KR101504136B1 - Biomarker composition for diagnosis of exposure to volatile organic compounds - Google Patents

Abstract

It is a biomarker for the detection of exposure to volatile organic compounds.
The biomarker according to the present invention has an effect of diagnosing exposure to a specific volatile organic compound such as ethylbenzene, toluene and xylene. Thus, it is possible to directly determine whether the biomarker is exposed after exposure to the specific concentration of the volatile organic compound through the biomarker.

Description

Biomarker composition for diagnosis of exposure to volatile organic compounds}

The present invention relates to a biomarker, and more particularly, to a biomarker for diagnosis of exposure to volatile organic compounds.

Volatile Organic Compounds (VOCs) are a generic term for liquid or gaseous organic compounds that are easily evaporated into the atmosphere due to their high vapor pressure.When they coexist with nitrogen oxides in the atmosphere, they cause photochemical reactions due to the action of sunlight, causing ozone and pan (PAN: Peroxyacetyl nitrate) and other substances that cause photochemical smog by generating photochemical oxidizing substances are collectively referred to. It is an air pollutant and a toxic chemical with carcinogenicity, and is also a precursor to photochemical oxides. It is also a source of global warming and may cause odor. Therefore, each country is managing it in a policy to reduce emissions.

In addition, volatile organic compounds are carcinogens that cause disorders in the nervous system through skin contact or respiratory inhalation. In most cases, these volatile organic compounds cause odor even at low concentrations, and they are directly harmful to the environment and human body, or they participate in photochemical reactions in the atmosphere to generate secondary pollutants such as photochemical oxides.

Among these volatile organic compounds, ethylbenzene (Ethylbenzene) is an important aromatic hydrocarbon used as an intermediate material to produce styrene in the petrochemical industry, and toluene (Toluene) is a colorless liquid. It is produced by rectification or by dehydrogenation of methylcyclohexane and is an important compound in organic synthetic chemistry. In addition, xylene is a compound mainly used as a solvent in the printing, rubber, and leather industries.

On the other hand, in recent years, as environmental pollution caused by rapid industrialization becomes serious, an effective analysis system is needed to identify and analyze the dangers of very trace amounts of environmentally harmful substances early. In particular, environmentally hazardous substances in the form of long-term accumulation at low concentrations. Assessment of human health damage caused by exposure is emerging as a very important environmental technology. Rather than relying on the results of toxicity tests conducted at high doses in the past, recent hazard evaluation techniques focus on the identification of low-dose exposure effects that can reflect the level of human exposure in a realistic living environment, and no adverse effects from low-dose exposure appear. The need to develop a method of setting management standards in consideration of the level is emerging.

The development of this method should precede the development of biomarkers. However, there is a problem in the reality that the development of biomarkers capable of effectively diagnosing exposure of low-concentration volatile organic compounds is insufficient.

In addition, efforts to utilize microRNA, which plays an important role in regulating gene expression in eukaryotes, and methylation DNA, which are important for regulating cancer incidence, as biomarkers, are currently lacking. .

The present invention has been devised to solve the above-described problems, and an object of the present invention is to provide a biomarker for diagnosing exposure to volatile organic compounds. In addition, it is to provide a method of confirming exposure to volatile organic compounds using the biomarker.

The biomarker according to one feature of the present invention for solving the above problems is any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 It is a biomarker for diagnosing exposure to ethylbenzene containing and their respective complementary nucleotide sequences.

The biomarker according to another feature of the present invention includes any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: It is a biomarker for diagnosis of exposure to toluene containing each complementary nucleotide sequence.

The biomarker according to another feature of the present invention includes any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: It is a biomarker for diagnosis of exposure to xylene containing each complementary nucleotide sequence.

A method for confirming the increase or decrease in gene expression according to another feature of the present invention includes the steps of: 1) extracting microRNAs from the blood of the experimental group and the control group, and 2) microRNAs of the experimental group and the control group according to step 1). Synthesis of cDNA of a complementary nucleotide sequence, 3) amplifying the cDNA of step 2) through PCR, and 4) comparing and analyzing the amplified product of step 3) before and after amplification to confirm the biomarker It is a method of confirming an increase or decrease in gene expression for any one or more substances selected from the group consisting of ethylbenzene, toluene, and xylene including the step of.

