KR101465319B1 - MicroRNA decay element and its use - Google Patents

Abstract

The polynucleotide for regulating miRNA according to the present invention can be designed to have various sequences capable of binding to specific microRNAs, and can be targeted to various miRNAs through various sequence applications, and can be used not only as a molecular and cellular biological research tool, can be usefully used as a clinical therapeutic agent related to miRNA.

Description

[0002] MicroRNA degradation elements and their uses {MicroRNA decay element and its use}

The subject is related to microRNA regulation.

MicroRNA (miRNA) is a short-length endogenous RNA involved in mRNA regulation at post-transcriptional stage through complementary binding to target mRNA. miRNAs are derived from long precursors of the hairpin structure by the RNAse III ribonucleases Drosha (Lee et al. 2003. Nature 425: 415-419) and Dicer (Hutvagner et al. 2001. Science 293: 834-838; Ketting et al. 2001, Genes Dev 15: 2654-2659). As of August 2012, 25,141 mature miRNAs from 193 species are registered according to the miRNA database (19th edition, miRBase).

Most miRNAs are known to bind to the 3'-UTR of the target gene, inhibit its translation, and regulate various functions within the cell. For example, miRNA has been implicated in cell growth and apoptosis (Brennecke, J. et al. 2003. Cell 113: 25-36), hematopoietic differentiation (Chen, CZ, et al. 2004. Science 303: 83-86) (Boehm, M., Slack, F. 2005. Science. 310: 1954-7) as well as viral infections as well as various diseases including cancer. More specifically, over 50% of miRNA genes have been found in the genomic region associated with cancer (Calin, G. A. et al., 2004. Proc Natl Acad Sci U S. 101. 2999-3004). Modulation disorders of miRNA have been reported in breast cancer (Iorio, MV et al. 2005. Cancer Res. 65: 7065-70.), lung cancer (Johnson, SM et al. 2005. Cell 120: 635-647) Cancer Res. 1: 882-891), for example, the miR-17-92 cluster is amplified in human B-cell lymphoma and is up-expressed in bucky limpoma He, L. et al., 2005. Nature 435: 828-833).

Thus, the regulation of human miRNAs has emerged as a new target for the development of therapeutic agents, but unlike the miRNA production process, its regulation, especially the studies related to degradation, is in its infancy.

An example of the latter is a polynucleotide modulator that binds to miRNA and regulates its translation by inducing its inhibition or cleavage. U.S. Patent No. 7365058 relates to a microRNA and a method of inhibiting miRNA, miRNA. U.S. Patent Publication No. 2012-0238618 also relates to a pharmaceutical composition comprising an anti-miRNA antisense oligonucleotide, which discloses oligonucleotides that bind to various miRNAs of 8-26 nt in length, including LNA.

However, there is still a need to develop modulators that can modulate various miRNAs involved in the development of various functions and diseases in the cell.

The present invention seeks to develop miRNA modulators related to the development of various diseases.

In one aspect, the disclosure provides polynucleotides for microRNA regulation. The polynucleotide according to the present invention comprises a sequence of 5'-X ₁ -YX ₂ -CGUGUCUGAWUAUCUGUGGG-3 'as an RNA, Wherein W is G or A, X ₂ is a sequence complementary to the seed sequence of the microRNA of about 8 to about 10 nt in length, Y forms an internal secondary structure of about 7 to about 8 nt in length Or non-complementary sequence to the microRNA, and may be referred to as a bulge, and as long as the above conditions are satisfied, various sequences can be used. In one embodiment, for example, AAAAAAAG is used, but not limited thereto. X ₁ has a sequence complementary to about 7 to about 9 consecutive nt sequences located about 3 to about 4 nt in the 3 'direction from the seed sequence of the microRNA. The polynucleotide for microRNA regulation according to the present invention decomposes each microRNA by binding between microRNAs, and an exemplary method of action is described in FIG.

In one embodiment according to the present application, the microRNA to which the polynucleotide according to the present invention binds is a microRNA of the family of miR-17, miR-18, miR-19, or miR-92 belonging to the miR- And X ₂ includes a sequence of GCACUUU, GCACCUU, UUUGCAC or GUGCAAU, which is complementary to the seed sequence of each family.

In another embodiment according to the present application, the microRNA to which the polynucleotide according to the present invention binds is a microRNA of the family of miR-17, miR-18, miR-19, or miR-92 belonging to the miR- And 5'-UCCUGCACUAAAAAAAGAAGCACUUUACGGCGUGUCUGAGUAUCUGUGGG-3 '(wild type) or 5'-UCCUGCACUAAAAAAAGAAGACAUUUACGGCGUGUCUGAUUAUCUGUGGG-3' for the miR-17 regulatory polynucleotide according to the present invention. 5'-UUCUGCACUAAAAAAAGAUGCACCUUACGGCGUGUCUGAGUAUCUGUGGG-3 'for miR18 regulation; miR_19 modulator is 5'-UGUUUUGCAAAAAAAAGGAUUUGCACACGGCGUGUCUGAGUAUCUGUGGG-3 '; And miR92 regulatory sequence 5'-UAGGCCGGGAAAAAAAGAAGUGCAAUACGGCGUGUCUGAGUAUCUGUGGG-3 '.

In another aspect, the invention provides a vector comprising DNA corresponding to a polynucleotide according to the present invention, a cell comprising said vector.

