KR101504136B1 - Biomarker composition for diagnosis of exposure to volatile organic compounds - Google Patents
Biomarker composition for diagnosis of exposure to volatile organic compounds Download PDFInfo
- Publication number
- KR101504136B1 KR101504136B1 KR1020140111558A KR20140111558A KR101504136B1 KR 101504136 B1 KR101504136 B1 KR 101504136B1 KR 1020140111558 A KR1020140111558 A KR 1020140111558A KR 20140111558 A KR20140111558 A KR 20140111558A KR 101504136 B1 KR101504136 B1 KR 101504136B1
- Authority
- KR
- South Korea
- Prior art keywords
- seq
- biomarker
- exposure
- toluene
- xylene
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
휘발성 유기화합물 노출 여부 진단용 바이오마커이다.
본 발명에 따른 바이오마커는 에틸벤젠, 톨루엔 및 자일렌 등 특정 휘발성 유기화합물에 대한 노출을 진단하는 효과가 있다. 그리하여 상기 바이오마커를 통해 저농도의 특정 휘발성 유기화합물에 노출된 후에도 이의 노출 여부를 직접 확인할 수 있다.It is a biomarker for the detection of exposure to volatile organic compounds.
The biomarker according to the present invention has an effect of diagnosing exposure to a specific volatile organic compound such as ethylbenzene, toluene and xylene. Thus, it is possible to directly determine whether the biomarker is exposed after exposure to the specific concentration of the volatile organic compound through the biomarker.
Description
본 발명은 바이오마커에 관한 것으로서, 보다 구체적으로는 휘발성 유기화합물 노출 여부 진단용 바이오마커에 관한 것이다.
The present invention relates to a biomarker, and more particularly, to a biomarker for diagnosis of exposure to volatile organic compounds.
휘발성 유기화합물(Volatile Organic Compounds: VOCs)은 증기압이 높아 대기 중으로 쉽게 증발되는 액체 또는 기체상 유기화합물의 총칭으로, 대기 중에서 질소산화물과 공존하면 햇빛의 작용으로 광화학반응을 일으켜 오존 및 팬(PAN: 퍼옥시아세틸 나이트레이트) 등 광화학 산화성물질을 생성시켜 광화학스모그를 유발하는 물질을 통틀어 일컫는다. 대기오염물질이며 발암성을 지닌 독성 화학물질로서 광화학산화물의 전구물질이기도 하다. 또한 지구온난화의 원인물질이며 악취를 일으키기도 한다. 따라서, 국가마다 배출을 줄이기 위해 정책적으로 관리하고 있다.Volatile Organic Compounds (VOCs) are a generic term for liquid or gaseous organic compounds that are easily evaporated into the atmosphere due to their high vapor pressure.When they coexist with nitrogen oxides in the atmosphere, they cause photochemical reactions due to the action of sunlight, causing ozone and pan (PAN: Peroxyacetyl nitrate) and other substances that cause photochemical smog by generating photochemical oxidizing substances are collectively referred to. It is an air pollutant and a toxic chemical with carcinogenicity, and is also a precursor to photochemical oxides. It is also a source of global warming and may cause odor. Therefore, each country is managing it in a policy to reduce emissions.
또한, 휘발성 유기화합물은 피부접촉이나 호흡기 흡입을 통해 신경계에 장애를 일으키는 발암물질이다. 이들 휘발성 유기화합물은 대개의 경우 저농도에서도 악취를 유발하며, 화합물 자체로서도 환경 및 인체에 직접적으로 유해하거나 대기 중에서 광화학반응에 참여하여 광화학산화물 등 2차 오염물질을 생성하기도 한다.In addition, volatile organic compounds are carcinogens that cause disorders in the nervous system through skin contact or respiratory inhalation. In most cases, these volatile organic compounds cause odor even at low concentrations, and they are directly harmful to the environment and human body, or they participate in photochemical reactions in the atmosphere to generate secondary pollutants such as photochemical oxides.
이러한 휘발성 유기화합물 중 에틸벤젠(Ethylbenzene)은 석유화학산업에서 스타이렌을 생산하는데 중간물질로서 사용되는 중요한 방향족탄화수소이며, 톨루엔(Toluene)은 무색의 액체로서 석탄을 건류하여 얻은 경유를 황산으로 씻은 다음 정류하여 만들거나 메틸사이클로헥세인을 수소이탈하여 제조하며 유기합성화학에서 중요한 화합물이다. 또한 자일렌(Xylene)은 주로 인쇄, 고무, 가죽 산업에서 용매로 사용되는 화합물이다. Among these volatile organic compounds, ethylbenzene (Ethylbenzene) is an important aromatic hydrocarbon used as an intermediate material to produce styrene in the petrochemical industry, and toluene (Toluene) is a colorless liquid. It is produced by rectification or by dehydrogenation of methylcyclohexane and is an important compound in organic synthetic chemistry. In addition, xylene is a compound mainly used as a solvent in the printing, rubber, and leather industries.
한편, 최근에는 빠른 산업화에 따른 환경오염이 심각해짐에 따라 극미량의 환경유해 물질의 위험성을 조기에 확인하고 분석할 수 있는 효과적인 분석 시스템이 필요하며, 특히 저 농도로 장기간 축적되는 형태의 환경유해물질노출에 의한 인간의 건강 피해 평가는 매우 중요한 환경기술로 대두되고 있다. 최근의 유해성 평가기술은 과거의 고용량으로 실험된 독성실험결과에 의존하기보다는 현실적인 생활환경에서의 인체노출 수준을 반영할 수 있는 저용량 노출영향규명에 초점을 두고, 저용량 노출에서의 유해 영향이 나타나지 않는 수준을 고려하여 관리기준을 설정하는 방법을 개발할 필요성이 부각되고 있다.On the other hand, in recent years, as environmental pollution caused by rapid industrialization becomes serious, an effective analysis system is needed to identify and analyze the dangers of very trace amounts of environmentally harmful substances early. In particular, environmentally hazardous substances in the form of long-term accumulation at low concentrations. Assessment of human health damage caused by exposure is emerging as a very important environmental technology. Rather than relying on the results of toxicity tests conducted at high doses in the past, recent hazard evaluation techniques focus on the identification of low-dose exposure effects that can reflect the level of human exposure in a realistic living environment, and no adverse effects from low-dose exposure appear. The need to develop a method of setting management standards in consideration of the level is emerging.
이러한 방법의 개발에는 바이오마커를 개발하는 일이 선행되어야 한다. 하지만, 현재 저농도의 휘발성 유기화합물 노출 여부를 효과적으로 진단할 수 있는 바이오마커의 개발이 미흡한 현실에 처해 문제가 있다. The development of this method should precede the development of biomarkers. However, there is a problem in the reality that the development of biomarkers capable of effectively diagnosing exposure of low-concentration volatile organic compounds is insufficient.
또한 진핵생물의 유전자 발현 조절에 중요한 역할을 담당하고 있는 마이크로 RNA(microRNA)와 암발생 조절에 중요하게 관련되는 메틸레이션 DNA(methylation DNA)를 바이오마커로 활용하고자 하는 노력은 현재 많이 부족한 문제점이 있다.
In addition, efforts to utilize microRNA, which plays an important role in regulating gene expression in eukaryotes, and methylation DNA, which are important for regulating cancer incidence, as biomarkers, are currently lacking. .
본 발명은 상술한 문제점을 해결하기 위해 안출된 것으로서, 본 발명의 목적은 휘발성 유기화합물에 대한 노출 여부를 진단하는 바이오마커를 제공하는 것이다. 또한 상기 바이오마커를 활용하여 휘발성 유기화합물에 대한 노출 여부를 확인하는 방법을 제공하는 것이다.
The present invention has been devised to solve the above-described problems, and an object of the present invention is to provide a biomarker for diagnosing exposure to volatile organic compounds. In addition, it is to provide a method of confirming exposure to volatile organic compounds using the biomarker.
위와 같은 과제를 해결하기 위한 본 발명의 한 특징에 따른 바이오마커는 서열번호1, 서열번호 2, 서열번호 5, 서열번호 8, 서열번호 9 및 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 염기서열과 이들 각각의 상보적 염기서열을 포함하는 에틸벤젠에 대한 노출 여부 진단용 바이오마커이다.