In addition, the biomarker is characterized in that any one or more biomarkers selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

According to another feature of the present invention, a method of checking whether a gene is methylated is 1) extracting DNA from the blood of the test group and the control group, and 2) using a primer for checking whether the DNA of step 1) is methylated. Any one or more selected from the group consisting of ethylbenzene, toluene and xylene comprising the step of performing PCR, and 3) comparing and analyzing whether methylation through the PCR result of step 2) and confirming the biomarker. This is a method to check whether a gene is methylated to a substance.

In addition, the biomarker is characterized in that any one or more biomarkers selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.

The biomarker according to the present invention is effective in diagnosing exposure to specific volatile organic compounds. Thus, even after exposure to a low concentration of a specific volatile organic compound through the biomarker, it is possible to directly determine whether or not it is exposed.

1 is a graph showing changes in gene expression of micro RNA biomarkers according to SEQ ID NOs: 1 to 5 according to the present invention after exposure to volatile organic compounds.
2 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 6 according to the present invention after exposure to a volatile organic compound as a band.
3 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 7 according to the present invention after exposure to a volatile organic compound as a band.
4 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 8 according to the present invention after exposure to a volatile organic compound as a band.
5 is an agarose gel photograph showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 9 according to the present invention after exposure to a volatile organic compound as a band.
6 is a photo of an agarose gel showing changes in gene expression of the methylated DNA biomarker according to SEQ ID NO: 10 according to the present invention after exposure to a volatile organic compound.

Accordingly, the present inventors completed the present invention by discovering the biomarker according to the present invention as a result of intensive research efforts to develop a biomarker for diagnosis of exposure to a specific volatile organic compound.

Specifically, the biomarker according to the present invention may preferably include any one or more nucleotide sequences selected from the following SEQ ID NO: 1 to SEQ ID NO: 10, and may be a biomarker for diagnosis of exposure to a specific volatile organic compound.

SEQ ID NO: 1: AGTAGTGCTTTCTACTTTA

SEQ ID NO: 2: TCAGTTTTGCATAGATTTGCA

SEQ ID NO: 3; TCAGCCGCTGTCACAC

SEQ ID NO: 4: TTGCCCTCTCAACCC

SEQ ID NO: 5: TTCAAAACATGAATTGCTGCTG

SEQ ID NO: 6: TCGGTGTTTATAGGTGTTGGC

SEQ ID NO: 7: TTTAGGAGACGTTTATGAGTTTGC

SEQ ID NO: 8: TTTGTTAGTTAGGGTTTGGGTTTC

SEQ ID NO: 9: TTGAGATTAGTTTGGTTAATATGGC

SEQ ID NO: 10: TAAGTGTTTAGTTGGGAGAGTTGTAAC

In general, microRNA is important in regulating gene expression in eukaryotic cells, and methylated DNA is DNA in which CH3 is attached to a carbon atom of cytosine, and is important in regulating and suppressing the expression of cancer-expressing genes.

Meanwhile, the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 5 may preferably be a nucleotide sequence of micro RNA, and the nucleotide sequence of SEQ ID NO: 6 to SEQ ID NO: 10 may preferably be a nucleotide sequence of methylation DNA.

In addition, the nucleotide sequences of SEQ ID NOs: 6 to 10 are directed from the 5'end to the 3'end when proceeding from left to right, and a nucleotide sequence complementary to the nucleotide sequence may be double bonded.

In addition, the specific volatile organic compound may preferably be any one or more substances selected from the group consisting of ethylbenzene, toluene, and xylene.

In particular, the biomarker comprising any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is preferably the gene for ethylbenzene. Since the expression level of is changed, it may be a biomarker for diagnosis of exposure to ethylbenzene.

In addition, the biomarker including any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is preferably in toluene. On the other hand, since the expression level of the gene changes, it may be a biomarker for diagnosis of exposure to toluene.

In addition, the biomarker comprising any one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is preferably xylene Since the expression level of the gene changes with respect to, it may be a biomarker for diagnosis of exposure to xylene.

In addition, more specifically, the nucleotide sequence of SEQ ID NO: 1 is a biomarker having a nucleotide sequence of micro RNA, and since the amount of gene expression significantly decreases when exposed to ethylbenzene, xylene and toluene, ethylbenzene, xylene, and toluene It may be a biomarker for diagnosis of exposure to.

