrogen peroxide, a borated compound represented by sodium borate, a copper compound represented by copper sulfate, and a zinc compound represented by zinc chloride. Calcium compounds represented by sulfur-based calcium oxide, thiosulphite silver complex salt, silver compounds represented by silver nitrate, sulfur compounds such as sulfur, polysulfuric acid lime, and hydrated sulfur, and oxo and sodium silicofluoride, Examples of the organic-based natural product extracting antibacterial agents include hinokithiol, bamboo shoots, creosote oil, and the like.

In the present invention, "meningitis" is a variety of diseases in which inflammation occurs in the subarachnoid space between the arachnoid and the soft membrane, and is a meningitis caused by a virus or bacteria invading the subarachnoid space, but a specific chemical substance By inflammation and seeding of cancer cells into the cerebrospinal fluid space.

References

Ron D, Walter P (2007) Signal integration in the endoplasmic reticulum unfolded protein response.Nat Rev Mol Cell Biol 8: 519-529.

Bernales S, Papa FR, Walter P (2006) Intracellular signaling by the unfolded protein response. Annu Rev Cell Dev Biol 22: 487-508.

Malhotra JD, Kaufman RJ (2007) The endoplasmic reticulum and the unfolded protein response. Semin Cell Dev Biol 18: 716-731.

Lin JH, Walter P, Yen TSB (2008) Endoplasmic Reticulum Stress in Disease Pathogenesis. Annu Rev Path : Mech Dis 3: 399-425.

Zhang K, Kaufman RJ (2008) From endoplasmic-reticulum stress to the inflammatory response. Nature 454: 455-462.

6. Travers KJ, et al. (2000) Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation. Cell 101: 249-258.

7. Lin JH, et al. (2007) IRE1 signaling affects cell fate during the unfolded protein response. Science 318: 944-949.

8. Cox JS, Shamu CE, Walter P (1993) Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell 73: 1197-1206.

9. Cox JS, Walter P (1996) A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response. Cell 87: 391-404.

10.Kawahara T, Yanagi H, Yura T, Mori K (1997) Endoplasmic reticulum stress-induced mRNA splicing permits synthesis of transcription factor Hac1p / Ern4p that activates the unfolded protein response. Mol Biol Cell 8: 1845-1862.

11.Kawahara T, Yanagi H, Yura T, Mori K (1998) Unconventional splicing of HAC1 / ERN4 mRNA required for the unfolded protein response. Sequence-specific and non-sequential cleavage of the splice sites. J Biol Chem 273: 1802-1807.

12.Ruesegger U, Leber JH, Walter P (2001) Block of HAC1 mRNA translation by long-range base pairing is released by cytoplasmic splicing upon induction of the unfolded protein response. Cell 107: 103-114.

13. Calfon M, et al. (2002) IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP -1 mRNA. Nature 415: 92-96.

14. Yoshida H, et al. (2001) XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107: 881-891.

15. Tirosh B, Iwakoshi NN, Glimcher LH, Ploegh HL (2006) Rapid turnover of unspliced Xbp-1 as a factor that modulates the unfolded protein response. J Biol Chem 281: 5852-5860.

16. Richie DL, et al. (2009) A role for the unfolded protein response (UPR) in virulence and antifungal susceptibility in Aspergillus fumigatus . PLoS Pathog 5: e1000258.

17. Wimalasena TT, et al. (2008) Impact of the unfolded protein response upon genome-wide expression patterns, and the role of Hac1 in the polarized growth, of Candida albicans . Fungal genet Biol 45: 1235-1247.

18.Casadevall A, Perfect JR (1998) Cryptococcus neoformans (ASM Press, Washington, DC) pp viii, 541 p.

19. Chen Y, et al. (2005) Identification of mitogen-activated protein kinase signaling pathways that confer resistance to endoplasmic reticulum stress in Saccharomyces cerevisiae . Mol Cancer Res 3: 669-677.

20.Scrimale T, Didone L, de Mesy Bentley KL, Krysan DJ (2009) The unfolded protein response is induced by the cell wall integrity mitogen-activated protein kinase signaling cascade and is required for cell wall integrity in Saccharomyces cerevisiae . Mol Biol Cell 20: 164-175.

21. Odom A, et al. (1997) Calcineurin is required for virulence of Cryptococcus neoformans . EMBO J 16: 2576-2589.

Alspaugh JA, Cavallo LM, Perfect JR, Heitman J (2000) RAS1 regulates filamentation, mating and growth at high temperature of Cryptococcus neoformans . Mol Microbiol 36: 352-365.

Kraus PR, Fox DS, Cox GM, Heitman J (2003) The Cryptococcus neoformans MAP kinase Mpk1 regulates cell integrity in response to antifungal drugs and loss of calcineurin function. Mol Microbiol 48: 1377-1387.

24. Gerik KJ, et al. (2005) Cell wall integrity is dependent on the PKC1 signal transduction pathway in Cryptococcus neoformans . Mol Microbiol 58: 393-408.

25. Kraus PR, et al. (2004) Identification of Cryptococcus neoformans temperature-regulated genes with a genomic-DNA microarray. Eukaryotic Cell 3: 1249-1260.

26. Ko YJ, et al. (2009) Remodeling of global transcription patterns of Cryptococcus neoformans genes mediated by the stress-activated HOG signaling pathways. Eukaryot Cell 8: 1197-1217.

27. Ma H, May RC (2009) Chapter 5 Virulence in Cryptococcus Species. Adv Appl Microbiol , eds Allen I. Laskin SS & Geoffrey MG (Academic Press), Vol Volume 67, pp 131-190.

28.Aksenov SI, Babyeva IP, Golubev VI (1973) On the mechanism of adaptation of micro-organisms to conditions of extreme low humidity. Life Sci Space Res 11: 55-61.

29. Kuge S, et al. (2001) Regulation of the yeast Yap1p nuclear export signal is mediated by redox signal-induced reversible disulfide bond formation. Mol Cell Biol 21: 6139-6150.

30. Plummer JL, Smith BR, Sies H, Bend JR (1981) Chemical depletion of glutathione in vivo. Methods Enzymol 77: 50-59.

31.Roisch K (2005) ENDOPLASMIC RETICULUM-ASSOCIATED Annu Rev Cell Dev Biol 21: 435-456.

32. Samuelson J, et al. (2005) The diversity of dolichol-linked precursors to Asn-linked glycans likely results from secondary loss of sets of glycosyltransferases. Proc Natl Acad Sci USA 102: 1548-1553.

33. Banerjee S, et al. (2007) The evolution of N-glycan-dependent endoplasmic reticulum quality control factors for glycoprotein folding and degradation. Proc Natl Acad Sci USA 104: 11676-11681.

34. Saloheimo M, Valkonen M, Penttila M (2003) Activation mechanisms of the HAC1 -mediated unfolded protein response in filamentous fungi. Mol Microbiol 47: 1149-1161.

35.Oh MH, Cheon SA, Kang HA, Kim JY (2010) Functional characterization of the unconventional splicing of Yarrowia lipolytica HAC1 mRNA induced by unfolded protein response. Yeast .

36. Kupfer DM, et al. (2004) Introns and splicing elements of five diverse fungi. Eukaryot Cell 3: 1088-1100.

37. Aragon T, et al. (2009) Messenger RNA targeting to endoplasmic reticulum stress signaling sites. Nature 457: 736-740.

38.Nikawa J, Yamashita S (1992) IRE1 encodes a putative protein kinase containing a membrane-spanning domain and is required for inositol phototrophy in Saccharomyces cerevisiae . Mol Microbiol 6: 1441-1446.