In another aspect, the present invention provides a composition for treating a microRNA-related disease comprising a polynucleotide according to the present invention. The composition according to the present invention can be used for the treatment of cancer-related diseases including lymphocytic leukemia, undifferentiated thyroid cancer, or malignant lung cancer. In particular, miR-17-92 microRNA cluster-related diseases, including, but not limited to, lymphoma, lymphatic leukemia, lymphocytic leukemia, or leukemia.

In another aspect, the invention also provides a method of screening for HCMV proliferative inhibitors, the method comprising, in one embodiment, administering an inhibitor of the miR-17-92 cluster comprising the miR-17, miR-18, miR- Providing at least one of the microRNAs; Providing a polynucleotide for regulating microRNA derived from HCMV binding to the microRNA of each family; Treating the test substance expected to inhibit the interaction of the microRNA and the polynucleotide; And selecting the test substance as the candidate compound to inhibit the interaction with the control substance not treated with the test substance. The polynucleotides derived from HCMV binding to each of the families of miR-17, miR-18, miR-19 and miR-92 in the method according to the present invention are characterized by seed sequences of each family comprising GCACUUU, GCACCUU, UUUGCAC and GUGCAAU And a sequence containing CGUGUCUGAUUUUCUGUGGG-3 'addition motif in the 3' direction of the above sequence. In one embodiment according to the present disclosure, the microRNA may be provided in the form of a cell comprising HEK293T, HFF, HUVEC, THP-1, or U373MG.

In another aspect, the disclosure also provides a method of modulating microRNAs in a cell or an Invitro, comprising contacting the polynucleotide according to the present invention with a microRNA.

The polynucleotide for regulating miRNA according to the present invention can be designed to have various sequences capable of binding to specific microRNAs, and can be targeted to various miRNAs through various sequence applications, and can be used not only as a molecular and cellular biological research tool, It is also worth using as a clinical therapeutic agent related to miRNA.