*In addition, the nucleotide sequence of SEQ ID NO: 2 is a biomarker having the nucleotide sequence of micro RNA, and since the expression level of the gene significantly decreases when exposed to ethylbenzene, xylene and toluene, exposure to ethylbenzene, xylene and toluene It may be a biomarker for diagnosis.

In addition, the nucleotide sequence of SEQ ID NO: 3 is a biomarker having the nucleotide sequence of micro RNA, and since the expression level of the gene increases significantly when exposed to toluene, it may be a biomarker for diagnosis of exposure to toluene.

In addition, the nucleotide sequence of SEQ ID NO: 4 is a biomarker having a nucleotide sequence of micro RNA, and since the expression level of the gene increases significantly when exposed to xylene, it may be a biomarker for diagnosis of exposure to xylene.

In addition, the nucleotide sequence of SEQ ID NO: 5 is a biomarker having a nucleotide sequence of micro RNA, and since the expression level of the gene is significantly reduced when exposed to ethylbenzene, it may be a biomarker for diagnosis of exposure to ethylbenzene.

In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 6 is a biomarker that is methylation DNA, and since the expression level of the gene changes significantly when exposed to xylene, it may be a biomarker for diagnosis of exposure to xylene.

*In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 7 is a biomarker that is methylation DNA, and since the expression level of the gene changes significantly when exposed to toluene, it may be a biomarker for diagnosis of exposure to toluene.

In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 7 is a biomarker that is methylation DNA, and since the expression level of the gene significantly changes when exposed to ethylbenzene, toluene, and xylene, it may be a biomarker for diagnosis of exposure to toluene. have.

In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 8 is a biomarker that is methylation DNA, and since the expression level of the gene significantly changes when exposed to ethylbenzene, toluene and xylene, exposure to ethylbenzene, toluene and xylene It may be a biomarker for diagnosis.

In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 9 is a biomarker that is methylation DNA, and since the amount of gene expression significantly changes when exposed to ethylbenzene, toluene and xylene, exposure to ethylbenzene, toluene and xylene It may be a biomarker for diagnosis.

In addition, the biomarker having the nucleotide sequence of SEQ ID NO: 10 is a biomarker that is methylation DNA, and since the amount of gene expression significantly changes when exposed to ethylbenzene, toluene and xylene, exposure to ethylbenzene, toluene and xylene It may be a biomarker for diagnosis.

Ethylbenzene is an important aromatic hydrocarbon used as an intermediate material for producing styrene in the petrochemical industry, and toluene is a colorless liquid. It is produced by dehydrogenating methylcyclohexane and is an important compound in organic synthetic chemistry.

In addition, xylene is a compound mainly used as a solvent in the printing, rubber, and leather industries. Ethylbenzene, toluene, and xylene are well known as substances that exert harmful effects even when accumulated in a small amount in the human body.

The biomarker is not particularly limited in the number and form of nucleotide sequences, but may be preferably 10 to 50 bp, more preferably 15 to 30 bp. In addition, the biomarker of the present invention may be added including not only the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 10, but preferably the entire nucleotide sequence of the biomarker, and the number of the nucleotide sequence is not limited, but the addition The total bp including the nucleotide sequence may preferably be 100 to 300 bp.

As another feature of the present invention, the method of confirming the increase or decrease of gene expression after exposure to any one or more substances selected from the group consisting of ethylbenzene, toluene and xylene is 1) the group consisting of ethylbenzene, toluene, and xylene. Extracting total RNA (Total RNA) from the blood of an individual (experimental group) suspected of exposure to one or more substances selected from, and 2) from the total RNA of the experimental group and the control group according to step 1). Synthesis of cDNA of a base sequence complementary to the biomarker, 3) amplifying the cDNA of step 2) through PCR, and 4) comparing and analyzing the amplified product of step 3) before and after amplification It may include the step of checking the biomarker.

The biomarker may be preferably any one or more biomarkers selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

The method of obtaining the blood is not particularly limited, but the method of obtaining the blood of the experimental group may preferably be one obtained at a work site or the like that handles the volatile organic compound.

Synthesis of the RNA into cDNA can be synthesized by any method known in the art, preferably by reverse transcriptase.