39.Perfect JR (2006) Cryptococcus neoformans : the yeast that likes it hot. FEMS Yeast Research 6: 463-468.

40. Rosa e Silva LK, et al. (2008) Identification of novel temperature-regulated genes in the human pathogen Cryptococcus neoformans using representational difference analysis. Res Microbiol 159: 221-229.

Parodi AJ (2000) PROTEIN GLUCOSYLATION AND ITS ROLE IN PROTEIN FOLDING. Annu Rev Biochem 69: 69-93.

42. Nakatsukasa K, et al. (2004) Roles of O-Mannosylation of Aberrant Proteins in Reduction of the Load for Endoplasmic Reticulum Chaperones in Yeast. J Biol Chem 279: 49762-49772.

43. Shen X, Ellis RE, Sakaki K, Kaufman RJ (2005) Genetic Interactions Due to Constitutive and Inducible Gene Regulation Mediated by the Unfolded Protein Response in <italic> C. elegans </ italic>. PLoS Genet 1: e37.

44. Hollien J, et al. (2009) Regulated Ire1-dependent decay of messenger RNAs in mammalian cells. The Journal of Cell Biology 186: 323-331.

45. Hollien J, Weissman JS (2006) Decay of endoplasmic reticulum-localized mRNAs during the unfolded protein response. Science 313: 104-107.

46.Hicks JK, D'Souza CA, Cox GM, Heitman J (2004) Cyclic AMP-dependent protein kinase catalytic subunits have divergent roles in virulence factor production in two varieties of the fungal pathogen Cryptococcus neoformans . Eukaryotic Cell 3: 14-26.

47. Bahn YS, et al. (2004) Adenylyl cyclase-associated protein Aca1 regulates virulence and differentiation of Cryptococcus neoformans via the cyclic AMP-protein kinase A cascade. Eukaryot Cell 3: 1476-1491.

48. Gerik KJ, et al. (2008) PKC1 is essential for protection against both oxidative and nitrosative stresses, cell integrity, and normal manifestation of virulence factors in the pathogenic fungus Cryptococcus neoformans . Eukaryot Cell 7: 1685-1698.

49.Bahn YS, Kojima K, Cox GM, Heitman J (2005) Specialization of the HOG pathway and its impact on differentiation and virulence of Cryptococcus neoformans . Mol Biol Cell 16: 2285-2300.

50. Letunic I, Doerks T, Bork P (2009) SMART 6: recent updates and new developments. Nucleic acids Res 37: D229-D232.

The invention may search for an effective candidate substance having the antimicrobial or therapeutic effects of meningitis inhibit the gene and protein encoding the novel Ire1 and Hxl1 (H AC1 and X BP1 L ike gene 1). Further, the conventional antibacterial agent or meningitis with a therapeutic agent for co-administration during the candidate substance which can have a synergistic effect and provides a screening method, the gene novel Ire1 and protein and encoding the Hxl1 (H AC1 and X BP1 L ike gene 1) By inhibiting it can provide a pharmaceutical composition having an antimicrobial or meningitis therapeutic effect.

Figure 1 shows an overview of the primer preparation method for performing RT-PCR.
2 is for the identification of the target gene of Ire1 sensor kinase / ribonuclease via RT-PCR. Specific splicing patterns through RT-PCR were identified through RT-PCR1 and RT-PCR2. KAR2 and ACT1 were identified as controls.
Figure 3 shows the specific splicing pattern change of the HXL1 gene in the ire1 Δ mutant strain. After processing the DTT and pitcher NIKA azithromycin (tunicamycin) that causes UPR stress was confirmed that the specific splicing pattern changes in HXL1 gene in ire1 Δ mutant strain through the RT-PCR2 not occur which HXL1 the Ire1 sensor kinase / It shows the purpose of ribonucleases (kinase / ribonclease).
4 shows the phylogenetic tree of the target protein of Ire1 sensor kinase.
[An: Aspergillus nidulans , Af: Aspergillus fumigatus , Tr : Trichoderma reesei , Sc: Saccharomyces cerevisiae , Ca: Candida albicans , Yl: Yarrowia lipolytica , Hs: Homo sapiens , Mm: Mus musculus , Ce: Caenorhabditis elegans , Cn: Cryptococcus neoformans ]
5 shows the effect of UPR signaling pathway gene deletion on temperature sensitivity. It can be seen that the temperature sensitivity is increased when the UPR signaling pathway gene IRE1 or HXL1 is deleted. In particular, hxl1 Δ mutant strain can be seen that this temperature sensitivity in the temperature lower than appears ire1 Δ mutant strain. The strains used in the experiment are as follows (wild type (WT), ire1 Δ (YSB552), ire1 Δ + IRE1 (YSB1000), hxl1 Δ (YSB723), hxl1 Δ + HXL1 (YSB762), ire1 Δ + HXL1 ^U (YSB1125), ire1 Δ + HXL1 ^S (YSB1127), mpk1Δ (KK3), cna1 Δ (KK1), ras1 Δ (YSB53)]
6 shows the effect of UPR signaling pathway gene deletion on antifungal drug sensitivity. The UPR signaling pathway genes, IRE1 or HXL1, were found to increase the sensitivity of antifungal agents when deletions occurred. The concentration of drug used in the experiment is as follows. [Ketoconazole (ketoconazole, 0.1 μg / ml) fluconazole (14 μg / ml), itraconazole (itraconazole, 0.5 μg / ml), amphotericin B (amphotericin B, 0.8 μg / ml), fludioxonil (fludioxonil, 0.5 μg / ml)] strains used in the experiment are as follows (wild type (WT), ire1 Δ (YSB552), ire1 Δ + IRE1 (YSB1000), hxl1 Δ (YSB723), hxl1 Δ + HXL1 (YSB762), ire1 Δ + HXL1 ^U (YSB1125), ire1 Δ + HXL1 ^S (YSB1127)]
7 shows an siRNA design to inhibit IRE1 gene expression. The ACT1 promoter and GAL7 promoter were used to insert the front of the sense and antisense portions of the IRE1 gene, and a lineker was inserted so that the sense and antisense form a stem-loop. This linkage can utilize GFP proteins as mentioned in the references.
8 is It shows siRNA design to inhibit HXL1 gene expression. The ACT1 promoter and GAL7 promoter were used to insert the front of the sense and antisense portions of the HXL1 gene, and a lineker was inserted so that the sense and antisense form a stem-loop. This linkage can utilize GFP proteins as mentioned in the references.
9 shows the effect of IRE1 deletion, an UPR signaling pathway gene, on pathogenicity in vivo. Deletion of the UPR signaling pathway gene, IRE1 , suggests that pathogenicity is weakened in vivo. [Wild type (WT), ire1 Δ (YSB552), ire1 Δ + IRE1 (YSB1000)]
Figure 10 shows the effect of HXL1 deletion, a UPR signaling pathway gene on the pathogenicity in vivo. The deletion of the UPR signaling pathway gene, HXL1 , suggests that pathogenicity is weakened in vivo. [Wild type (WT), hxl1 Δ (YSB723), hxl1 Δ + HXL1 (YSB762)]

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

<Strain and culture conditions>

In this example, Cryptococcus neoformus shown in Table 1 was used as a strain. Yeast extract-peptone-dextrose (YPD) was used as the liquid medium, and the strains were incubated at 30 ° C. at 210 rpm.