The biomarker according to one feature of the present invention for solving the above problems is any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 It is a biomarker for diagnosing exposure to ethylbenzene containing and their respective complementary nucleotide sequences.
본 발명의 또 다른 특징에 따른 바이오마커는 서열번호 1, 서열번호 2, 서열번호 3, 서열번호 7, 서열번호 8, 서열번호 9 및 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 염기서열과 이들 각각의 상보적 염기서열을 포함하는 톨루엔에 대한 노출 여부 진단용 바이오마커이다.
The biomarker according to another feature of the present invention includes any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: It is a biomarker for diagnosis of exposure to toluene containing each complementary nucleotide sequence.
본 발명의 또 다른 특징에 따른 바이오마커는 서열번호 1, 서열번호 2, 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 9 및 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 염기서열과 이들 각각의 상보적 염기서열을 포함하는 자일렌에 대한 노출 여부 진단용 바이오마커이다.
The biomarker according to another feature of the present invention includes any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: It is a biomarker for diagnosis of exposure to xylene containing each complementary nucleotide sequence.
본 발명의 또 다른 특징에 따른 유전자 발현의 증가 또는 감소를 확인하는 방법은 1) 실험군 및 대조군의 혈액으로부터 마이크로 RNA를 추출하는 단계와, 2) 상기 단계 1)에 따른 실험군 및 대조군의 마이크로 RNA를 상보적 염기서열의 cDNA로 합성하는 단계와, 3)상기 단계 2)의 cDNA를 PCR을 통해 증폭시키는 단계, 및 4) 상기 단계 3)의 증폭된 산물을 증폭 전후로 비교 분석하여 상기 바이오마커를 확인하는 단계를 포함하는 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질에 대한 유전자 발현의 증가 또는 감소를 확인하는 방법이다. A method for confirming the increase or decrease in gene expression according to another feature of the present invention includes the steps of: 1) extracting microRNAs from the blood of the experimental group and the control group, and 2) microRNAs of the experimental group and the control group according to step 1). Synthesis of cDNA of a complementary nucleotide sequence, 3) amplifying the cDNA of step 2) through PCR, and 4) comparing and analyzing the amplified product of step 3) before and after amplification to confirm the biomarker It is a method of confirming an increase or decrease in gene expression for any one or more substances selected from the group consisting of ethylbenzene, toluene, and xylene including the step of.
또한 상기 바이오마커는 서열번호 1, 서열번호 2, 서열번호 3, 서열번호 4 및 서열번호 5으로 이루어지는 군 중에서 선택된 어느 하나 이상의 바이오마커인 것을 특징으로 한다.
In addition, the biomarker is characterized in that any one or more biomarkers selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.
본 발명의 또 다른 특징에 따른 유전자의 메틸레이션 여부를 확인하는 방법은 1) 실험군 및 대조군의 혈액으로부터 DNA를 추출하는 단계와, 2) 상기 단계 1)의 DNA를 메틸레이션 여부 확인용 프라이머를 이용해 PCR을 수행하는 단계, 및 3) 상기 단계 2)의 PCR 결과를 통해 메틸레이션 여부를 비교 분석하여 상기 바이오마커를 확인하는 단계를 포함하는 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질에 대한 유전자의 메틸레이션 여부를 확인하는 방법이다. According to another feature of the present invention, a method of checking whether a gene is methylated is 1) extracting DNA from the blood of the test group and the control group, and 2) using a primer for checking whether the DNA of step 1) is methylated. Any one or more selected from the group consisting of ethylbenzene, toluene and xylene comprising the step of performing PCR, and 3) comparing and analyzing whether methylation through the PCR result of step 2) and confirming the biomarker. This is a method to check whether a gene is methylated to a substance.
또한 상기 바이오마커는 서열번호 6, 서열번호 7, 서열번호 8, 서열번호 9 및 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 바이오마커인 것을 특징으로 한다.
In addition, the biomarker is characterized in that any one or more biomarkers selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
본 발명에 따른 바이오마커는 특정 휘발성 유기화합물에 대한 노출을 진단하는 효과가 있다. 그리하여 상기 바이오마커를 통해 저농도의 특정 휘발성 유기화합물에 노출된 후에도 이의 노출 여부를 직접 확인할 수 있다.
The biomarker according to the present invention is effective in diagnosing exposure to specific volatile organic compounds. Thus, even after exposure to a low concentration of a specific volatile organic compound through the biomarker, it is possible to directly determine whether or not it is exposed.
도 1은 휘발성 유기화합물에 노출된 후 본 발명에 따른 서열번호 1 내지 서열번호 5에 따른 마이크로 RNA 바이오마커의 유전자 발현 변화를 나타낸 그래프이다.
도 2는 휘발성 유기화합물에 노출된 후 본 발명에 따른 서열번호 6에 따른 메틸레이션 DNA 바이오마커의 유전자 발현 변화를 밴드로 나타낸 아가로스 젤 사진이다.
도 3는 휘발성 유기화합물에 노출된 후 본 발명에 따른 서열번호 7에 따른 메틸레이션 DNA 바이오마커의 유전자 발현 변화를 밴드로 나타낸 아가로스 젤 사진이다.
도 4는 휘발성 유기화합물에 노출된 후 본 발명에 따른 서열번호 8에 따른 메틸레이션 DNA 바이오마커의 유전자 발현 변화를 밴드로 나타낸 아가로스 젤 사진이다.
도 5는 휘발성 유기화합물에 노출된 후 본 발명에 따른 서열번호 9에 따른 메틸레이션 DNA 바이오마커의 유전자 발현 변화를 밴드로 나타낸 아가로스 젤 사진이다.
도 6은 휘발성 유기화합물에 노출된 후 본 발명에 따른 서열번호 10에 따른 메틸레이션 DNA 바이오마커의 유전자 발현 변화를 밴드로 나타낸 아가로스 젤 사진이다. 1 is a graph showing changes in gene expression of micro RNA biomarkers according to SEQ ID NOs: 1 to 5 according to the present invention after exposure to volatile organic compounds.
2 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 6 according to the present invention after exposure to a volatile organic compound as a band.
3 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 7 according to the present invention after exposure to a volatile organic compound as a band.
4 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 8 according to the present invention after exposure to a volatile organic compound as a band.
5 is an agarose gel photograph showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 9 according to the present invention after exposure to a volatile organic compound as a band.
6 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 10 according to the present invention after exposure to a volatile organic compound.
이에 본 발명자들은 특정 휘발성 유기화합물에 대한 노출 여부 진단용 바이오마커를 개발하기 위하여 예의 연구 노력한 결과, 본 발명에 따른 바이오마커를 발견하여 본 발명을 완성하였다.
Accordingly, the present inventors completed the present invention by discovering the biomarker according to the present invention as a result of intensive research efforts to develop a biomarker for diagnosis of exposure to a specific volatile organic compound.
구체적으로 본 발명에 따른 바이오마커는 바람직하게는 하기 서열번호 1 내지 서열번호 10 중에서 선택된 어느 하나 이상의 염기서열을 포함할 수 있으며, 특정 휘발성 유기화합물에 대한 노출 여부 진단용 바이오마커 일 수 있다.
Specifically, the biomarker according to the present invention may preferably include any one or more nucleotide sequences selected from the following SEQ ID NO: 1 to SEQ ID NO: 10, and may be a biomarker for diagnosis of exposure to a specific volatile organic compound.