The conditions of the PCR are not particularly limited as long as they are within the range in which the cDNA can be effectively amplified, and all conditions of PCR applied in the art may be included, but it is preferable that real-time RT-PCR is preferably used for quantitative analysis. .

For the analysis, any gene analysis method applied in the art may be used, and preferably, analysis software known in the art may be used.

In the step of identifying the biomarker, preferably, the biomarker can be identified with the content of a significant change in the expression level of the gene by comparing before and after amplification of the product amplified by the PCR.

As another feature of the present invention, a method for determining whether a gene is methylated for at least one substance selected from the group consisting of ethylbenzene, toluene, and xylene is preferably 1) preferably ethylbenzene, toluene, and xylene. Extracting DNA from the blood of an individual (experimental group) suspected of exposure to one or more substances selected from the group consisting of, and the blood of the control group, and 2) using a primer for checking whether the DNA of step 1) is methylated. Performing PCR, and 3) comparing and analyzing whether methylation through the PCR result of step 2), and confirming the biomarker.

The biomarker may preferably be any one or more biomarkers selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.

The method of obtaining the blood is not particularly limited, but the method of obtaining the blood of the experimental group may preferably be one obtained at a work site or the like that handles the volatile organic compound.

The PCR conditions are not particularly limited as long as they are within a range that can effectively amplify the DNA, and all conditions of PCR applied in the art may be included, but preferably methylation specific PCR (MSP). I can.

For the analysis, any gene analysis method applied in the art may be used, and preferably, analysis software known in the art may be used.

Hereinafter, the present invention will be described in detail with reference to preferred embodiments so that those of ordinary skill in the art can easily implement the present invention. However, the present invention may be implemented in various different forms and is not limited to the embodiments described herein.

Example

< Example 1: Identification of micro RNA biomarkers specifically expressed in specific volatile organic compounds>

(One) cDNA making

It handles volatile organic compounds such as ethylbenzene, toluene or xylene, and blood was collected from workers in industrial sites such as factories exposed to them. In addition, samples were classified for each exposed material. And total RNA (Total RNA) of each sample was extracted. The extracted total RNA was cDNA synthesized using TaqMan MicroRNA Reverse Transcription Kit (ABI, Applied Biosystems, USA). In the experiment, a Maser mix was prepared by mixing 0.15 ul of 100mM dNTPs, 1 ul of Multi Reverse Transcriptase (50U/ul), 1.5 ul of 10X buffer, 0.19 ul of RNase Inhibitor, and 4.16 ul of Nuclase-free water. After adding 3ul of primer and 5ul of total RNA to 7ul of the prepared master mix and leaving it on ice for 5 minutes, cDNA was synthesized at 16℃ for 30 minutes and 42℃ for 30 minutes, and then reacted at 85℃ for 5 minutes to synthesize cDNA. I ended it. These cDNA synthesis conditions are shown in Table 1 below.

(2) real time RT - PCR Perform of

Real-time RT-PCR was performed using the cDNA synthesized in the previous step and a custom-made Taqman probe. The reason for performing such real-time RT-PCR is to quantitatively analyze the expressed gene. The specific conditions thereof are shown in Table 2 below.

After performing such real-time RT-PCR, five microRNAs whose gene expression was changed by treatment with the volatile organic compounds ethylbenzene, toluene, or xylene were identified. These five microRNAs were designated as miR-142-5p, miR-19a, miR-210, miR-320b, and miR-424-5p, respectively. In addition, the results of measuring the expression patterns of each gene are shown in FIG. 1 below.

As can be seen in FIG. 1, the expression pattern of miR-142-5p changes in all of ethylbenzene, toluene, and xylene, and in particular, when exposed to all three volatile organic compounds, the amount of expression decreases. I was able to confirm that it was. In addition, in the case of miR-19a, it was confirmed that the expression level of genes in all three volatile organic compounds decreased. In addition, in the case of miR-210, it was confirmed that the amount of expression increased upon exposure to toluene. In addition, in the case of miR-320b, it was confirmed that the amount of expression increased upon xylene exposure. In addition, in the case of miR-424-5p, it was confirmed that the amount of expression decreased when exposed to ethylbenzene. Therefore, it was confirmed that miR-142-5p and miR-19a can be used as biomarkers for ethylbenzene, toluene, and xylene, and in the case of miR-210, it was confirmed that they can be used as biomarkers for toluene. In addition, in the case of miR-320b, it was confirmed that it can be used as a biomarker for xylene, and in the case of miR-424-5p, it was confirmed that it can be used as a biomarker for ethylbenzene.