Figure 1 shows the differential expression control of miR-17-92 clusters derived from HCMV isolated from clinically,
Figure 1a is a microarray result showing miRNA expression changes due to HCMV infection,
Fig. 1B shows the results of a comparison between the four families of miR-17 (miR-17 and miR-20a), miR-18 (miR-18a), miR-19 (miR-19a, b), and miR- As a schematic diagram showing the structure of the miR-17-92 cluster constituted, red is a seed sequence,
Figure 1C shows Northern blot results indicating mature miRNA concentration changes in miR-17-92 clusters due to HCMV Toledo infection,
Figure 1d shows the results of quantitative reverse transcription PCR, which shows the change in mature miRNA concentration in the miR-17-92 cluster due to HCMV Toledo infection,
Figure 1e shows Northern blot results of miR-17, miR-20a, and miR-19a in HFF infected with Toledo-WT or ToledoA15kb (5 MOI). NI is an uninfluenced control group and error bars are ± 1 SD.
Figure 2 shows the expression of miR-17-92 expression regulation (temporal regulation) due to HCMV infection,
Figures 2a and 2b show the results of quantitative reverse transcription PCR for primary miR-17-92 in HFF infected with Toledo-WT or Toledo A15kb (5 MOI)
Figure 2c shows the results of quantitative reverse transcription PCR for pri-miRNA in HFF expressing HCMV IE1 and IE2,
Figure 2d shows the results of quantitative reverse transcription PCR (on the left) for pri-miRNA showing loss of the miR-17-92 induced function of IE1 or IE2 in HFF cells transfected with IE1 or IE2 specific siRNA and IE1 and IE2 Immunoblot results indicating the defect (right)
Figure 2e shows northern blot results indicative of the expression of mature miR-20a (upper panel) and miR-17 (lower panel) during Toledo infection and pre-miR-20a detection (upper right panel) , The rDNA band stained with ethidium bromide was used as a loading control, NI is an uninfected control group, and the error bar represents ± 1 SD.
Figure 3 shows that the non-coding region located between the genes of UL144-145 RNA down-modulates miR-17 and miR-20a matured through sequence-specific interactions,
Figure 3a is a quantitative analysis of total RNA extracted in HFF after 36 hours of treatment with DMSO, actinomycin D (Act D) or cyclohexamide (CHX) as a control in 12 hpi Toledo-WT (5 MOI) ,
Figure 3b is a schematic representation of some of the (B) 15-kb region used in recovery experiments,
FIG. 3c shows the expression of mature miR-17 and pri-miR-17- (SEQ ID NO: 17) after transferring HFF infected with ToledoΔ17 Seed (5 MOI) to a vector without promoter (pBlueScript) 92 transcript concentration by quantitative reverse transcription-polymerase chain reaction (PCR)
Figure 3d is a diagrammatic representation of the UL144-145 RNA locus of clone 3 of Figure 3b in which the miR-17 binding site is located in the intergenic region between UL144 and UL145,
Figure 3e shows UL144-145 RNA two-dimensionally using Mfold software, showing 5 'and 3' complementary sequences to the central bulge of miR-17 (red) and miR-17 binding site (blue) Respectively.
FIG. 3f shows the results of quantitative reverse transcription-PCR of a mature miRNA transcript from HEK293T transfected with different concentrations of pcDNA3.1 vector containing UL144-145 RNA,
FIG. 3g shows the results of detection of miRNA transcript concentration of HEK293T cells transfected with UL144-145 RNA (UL144-145 seed mut) having a mutation at the miR-17 seed-binding site by quantitative reverse transcription PCR,
FIG. 3h shows the miRNA transcript concentration of HEK293T cells transfected with UL144-145 in which the miR-17 binding site of UL144-145 RNA was mutated to the miR-18a-binding site (UL144-14517 → 18a) As a result,
Figure 3i shows the tertiary structure of 240 nt of the intergenic region corresponding to UL144-145 using the Rosetta program. The miR-17 is red, the middle protruding region is blue, and the 3 'additional region is orange A), B was transfected into HEK 293T cells after miR-17 binding site was replaced with miR-92a binding site (17-> 92a), and mature miRNA was analyzed by quantitative reverse transcription PCR.
Where **: p <0.01; *: p < 0.05 (Student's t-test); NS: nonspecific, and an error bar indicates ± 1 SD.
Figure 4 shows the minimal sequence required for miR-17 degradation,
Figure 4a shows firefly-736nt, UL145 ORF, and 3'UTR comprising intergenic regions; Firefly-240nt containing only the intergenic region; And a firefly-30nt luciferase reporter system construct containing only the miR-17 binding site,
FIG. 4B shows the result of qRT-PCR detection of over-expression of the reporter system in HEK293T, showing that only miR-17 and miR-20a, not pri-miR-17-92,
Figure 4c shows the results of qRT-PCR showing the effect of firefly-30nt on miR-17 degradation as a result of overexpression of the reporter system in HEK293T,
Figure 4d is a schematic representation of a series of deletion sites for the UL144-145 intergenic region for further motif identification,
FIG. 4E shows the result of qRT-PCR after transfer into HEK293T as a result of primary screening using a 40-nt deletion region,
FIG. 4f shows a result of qRT-PCR after transfer into HEK293T as a result of secondary screening using a 4-nt deletion region in the? 3 region,
Figure 4g shows that 50 nt RNA oligomers containing 50 nt of miR-17-binding site and miRDE 3 'additional motif (miRDE-50-mer_WT) are transferred to HEK293T as a result of using synthetic RNA oligomers of minimized viral intergenic RNA QRT-PCR results for post-mature miRNAs,
Figure 4h shows the results of using a synthetic RNA oligomer of minimized viral gene intergenic RNA, including miRDE wild-type oligomer (miRDE-50-mer_WT) or miR-17 seed binding site mutant oligomer (miRDE-50-mer_seed mut) The results of qRT-PCR for mature miRNA after transfer of 50 nt RNA oligomer to HEK293T,
Fig. 4i shows the result of using the synthetic RNA oligomer of minimized viral gene intergenic RNA to transfer 30 nt RNA oligomer containing only miR-17 binding site of miRDE (miRDE-30-mer) to HEK293T. -PCR result, and the error bar indicates +/- 1 SD.
Figure 5 shows that a mutagenic virus with a triple base substitution at the miR-17 binding site failed to induce targeted degradation of matured miR-17,
Figure 5a is a schematic representation of the miR-17-binding site of the mutated (CAC- > ACA, red) mutant virus (Toledo [Delta] 17Seed)
Figure 5b shows the effect of HFF on pre-miR-17 (top panel), mature miR-17 (second panel), pre-miR- 20a (third panel), and mature miR-20a (fourth panel)
FIG. 5c shows the results of qRT-PCR analysis on Pri-miR-17-92 concentration,
Figure 5d shows the results of qRT-PCR analysis for UL144-145 concentration,
Figure 5e shows the results of a pulse-to-chase analysis of the stability of mature miRNA during HCMV infection, showing that the amount of miR-17 transcript was transferred to a 0.2 nM miR-17 / miR- . Error bars indicate ± 1 SD.
6, As a result, miR-17 degradation by miRDE is important for rapid virus production during lytic infection,
FIG. 6A is a graph of virus production in HFF infected with Toledo-WT and ToledoΔ17Seed of 2 MOI. The virus titer was analyzed by limiting dilution of the supernatant of the infected medium,
Figure 6b shows the results of quantitative PCR analysis of viral genomic DNA concentration in HFF infected with Toledo-WT and Toledo [Delta] 17Seed of 2 MOIs, with error bars representing ± 1 SD,
Figure 6C shows immunoblot results for HCMV immediate early proteins (IE1 and IE2) and late (gB)
Figure 6d shows a sequence comparison of miRDE in HCMV UL144-145 genomic region isolated from clinically, GenBank information is as follows: Toledo (GU937742.1), VR1814 (GU179289.1), Merlin (AY446894.2) , JHC (HQ380895.1), TB40 / E (AY446866.1), AF1 (GU179291.1), 3301 (GQ466044.1), HAN38 (GQ396662.1), JP (GQ221975.1) ), U8 (GU179288.1), HAN20 (GQ396663.1), 3157 (GQ221974.1), and HAN13 (GQ221973.1). The conserved (red) and non-conserved (blue) sequences were indicated. The miRNA decay element (miRDE) sequence is shown in the box, with the miR-17 binding site sequence and the 3 'additional motif.
7 shows the sequence of the UL144-145 intergenic region, wherein A is a sequence of GenBank No. GU937742.1, the miR-17 binding site is red, the 3'portion motif is blue, B is Renilla Lucifer Lase, firefly-240nt vector and HEK293T cells co-transfected with miR-17 or miR-20. The relative luciferase activity was measured as a ratio to the activity of Renilla luciferase activity And C represents UL144-145 RNA oligomer comprising miR-17 binding site (30 mer) and 3 'additional motif (20 mer), and the mutant oligomer contains a substitution at the miR-17 seed binding site And all oligomers contain a 5 ' monophosphate modification.
Figure 8 is a graphical representation of the way miRDE works in accordance with the present invention.