서열번호 1: AGTAGTGCTTTCTACTTTASEQ ID NO: 1: AGTAGTGCTTTCTACTTTA
서열번호 2: TCAGTTTTGCATAGATTTGCASEQ ID NO: 2: TCAGTTTTGCATAGATTTGCA
서열번호 3; TCAGCCGCTGTCACACSEQ ID NO: 3; TCAGCCGCTGTCACAC
서열번호 4: TTGCCCTCTCAACCCSEQ ID NO: 4: TTGCCCTCTCAACCC
서열번호 5: TTCAAAACATGAATTGCTGCTGSEQ ID NO: 5: TTCAAAACATGAATTGCTGCTG
서열번호 6: TCGGTGTTTATAGGTGTTGGCSEQ ID NO: 6: TCGGTGTTTATAGGTGTTGGC
서열번호 7: TTTAGGAGACGTTTATGAGTTTGCSEQ ID NO: 7: TTTAGGAGACGTTTATGAGTTTGC
서열번호 8: TTTGTTAGTTAGGGTTTGGGTTTCSEQ ID NO: 8: TTTGTTAGTTAGGGTTTGGGTTTC
서열번호 9: TTGAGATTAGTTTGGTTAATATGGCSEQ ID NO: 9: TTGAGATTAGTTTGGTTAATATGGC
서열번호 10: TAAGTGTTTAGTTGGGAGAGTTGTAAC
SEQ ID NO: 10: TAAGTGTTTAGTTGGGAGAGTTGTAAC
일반적으로 마이크로 RNA는 진핵세포의 유전자 발현을 조절하는데 있어 중요하며, 메틸레이션 DNA는 시토신의 탄소원자에 CH3가 붙은 DNA로서 암발현 유전자의 발현 조절 및 억제에 있어 중요하다.In general, microRNA is important in regulating gene expression in eukaryotic cells, and methylated DNA is DNA in which CH3 is attached to a carbon atom of cytosine, and is important in regulating and suppressing the expression of cancer-expressing genes.
한편 상기 서열번호 1 내지 서열번호 5의 염기서열은 바람직하게는 마이크로 RNA의 염기서열일 수 있고, 상기 서열번호 6 내지 서열번호 10의 염기서열은 바람직하게는 메틸레이션 DNA의 염기서열일 수 있다. Meanwhile, the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 5 may preferably be a nucleotide sequence of micro RNA, and the nucleotide sequence of SEQ ID NO: 6 to SEQ ID NO: 10 may preferably be a nucleotide sequence of methylation DNA.
또한 상기 서열번호 6 내지 서열번호 10의 염기서열은 왼쪽에서 오른쪽으로 진행함에 있어서 5’ 말단에서 3’ 말단 방향으로 향하는 것이며, 상기 염기서열에 상보적인 염기서열이 이중결합할 수 있다. In addition, the nucleotide sequences of SEQ ID NOs: 6 to 10 are directed from the 5'end to the 3'end when proceeding from left to right, and a nucleotide sequence complementary to the nucleotide sequence may be double bonded.
또한 상기 특정 휘발성 유기화합물은 바람직하게는 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질일 수 있다. In addition, the specific volatile organic compound may preferably be any one or more substances selected from the group consisting of ethylbenzene, toluene, and xylene.
특히 상기 서열번호 1, 서열번호 2, 서열번호 5, 서열번호 8, 서열번호 9 및 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 염기서열을 포함하는 바이오마커는 바람직하게는 에틸벤젠에 대하여 상기 유전자의 발현량이 변화하므로, 에틸벤젠에 대한 노출 여부 진단용 바이오마커 일 수 있다. In particular, the biomarker comprising any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is preferably the gene for ethylbenzene. Since the expression level of is changed, it may be a biomarker for diagnosis of exposure to ethylbenzene.
또한 상기 서열번호 1, 서열번호 2, 서열번호 3, 서열번호 7, 서열번호 8, 서열번호 9 및 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 염기서열을 포함하는 바이오마커는 바람직하게는 톨루엔에 대하여 상기 유전자의 발현량이 변화하므로 톨루엔에 대한 노출 여부 진단용 바이오마커 일 수 있다.In addition, the biomarker including any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is preferably in toluene. On the other hand, since the expression level of the gene changes, it may be a biomarker for diagnosis of exposure to toluene.
또한 상기 서열번호 1, 서열번호 2, 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 9, 서열번호 10으로 이루어지는 군 중에서 선택된 어느 하나 이상의 염기서열을 포함하는 바이오마커는 바람직하게는 자일렌에 대하여 상기 유전자의 발현량이 변화하므로, 자일렌에 대한 노출 여부 진단용 바이오마커 일 수 있다. In addition, the biomarker comprising any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is preferably xylene Since the expression level of the gene changes with respect to, it may be a biomarker for diagnosis of exposure to xylene.
또한 더욱 구체적으로는 상기 서열번호 1의 염기서열은 마이크로 RNA의 염기서열을 갖는 바이오마커로서, 에틸벤젠, 자일렌 및 톨루엔에 노출시 유전자의 발현량이 유의하게 감소하므로, 에틸벤젠, 자일렌 및 톨루엔에 대한 노출 여부 진단용 바이오마커 일 수 있다.
In addition, more specifically, the nucleotide sequence of SEQ ID NO: 1 is a biomarker having a nucleotide sequence of micro RNA, and since the amount of gene expression significantly decreases when exposed to ethylbenzene, xylene and toluene, ethylbenzene, xylene, and toluene It may be a biomarker for diagnosis of exposure to.
*또한 상기 서열번호 2의 염기서열은 마이크로 RNA의 염기서열을 갖는 바이오마커로서, 에틸벤젠, 자일렌 및 톨루엔에 노출시 유전자의 발현량이 유의하게 감소하므로, 에틸벤젠, 자일렌 및 톨루엔에 대한 노출 여부 진단용 바이오마커 일 수 있다. *In addition, the nucleotide sequence of SEQ ID NO: 2 is a biomarker having the nucleotide sequence of micro RNA, and since the expression level of the gene significantly decreases when exposed to ethylbenzene, xylene and toluene, exposure to ethylbenzene, xylene and toluene It may be a biomarker for diagnosis.
또한 상기 서열번호 3의 염기서열은 마이크로 RNA의 염기서열을 갖는 바이오마커로서 톨루엔에 노출시 유전자의 발현량이 유의하게 증가하므로, 톨루엔에 대한 노출 여부 진단용 바이오마커 일 수 있다. In addition, the nucleotide sequence of SEQ ID NO: 3 is a biomarker having the nucleotide sequence of micro RNA, and since the expression level of the gene increases significantly when exposed to toluene, it may be a biomarker for diagnosis of exposure to toluene.
또한 상기 서열번호 4의 염기서열은 마이크로 RNA의 염기서열을 갖는 바이오마커로서, 자일렌에 대한 노출시 유전자의 발현량이 유의하게 증가하므로, 자일렌에 대한 노출 여부 진단용 바이오마커 일 수 있다. In addition, the nucleotide sequence of SEQ ID NO: 4 is a biomarker having a nucleotide sequence of micro RNA, and since the expression level of the gene increases significantly when exposed to xylene, it may be a biomarker for diagnosis of exposure to xylene.
또한 상기 서열번호 5의 염기서열은 마이크로 RNA의 염기서열을 갖는 바이오마커로서, 에틸벤젠에 노출시 유전자의 발현량이 유의하게 감소하므로, 에틸벤젠에 대한 노출 여부 진단용 바이오마커 일 수 있다. In addition, the nucleotide sequence of SEQ ID NO: 5 is a biomarker having a nucleotide sequence of micro RNA, and since the expression level of the gene is significantly reduced when exposed to ethylbenzene, it may be a biomarker for diagnosis of exposure to ethylbenzene.
또한 상기 서열번호 6의 염기서열을 갖는 바이오마커는 메틸레이션 DNA인 바이오마커로서, 자일렌에 대한 노출시 유전자의 발현량이 유의하게 변화하므로, 자일렌에 대한 노출 여부 진단용 바이오마커 일 수 있다.
In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 6 is a biomarker that is methylation DNA, and since the expression level of the gene changes significantly when exposed to xylene, it may be a biomarker for diagnosis of exposure to xylene.
*또한 상기 서열번호 7의 염기서열을 갖는 바이오마커는 메틸레이션 DNA인 바이오마커로서, 톨루엔에 노출시 유전자의 발현량이 유의하게 변화하므로, 톨루엔에 대한 노출 여부 진단용 바이오마커 일 수 있다. *In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 7 is a biomarker that is methylation DNA, and since the expression level of the gene changes significantly when exposed to toluene, it may be a biomarker for diagnosis of exposure to toluene.
또한 상기 서열번호 7의 염기서열을 갖는 바이오마커는 메틸레이션 DNA인 바이오마커로서, 에틸벤젠, 톨루엔 및 자일렌에 노출시 유전자의 발현량이 유의하게 변화하므로, 톨루엔에 대한 노출 여부 진단용 바이오마커 일 수 있다.In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 7 is a biomarker that is methylation DNA, and since the expression level of the gene significantly changes when exposed to ethylbenzene, toluene, and xylene, it may be a biomarker for diagnosis of exposure to toluene. have.