Strain Genotype Mother strain C. neoformans H99 Antigen A AMAT α YSB552 MAT α ire1 Δ :: NAT - STM # 224 * H99 YSB554 MAT α ire1 Δ :: NAT - STM # 224 H99 YSB723 MAT α hxl1 Δ :: NAT - STM # 229 H99 YSB730 MAT α hxl1 Δ :: NAT - STM # 229 H99 YSB1000 MAT α ire1 Δ :: NAT IRE1 - NEO YSB552 YSB1005 MAT α ire1 Δ :: NAT IRE1 - NEO YSB554 YSB1125 MAT α ire1 Δ :: NAT HXL1 - HXL1 ^u - NEO YSB552 YSB743 MAT α ire1 Δ :: NAT HXL1 - HXL1 ^u - NEO YSB554 YSB1127 MAT α ire1 Δ :: NAT HXL1 - HXL1 ^s - NEO YSB552 YSB747 MAT α ire1 Δ :: NAT HXL1 - HXL1 ^s - NEO YSB554 YSB762 MAT α hxl1 Δ :: NAT HXL1 ^u - NEO YSB723 KK1 MAT α cna1 Δ :: NAT - STM # 117 H99 KK3 MAT α mpk1 Δ :: NAT - STM # 150 H99 YSB53 MAT α ras1 Δ :: NAT - STM # 150 H99

(* Each NAT - STM # stands for a Nat ^r marker with a unique signature tag.)

<Stress Sensitivity Test Method>

"Bahn YS, Kojima K, Cox GM, Heitman J (2005) Mol Biol Cell 16: 2285-2300." And each strain was incubated at 30 ° C. for 16 hours in 5 ml of YPD medium and washed, as described in “Bahn YS, Kojima K, CoxGM, Heitman J (2006) Mol Biol Cell 17: 3122-3135”. , serially diluted in dH ₂ O (1 to 10 ⁴ dilution). Next, spotted in solid YPD medium containing the indicated concentration of antifungal agent.

To identify drug sensitivity to antifungal agents, strains were identified as polyene-based drugs, amphoteracin B (Sigma), azole-based fluconazole (Sigma), itraconazole (Sigma), and ketoconazole (Sigma), and phenylpyrrole-based drugs. Spotted in YPD medium containing fludioxonil. After spotting, the cells were incubated at 30 ° C., and photographed for 2-4 days.

In order to check the temperature sensitivity, each strain was incubated at 30 ° C. for 16 hours in 5 ml of YPD medium, washed, and then sequentially diluted in dH ₂ O (1 to 10 ⁴ dilution) to a solid YPD medium. Spotted. After spotting, each strain was incubated at 30 ° C., 35 ° C. and 37 ° C. and photographed for 2-4 days.

< RNA  Extraction and RT - PCR  Method>

To extract RNA, strains were incubated at 30 ° C. for 16 hours in YPD medium. Thereafter, the initial strain was inoculated with 100 ml of fresh YPD medium, the optical density at 600 nm (OD ₆₀₀ ) was adjusted to 0.15, and then cultured at 30 ° C. until the OD ₆₀₀ reached 0.5. To obtain a zero-time sample, 50 ml of the culture solution in 100 ml was sampled and washed twice with DEPC treated dH ₂ O followed by rapid freezing in liquid nitrogen. The remaining 50 ml of the culture was treated with 8 μg / ml of tunicamycin, or 20 mM of DTT, to obtain strains after 1 or 2 hours. This strain was washed twice with DEPC treated dH ₂ O and then rapidly frozen in liquid nitrogen. Total RNA was extracted using RNeasy Mini Kit (Qiagen) and cDNA was synthesized using MMLV reverse transcriptase (Invitrogen). Reverse transcriptase polymerase chain reaction (RT-PCR) was performed using Maxime ™ PCR PreMix (i-Taq) (iNtRON Biotechnology).

< UPR  Function breakdown method of signaling gene>

For disruption of genes, genomic DNA structure information for each gene can be obtained from the genome database of antigenic type A C. neoformans ( http://www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html). ) And "" Davidson RC, et al. (2002) A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 148: 2607-2615 "and""Kim MS, et al. (2009) An efficient gene-disruption method in Cryptococcus neoformans by double-joint PCR with NAT-split markers. Biochem Biophys Res As described in Commun 390: 983-988 "", IRE1 ( C1 neoformans antigen A H99 strain in C. neoformans antigen A H99 strain by overlap PCR and double joint PCR via split-marker and biolistic transformation. CNAG_03670.2) and HXL1 (CNAG_06134.2) disrupted the function. Primers required for gene function destruction are shown in Table 2 below. Gold microcarrier beads (0.6 μm [Bio-Rad]) were coated with gel-extracted deletion cassettes produced by overlap PCR or double joint PCR and transformed with antigen A H99 strain. Strains that grow well in YPD medium containing Norseothricin were selected first through diagnostic PCR, and the transformed strains of the gene deletion were identified through Southern blot analysis using gene-specific probes. It was.

primer Sequence (5 'to 3) ^a purpose B1644 GCCCCATCATCATAATCAC IRE1 breaking primer B1645 GCTCACTGGCCGTCGTTTTACACTATGTGTCCATCTGAGGC Homology B1646 CATGGTCATAGCTGTTTCCTGAGTGAGTTGAGGGAGGAAAG Homology B1647 GAAGAAGAGCGTCAAGAAGG Homology B1648 AGGAATACGAGGTTTATCGG IRE1 diagnostic primer B1683 AGCATTAGGGGTGTAGGTG IRE1 probe primer B1881 GTTTGAGGCTGGTAAAAAGG HXL1 Destructive Primer B1882 GCTCACTGGCCGTCGTTTTACATGGGGAATGAAAGCGTG Homology B1883 CATGGTCATAGCTGTTTCCTGAAGGGGCGAGAGTAGTTCAG Homology B1884 GACTGTAAAGGAGGGCATAAG Homology B1880 AACTCTTCTCAGCCTTCGG HXL1 diagnostic primer B1885 CGTTCTCCGTCTTGATAGC HXL1 probe primer M13Fe GTAAAACGACGGCCAGTGAGC Destructive Marker Primer M13Re CAGGAAACAGCTATGACCATG Destructive Marker Primer B1969 CGCGCGGCCGCGCACAGGATTACTTTTGGGTGATG IRE1 supplement B1970 CGCGCGGCCGCAGTTGGAAAAGGAGCGTCC Homology B1454 AAGGTGTTCCCCGACGACGAATCG Double Joint PCR Primer B1455 AACTCCGTCGCGAGCCCCATCAAC Double Joint PCR Primer C01 ATACAGCCAGTGTCCTTCCC H99 CNAG_03976.2
RT-PCR Primer (RT-PCR1) C02 ATGGATATCAGTTGCGGGAT Homology C03 AGAGATTGAGCTCCTCCG H99 CNAG_03976.2
RT-PCR Primer (RT-PCR2) C04 TTACCAGACACTGACACC Homology C05 ATGTCCGCGATCGATTAC H99 CNAG_07560.2
RT-PCR Primer (RT-PCR1) C06 CCTTCTTCTCAGCAGCAGTC Homology C07 TTAACGGCTGCGTCAATC H99 CNAG_07560.2
RT-PCR Primer (RT-PCR2) C08 TCTTCTTCTATCGACCCG Homology C09 TTTGGCAATGACGACTCAAG H99 CNAG_07940.2
RT-PCR Primer (RT-PCR1) C10 CCTGTAACGCTCTGTTCTCC Homology C11 TCATGGGCTGTTGATTCC H99 CNAG_07940.2
RT-PCR Primer (RT-PCR2) C12 TAAAGGAAGGTTCCGGTG Homology C13 AGTGCACTGATGGCGTCA H99 CNAG_00871.2
RT-PCR Primer (RT-PCR1) C14 AAAGCATAGACAACGGCG Homology C15 CACTCGGCACCGTTATGT H99 CNAG_00871.2
RT-PCR Primer (RT-PCR2) C16 TGGCAAATGCGTAGCTTC Homology C17 ATGGCTACCGCTGTCGCT H99 CNAG_06134.2
RT-PCR Primer (RT-PCR1) C18 TGATTCGCGGTTACGGAT Homology C19 CACTCCATTCCTTTCTGC H99 CNAG_06134.2
RT-PCR Primer (RT-PCR2) C20 CGTAACTCCACTGTGTCC Homology C25 TGCAGAAGATGGCGTTGC IRE1 RT-PCR primers of all antigenic forms C26 ACACTCCCGCCTTTATAC Homology C27 TCGATGCCAATGGTATCC Of CNAG_06443.2
RT-PCR Primer C28 TCATGGCTGAAAGGCATC Homology C29 CACTCACCGATCTGTTTC CNAG_00072.2
RT-PCR Primer C30 ATTTGCTTGGCAGAGTCC Homology C31 ACCCAAGGTCCTGTTTAC 06240.2 RT-PCR Primer C32 ATCGTGCTCAGGAGTCTC Homology C33 AGCCTTCTCTCCTTGGTC ACT1 RT-PCR Primer C34 ACGATTGAGGGACCAGAC Homology C35 GTC GTTAAC CTTCGGAGGCTTTTACAC HXL1 replacement C36 CTCGAG CATATG GCTAGC TGCGAGGATGGGAATAGG Homology C37 GCTAGC CATATG CTCGAG GGAAGAAACAAAATAACCAAC Homology C38 CAC GGTACC AATATATCATGCCCTCCCG Homology