The present invention is based on the discovery that a sequence derived from HCMV (Human Cytomegalo virus) binds to human microRNA and promotes proliferation in the lytic cycle through its regulation.

In one embodiment, the present invention relates to a polynucleotide for regulating microRNAs belonging to a miR-17-92 microRNA cluster, wherein the polynucleotide comprises the sequence of 5'-X ₁ -YX ₂ -CGUGUCUGAWUAUCUGUGGG-3 ' in W is G or a, X ₂ is a sequence complementary to the seed sequence of the micro-RNA of from 8 to 10 nt in length, Y is an emergency in the micro-RNA that does not form the internal secondary structure of 7 to 8 nt length And X ₁ comprises a sequence complementary to about 7 to 9 consecutive nt sequences located about 3 to 4 nt in the 3 'direction from the seed sequence of the microRNA.

Referring to FIG. 1B, the miR-17-92 clusters of the present invention include miR-17 (miR-17 and miR-20a), miR-18 (miR-18a), miR- -92 (miR-92a) consists of four families (parentheses are members of each family), and the seed sequence is shown in red. The seed sequence refers to a nucleic acid sequence of about 2-8 nt of the 5 'portion of the miRNA and participates in a complementary binding with the polynucleotides herein. MiRNAs belonging to each family include seed sequences of GCACUUU, GCACCUU, UUUGCAC or GUGCAAU, respectively, and the polynucleotides of the present invention include a sequence complementary to the seed sequence and an additional motif (5'CGUGUCUGAWUAUCUGUGGG3 ').

In one embodiment, the polypeptide for regulating microRNAs according to the present invention modulates the microRNAs of a family of miR-17, miR-18, miR-19, or miR-92 belonging to the miR-17-92 microRNA cluster, The polynucleotide for microRNA regulation is 5'-UCCUGCACUAAAAAAAAGAAGCACUUUACGGCGUGUCUGAGUAUCUGUGGG-3 'or 5'-UCCUGCACUAAAAAAAAGAAGACAUUUACGGCGUGUCUGAUUAUCUGUGGG-3' for miR-17 regulation. 5'-UUCUGCACUAAAAAAAGAUGCACCUUACGGCGUGUCUGAGUAUCUGUGGG-3 'for miR18 regulation; miR_19 modulator is 5'-UGUUUUGCAAAAAAAAGGAUUUGCACACGGCGUGUCUGAGUAUCUGUGGG-3 '; And miR92 regulatory sequence 5'-UAGGCCGGGAAAAAAAGAAGUGCAAUACGGCGUGUCUGAGUAUCUGUGGG-3 '.

MicroRNAs (miRNAs) refer to RNAs that do not encode proteins that play an important role in regulating gene expression. In general, microRNAs are transcribed into precursors of about 70-80 nt (nucleotide) long with a hairpin structure called pre-miRNA and then matured by cleavage by the RNAse III enzyme Dicer. MicroRNAs form a ribonucleotide complex called miRNP, which cleaves the target gene by complementary binding to the target site, or inhibits translation.

The term " miRNA " or " microRNA " herein is an RNA oligonucleotide of about 18-25 nt in length and is an endogenous RNA molecule having various regulatory functions in the cell.

As used herein, the term " target miRNA "refers to a miRNA associated with a disease, wherein upregulation or downregulation is associated with the disease, for example oncogenic miRNA or cancer inhibiting miRNA, Lt; / RTI >

Over 30% of human miRNAs are present in clusters, which are transcribed into a single precursor and then cleaved to form the final mature miRNA. Most miRNAs are known to bind to the 3'-UTR of the target gene, inhibit its translation, and regulate various functions within the cell. For example, miRNAs can be used to detect not only intracellular functions such as cell growth and cell death (Brennecke et al. 2003), hematopoietic differentiation (Chen et al. 2004), lifetime control (Boehm and Slack 2005) And other diseases.

More specifically, over 50% of miRNA genes are found in the genomic region associated with cancer (Calin et al. 2004). The miR-17-92 clusters have been associated with human B-cell (s), including breast cancer (Iorio et al. 2005), lung cancer (Johnson et al. 2005) Amplified in lymphoma, and expressed up-regulated in bucky limpoma (He et al. 2005).

In one embodiment, the target miRNA is present in the miR-17-92 cluster. The miR-17-92 cluster consists of six miRNAs, miR-17, miR-18a, miR-19a and miR-20a. miR-19b-1, and miR-92a-1 (He et al., 2005). The association of miR-17-92 with cancer is described by Olive V. et al. Int J Biochem Cell Biol. 2010 Aug; 42 (8): 1348-54. miR-19 is known to induce lymphoma by targeting the cell death genes Pten and Bim (Mavrakis, KJ et al. 2010. Nat Cell Biol 12: 372-379; Mu, P. et al. MiR-17 is known to be involved in cell adhesion, migration and proliferation (Shan, SW et al. 2009. Nat < RTI ID = 0.0 > Cell Biol 11: 1031-1038).

Thus, miRNAs can serve as important targets for disease treatment, and polynucleotides according to the present invention that regulate miRNAs of miR-17-92 can be usefully used in the treatment of diseases related thereto.

As used herein, the term " nucleic acid " includes polynucleotides, oligonucleotides, DNA, RNA, and analogs thereof, including peptide nucleic acids (PNA) or mixtures thereof. The nucleic acid can also be single or double stranded and can encode molecules including polypeptides, mRNA, microRNA or siRNA, and the like. Polynucleotides are used interchangeably with oligonucleotides and include DNA or RNA.