또한 상기 서열번호 8의 염기서열을 갖는 바이오마커는 메틸레이션 DNA인 바이오마커로서, 에틸벤젠, 톨루엔 및 자일렌에 노출시 유전자의 발현량이 유의하게 변화하므로, 에틸벤젠, 톨루엔 및 자일렌에 대한 노출 여부 진단용 바이오마커 일 수 있다. In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 8 is a biomarker that is methylation DNA, and since the expression level of the gene significantly changes when exposed to ethylbenzene, toluene and xylene, exposure to ethylbenzene, toluene and xylene It may be a biomarker for diagnosis.
또한 상기 서열번호 9의 염기서열을 갖는 바이오마커는 메틸레이션 DNA인 바이오마커로서, 에틸벤젠, 톨루엔 및 자일렌에 노출시 유전자의 발현량이 유의하게 변화하므로, 에틸벤젠, 톨루엔 및 자일렌에 대한 노출 여부 진단용 바이오마커 일 수 있다. In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 9 is a biomarker that is methylation DNA, and since the amount of gene expression significantly changes when exposed to ethylbenzene, toluene and xylene, exposure to ethylbenzene, toluene and xylene It may be a biomarker for diagnosis.
또한 상기 서열번호 10의 염기서열을 갖는 바이오마커는 메틸레이션 DNA인 바이오마커로서, 에틸벤젠, 톨루엔 및 자일렌에 노출시 유전자의 발현량이 유의하게 변화하므로, 에틸벤젠, 톨루엔 및 자일렌에 대한 노출 여부 진단용 바이오마커 일 수 있다.In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 10 is a biomarker that is methylation DNA, and since the amount of gene expression significantly changes when exposed to ethylbenzene, toluene and xylene, exposure to ethylbenzene, toluene and xylene It may be a biomarker for diagnosis.
상기 에틸벤젠(Ethylbenzene)은 석유화학산업에서 스타이렌을 생산하는데 중간물질로서 사용되는 중요한 방향족탄화수소이며, 톨루엔(Toluene)은 무색의 액체로서 석탄을 건류하여 얻은 경유를 황산으로 씻은 다음 정류하여 만들거나 메틸사이클로헥세인을 수소이탈하여 제조하며 유기합성화학에서 중요한 화합물이다.Ethylbenzene is an important aromatic hydrocarbon used as an intermediate material for producing styrene in the petrochemical industry, and toluene is a colorless liquid. It is produced by dehydrogenating methylcyclohexane and is an important compound in organic synthetic chemistry.
또한 자일렌(Xylene)은 주로 인쇄, 고무, 가죽 산업에서 용매로 사용되는 화합물이다. 이러한 에틸벤젠, 톨루엔 및 자일렌은 소량으로 인체에 축적되더라도 유해한 효과를 내는 물질로 잘 알려져 있다. In addition, xylene is a compound mainly used as a solvent in the printing, rubber, and leather industries. Ethylbenzene, toluene, and xylene are well known as substances that exert harmful effects even when accumulated in a small amount in the human body.
상기 바이오마커는 염기서열의 개수 및 형태에 특별한 제한이 있는 것은 아니지만, 바람직하게는 10 내지 50 bp, 더욱 바람직하게는 15 내지 30 bp 일 수 있다. 또한 본 발명의 바이오마커는 상기 서열번호 1 내지 서열번호 10의 염기서열뿐 만 아니라 바람직하게는 상기 바이오마커 전체 염기서열을 포함하여 추가될 수 있으며, 그 염기서열의 숫자는 제한이 없으나, 상기 추가된 염기서열을 포함한 전체 bp는 바람직하게는 100 내지 300 bp일 수 있다.
The biomarker is not particularly limited in the number and form of nucleotide sequences, but may be preferably 10 to 50 bp, more preferably 15 to 30 bp. In addition, the biomarker of the present invention may be added including not only the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 10, but preferably the entire nucleotide sequence of the biomarker, and the number of the nucleotide sequence is not limited, but the addition The total bp including the nucleotide sequence may preferably be 100 to 300 bp.
본 발명의 또 다른 특징으로서 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질에 노출된 후 유전자 발현의 증가 또는 감소를 확인하는 방법은 1) 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질에 대한 노출이 의심되는 개체(실험군)의 혈액 및 대조군의 혈액으로부터 전체 RNA(Total RNA)를 추출하는 단계와, 2) 상기 단계 1)에 따른 실험군 및 대조군의 전체 RNA로부터 상기 바이오마커에 대하여 상보적 염기서열의 cDNA 를 합성하는 단계와, 3) 상기 단계 2)의 cDNA를 PCR을 통해 증폭시키는 단계, 및 4)상기 단계 3)의 증폭된 산물을 증폭 전후로 비교 분석하여 상기 바이오마커를 확인하는 단계를 포함할 수 있다.As another feature of the present invention, the method of confirming the increase or decrease of gene expression after exposure to any one or more substances selected from the group consisting of ethylbenzene, toluene and xylene is 1) the group consisting of ethylbenzene, toluene, and xylene. Extracting total RNA (Total RNA) from the blood of an individual (experimental group) suspected of exposure to one or more substances selected from, and 2) from the total RNA of the experimental group and the control group according to step 1). Synthesis of cDNA of a base sequence complementary to the biomarker, 3) amplifying the cDNA of step 2) through PCR, and 4) comparing and analyzing the amplified product of step 3) before and after amplification It may include the step of checking the biomarker.
상기 바이오마커는 바람직하게는 서열번호 1, 서열번호 2, 서열번호 3, 서열번호 4 및 서열번호 5로 이루어지는 군 중에서 선택된 어느 하나 이상의 바이오마커 일 수 있다.The biomarker may be preferably any one or more biomarkers selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.
상기 혈액의 수득 방법은 특별히 제한되는 것은 아니지만, 실험군의 혈액 수득 방법은 바람직하게는 상기 휘발성 유기화합물을 취급하는 근로 현장 등에서 수득 된 것일 수 있다. The method of obtaining the blood is not particularly limited, but the method of obtaining the blood of the experimental group may preferably be one obtained at a work site or the like that handles the volatile organic compound.
상기 RNA를 cDNA 로의 합성은 당업계에 적용되는 공지의 모든 방법에 의해 합성될 수 있으며, 바람직하게는 역전사효소에 의해 합성 될 수 있다. Synthesis of the RNA into cDNA can be synthesized by any method known in the art, preferably by reverse transcriptase.
상기 PCR의 조건은 상기 cDNA 를 효과적으로 증폭할 수 있는 범위 이내라면 특별히 제한되지 않으며, 당업계에 적용되는 PCR의 조건이 모두 포함될 수 있으나, 바람직하게는 정량적 분석을 위해 실시간 RT-PCR인 것이 바람직하다. The conditions of the PCR are not particularly limited as long as they are within the range in which the cDNA can be effectively amplified, and all conditions of PCR applied in the art may be included, but it is preferable that real-time RT-PCR is preferably used for quantitative analysis. .
상기 분석은 당업계에 적용되는 모든 유전자 분석 방법을 사용할 수 있으며, 바람직하게는 당업계에 알려진 분석 소프트웨어를 사용할 수 있다. For the analysis, any gene analysis method applied in the art may be used, and preferably, analysis software known in the art may be used.
상기 바이오마커를 확인하는 단계는 바람직하게는 상기 PCR에 의해 증폭된 산물의 증폭 전후를 비교하여 유전자의 발현량이 유의하게 변화한 내용을 가지고 상기 바이오마커를 확인할 수 있다.
In the step of identifying the biomarker, preferably, the biomarker can be identified with the content of a significant change in the expression level of the gene by comparing before and after amplification of the product amplified by the PCR.