^The underlined sequence in ^a primer is the restriction enzyme portion for subsequent subcloning and the sequence shown in bold is the complementary sequence for fusion PCR.

< UPR  For signaling gene deletion Supplementary  Manufacturing method>

To confirm the sensitivity to antifungal agents due to the deletion of the UPR signaling gene, supplementary bacteria were prepared for each of the UPR signaling gene deletion transforming strains. Among them, in order to prepare an IRE1 supplement strain, an IRE1 gene fragment including a 0.78 kilobase (kb) promoter, an 3.52 kilobase (kb) Open Reading Frame (ORF), and a terminator of 0.53 kilobase (kb) was restricted. Amplification was carried out by PCR using a primer containing an enzyme site, and then subcloned into pTOP-V2 plasmid (purchased by Enzynomics), and the DNA sequence was confirmed. A 4.8 kilobase (IRE) IRE1 gene insert using a plasmid with identical sequencing was used as a pJAF12 vector with a NEO marker (Neomycin / G418-resistant marker) (James A. Fraser, Center for Infectious Disease Research, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, QLD 4072, Australia). This subcloned plasmid was cut with Mlu1 restriction enzyme and transformed with the IRE1 deletion mutant strain.

.

Likewise, in order to prepare HXL1 supplement strains, one kilobase (kb) promoter of HXL1 gene, 1.8 kilobase (kb) Open Reading Frame (ORF), and the terminator portion of 0.6 kilobase (kb) were prepared using primers (C35 / C38) was used to amplify by PCR and subcloned into a vector pJAFS1 with a NEO marker (vector from which the hidden Sac1 restriction enzyme portion of pJAF12 was removed). This subcloned plasmid was cut with Sac1 restriction enzyme and transformed with HXL1 deletion mutant strain.

< HXL1 Splicing ( splicing ) Genes and Unsplicing ( unsplicing A) gene IRE1  fruition Mutant strain  Transformation>

To determine whether the susceptibility to antifungal agents due to IRE1 deletion was HXL1 dependent, the HXL1 gene was exchanged from cDNA derived from whole RNA isolated from cells treated with or without tunicamycin, an unfolded protein response (UPR) derivative. Splicing mRNA and unsplicing mRNA were obtained, respectively. DNA was obtained from the obtained mRNA and subcloned into pJAFS1-HXL1PT (HJA1 promoter and terminator vector) plasmid pJAFS1-HXL1PT with HXL1 promoter and terminator, and then subcloned into pJAFS1-HXL1U plasmid and pJAFS1-HXL1S. Obtained plasmid. This plasmid was cut with Sac1 restriction enzyme and then transformed with the IRE1 deletion mutant strain.

< Cryptococcus  Through mouse model In vivo  top HXL1  Gene and IRE1  Confirm pathogenicity of gene deletion mutations>

To investigate the effect of Ire1 sensor kinase / ribonuclease and its target gene, HXL1 , on in vivo pathogenicity, play an important role in UPR signaling pathways. Jackson Laboratory, 18-22 g). Wild-type and ire1 Δ hxl1 Δ mutant strains and restorative strains were incubated in YPD medium at 24 ° C. for 16 hours, washed in PBS (phosphate buffered saline) buffer solution, and the number of cells was adjusted to 10 ⁶ cells per ml. . Ten mice were used per wild type, mutant strain, and recovery strain, and infected by injecting 10 ⁵ cells into the nasal cavity. Survival of mice was observed twice a day for 6 weeks.

< Example  1> IRE1 Gene of interest HXL1 The identification of

To find the target gene of Ire1 kinase / ribonuclease in the UPR signaling pathway, an antigenic A C. neoformans genome database (http: The candidate genes were searched through //www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html). As a result, five CNAG_00671.2, CNAG_03670.2, CNAG_07560.2, CNAG_07940.2 and CNAG_03976.2 candidate genes were selected.

Ire1 kinase / ribonuclease is characterized by specific splicing of target mRNAs in a non-traditional manner. Therefore, RT-PCR primers were prepared as shown in Table 2 to determine the splicing behavior. The experiment was performed by dividing by RT-PCR 1 and 2 (see FIG. 1). The target genes were identified through the splicing pattern changes in 1 and 2 when DTT and tunicamycin induced UPR stress were treated (see FIG. 2). In order to confirm that CNAG_03670.2, which has a specific splicing in this experiment, is spliced in the ire1 Δ mutant strain, the same UPR stress-induced DTT and tunicamycin were treated and RT-PCR2 was performed. . As a result, specific splicing was observed in the wild type but not in the ire1 Δ mutant strain (see FIG. 3). This experiment confirmed that CNAG_03670.2 mRNA was the target gene of Ire1 sensor kinase / ribonuclease. Phylogenetic tree was performed to investigate the protein sequence similarity of CNAG_03670.2, which was revealed by this experiment, with the target protein of the known Ire1 sensor kinase / ribonuclease. As a result, protein sequence similarity with the target gene of the previously known Ire1 sensor kinase / ribonuclease was significantly different (see FIG. 4). Although the protein sequence similarity is low a lot but named Hac1 transcription factors and Xbp1 transcription factors with specific splicing HXL1 (H AC1 and X BP1 L ike gene 1) based on the similar characteristics of the human in the name of the gene fungi It was.

< Example  2> ire1 Δ  Mutant strains and hxl1 Δ  Mutant strain UPR  Determination of temperature sensitivity due to signal transduction inhibition

Pathogenic determinants affecting the pathogenicity of Cryptococcus neoforms are capsules that interfere with phagocytosis, antioxidant melanin, and their ability to grow at the body temperature of the host. Among them, the ability to grow at the host temperature of 37 ℃ can be said to be a very important factor in causing pathogenicity.