In one embodiment herein, the polynucleotide is about 50 to 240 nt comprising the miRNA binding site as an RNA and an additional motif at the 3 ' The polynucleotides of the present invention include miR-17 (miR-17 and miR-20a), miR-18 (miR-18a), miR-19 miR-92a) Core (seed) sequences of GCACUUU, GCACCUU, UUUGCAC and GUGCAAU binding to each of the four families and a CGTGTCTGAGTATCTGTGGG addition motif in the 3 'direction of the core sequence. The additional motif is not complementary to the miRNA sequence and it can be understood that the polynucleotide of the present invention, miRDE, is structurally aiding in binding miRNA, but is not limited to this theory.

The polynucleotides herein may be single stranded, in the presence of a complementary sequence, to form double strands and not to exclude the formation of partial double strands in the molecule due to internal complementary sequences.

The polynucleotides of the present invention bind to and facilitate degradation of the target miRNA, an exemplary mode of action is described in FIG. For binding, there should be sequence complementarity between the polynucleotide of interest herein and the target miRNA, and not only 100% complementarity is necessary as long as it promotes degradation, and the degree of complementarity may vary. Specifically, about 8 nt of bulge and about 8 nt of the 3 'portion, which is a part that does not participate in the complementary binding described below with about 9-nt containing the miRNA 5' seed sequence, forms a complementary bond with miRDE.

In another embodiment, the invention also relates to a vector comprising the polynucleotide of the present invention, a cell comprising the vector. Polynucleotides according to the present invention may be used in a vector operable in a suitable prokaryotic or eukaryotic cell, including a promoter capable of inducing its transcription for expression or production in a cell. A variety of vectors known in the art can be used, including, but not limited to, pcDNA3, pCK. The present application also includes cells comprising the vector. Such cells may be prokaryotic or eukaryotic, and various known cells may be used including, but not limited to, HFF, HEK293, Hela, THP-1, and U937.

The polynucleotide herein specifically binds miRNAs in miR-17-92 clusters to induce their degradation and thus can be used in the treatment of diseases associated with miR-17-92.

Thus, in one aspect, the present invention is directed to a pharmaceutical composition for treating, ameliorating, or preventing a disease associated with miR-17-92 comprising a polynucleotide according to the present disclosure.

 The term " treatment ", " palliative " or " improvement " as used herein means any action that improves or alleviates the symptoms of a related disease upon administration of the composition. Those skilled in the art will be able to ascertain the precise criteria of the disease by referring to the data provided by the Korean Medical Association, and to judge the degree of improvement, improvement, and treatment of the disease.

As used herein, the term "prevention" means any act that inhibits or delays the onset of a related disorder. It will be apparent to those skilled in the art that the compositions herein may prevent early onset symptoms, or related disorders when administered prior to appearance.

The composition of the present invention may further contain, in addition to the polynucleotides of the present invention, one or more active ingredients exhibiting the same or similar functions in relation to the treatment of diseases, or a compound that maintains / increases the solubility and / or absorbency of the active ingredient. Also optionally, it may further comprise a chemotherapeutic agent, an anti-inflammatory agent, an antiviral agent and / or an immunomodulator. For example, to improve delivery to tumor tissue, such as, but not limited to, carriers, such as cationic liposomes, cyclodextrin, porphyrin derivatives, branched chain dendrimers, polyethyleneimine polymers, nanoparticles and microspheres may be used have. The compositions herein may also be used alone or in combination with methods for the treatment or prevention of related diseases, or using surgery, drug therapy and biological response modifiers.

In addition to the above-mentioned active ingredients, the composition may further comprise at least one pharmaceutically acceptable diluent, carrier and / or adjuvant. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and at least one of these components. , A buffer solution, a bacteriostatic agent, and the like may be added. In addition, it can be formulated into injection formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, Specific antibody or other ligand can be used in combination with the carrier. Can further be suitably formulated according to the respective disease or ingredient according to the appropriate method in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA have. For example, as solutions, emulsions and liposomes, and the like. For example, the active ingredient may be formulated into tablets, capsules, gels, syrups or suppositories by mixing with pharmaceutically acceptable liquid and / or solid carriers or excipients of fine powder. The composition according to the invention may also be prepared as a suspension in an aqueous, non-aqueous or mixed medium. The aqueous suspension may further comprise a material that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol and / or dextran. Polynucleotides included in compositions according to the present disclosure can be conjugated with other drugs that are effective in treating other diseases.

The method of administration of the therapeutic agent of the present invention is not particularly limited thereto, and the known method of administering the inhibitor may be applied, and parenteral administration (for example, intravenous, subcutaneous, intraperitoneal or topical application) Or oral administration, and administration by intravenous injection is preferable in order to obtain a rapid therapeutic effect.

The dosage ranges vary widely depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the disease, and a proper dosage is, for example, And / or the degree of specific activity of the polynucleotide used. It may be calculated on the basis of the EC ₅₀ generally measured as effective in the in vivo animal model and in vitro, for example from 0.01 μg to 1 g per kg of body weight, and may be calculated on a daily, weekly, monthly or yearly basis , May be administered once or several times per unit period, or may be continuously administered for a long period using an infusion pump. The number of repeated administrations is determined in consideration of the duration of the drug in the body, the drug concentration in the body, and the like. The composition may be administered for recurrence, even after treatment according to the course of the disease treatment.