본 발명의 또 다른 특징으로서 바람직하게는 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질에 대한 유전자의 메틸레이션 여부를 확인하는 방법은 1) 바람직하게는 에틸벤젠, 톨루엔 및 자일렌으로 이루어지는 군 중에서 선택된 어느 하나 이상의 물질에 대한 노출이 의심되는 개체(실험군)의 혈액 및 대조군의 혈액으로부터 DNA를 추출하는 단계와, 2) 상기 단계 1)의 DNA를 메틸레이션 여부 확인용 프라이머를 이용해 PCR을 수행하는 단계, 및 3)상기 단계 2)의 PCR 결과를 통해 메틸레이션 여부를 비교 분석하여 상기 바이오마커를 확인하는 단계를 포함할 수 있다. As another feature of the present invention, a method for determining whether a gene is methylated for at least one substance selected from the group consisting of ethylbenzene, toluene, and xylene is preferably 1) preferably ethylbenzene, toluene, and xylene. Extracting DNA from the blood of an individual (experimental group) suspected of exposure to one or more substances selected from the group consisting of, and the blood of the control group, and 2) using a primer for checking whether the DNA of step 1) is methylated. Performing PCR, and 3) comparing and analyzing whether methylation through the PCR result of step 2), and confirming the biomarker.
상기 바이오마커는 바람직하게는 상기 서열번호 6, 서열번호 7, 서열번호 8, 서열번호 9 및 서열번호 10로 이루어지는 군 중에서 선택된 어느 하나 이상의 바이오마커일 수 있다. The biomarker may preferably be any one or more biomarkers selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
상기 혈액의 수득 방법은 특별히 제한되는 것은 아니지만, 실험군의 혈액 수득 방법은 바람직하게는 상기 휘발성 유기화합물을 취급하는 근로 현장 등에서 수득 된 것일 수 있다. The method of obtaining the blood is not particularly limited, but the method of obtaining the blood of the experimental group may preferably be one obtained at a work site or the like that handles the volatile organic compound.
상기 PCR의 조건은 상기 DNA 를 효과적으로 증폭할 수 있는 범위 이내라면 특별히 제한되지 않으며, 당업계에 적용되는 PCR의 조건이 모두 포함될 수 있으나, 바람직하게는 메틸레이션 특이 PCR(MSP, Methylation specific PCR)일 수 있다.The PCR conditions are not particularly limited as long as they are within a range that can effectively amplify the DNA, and all conditions of PCR applied in the art may be included, but preferably methylation specific PCR (MSP). I can.
상기 분석은 당업계에 적용되는 모든 유전자 분석 방법을 사용할 수 있으며, 바람직하게는 당업계에 알려진 분석 소프트웨어를 사용할 수 있다.
For the analysis, any gene analysis method applied in the art may be used, and preferably, analysis software known in the art may be used.
이하 본 발명을 바람직한 실시예를 참고로 하여 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 상세히 설명한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to preferred embodiments so that those of ordinary skill in the art can easily implement the present invention. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.
실시예Example
< 실시예 1: 특정 휘발성 유기화합물에 특이하게 발현하는 마이크로 RNA바이 오마커 확인> < Example 1: Identification of micro RNA biomarkers specifically expressed in specific volatile organic compounds>
(1)(One) cDNAcDNA 제작 making
에틸벤젠, 톨루엔 또는 자일렌의 휘발성 유기화합물을 취급하고 있으며, 이에 각각 노출된 공장 등 산업현장의 근로자들로부터 혈액을 채취하였다. 그리고 각 노출된 물질별로 샘플을 구분하였다. 그리고 각 샘플의 전체 RNA(Total RNA)를 추출하였다. 추출된 토탈 RNA는 TaqMan MicroRNA Reverse Transcription Kit (ABI, Applied Biosystems, USA)를 사용하여 cDNA를 합성하였다. 실험과정은 100mM dNTPs 0.15 ul, Multi Reverse Transcriptase 1ul (50U/ul), 10X buffer 1.5 ul, RNase Inhibitor 0.19 ul, Nuclase-free water 4.16 ul를 섞어서 Maser mix를 제조하였다. 제조한 master mix 7ul 에 primer 3ul, Total RNA 5ul를 첨가하여 얼음에 5분간 방치하여 둔 후, 16℃에서 30분, 42℃ 30분간 cDNA를 합성한 후, 85℃에서 5분간 반응하여 cDNA합성을 종료 시켰다. 이러한 cDNA 합성 조건을 하기 표 1에 나타냈다.
It handles volatile organic compounds such as ethylbenzene, toluene or xylene, and blood was collected from workers in industrial sites such as factories exposed to them. In addition, samples were classified for each exposed material. And total RNA (Total RNA) of each sample was extracted. The extracted total RNA was cDNA synthesized using TaqMan MicroRNA Reverse Transcription Kit (ABI, Applied Biosystems, USA). In the experiment, a Maser mix was prepared by mixing 0.15 ul of 100mM dNTPs, 1 ul of Multi Reverse Transcriptase (50U/ul), 1.5 ul of 10X buffer, 0.19 ul of RNase Inhibitor, and 4.16 ul of Nuclase-free water. After adding 3ul of primer and 5ul of total RNA to 7ul of the prepared master mix and leaving it on ice for 5 minutes, cDNA was synthesized at 16℃ for 30 minutes and 42℃ for 30 minutes, and then reacted at 85℃ for 5 minutes to synthesize cDNA. I ended it. These cDNA synthesis conditions are shown in Table 1 below.
(2)(2) 실시간 real time RTRT -- PCRPCR 의 수행Perform of
전 단계에서 합성한 cDNA와 주문 제작한 태크맨 프로브(Taqman probe)를 사용하여 실시간 RT-PCR을 수행하였다. 이러한 실시간 RT-PCR의 수행을 수행한 이유는 발현되는 유전자를 정량적으로 분석하기 위함이다. 이의 구체적인 조건은 하기 표 2에 나타냈다.
Real-time RT-PCR was performed using the cDNA synthesized in the previous step and a custom-made Taqman probe. The reason for performing such real-time RT-PCR is to quantitatively analyze the expressed gene. The specific conditions thereof are shown in Table 2 below.
이러한 실시간 RT-PCR을 수행한 후 상기 휘발성 유기화합물인 에틸벤젠, 톨루엔 또는 자일렌을 처리함에 따라 유전자의 발현이 변화하는 5개의 마이크로RNA를 확인하였다. 이러한 5개의 마이크로RNA는 각각 miR-142-5p, miR-19a, miR-210, miR-320b, miR-424-5p라고 명명하였다. 또한 각각의 유전자 발현 양상을 측정한 결과는 하기 도 1에 나타냈다.
After performing such real-time RT-PCR, five microRNAs whose gene expression was changed by treatment with the volatile organic compounds ethylbenzene, toluene, or xylene were identified. These five microRNAs were designated as miR-142-5p, miR-19a, miR-210, miR-320b, and miR-424-5p, respectively. In addition, the results of measuring the expression patterns of each gene are shown in FIG. 1 below.
상기 도 1에서 확인할 수 있는 바와 같이 miR-142-5p의 유전자 발현 양상은 에틸벤젠, 톨루엔 및 자일렌 모두에서 그 발현 양상이 변화하며, 특히 세가지 휘발성 유기화합물 모두에 노출되면 그 발현양이 감소하는 것임을 확인할 수 있었다. 또한 miR-19a의 경우에도 세가지 휘발성 유기화합물에 모두 유전자의 발현량이 감소하는 것으로 확인되었다. 또한 miR-210의 경우에는 톨루엔의 노출시 그 발현양이 증가하는 것으로 확인되었다. 또한 miR-320b의 경우에는 자일렌의 노출시 그 발현양이 증가하는 것으로 확인되었다. 또한 miR-424-5p의 경우에는 에틸벤젠에 노출시 그 발현양이 감소하는 것으로 확인되었다. 그러므로 miR-142-5p과 miR-19a의 경우에는 에틸벤젠, 톨루엔 및 자일렌에 대한 바이오마커로서 활용 가능함을 확인하였으며, miR-210의 경우에는 톨루엔에 대한 바이오마커로서 활용가능함을 확인하였다. 또한, miR-320b의 경우에는 자일렌에 대한 바이오마커로서 활용가능함을 확인하였고, miR-424-5p의 경우에는 에틸벤젠에 대하여 바이오마커로서 활용가능함을 확인하였다. As can be seen in FIG. 1, the expression pattern of miR-142-5p changes in all of ethylbenzene, toluene, and xylene, and in particular, when exposed to all three volatile organic compounds, the amount of expression decreases. I was able to confirm that it was. In addition, in the case of miR-19a, it was confirmed that the expression level of genes in all three volatile organic compounds decreased. In addition, in the case of miR-210, it was confirmed that the amount of expression increased upon exposure to toluene. In addition, in the case of miR-320b, it was confirmed that the amount of expression increased upon xylene exposure. In addition, in the case of miR-424-5p, it was confirmed that the amount of expression decreased when exposed to ethylbenzene. Therefore, it was confirmed that miR-142-5p and miR-19a can be used as biomarkers for ethylbenzene, toluene, and xylene, and in the case of miR-210, it was confirmed that they can be used as biomarkers for toluene. In addition, in the case of miR-320b, it was confirmed that it can be used as a biomarker for xylene, and in the case of miR-424-5p, it was confirmed that it can be used as a biomarker for ethylbenzene.