In order to examine how this temperature sensitivity plays a role in the UPR signaling pathway, temperature sensitivity experiments were conducted. As a result, both the ire1 Δ mutant strain and the hxl1 Δ mutant strain were significantly inhibited at 37 ° C. compared with the wild type.

For the ire1 Δ mutant strain, growth at 37 ° C. did not recover as wild type even when the HXL1 splicing gene was transformed. In the case of hxl1 Δ mutant strain, even at 35 ℃ showed a higher temperature sensitivity in that the growth is much reduced compared to the wild type (see Figure 5).

< Example  3> ire1 Δ  Mutant strains and hxl1 Δ  Mutant strain UPR  Confirmation of Action of Conventional Antifungal Agents on Signaling Pathway Inhibition

We investigated whether the drug susceptibility to antifungal agents of the strains of the UPR signaling pathway mutant of Cryptococcus neoforms was investigated. As a result, both the ire1 Δ mutant strain and the hxl1 Δ mutant strain showed amphotericin B susceptibility compared to the wild type in the polyene-based amphoteracin B. The strains in which the HXL1 splicing gene was transformed into the ire1 Δ mutant strain recovered to wild-type levels. It was shown that amphotericin B susceptibility of the ire1 Δ mutant strain was dependent on Hxl1 (FIG. 6).

Drug sensitivity experiments with azole drugs such as fluconazole, itraconazole and ketoconazole showed significantly higher sensitivity than wild type. In particular, the hxl1 Δ mutant strain was more than 10 times more sensitive to fluconazole than the ire1 Δ mutant strain. This fact suggests that the regulation of Hxl1 is regulated by Ire1 as well as other upregulatory proteins. It can be seen that the strains transformed with the HXL1 splicing gene to the ire1 Δ mutant strain are restored to wild-type levels. Likewise, the drug susceptibility of the azole family also depends on Hxl1 in the UPR signaling pathway (FIG. 6).

Phenyl Similarly, in the drug susceptibility results for the pyrrole-based platform Rudy oxo carbonyl (fludioxonil) of ire1 Δ mutant strain with hxl1 Δ mutant strains both showed a sensitivity, as with fluconazole hxl1 Δ mutation ire1 Δ mutant strain sensitivity about 100 times that of This appeared more. This suggests that, as mentioned above, the regulation of Hxl1 is regulated by Ire1 as well as other upregulatory proteins (FIG. 6).

< Example  4> IRE1  And HXL1  For genes siRNA Using UPR  Confirmation of antimicrobial effect by inhibition of signaling pathway

IRE1 And siRNA may be synthesized using a Silencer ^™ siRNA cocktail kit (RNase III; Ambion) for the purpose of performing a silencing experiment of HXL1 gene expression. Oligonucleotides used for dsRNA synthesis for IRE1 are as follows:

5'-GATCTCAGATACTATCATTGGTTTTGGATC-3 'and 5'- CAAGTTGTTCGCCGTCGGCGCAAAGGAT-3

In addition, oligonucleotides used for dsRNA synthesis in HXL1 are as follows:

5'-CCTATCAAGCGTCCTCGTCAATCTAGT-3 'and 5'-CCTATCAAGCGTCCTCGTCAATCTAGT -3'.

siRNA sequences were selected from 431 bp for IRE1 (SEQ ID NOs: 1935-2421) and 530 bp for HXL1 (88-617 nucleotides of SEQ ID NO: 3) (Ahn JH, et al: Identification of the genes differentially expressed in human dendritic cell subsets by cDNA subtraction and microarray analysis.Blood 2002, 100 (5): 1742-1754 and Yang YH et al: Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Acids Res 2002, 30 (4): e15. 20, 21). IRE1 and HXL1 siRNA designs are shown in FIGS. 7 and 8. (Hong Liu, et al: RNA interference in the pathogenic fungus Cryptococcus neoformans . Genetics, 2002, 160: 463-470) Using the siRNA designed as described above, the linearized siRNA was transformed into wild-type strains by electroporation. Inhibition of the expression of IRE1 or HXL1 gene by siRNA showed effects such as antifungal agent sensitivity, pathogenicity and temperature sensitivity.

< Example  5> IRE1  Gene and HXL1  Due to gene deletion UPR  Signaling Pathway Inhibition In vivo  Effects on pathogenicity

The pathogenicity of the mutants of the UPR signaling pathway mutant of Cryptococcus neoforms was investigated using a mouse model. As a result, it was confirmed that the pathogenicity of the ire1 Δ and hxl1 Δ mutant strains, UPR signaling pathway mutations are significantly reduced compared to the wild type. It can be seen that the UPR signaling pathway plays an important role in the pathogenicity of Cryptococcus (FIGS. 9 and 10).