Polynucleotides according to the present invention may be used in the composition as such or in the form of pharmaceutically acceptable salts. A pharmaceutically acceptable salt means that the undesirable toxicity is minimized while maintaining the biological activity of the polynucleotide according to the present invention. Such salts include salts formed with metal cation such as, for example, zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, But are not limited to, salts formed with cations derived from N-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine. no.

In one embodiment according to the present disclosure, the polynucleotide herein may be in the form of a prodrug. Polynucleotides are negatively charged due to the nature of the nucleotides that make up them. Due to the lipophilic nature of the cell membrane, the absorption of the polynucleotide into the cell membrane can be reduced. Absorption inhibition due to this polarity can be overcome through the prodrug approach described below (Crooke, RM (1998) in Crooke, ST Antisense research and Application, Springer-Verlag, Berlin, Germany, vol. 103-140).

Polynucleotides included in the compositions herein may target one or more miRNAs, and one polynucleotide may target one or more miRNAs, or a mixture of multiple polynucleotides targeting each miRNA may be used .

The composition according to the present invention can be used for the treatment of diseases associated with miR-17-92 clusters as described above and, therefore, in another aspect, the present invention relates to a method of treating diseases associated with miR-17-92 clusters.

The methods herein comprise administering a therapeutically effective amount of a polynucleotide of the present invention or a conjugate thereof, or a composition comprising the polynucleotide, to a subject in need thereof. In this method, chemical / radiotherapeutic agents other than polynucleotides can be used individually, together or sequentially.

The compositions herein can be used for the prevention or treatment of cancer. In one embodiment according to the present disclosure, the disease associated with microRNA is associated with miR-17-92, a disease or disorder caused by overexpression, particularly cancer, of one or more miRNAs belonging to miR-17-92, Lymphocytes, lymphoid leukemia, lymphocytic leukemia (He et al., 2005. Nature 435: 828-833), undifferentiated thyroid cancer (Takakura et al., 2008. Cancer Sci: 1147-1154), malignant lung cancer , 2005. Cancer Res 65: 9628-32; Lu et al., 2005. Nature 435: 834-838).

The polynucleotide according to the present invention is a miRNA decay element (miRDE) that degrades human microRNAs derived from human cytomegalovirus (HCMV), and specifically binds specifically to miRNAs belonging to the miR-17-92 cluster Which leads to its decomposition. As a result, HCMV decreases the lytic cycle efficiency through the generation of viruses. Therefore, a substance that inhibits the interaction of miRDE with microRNAs of HCMV can be used as an inhibitor of HCMV proliferation.

Thus, in one aspect, the invention provides a method of screening for HCMV proliferation inhibitors. In one embodiment, the method comprises contacting miR-17, miR-18a, miR-19a, miR-20a. miR-19b-1, and miR-17-92 clusters comprising miR-92a-1; Providing a microRNA-regulating polynucleotide derived from HCMV binding to each microRNA, that is, miRDE; Treating the test substance expected to inhibit the interaction of the microRNA and the polynucleotide; And selecting the test substance as the candidate compound to inhibit the interaction with the control substance not treated with the test substance.

The miRDE used herein can be prepared using RNA production methods known in the art. For example, miRDE can be used by cloning a gene in a vector such as pET28b (Novagen), expressing it in Invitro using a transfer kit, transferring it to a cell line, and then purifying it. However, no.

MicroRNA and miRDE can be used directly in vitro to confirm activity in the absence or presence of the test substance. After the test substance is added, the activity of the test substance can be confirmed by a known method after a certain period of time. Such a method can be confirmed by, for example, Northern blotting or quantitative reverse transcription PCR.

In one embodiment, the microRNA can be provided in the form of a cell expressing it, and miRDE can be introduced into the miRNA by a known method. The available cell lines may include, but are not limited to, human embryonic kidney 293T (HEK293T), or human foreskin fibroblasts (HFF), HUVEC, THP-1, or U373MG, Various cells capable of achieving the object of the present invention can be used. Total RNA is extracted from the cells after a certain period of time after the test substance is added to the cells, and the activity of the test substance is determined by a known method, Blotting or quantitative reverse transcription-polymerase chain reaction (PCR).

The amount of microRNA and miRDE used in the present method, the type of cell, and the amount and kind of test substance depend on the specific experimental method used and the kind of the test substance, and those skilled in the art will be able to select an appropriate amount. As a result of the test, a substance which inhibits the microRNA-degrading activity of miRDE in the presence of the test substance is selected as a candidate substance as compared with the control group not in contact with the test substance. Less than about 99%, less than about 95%, about 90%, about 85%, about 80%, about 75%, about 70% less, less than about 65% , About 55% reduction, about 50% reduction, about 45% reduction, about 40% reduction, about 30% reduction, about 20% reduction or less.

Refers to a substance that is expected to inhibit the interaction (binding) of microRNAs and miRDE and may be a low molecular weight compound, a high molecular weight compound, a mixture of compounds (e.g., a natural extract or a cell or tissue culture ), Or biopharmaceuticals (e.g., proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzymes and DNAzymes) or sugars and lipids.

Test substances can be obtained from libraries of synthetic or natural compounds and methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich Available from MycoSearch (USA). The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the desired synthetic library method, " 1-bead 1-compound " library method, and by synthetic library methods using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

For screening purposes of the drug, the compound may be used that has a therapeutic effect of low molecular weight. For example, compounds having a weight of about 1000 Da such as 400 Da, 600 Da or 800 Da can be used. Depending on the purpose, such compounds may constitute a part of a library of compounds, and the number of compounds constituting the library may vary from several tens to several millions. Such a library of compounds can be prepared by reacting peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular weight compounds based on a template, such as benzodiazepines, hydantoins, biaryls, carbocycles, and polycycle compounds such as naphthalene, Carbodihydrate and amino acid derivatives, dihydropyridines, benzhydryls and heterocycles (such as triazine, indole, thiazolidine, etc.), but this is merely exemplary It is not limited thereto.