이러한 각각의 마이크로 RNA는 본원출원에서, miR-142-5p는 서열번호 1로 표시되며, miR-19a는 서열번호 2로 표시되며, miR-210는 서열번호 3으로 표시되며, miR-320b는 서열번호 4로 표시되며, miR-424-5p는 서열번호 5로 표시된다.
In this application, each of these microRNAs is represented by SEQ ID NO: 1, miR-19a is represented by SEQ ID NO: 2, miR-210 is represented by SEQ ID NO: 3, and miR-320b is represented by SEQ ID NO: It is represented by number 4, and miR-424-5p is represented by SEQ ID NO: 5.
< 실시예 2: 특정 휘발성 유기화합물에 특이하게 발현하는 메틸레이션 DNA바 이오마커 확인> <Example 2: methylation which specifically expressed in certain VOCs DNA biomarker confirmation>
(1)(One) DNADNA 컨버젼( Conversion ( conversionconversion ))
에틸 벤젠, 톨루엔 또는 자일렌에 노출된 각각의 혈액 샘플에서 추출한 DNA는 EpiTect Bisulfite conversion Kit (Qiagen, USA)를 사용하여 bisulfite conversion 및 cleanup을 수행하였다. DNA 20 ul (1 ug), bisulfite mix 85 ul, DNA protect buffer 35 ul를 섞어 mixture 140 ul를 만들어 95℃ 5분, 60℃ 25분, 95℃ 5분, 60℃ 85분, 95℃ 5분, 60℃ 175분(Denaturation과 Incubation의 반복) 반응하여 컨버젼(conversion)을 종료하고 컬럼을 사용하여 클린업(cleanup) 하였다.
DNA extracted from each blood sample exposed to ethyl benzene, toluene or xylene was subjected to bisulfite conversion and cleanup using the EpiTect Bisulfite Conversion Kit (Qiagen, USA). Mix 20 ul (1 ug) of DNA, 85 ul of bisulfite mix, and 35 ul of DNA protect buffer to make 140 ul of mixture. 95℃ 5min, 60℃ 25min, 95℃ 5min, 60℃ 85min, 95℃ 5min, Conversion was terminated by reaction at 60° C. for 175 minutes (repetition of denaturation and incubation), and cleanup was performed using a column.
(2)(2) 메틸레이션Methylation 특이 singularity PCRPCR (( MSPMSP , , MethylationMethylation SpecificSpecific PCRPCR )의 수행Of)
전 단계에서 준비된 컨버젼(conversion) DNA와 주문 제작한 프라이머를 사용하여 메틸레이션 특이 PCR을 수행하였다. 각 프라이머 마다 annealing 온도가 달라 다른 조건은 동일하되, 프라이머 간 annealing 온도만을 변화시켜주며 PCR을 진행하였다. 본 PCR의 조건을 하기 표 3에 나타냈다.
Methylation-specific PCR was performed using the conversion DNA prepared in the previous step and custom-made primers. The annealing temperature was different for each primer, and the other conditions were the same, but PCR was performed by changing only the annealing temperature between primers. The conditions of this PCR are shown in Table 3 below.
본 PCR 결과 에틸벤젠, 톨루엔 또는 자일렌과 같은 휘발성 유기화합물에 노출된 후 그 발현 양상이 변화하는 5가지의 메틸레이션 DNA를 확인하였다. 이는 각각 FAM173A(family with sequence similarity 173, member A), HSPB7(heat shock 27kDa protein family, member 7), ISG15 (ISG15 ubiquitin-like modifier), MYADM (myeloid-associated differentiation marker), ZC3H3(zinc finger CCCH-type containing 3)로 명명하였다. 그리고 이러한 PCR의 결과는 하기 도 2 내지 도 6에 나타냈다.
As a result of this PCR, five methylated DNAs were identified whose expression patterns changed after exposure to volatile organic compounds such as ethylbenzene, toluene, or xylene. These are FAM173A (family with sequence similarity 173, member A), HSPB7 (heat shock 27kDa protein family, member 7), ISG15 (ISG15 ubiquitin-like modifier), MYADM (myeloid-associated differentiation marker), ZC3H3 (zinc finger CCCH- It was named as type containing 3). And the results of this PCR are shown in FIGS. 2 to 6 below.
상기 도 2 내지 도 6에서 M size는 메틸레이션 DNA의 사이즈를 말하며, U size는 메틸레이션 되지 않은 DNA(unmethylation DNA)의 사이즈를 의미한다. 즉, M은 메틸레이션 DNA를 의미하며, U는 메틸레이션 되지 않은 DNA(unmethylation DNA)를 의미한다. 또한 도 2 내지 도 6에서 ‘con’ 및 ‘Ctrl’은 ‘control’의 약어로서 어떠한 휘발성 유기화합물도 처리 하지 않은 혈액 샘플의 대조군을 의미한다. 이러한 PCR의 결과는 DNA 아가로스 젤 상에서 전기영동을 하여 나타나는 밴드의 두께를 비교하여 확인하였다. In FIGS. 2 to 6, M size refers to the size of methylated DNA, and U size refers to the size of unmethylated DNA (unmethylation DNA). That is, M stands for methylated DNA, and U stands for unmethylated DNA. In addition, in FIGS. 2 to 6,'con' and'Ctrl' are abbreviations for'control' and refer to a control group of blood samples that have not been treated with any volatile organic compounds. The results of this PCR were confirmed by comparing the thickness of the bands shown by electrophoresis on a DNA agarose gel.
상기 도 2에서 확인할 수 있는 바와 같이 FAM173A는 자일렌에 노출된 메티레이션 DNA의 경우 그 두께가 대조군에 비해 가늘어지며 흐릿해짐을 확인할 수 있어 그 발현 양상이 변화함을 확인할 수 있다. 또한 대조군 대비 실험군의 시료에서 메틸레이션의 활성이 어느 정도인지를 메틸레이션 마이크로어레이 결과를 바탕으로 계산하였다. 그리하여 그 측정값이 대조군의 경우 25%를 보이지만, 자일렌에 노출된 메틸레이션 DNA 경우 100%의 측정값을 나타내 유의한 변화를 보이는 것을 확인할 수 있었다. As can be seen in FIG. 2, in the case of the metathesis DNA exposed to xylene, it can be confirmed that the thickness of FAM173A is thinner and blurred compared to the control group, so that the expression pattern thereof is changed. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value was 25% in the case of the control group, but it was confirmed that the methylation DNA exposed to xylene exhibited a measured value of 100%, showing a significant change.
또한 상기 도 3에서 확인할 수 있는 바와 같이 HSPB7의 경우 톨루엔에 노출시 대조군에 비해 그 밴드 두께가 두꺼워짐을 확인하였다. 또한 대조군 대비 실험군의 시료에서 메틸레이션의 활성이 어느 정도인지를 메틸레이션 마이크로어레이 결과를 바탕으로 계산하였다. 그리하여 그 측정값이 대조군의 경우 100%를 보이지만, 톨루엔에 노출된 메틸레이션 DNA의 경우 90%의 측정값을 나타내 유의한 변화를 보이는 것을 확인할 수 있었다. In addition, as can be seen in FIG. 3, in the case of HSPB7, when exposed to toluene, it was confirmed that the band thickness became thicker than the control group. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value was 100% in the case of the control group, but it was confirmed that the methylated DNA exposed to toluene exhibited a measurement value of 90%, indicating a significant change.