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Use of IRE1 gene and HXL1 gene in UPR signal pathway for treating          mycoses or meningoencephalitis <130> IPDB39767 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 426 <212> PRT <213> Cryptococcus neoformans <400> 1 Met Ala Thr Ala Val Ala Ser Pro Ser Ser Phe Ser Pro Ile Pro Ser   1 5 10 15 Thr Ser Lys Arg Ser Ala Pro Ser Pro Ser Ser Ser Gln Pro Ile Lys              20 25 30 Arg Pro Arg Gln Ser Ser Ser Ser Pro Arg Asp Glu Asp Glu Ala Ala          35 40 45 Ala Ser Asp Glu Asp Leu Asp Glu Glu Ala Arg Ala Lys Leu Ala Arg      50 55 60 Lys Glu Ala Arg Thr Ile Arg Asn Arg Glu Ser Ala Gln Arg Ser Arg  65 70 75 80 Asn Ala Arg Lys Ala His Val Ala Trp Leu Glu Lys Arg Val Val Glu                  85 90 95 Leu Glu Ala Glu Asn Arg Ser Leu Lys Gly Glu Pro Pro Thr Ser Thr             100 105 110 Asp Pro Val Pro Ala Ala Ala Thr Pro Glu Pro Thr Ala Gln Pro Leu         115 120 125 Thr Arg Glu Ala Ser Thr Glu His Asp Val Leu Ser Phe Ala Asn Asp     130 135 140 Leu Gly Ile Pro Thr Glu Ile Val Ser Ser Gly Val Ser Leu Ser Asn 145 150 155 160 Val Ala Pro Pro Pro Ser Ser Val Asp Val Asp Val Lys Pro Ile Ile                 165 170 175 Glu Pro Ser Pro Leu Thr Leu Ala Ser Pro Ala Val Val Leu Thr Ser             180 185 190 Asn Asp Asp Leu Val Ala Ile Lys Thr Glu Asn Ala Ser Leu Arg Gln         195 200 205 Arg Val Thr Leu Leu Glu Asn Leu Val Lys Gln Val Val Ala Ile Ala     210 215 220 Asn Phe Ser Pro Pro Val Pro Ser Thr Ser Gln Arg Thr Pro Val Asn 225 230 235 240 Gln Phe Ala Ser Leu Pro Ser Gln Ser Ser Leu Asp Trp Ser Ser Thr                 245 250 255 Leu Ser Ala Thr Ser Val Leu Pro Ala Gly Leu Ser Ser Thr Leu Ser             260 265 270 Pro Gly Leu Pro Ala Arg Asn Ser Thr Val Ser Thr Thr Ser Ala Ser         275 280 285 Gln Leu Thr His His Ala Gln Thr Ser Gln Pro Glu Leu Ala Ser Ser     290 295 300 Gln Asn Val Ser Asn Pro Val Ala Cys His Ser Ala Ala Gly Glu Gly 305 310 315 320 Glu Leu Phe Asp Ala Leu Phe Gly Val Gly Val Gly Glu Gly Arg Glu                 325 330 335 Ala Asn Gly Ala Gly Ser Glu Val Asn His Arg Leu Gly Glu Thr Gln             340 345 350 Gly Leu Asp Ile Ser Ser Ser Thr Ile Gln Ser Thr Ser Gly His Gly         355 360 365 Val Glu Gly Met Phe Gly Arg Glu Glu Met Gln Ala Ala Val Glu Ser     370 375 380 Trp Asp Glu Ala Met Lys Ala Leu Ile Glu Asp Leu Glu Gly Gly Gln 385 390 395 400 Lys Glu Glu Lys Ala Asp Asp Arg Glu Glu Glu Gln Lys Gly Met Glu                 405 410 415 Trp Leu Asn Val Glu Arg Gly Ile Met Ala             420 425 <210> 2 <211> 1281 <212> DNA <213> Cryptococcus neoformans <400> 2 atggctaccg ctgtcgcttc tccttcctca ttctccccta ttccttcgac ttccaagcga 60 tctgccccct ctccttcatc atcgcaacct atcaagcgtc ctcgtcaatc tagttcatca 120 cccagggatg aggacgaggc agccgcaagt gatgaagatc tggatgaaga agcccgtgca 180 aagctggccc gtaaagaagc tagaaccatc cgtaaccgcg aatcagctca aagatcacgt 240 aacgcccgca aagcccatgt tgcatggcta gagaagcgcg tagtcgagtt ggaggccgaa 300 aatcgctccc tgaaaggaga gccaccaacg tcgacggatc cggttccggc tgcggctacc 360 cccgagccca ctgcacagcc tcttacccga gaagcttcca cagagcacga cgtattgtcc 420 ttcgccaacg accttggtat cccaacagaa atcgttagca gtggtgtaag cttgtcaaac 480 gtcgcacctc ctccgtcgag cgtagatgta gacgtcaagc caataatcga gccttcacct 540 ctcacactcg catcgcctgc ggtagtgttg acctcgaatg acgatctagt ggctatcaag 600 acggagaacg caagcctgag acaaagagta acgttgctgg agaacctcgt taagcaggtt 660 gtggccattg ccaatttcag cccgcctgtc ccttctacat ctcaacggac cccagtcaac 720 caatttgcat cattaccttc gcagtcgtct cttgattggt cgtcgacgct ctcggcgaca 780 tccgttttgc ccgccggtct ttcttctacc ctttcgcctg gcctccctgc ccgtaactcc 840 actgtgtcca ccacctcggc ttctcagctt acgcaccatg cccagacctc ccaaccggaa 900 ctggcgtctt cccaaaatgt atcgaacccc gtcgcttgcc actcagcagca gggcgagggg 960 gaattattcg atgcactctt tggcgttggc gttggcgaag gacgagaagc gaatggcgca 1020 ggtagcgagg ttaatcatcg ccttggcgag acacaagggc tggatatctc atcctcgacg 1080 atccaatcaa cctctggaca cggcgtggaa gggatgtttg gaagggagga gatgcaggca 1140 gcggtcgaga gttgggatga ggcgatgaag gcgttaattg aggatcttga gggagggcag 1200 aaggaggaga aggcagatga cagagaggaa gagcagaaag gaatggagtg gttgaatgtt 1260 gagaggggta ttatggcttg a 1281 <210> 3 <211> 1072 <212> PRT <213> Cryptococcus neoformans <400> 3 Met Leu Tyr Phe Leu Phe Leu Leu Pro Leu Leu Ile Ala Tyr Ala Ala   1 5 10 15 Pro Glu Pro Ala Ala Leu Ile Pro Phe Pro His His Thr Leu Arg Ala              20 25 30 Leu Ala Pro Ser Ser Thr Ala Thr Leu Pro Val Gln Ile Asp His Asp          35 40 45 Leu His Pro Leu Val Leu Val Ser Thr Ile Asp Gly Ala Leu His Ala      50 55 60 Leu Glu Arg Ser Thr Gly Lys Glu Lys Trp Val Leu Glu Gly Asp Pro  65 70 75 80 Leu Val Gly Gly Lys Met Lys Gly Gly Val Glu Glu Tyr Ile Val Glu                  85 90 95 Pro Leu Ser Gly Ser Leu Tyr Val His Glu Asp Lys Asp Gly Glu Met             100 105 110 Arg Met Arg Lys Leu Pro Leu Ser Val Asp Gln Leu Ile Glu Leu Ser         115 120 125 Pro Phe Thr Phe Pro Glu Ser Pro Thr Gln Ile Phe Thr Gly Ser Lys     130 135 140 His Thr Ser Leu Met Ser Val Asp Leu Arg Thr Gly Glu Gln Val Asp 145 150 155 160 Cys Phe Ser Pro Thr Ala Asn Leu Ser Gln Tyr Asp Gly Ser Ser Val                 165 170 175 Cys Asp Asp Leu Asp Asp Leu Glu Arg Arg Gly Ser Ser Gln Arg Asp             180 185 190 Thr Leu Phe Ile Gly Arg Thr Asp Tyr Arg Leu Thr Ile His Ser Pro         195 200 205 Ser Ser Ser Gln Gly Leu Ser Thr Tyr Thr Ser Ala Ala Tyr Pro Ala     210 215 220 Glu Lys Lys Ser Ala Pro Ala Val Gln Glu Ile Ser Tyr Ser Thr Tyr 225 230 235 240 Thr Pro Asn Ala Tyr Asn Arg Pro Leu Ala Glu Ser Trp Val Lys Ala                 245 250 255 Gly Val Ala His Gln Ser Trp Gly Pro Asp Asn Glu Glu Pro Arg Ile             260 