For example, biologics can also be used for screening. Biologics refers to a cell or a biomolecule, which refers to a substance produced using biomolecules, proteins, nucleic acids, carbohydrates, lipids, or in vivo and in vitro cell systems. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, proteins or biological organic materials found in polynucleotides, peptides, antibodies, or other plasma.

Hereinafter, embodiments are provided to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited to the following examples.

Example

Experimental Method

The experimental method used in this embodiment is as follows.

Cells and viruses used

Human embryonic kidney 293T (HEK293T) (CRL-11268) was cultured in DMEM medium containing 2 mM l-glutamine, 50 U / mL penicillin, 50 μg / mL streptomycin, 7.5% fetal bovine serum Hyclone). Human foreskin fibroblasts (HFF) (SCRC-1041), passages 10-15) were cultured in DMEM medium (Hyclone) containing 10% fetal bovine serum.

Transferred Lipofectamine (Invitrogen) was used according to the manufacturer's instructions.

Bacterial artificial chromosomes (BAC) Toledo, Toledo A15kb, and AD169 were introduced into HFF cells by electroporation (Gene-Pulser II, Bio-Rad). After 2 weeks, the cultures were collected and IE1-positive cells were measured by immunofluorescence analysis and the titer was measured as an infectious unit. Anti-IE1 antibodies (MAB810R, Millipore) and anti-gB antibodies (1-M-12, Santacruz) were used in the immunoblot.

miRNA microarray

Microarray analysis was performed to investigate the expression pattern of intracellular miRNA during HCMV infection. Total RNA was extracted from the HFF infected with the non-infected control, Toledo-WT, and ToledoΔ15kb using Trizol reagent (Invitrogen). Each sample was prepared according to the Agilent miRNA Microarray System (Agilent Human miRNA array v14.0) protocol.

Virus mutation induction

To construct the site-specific mutant virus ToledoA17Seed, the UL144-145 genomic region of Toledo-BAC was replaced with the rpsL-neo cassette. Briefly, the rpsL-neo cassette was amplified using primers containing homologous arms consisting of 50 nt above and below the target gene (reaction conditions: 98 ° C for 10 seconds, 56 ° C for 30 seconds, 72 ° C for 1 minute the cycle repeated 25 times), Escherichia that the amplification product contains the wild-type Toledo-BAC E. coli DH10b cells were introduced by electroporation using Gene Pulser II. Counter selection was performed in medium containing kanamycin and streptomycin for an intermediate Toledo-BAC construct containing the rpsL-neo cassette. The cassette is replaced by a mutant virus genome and contains three base substitutions in UL144-145. Toledo-Revertant BAC was also performed in the same manner as above.

The primers are shown in Tables 1-1 to 1-4 below.

[Table 1-1]

[Table 1-2]

[Table 1-3]

[Table 1-4]

Firefly reporter constructs and dual luciferase analysis

The function of UL144-145 RNA was identified using pRL3-CMV (Promega), a firefly luciferase vector containing the Renilla luciferase vector pRL-TK (Promega) and the CMV promoter as a control. The primers used are listed in Table 1. The firefly luciferase activity was titrated to the renilla luciferase activity and each activity was performed according to the method of the manufacturer (Dual-Luciferase Reporter Assay System, Promega) using a luminometer (Berthold Technologies).

Quantitative reverse transcription PCR (qRT-PCR) and Northern blot

MiRNA sequences used in the present experiments were obtained from miRBase (Sanger Institute). Based on this, probes used in miRNA blots were designed. Total RNA of HFF and HEK293T cells was isolated according to the manufacturer's instructions using Trizol reagent (Invitrogen) reagent. The isolated total RNA was separated by electrophoresis on a gel containing 15% acrylamide and 8M urea, transferred to a nylon membrane (Zeta-probe GT, Bio-Rad) and crosslinked with EDC for 1 hour (Pall and Hamilton , 2008). Subsequent hybridization reactions were performed for 3 hours at 37 ° C using Hybridization Solution (Clontech) and then exposed to FUJI BAS film for one day.

For quantitative RT-PCR, the total RNA was reverse-transcribed with M-MLV reverse transcriptase (Invitrogen) using oligo-dT for 3 hours at 37 ° C, and then PCR amplified using iQ SYBR Green Supermix (Bio-Rad) Reaction conditions: a cycle of 95 ° C for 10 seconds and 60 ° C for 40 seconds repeated 40 times). The expression levels of pri-mRNA and target mRNA were optimized for GAPDH mRNA. miRNA was quantitated by reverse transcriptase PCR using miRNA assay kit (Taqman, Applied Biosystems). The mature miRNA was optimized for U6 snRNA and the experimental procedure was performed according to the manufacturer's method.