또한 상기 도 4에서 확인할 수 있는 바와 같이 ISG15의 경우 에틸벤젠, 톨루엔 및 자일렌에 노출된 경우 모두에 있어서 대조군과 비교하여 그 밴드 두께가 달라짐을 확인할 수 있었다. 또한 대조군 대비 실험군의 시료에서 메틸레이션의 활성이 어느 정도인지를 메틸레이션 마이크로어레이 결과를 바탕으로 계산하였다. 그리하여 그 측정값이 대조군의 경우 83.33333%를 보임에 반하여, 에틸벤젠에 노출된 메틸레이션 DNA의 경우 14.28571%의 측정값을 나타내며, 톨루엔에 노출된 경우는 60%의 측정값을 나타내고, 자일렌에 노출된 경우는 36.36364%를 나타내 각각 유의한 변화를 보임을 확인할 수 있었다. In addition, as can be seen in FIG. 4, in the case of ISG15, it was confirmed that the band thickness was changed compared to the control group in all cases of exposure to ethylbenzene, toluene, and xylene. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value was 83.33333% in the case of the control group, whereas the measured value was 14.28571% in the case of methylated DNA exposed to ethylbenzene, and 60% in the case of exposure to toluene. In the case of exposure, it was confirmed that 36.36364% was shown, respectively, showing a significant change.
또한 상기 도 5에서 확인할 수 있는 바와 같이 MYADM의 경우도 에틸벤젠, 톨루엔 및 자일렌에 노출된 경우 모두에 있어서 대조군과 비교하여 그 밴드 두께가 달라짐을 확인할 수 있었다. 또한 대조군 대비 실험군의 시료에서 메틸레이션의 활성이 어느 정도인지를 메틸레이션 마이크로어레이 결과를 바탕으로 계산하였다. 그리하여 그 측정값은 대조군의 경우 75%를 보임에 반하여, 에틸벤젠에 노출된 메틸레이션 DNA의 경우 14.28571%의 측정값을 나타내며, 톨루엔에 노출된 경우는 50%의 측정값을 나타내고, 자일렌에 노출된 경우는 18.18182%를 나타내 각각 유의한 변화를 보임을 확인할 수 있었다. In addition, as can be seen in FIG. 5, it was confirmed that the band thickness of MYADM was different compared to the control group in all cases of exposure to ethylbenzene, toluene, and xylene. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measurement value represents a measurement value of 14.28571% in the case of methylated DNA exposed to ethylbenzene, whereas the measurement value in the case of the control group shows 75%, and when exposed to toluene, the measurement value is 50%. In the case of exposure, 18.18182% was confirmed, indicating a significant change, respectively.
또한 상기 도 6에서 확인할 수 있는 바와 같이 ZC3H3의 경우도 에틸벤젠, 톨루엔 및 자일렌에 노출된 경우 모두에 있어서 대조군과 비교하여 그 밴드 두께가 달라짐을 확인할 수 있었다. 또한 대조군 대비 실험군의 시료에서 메틸레이션의 활성이 어느 정도인지를 메틸레이션 마이크로어레이 결과를 바탕으로 계산하였다. 그리하여 그 측정값은 대조군의 경우 100%를 보임에 반하여, 에틸벤젠에 노출된 메틸레이션 DNA의 경우 14.28571%의 측정값을 나타내며, 톨루엔에 노출된 경우는 30%의 측정값을 나타내고, 자일렌에 노출된 경우는 18.18182%를 나타내 각각 유의한 변화를 보임을 확인할 수 있었다. In addition, as can be seen in FIG. 6, in the case of ZC3H3 also when exposed to ethylbenzene, toluene, and xylene, it was confirmed that the band thickness was different compared to the control group. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value is 100% in the case of the control group, whereas the measured value is 14.28571% in the case of methylated DNA exposed to ethylbenzene, and the measured value is 30% when exposed to toluene. In the case of exposure, 18.18182% was confirmed, indicating a significant change, respectively.
그러므로 이러한 결과로 보아, FAM173A는 자일렌에 노출 여부를 진단할 수 있는 바이오마커로 활용 가능함을 확인하였고, HSPB7의 경우는 톨루엔에 노출 여부를 진단할 수 있는 바이오마커로 활용 가능함을 확인하였다. 또한 ISG15, MYADM, ZC3H3는 에틸벤젠, 톨루엔 및 자일렌 모두에 대한 노출 여부를 진단할 수 있는 바이오마커로 활용 가능함을 확인하였다. Therefore, from these results, it was confirmed that FAM173A can be used as a biomarker to diagnose whether exposure to xylene, and HSPB7 can be used as a biomarker to diagnose exposure to toluene. In addition, it was confirmed that ISG15, MYADM, and ZC3H3 can be used as biomarkers that can diagnose exposure to all of ethylbenzene, toluene, and xylene.
그리하여 바이오마커로 활용할 수 있는 상기 각각의 메틸레이션 DNA는 진뱅크(Genebank)에 등록하여 등록번호를 부여받았다. 그 등록번호는 각각 FAM173A는 NM_023933.1를, HSPB7는 NM_014424.4를, ISG15는 NM_005101.3를, MYADM는 NM_001020818.1를, ZC3H3는 NM_015117.2이다. Thus, each methylation DNA that can be used as a biomarker was registered with Genebank and given a registration number. The registration number is NM_023933.1 for FAM173A, NM_014424.4 for HSPB7, NM_005101.3 for ISG15, NM_001020818.1 for MYADM, and NM_015117.2 for ZC3H3.
이러한 각각의 마이크로 RNA는 본원출원에서, FAM173A(family with sequence similarity 173, member A)는 5’에서 3’방향의 염기서열이 서열번호 6으로 표시되며, HSPB7(heat shock 27kDa protein family, member 7)는 5’에서 3’방향의 염기서열이 서열번호 7로 표시되며, ISG15 (ISG15 ubiquitin-like modifier)는 5’에서 3’방향의 염기서열이 서열번호 8로 표시되며, MYADM (myeloid-associated differentiation marker)는 5’에서 3’방향의 염기서열이 서열번호 9로 표시되며, ZC3H3(zinc finger CCCH-type containing 3)는 5’에서 3’방향의 염기서열이 서열번호 10으로 표시된다.
In this application, each of these microRNAs is FAM173A (family with sequence similarity 173, member A), the nucleotide sequence in the 5'to 3'direction is represented by SEQ ID NO: 6, and HSPB7 (heat shock 27kDa protein family, member 7) Is represented by SEQ ID NO: 7 in the 5'to 3'direction, and ISG15 (ISG15 ubiquitin-like modifier) is represented by SEQ ID NO: 8 in the 5'to 3'direction, and MYADM (myeloid-associated differentiation marker), the nucleotide sequence in the 5'to 3'direction is represented by SEQ ID NO: 9, and in the ZC3H3 (zinc finger CCCH-type containing 3), the nucleotide sequence in the 5'to 3'direction is represented by SEQ ID NO: 10.
상기에서는 본 발명의 바람직한 실시예에 대하여 설명하였지만, 본 발명은 이에 한정되는 것은 아니고, 본 발명의 기술 사상 범위 내에서 여러 가지로 변형하여 실시하는 것이 가능하고, 이 또한 첨부된 특허 청구 범위에 속하는 것은 당연하다.
In the above, preferred embodiments of the present invention have been described, but the present invention is not limited thereto, and it is possible to implement various modifications within the scope of the technical spirit of the present invention, and this also belongs to the appended claims. It is natural.