265 270 Arg Ile Glu Leu Gly Phe Asn Gly Lys Ala Leu Gly Val Lys Pro Gly         275 280 285 Gly Gly Leu Ile Trp Asn Arg Glu Leu Glu His Ile Gly Val Gly Val     290 295 300 Tyr Glu Ile Leu Ile Pro Arg Glu Asn Pro Leu Gly Ala Pro Ile Leu 305 310 315 320 Val Pro Gln Pro Pro Ala His Leu Pro Ala Leu Phe Pro Gly Gln Asn                 325 330 335 Asp Pro Arg Ala Phe Asn Ile His Asp Ala Pro Pro Ser Thr Tyr Ile             340 345 350 Ala Thr Leu Pro Glu Cys Leu Thr Leu Pro Ser Ser Asn Thr Thr Ser         355 360 365 Gly Asn Ala Thr Ala Gly Asn Lys Asp Thr Lys Pro Leu His Phe Ala     370 375 380 Leu Ser Ser Ser Ser Tyr Pro Leu Ile Asn Phe Ala Arg Pro Pro Pro 385 390 395 400 Pro Gly His Leu Ser Asp Gly Leu Phe Tyr Asn Ala Asp Asp Gly Asp                 405 410 415 Ser Ser Asp Leu Asp His Ser Arg Gly Arg Gly Leu Leu Ser Gly Leu             420 425 430 Ile Asp Pro Pro Arg Glu His Glu Thr Ile Asp Pro Pro Phe Ile Glu         435 440 445 Arg Gln Ala Gly Pro Ala Lys Asn Gly Trp Trp Arg Trp Val Val Ala     450 455 460 Leu Gly Met Leu Leu Ile Leu Leu Gly Gly Val Met Val Arg Phe Gly 465 470 475 480 Arg Gly Lys Gly Ser Val Pro Gly Ser Val Glu Ser Lys Val Asp Glu                 485 490 495 Lys Met Pro Leu Leu Ala Val Pro Val His Glu Val Arg Leu Glu Glu             500 505 510 Lys Glu Glu Glu Glu Glu Glu Asp Val Leu Pro Val Val Lys Ser Ala         515 520 525 Pro Val Val Arg Ile Gln Glu Pro Ser Ser Thr Pro Glu Asp Ser Pro     530 535 540 Pro Arg Ser Glu Gly Thr Pro Glu Thr His Gln Thr Ala Thr Pro Pro 545 550 555 560 Pro Lys Lys Lys Ser Thr Arg Arg Arg Val Arg Gly Lys Lys Lys Lys                 565 570 575 Pro Asp Ala Thr Thr Thr Ala Thr Ala Ala Gly Leu Thr Ala Glu Glu             580 585 590 Arg Asp Gly Glu Asn Glu Asp Glu Asp His Glu Lys Asp Lys Glu Asp         595 600 605 Phe Ser Pro Arg Ala Thr Pro Lys Gly Gly Asn Lys Pro Leu Pro Glu     610 615 620 Leu Pro Arg Glu Leu Ser Ser Thr Asp Leu Leu Asp Tyr Asp Gln Asp 625 630 635 640 Lys Glu Arg Leu Ala Ile Ser Asp Thr Ile Ile Gly Phe Gly Ser His                 645 650 655 Gly Thr Val Val Leu Lys Gly Thr Trp Gly Gly Arg Pro Val Ala Val             660 665 670 Lys Arg Leu Leu Ser Asp Phe Thr Arg Leu Ala Ser Gln Glu Val Lys         675 680 685 Leu Leu Gln Ala Ser Asp Asp His Pro Asn Val Ile Arg Tyr Tyr Cys     690 695 700 Gln Glu Lys Arg Asp Asn Phe Leu Tyr Ile Ala Leu Asp Leu Cys Gln 705 710 715 720 Ala Ser Leu Ala Asp Leu Ile Glu Ser Pro Glu Lys His Arg Glu Leu                 725 730 735 Ala Asp Gln Leu Asp Arg Lys Arg Ala Leu Met Glu Val Thr Lys Gly             740 745 750 Leu Lys His Leu His Gly Met Lys Ile Ile His Arg Asp Ile Lys Pro         755 760 765 Gln Asn Val Leu Val Ser Gln Thr Pro Ser Gly Leu Arg Ile Leu Val     770 775 780 Ser Asp Phe Gly Leu Ala Arg Arg Leu Gly Gln Asp Gln Ser Ser Phe 785 790 795 800 Ala Pro Thr Ala Asn Asn Leu Ala Gly Ser Leu Gly Trp Arg Ala Pro                 805 810 815 Glu Cys Ile Arg Gly Val Val Arg Leu Asn Glu Gly Phe Asp Ala Ser             820 825 830 Ser Ser Val Gly Ser Ser Gly Gly Ile Ala Asn Ala Glu Asp Gly Val         835 840 845 Ala Arg Ser Arg Leu Thr Lys Ala Val Asp Leu Phe Ala Leu Gly Cys     850 855 860 Leu Tyr Phe Trp Val Leu Leu Ser Gly Glu His Pro Phe Gly Glu Thr 865 870 875 880 Tyr Asn Arg Glu Ser Asn Ile Val Lys Gly Glu Ala Val Asn Met Gly                 885 890 895 Met Leu Ser Leu Leu Gly Glu Glu Arg Glu Glu Val Glu Asp Leu Val             900 905 910 Lys Met Leu Leu Ser Thr Glu Pro Asp Ala Arg Pro Ser Thr Ser Glu         915 920 925 Cys Leu Thr His Pro Ile Phe Trp Pro Ala Ala Lys Arg Leu Gly Phe     930 935 940 Leu Cys Asp Ala Ser Asp Arg Phe Glu Ile Met Gln Thr Glu Pro Ala 945 950 955 960 Glu Pro Thr Leu Val Leu Leu Glu Gln Gly Ala Gln Ser Val Val Gly                 965 970 975 Lys Asp Trp Tyr Ser Arg Leu Asp Lys Thr Phe Thr Gly Ser Leu Gly             980 985 990 Lys Tyr Arg Lys Tyr Lys Gly Gly Ser Val Arg Asp Met Leu Arg Ala         995 1000 1005 Met Arg Asn Lys Lys His His Tyr Gln Asp Leu Glu Pro Ala Val Gln    1010 1015 1020 Lys His Leu Gly Ala Leu Pro Ala Gly Phe Leu Leu Tyr Phe Ser Ser 1025 1030 1035 1040 Arg Tyr Pro Lys Leu Leu Met His Val Tyr Arg Thr Val Lys Glu Ser                1045 1050 1055 Glu Leu Arg Glu Glu Ser Met Phe Glu Gly Cys Phe Gln Glu Ala Val            1060 1065 1070 <210> 4 <211> 1072 <212> DNA <213> Cryptococcus neoformans <400> 4 MLYFLFLLPL LIAYAAPEPA ALIPFPHHTL RALAPSSTAT LPVQIDHDLH PLVLVSTIDG 60 ALHALERSTG KEKWVLEGDP LVGGKMKGGV EEYIVEPLSG SLYVHEDKDG EMRMRKLPLS 120 VDQLIELSPF TFPESPTQIF TGSKHTSLMS VDLRTGEQVD CFSPTANLSQ YDGSSVCDDL 180 DDLERRGSSQ RDTLFIGRTD YRLTIHSPSS SQGLSTYTSA AYPAEKKSAP AVQEISYSTY 240 TPNAYNRPLA ESWVKAGVAH QSWGPDNEEP RIRIELGFNG KALGVKPGGG LIWNRELEHI 300 GVGVYEILIP RENPLGAPIL VPQPPAHLPA LFPGQNDPRA FNIHDAPPST YIATLPECLT 360 LPSSNTTSGN ATAGNKDTKP LHFALSSSSY PLINFARPPP PGHLSDGLFY NADDGDSSDL 420 DHSRGRGLLS GLIDPPREHE TIDPPFIERQ AGPAKNGWWR WVVALGMLLI LLGGVMVRFG 480 RGKGSVPGSV ESKVDEKMPL LAVPVHEVRL EEKEEEEEED VLPVVKSAPV VRIQEPSSTP 540 EDSPPRSEGT PETHQTATPP PKKKSTRRRV RGKKKKPDAT TTATAAGLTA EERDGENEDE 600 DHEKDKEDFS PRATPKGGNK PLPELPRELS STDLLDYDQD KERLAISDTI IGFGSHGTVV 660 LKGTWGGRPV AVKRLLSDFT RLASQEVKLL QASDDHPNVI RYYCQEKRDN FLYIALDLCQ 720 ASLADLIESP EKHRELADQL DRKRALMEVT KGLKHLHGMK IIHRDIKPQN VLVSQTPSGL 780 RILVSDFGLA RRLGQDQSSF APTANNLAGS LGWRAPECIR GVVRLNEGFD ASSSVGSSGG 840 IANAEDGVAR SRLTKAVDLF ALGCLYFWVL LSGEHPFGET YNRESNIVKG EAVNMGMLSL 900 LGEEREEVED LVKMLLSTEP DARPSTSECL THPIFWPAAK RLGFLCDASD RFEIMQTEPA 960 EPTLVLLEQG AQSVVGKDWY SRLDKTFTGS LGKYRKYKGG SVRDMLRAMR NKKHHYQDLE 1020 PAVQKHLGAL PAGFLLYFSS RYPKLLMHVY RTVKESELRE ESMFEGCFQE AV 1072