In this application, each of these microRNAs is represented by SEQ ID NO: 1, miR-19a is represented by SEQ ID NO: 2, miR-210 is represented by SEQ ID NO: 3, and miR-320b is represented by SEQ ID NO: It is represented by number 4, and miR-424-5p is represented by SEQ ID NO: 5.

<Example 2: methylation which specifically expressed in certain VOCs DNA biomarker confirmation>

(One) DNA Conversion ( conversion )

DNA extracted from each blood sample exposed to ethyl benzene, toluene or xylene was subjected to bisulfite conversion and cleanup using the EpiTect Bisulfite Conversion Kit (Qiagen, USA). Mix 20 ul (1 ug) of DNA, 85 ul of bisulfite mix, and 35 ul of DNA protect buffer to make 140 ul of mixture. 95℃ 5min, 60℃ 25min, 95℃ 5min, 60℃ 85min, 95℃ 5min, Conversion was terminated by reaction at 60° C. for 175 minutes (repetition of denaturation and incubation), and cleanup was performed using a column.

(2) Methylation singularity PCR ( MSP , Methylation Specific PCR Of)

Methylation-specific PCR was performed using the conversion DNA prepared in the previous step and custom-made primers. The annealing temperature was different for each primer, and the other conditions were the same, but PCR was performed by changing only the annealing temperature between primers. The conditions of this PCR are shown in Table 3 below.

As a result of this PCR, five methylated DNAs were identified whose expression patterns changed after exposure to volatile organic compounds such as ethylbenzene, toluene, or xylene. These are FAM173A (family with sequence similarity 173, member A), HSPB7 (heat shock 27kDa protein family, member 7), ISG15 (ISG15 ubiquitin-like modifier), MYADM (myeloid-associated differentiation marker), ZC3H3 (zinc finger CCCH- It was named as type containing 3). And the results of this PCR are shown in FIGS. 2 to 6 below.

In FIGS. 2 to 6, M size refers to the size of methylated DNA, and U size refers to the size of unmethylated DNA (unmethylation DNA). That is, M stands for methylated DNA, and U stands for unmethylated DNA. In addition, in FIGS. 2 to 6,'con' and'Ctrl' are abbreviations for'control' and refer to a control group of blood samples that have not been treated with any volatile organic compounds. The results of this PCR were confirmed by comparing the thickness of the bands shown by electrophoresis on a DNA agarose gel.

As can be seen in FIG. 2, in the case of the metathesis DNA exposed to xylene, it can be confirmed that the thickness of FAM173A is thinner and blurred compared to the control group, so that the expression pattern thereof is changed. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value was 25% in the case of the control group, but it was confirmed that the methylation DNA exposed to xylene exhibited a measured value of 100%, showing a significant change.

In addition, as can be seen in FIG. 3, in the case of HSPB7, when exposed to toluene, it was confirmed that the band thickness became thicker than the control group. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value was 100% in the case of the control group, but it was confirmed that the methylated DNA exposed to toluene exhibited a measurement value of 90%, indicating a significant change.

In addition, as can be seen in FIG. 4, in the case of ISG15, it was confirmed that the band thickness was changed compared to the control group in all cases of exposure to ethylbenzene, toluene, and xylene. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value was 83.33333% in the case of the control group, whereas the measured value was 14.28571% in the case of methylated DNA exposed to ethylbenzene, and 60% in the case of exposure to toluene. In the case of exposure, it was confirmed that 36.36364% was shown, respectively, showing a significant change.

In addition, as can be seen in FIG. 5, it was confirmed that the band thickness of MYADM was different compared to the control group in all cases of exposure to ethylbenzene, toluene, and xylene. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measurement value represents a measurement value of 14.28571% in the case of methylated DNA exposed to ethylbenzene, whereas the measurement value in the case of the control group shows 75%, and when exposed to toluene, the measurement value is 50%. In the case of exposure, 18.18182% was confirmed, indicating a significant change, respectively.