<110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis of exposure to volatile organic compounds <130> HPC3424 <160> 10 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> RNA <213> Human <400> 1 agtagtgctt tctacttta 19 <210> 2 <211> 21 <212> RNA <213> Human <400> 2 tcagttttgc atagatttgc a 21 <210> 3 <211> 16 <212> RNA <213> Human <400> 3 tcagccgctg tcacac 16 <210> 4 <211> 15 <212> RNA <213> Human <400> 4 ttgccctctc aaccc 15 <210> 5 <211> 22 <212> RNA <213> Human <400> 5 ttcaaaacat gaattgctgc tg 22 <210> 6 <211> 21 <212> DNA <213> Human <400> 6 tcggtgttta taggtgttgg c 21 <210> 7 <211> 24 <212> DNA <213> Human <400> 7 tttaggagac gtttatgagt ttgc 24 <210> 8 <211> 24 <212> DNA <213> Human <400> 8 tttgttagtt agggtttggg tttc 24 <210> 9 <211> 25 <212> DNA <213> Human <400> 9 ttgagattag tttggttaat atggc 25 <210> 10 <211> 27 <212> DNA <213> Human <400> 10 taagtgttta gttgggagag ttgtaac 27 <110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis of exposure to volatile organic compounds <130> HPC3424 <160> 10 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> RNA <213> Human <400> 1 agtagtgctt tctacttta 19 <210> 2 <211> 21 <212> RNA <213> Human <400> 2 tcagttttgc atagatttgc a 21 <210> 3 <211> 16 <212> RNA <213> Human <400> 3 tcagccgctg tcacac 16 <210> 4 <211> 15 <212> RNA <213> Human <400> 4 ttgccctctc aaccc 15 <210> 5 <211> 22 <212> RNA <213> Human <400> 5 ttcaaaacat gaattgctgc tg 22 <210> 6 <211> 21 <212> DNA <213> Human <400> 6 tcggtgttta taggtgttgg c 21 <210> 7 <211> 24 <212> DNA <213> Human <400> 7 tttaggagac gtttatgagt ttgc 24 <210> 8 <211> 24 <212> DNA <213> Human <400> 8 tttgttagtt agggtttggg tttc 24 <210> 9 <211> 25 <212> DNA <213> Human <400> 9 ttgagattag tttggttaat atggc 25 <210> 10 <211> 27 <212> DNA <213> Human <400> 10 taagtgttta gttgggagag ttgtaac 27
Claims (3)
A biomarker composition for diagnosing exposure to toluene comprising the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 7 and their respective complementary base sequences.
2) 상기 단계 1)에 따른 실험군 및 대조군의 전체 RNA로부터 서열번호 3인 바이오마커에 대하여 상보적 염기서열을 갖는 cDNA를 합성하는 단계;
3) 상기 단계 2)의 cDNA를 PCR을 통해 증폭시키는 단계; 및
4) 상기 단계 3)의 증폭된 산물을 증폭 전후로 비교 분석하여 서열번호 3인 바이오마커를 확인하는 단계;
를 포함하는 톨루엔에 대한 유전자 발현의 증가 또는 감소를 확인하는 방법.
1) extracting total RNA from the blood of the experimental group and the control group;
2) synthesizing a cDNA having a complementary base sequence to the biomarker of SEQ ID NO: 3 from the total RNA of the experimental group and the control group according to the step 1);
3) amplifying the cDNA of step 2) by PCR; And
4) confirming the biomarker of SEQ ID NO: 3 by comparing and analyzing the amplified product of step 3) before and after amplification;
≪ RTI ID = 0.0 > and / or < / RTI >
2) 상기 단계 1)의 DNA를 메틸레이션 여부 확인용 프라이머를 이용해 PCR을 수행하는 단계; 및
3) 상기 단계 2)의 PCR 결과를 통해 메틸레이션 여부를 비교 분석하여 서열번호 7인 바이오마커를 확인하는 단계;
를 포함하는 톨루엔에 대한 유전자의 메틸레이션 여부를 확인하는 방법.
1) extracting DNA from the blood of the experimental group and the control group;
2) performing PCR using the primer for confirming methylation of the DNA of step 1); And
3) confirming the biomarker of SEQ ID NO: 7 by comparatively analyzing the methylation through the PCR result of the step 2);
To determine whether methylation of the gene to toluene is included.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140111558A KR101504136B1 (en) | 2014-08-26 | 2014-08-26 | Biomarker composition for diagnosis of exposure to volatile organic compounds |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140111558A KR101504136B1 (en) | 2014-08-26 | 2014-08-26 | Biomarker composition for diagnosis of exposure to volatile organic compounds |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120087441A Division KR101499094B1 (en) | 2012-08-09 | 2012-08-09 | Biomarker for diagnosis of exposure to volatile organic compounds |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20140111241A KR20140111241A (en) | 2014-09-18 |
KR101504136B1 true KR101504136B1 (en) | 2015-03-19 |
Family
ID=51756838
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020140111558A KR101504136B1 (en) | 2014-08-26 | 2014-08-26 | Biomarker composition for diagnosis of exposure to volatile organic compounds |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101504136B1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140008539A (en) * | 2012-06-22 | 2014-01-22 | 한국과학기술연구원 | Micrornas for identification of human exposure to toluene and the method of identification using thereof |
KR20140110550A (en) * | 2013-03-08 | 2014-09-17 | 한국과학기술연구원 | Methylation marker for identification of exposure to toluene and the method of identification using thereof |
-
2014
- 2014-08-26 KR KR1020140111558A patent/KR101504136B1/en active IP Right Grant
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140008539A (en) * | 2012-06-22 | 2014-01-22 | 한국과학기술연구원 | Micrornas for identification of human exposure to toluene and the method of identification using thereof |
KR20140110550A (en) * | 2013-03-08 | 2014-09-17 | 한국과학기술연구원 | Methylation marker for identification of exposure to toluene and the method of identification using thereof |
Non-Patent Citations (1)
Title |
---|
Environ. Toxicol., DOI 10.1002/tox.21795, pp. 1-11 (온라인 공개일: 2012.07.30.) * |
Also Published As
Publication number | Publication date |
---|---|
KR20140111241A (en) | 2014-09-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Hong et al. | DNA methylation-based age prediction from saliva: High age predictability by combination of 7 CpG markers | |
KR101562644B1 (en) | Prognosis prediction for colorectal cancer | |
Ravo et al. | Quantitative expression profiling of highly degraded RNA from formalin-fixed, paraffin-embedded breast tumor biopsies by oligonucleotide microarrays | |
Brettell et al. | Forensic science | |
Jiménez-Garza et al. | Aberrant promoter methylation in genes related to hematopoietic malignancy in workers exposed to a VOC mixture | |
CN108474033A (en) | From the evaluation method of the quality of the miRNA of body fluid | |
Alghanim et al. | DNA methylation assay based on pyrosequencing for determination of smoking status | |
Li et al. | Multiplex PCR coupled with direct amplicon sequencing for simultaneous detection of numerous waterborne pathogens | |
Brettell et al. | Forensic science | |
KR101504136B1 (en) | Biomarker composition for diagnosis of exposure to volatile organic compounds | |
KR101504134B1 (en) | Biomarker composition for diagnosis of exposure to volatile organic compounds | |
KR101567841B1 (en) | Biomarker for detecting volatile organic compounds and method for detecting volatile organic compounds using the same | |
US20180371523A1 (en) | Methods and materials for detecting rna sequences | |
KR20150009506A (en) | Biomarker Composition for diagnosis of exposure to volatile organic compounds | |
KR101499094B1 (en) | Biomarker for diagnosis of exposure to volatile organic compounds | |
KR101460529B1 (en) | Methylation marker for identification of exposure to toluene and the method of identification using thereof | |
Liang et al. | A combination of mitochondrial DNA markers Ckmito and ND5-CD is recommended as the most reliable indicator for microbial source tracking to identify faecal pollution from poultry in China | |
KR101079714B1 (en) | Specific biomarker for identification of genes after human exposure to toluene and the method of identification using thereof | |
McCord et al. | Applications of epigenetic methylation in body fluid identification, age determination and phenotyping | |
Song et al. | Gene expression analysis identifies potential biomarkers of phenanthrene in human hepatocytes (HepG2) | |
KR101735415B1 (en) | Methylation marker for identification of exposure to hexanal and the method of identification using thereof | |
An et al. | Identification of genetic/epigenetic biomarkers for supporting decision of VOCs exposure | |
KR20180068723A (en) | Methylation marker for identifying of exposure to particulate matter 2.5 and the identification method using thereof | |
CN109593835B (en) | Method, kit and application for evaluating trace FFPE RNA sample | |
KR101018788B1 (en) | Biomarker for identification of exposure to chlordane and the method of identification using thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A107 | Divisional application of patent | ||
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20180108 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20190304 Year of fee payment: 5 |