Claims (32)

(a) contacting a sample to be analyzed with a cell comprising an Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3;
(b) measuring the amount or activity of the protein; And
(c) determining that the sample is an antimicrobial agent when the amount or activity of the Hxl1 protein is determined to be down regulated. (a) contacting a sample to be analyzed with a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4;
(b) measuring the expression level of the gene; And
(c) when the expression level of the gene is measured to be down-regulation, determining that the sample is an antimicrobial agent. (a) a first measurement step of contacting an antimicrobial agent to a cell comprising an Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3, and measuring the amount or activity of the protein;
(b) a second measurement step of contacting a sample to be analyzed with a cell containing Hxl1 protein represented by SEQ ID NO: 1 or Ire1 protein represented by SEQ ID NO: 3 and the antimicrobial agent, and measuring the amount or activity of the protein; And
(c) comparing the measured values of the first and second measuring steps such that when the measured value of the second measuring step is down-regulated than the measured value of the first measuring step, the sample is antimicrobial for concomitant administration. Antimicrobial screening method for concomitant administration to determine whether or not. (a) a first measurement step of contacting an antimicrobial agent to a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, and measuring the expression level of the gene;
(b) a second measurement step of contacting a sample to be analyzed and the antimicrobial agent to a cell including the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, and measuring the expression level of the gene; And
(c) comparing the measured values of the first and second measuring steps such that when the measured value of the second measuring step is down-regulated than the measured value of the first measuring step, the sample is antimicrobial for concomitant administration. Antimicrobial screening method for concomitant administration to determine whether or not. The method according to claim 3 or 4,
The antimicrobial agent screening method for concomitant administration of antimicrobial agents is an azole or non-azole antibacterial agent. The method according to claim 3 or 4,
The azole-based antibacterial agent is any one or more of fluconazole, itraconazole, voriconazole and ketoconazole. The method according to claim 3 or 4,
A non-azole antibacterial agent is amphoteracin B or fludioxonil, a combination antimicrobial screening method. 3. The method according to claim 1 or 2,
(A) The antimicrobial screening method is carried out at 35 ℃ to 40 ℃. 3. The method according to claim 1 or 2,
The method of screening an antimicrobial agent in step (a) is Cryptococcus neoformus. The method according to claim 3 or 4,
Conjugated antimicrobial screening method for performing steps (a) and (b) at 35 ° C to 40 ° C. The method according to claim 3 or 4,
The method of (a) and (b), wherein the cells are Cryptococcus neoforms screening method of antimicrobial agent for concomitant use. Antimicrobial pharmaceutical composition comprising an antisense or siRNA (small interference RNA) oligonucleotide having a sequence complementary to the nucleotide sequence represented by SEQ ID NO: 2 or 4 as an active ingredient. The method of claim 12,
The antisense or siRNA oligonucleotide is an antimicrobial pharmaceutical composition having a sequence complementary to the nucleotide sequence 88 -617th nucleotide of SEQ ID NO: 2. The method of claim 12,
The antisense or siRNA oligonucleotide is an antimicrobial pharmaceutical composition having a sequence complementary to the nucleotide sequence 1935-2421 nucleotide of SEQ ID NO: 4.
(a) contacting a sample to be analyzed with a cell comprising an Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3;
(b) measuring the amount or activity of the protein; And
(c) determining that the sample is a meningitis therapeutic agent when the amount or activity of the Hxl1 protein is determined to be down regulated. (a) contacting a sample to be analyzed with a cell comprising the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4;
(b) measuring the expression level of the gene; And
(c) when the amount of expression of the gene is determined to be down-regulation, determining that the sample is a meningitis therapeutic agent. (a) a first measurement step of contacting a cell containing a Hxl1 protein represented by SEQ ID NO: 1 or an Ire1 protein represented by SEQ ID NO: 3 with a therapeutic agent for meningitis and measuring the amount or activity of the protein;
(b) a second measurement step of contacting a sample to be analyzed with a cell containing the Hxl1 protein represented by SEQ ID NO: 1 or the Ire1 protein represented by SEQ ID NO: 3, and the therapeutic agent for meningitis, and measuring the amount or activity of the protein; And
(c) comparing the measured values of the first and second measuring steps, when the measured value of the second measuring step is down-regulated than the measured value of the first measuring step, the sample is used for meningitis for co-administration Meningitis therapeutic agent screening method for concomitant administration to determine if it is a therapeutic agent. (a) a first measurement step of contacting a cell containing a HXL1 gene represented by SEQ ID NO: 2 or an IRE1 gene represented by SEQ ID NO: 4 with a therapeutic agent for meningitis, and measuring the expression level of the gene;
(b) a second measurement step of contacting a sample to be analyzed with a cell containing the HXL1 gene represented by SEQ ID NO: 2 or the IRE1 gene represented by SEQ ID NO: 4, and the meningitis therapeutic agent, and measuring the expression level of the gene; And
(c) comparing the measured values of the first and second measuring steps, when the measured value of the second measuring step is down-regulated than the measured value of the first measuring step, the sample is used for meningitis for co-administration Meningitis therapeutic agent screening method for concomitant administration to determine if it is a therapeutic agent. The method of claim 17 or 18,
The meningitis therapeutic agent is a azole-type or non-azole-type meningitis therapeutic agent. The method of claim 17 or 18,
The azole-based meningitis therapeutic agent is any one or more of fluconazole, itraconazole, voriconazole and ketoconazole. The method of claim 17 or 18,
A non-azole-based meningitis therapeutic agent is amphotericin B or fludioxonil. 17. The method according to claim 15 or 16,
(a) Meningitis treatment agent screening method is carried out at 35 ℃ to 40 ℃. 17. The method according to claim 15 or 16,
The method of screening the meningitis therapeutic agent cell (a) is Cryptococcus neoformus. The method of claim 17 or 18,
A method for screening a concomitant meningitis therapeutic agent, wherein steps (a) and (b) are performed at 35 ° C to 40 ° C. The method of claim 17 or 18,
The method of (a) and (b) the cells are Cryptococcus neo-formance screening method for concomitant meningitis therapeutics. Pharmaceutical composition for treating meningitis comprising an antisense or siRNA (small interference RNA) oligonucleotide having a sequence complementary to the nucleotide sequence represented by SEQ ID NO: 2 or 4 as an active ingredient. The method of claim 26,
The antisense or siRNA oligonucleotide is a pharmaceutical composition for treating meningitis having a sequence complementary to the nucleotide sequence 88 -617th nucleotide of SEQ ID NO: 2. The method of claim 26,
The antisense or siRNA oligonucleotide is a pharmaceutical composition for treating meningitis having a sequence complementary to the nucleotide sequence 1935-2421 nucleotide of SEQ ID NO: 4. Hxl1 (H AC1 and BP1 L ike X gene 1) protein shown in SEQ ID NO: 1; An HXL1 gene encoding the protein of claim 29. 31. The method of claim 30,
HXL1 gene represented by SEQ ID NO: 2. A host in which the gene of claim 31 is deleted.

Images