In addition, as can be seen in FIG. 6, in the case of ZC3H3 also when exposed to ethylbenzene, toluene, and xylene, it was confirmed that the band thickness was different compared to the control group. In addition, the degree of methylation activity in the samples of the experimental group compared to the control group was calculated based on the results of the methylation microarray. Thus, the measured value is 100% in the case of the control group, whereas the measured value is 14.28571% in the case of methylated DNA exposed to ethylbenzene, and the measured value is 30% when exposed to toluene. In the case of exposure, 18.18182% was confirmed, indicating a significant change, respectively.

Therefore, from these results, it was confirmed that FAM173A can be used as a biomarker to diagnose whether exposure to xylene, and HSPB7 can be used as a biomarker to diagnose exposure to toluene. In addition, it was confirmed that ISG15, MYADM, and ZC3H3 can be used as biomarkers that can diagnose exposure to all of ethylbenzene, toluene, and xylene.

Thus, each methylation DNA that can be used as a biomarker was registered with Genebank and given a registration number. The registration number is NM_023933.1 for FAM173A, NM_014424.4 for HSPB7, NM_005101.3 for ISG15, NM_001020818.1 for MYADM, and NM_015117.2 for ZC3H3.

In this application, each of these microRNAs is FAM173A (family with sequence similarity 173, member A), the nucleotide sequence in the 5'to 3'direction is represented by SEQ ID NO: 6, and HSPB7 (heat shock 27kDa protein family, member 7) Is represented by SEQ ID NO: 7 in the 5'to 3'direction, and ISG15 (ISG15 ubiquitin-like modifier) is represented by SEQ ID NO: 8 in the 5'to 3'direction, and MYADM (myeloid-associated differentiation marker), the nucleotide sequence in the 5'to 3'direction is represented by SEQ ID NO: 9, and in the ZC3H3 (zinc finger CCCH-type containing 3), the nucleotide sequence in the 5'to 3'direction is represented by SEQ ID NO: 10.

In the above, preferred embodiments of the present invention have been described, but the present invention is not limited thereto, and it is possible to implement various modifications within the scope of the technical spirit of the present invention, and this also belongs to the appended claims. It is natural.

<110> Industry-University Cooperation Foundation Hanyang University <120> Biomarker for diagnosis of exposure to volatile organic compounds <130> HPC3424 <160> 10 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> RNA <213> Human <400> 1 agtagtgctt tctacttta 19 <210> 2 <211> 21 <212> RNA <213> Human <400> 2 tcagttttgc atagatttgc a 21 <210> 3 <211> 16 <212> RNA <213> Human <400> 3 tcagccgctg tcacac 16 <210> 4 <211> 15 <212> RNA <213> Human <400> 4 ttgccctctc aaccc 15 <210> 5 <211> 22 <212> RNA <213> Human <400> 5 ttcaaaacat gaattgctgc tg 22 <210> 6 <211> 21 <212> DNA <213> Human <400> 6 tcggtgttta taggtgttgg c 21 <210> 7 <211> 24 <212> DNA <213> Human <400> 7 tttaggagac gtttatgagt ttgc 24 <210> 8 <211> 24 <212> DNA <213> Human <400> 8 tttgttagtt agggtttggg tttc 24 <210> 9 <211> 25 <212> DNA <213> Human <400> 9 ttgagattag tttggttaat atggc 25 <210> 10 <211> 27 <212> DNA <213> Human <400> 10 taagtgttta gttgggagag ttgtaac 27

Claims (3)

A biomarker composition for diagnosing exposure to toluene comprising the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 7 and their respective complementary base sequences.
1) extracting total RNA from the blood of the experimental group and the control group;
2) synthesizing a cDNA having a complementary base sequence to the biomarker of SEQ ID NO: 3 from the total RNA of the experimental group and the control group according to the step 1);
3) amplifying the cDNA of step 2) by PCR; And
4) confirming the biomarker of SEQ ID NO: 3 by comparing and analyzing the amplified product of step 3) before and after amplification;
&Lt; RTI ID = 0.0 &gt; and / or &lt; / RTI &gt;
1) extracting DNA from the blood of the experimental group and the control group;
2) performing PCR using the primer for confirming methylation of the DNA of step 1); And
3) confirming the biomarker of SEQ ID NO: 7 by comparatively analyzing the methylation through the PCR result of the step 2);
To determine whether methylation of the gene to toluene is included.

Images