Small RNA and plasmid DNA transfer

Small RNA, RNA oligomers and siRNA were transferred using Dharmafect 1 reagent (Dharmacon). Twenty-four hours prior to transfer, HFF and HEK293T cells were seeded in 12-well culture dishes containing the above-mentioned medium without antibiotics. RNA and Dharmafect mixtures were added to the medium at a concentration of 50 nM. After 6 hours, the transfer medium was changed and used for analysis 48 hours later. The siRNAs used were: IE1, GCGGGAGAUGUGGAUGGCUdTdT; And IE2, AAACGCAUCUCCGAGUUGGACdTdT. In addition, the following synthetic miR-17 duplexes were used: miR-17, pCAAAGUGCUUACAGUGCAGGUAG; And miR-17 *, pACUGCAGUGAAGGCACUUGUAG. The miRDE series sequence is described in FIG. Synthetic siRNA was purchased from IDT. The calcium phosphate method with plasmid transfer was used. HFF was electroporated using Neon (Invitrogen) under pre-titrated conditions.

Example 1 Differential expression control for miR-17-92 clusters by clinical isolate HCMV

MiRNA microarray analysis was used to analyze the host miRNA expression profile due to clinical isolate HCMV infection as described in the experimental method. HFF cells were infected with the clinically isolated HCMV strain Toledo, and the attenuated virus strain used the ToledoΔ15kb rule, resulting in the deletion of the 15-kb genomic region of UL / b '(Wang et al., 2005. J Virol 79: 2115-2123).

The results are shown in FIG. Several host miRNAs were regulated by HCMV infection. Specifically, miR-100, miR-199a-3p, miR-199a-5p, and miR-199b-5p were down-regulated to Toledo-wild type (WT) and ToledoΔ15kb infections. In particular, miR-29a / b / c, miR-125b, miR-199a-3p, and miR-199a-5p were down regulated at the primary miRNA level. In particular, Toledo-WT differentially regulated the concentration of mature miRNA in the miR-17-92 cluster. The miR-17-92 cluster contains the following six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92a. These are classified into the following four families according to the seed sequence: miR-17 (miR-17 and miR-20a), miR-18 (miR-18a), miR- -92 (miR-92a) (Fig. 1B).

Northern blot and qRT-PCR analysis down-regulated the two homologous mature miRNAs of Toledo-WT, miR-17 and miR-20a, but miR-18a, miR-19a, miR-19b, and miR- (Figs. 1C and 1D). This differential control was observed only in Toledo-WT and not in ToledoA15kb-infected cells. Toledo A15kb infection increased miR-17 and miR-20a expression (Fig. 1e). The results were similar to the attenuated HCMV strain AD169 ToledoΔ15kb.

These results indicate that Toledo differentially regulates miRNA expression in miR-17-92 clusters through the 15-kb region at post-transcriptional stage.

Example 2 Primary transcription induction and miR-17 and miR-20a downregulation of miR-17-92 clusters due to HCMV infection

Differential expression of individual miRNAs in the same miRNA cluster was not predicted and the effect of Toledo infection on miR-17-92 (pri-miR-17-92) primary transcripts for further identification was investigated. Due to Toledo or ToledoΔ15kb infection, the pri-miR-17-92 concentration gradually increased to 72 hours (hpi) after infection (FIGS. 2a and 2b). Transcription of miR-17-92 clusters is known to be activated by the E2F family (Sylvestre et al., 2007. J Biol Chem 282: 2135-2143), HCMV Immediate early protein 1 (IE1) (Hegemeier et al., 1994. EMBO J 13: 712-7677), and HCMV immediate early protein 2 (IE2) increases the expression of the E2F-response genes (Margolis et al., 1995. J Virol 69: Song and Stinski, 2002. Proc Natl Acad Sci USA 99: 2836-2841). Therefore, in this study, HCMV IE1 and IE2 were thought to be involved in the up-expression of pri-miR-17-92 due to Toledo infection, and expression of IE1 or IE2 resulted in increased expression of pri-miR-17-92 The coexpression of the two types of molecules significantly increased the expression of pri-miR-17-92 (Fig. 2c). In order to observe whether IE1 and IE2 increase the expression of pri-miR-17-92 during the actual infection process, the siRNA specific for IE1 and IE2 was prepared and the IE1 and / -17-92 up-expression was suppressed (Fig. 2d). This indicates that HCMV IE1 and IE2 play a role in the induction of primary miR-17-92 transcription.

Northern blot analysis revealed that the concentration of approximately 60-nt precursor miRNA (pre-miRNA) of miR-20a was gradually increased during the infectious period to determine the downregulation of mature miR-17 and miR- (Fig. 2E, long-term exposure). In contrast, the approximately 23-nt mature miR-20a concentration was significantly reduced during infection (Fig. 2e short term exposure). The mature miR-17 concentration also decreased in a similar manner (Fig. 2e, lower panel). These results indicate that Toledo initially induced the transcription of pri-miR-17-92 and subsequently down-regulated the miR-17 and miR-20a mature miRNAs of the miR-17 family of miR-17-92 clusters .

Example 3 miR-17 and miR-20a degradation by HCMV-specific RNA as a clinical isolate through sequence-specific RNA-miRNA interaction

Cells were treated with actinomycin D (ActD), a transcription inhibitor, or cycloheximide (CHX), a translational inhibitor, in order to identify viral factors involved in the selective degradation of miRNAs belonging to the miR-17 family. Due to ActD and CHX treatment, up-expression of miR-19a by Toledo was inhibited (Fig. 3a, left). Indicating that up-expression of Toledo-mediated miR-19a requires RNA and protein synthesis. In particular, the reduction in miR-17 expression induced by Toledo was blocked by ActD, but not CHX, indicating that viral RNA is involved in down-regulation of miR-17 (Fig. 3a, right). To determine the location of the regulatory sequences in the 15kb-UL / b 'region, we used clones containing a portion of the 15-kb region to determine which induced downregulation of miR-17 (FIG. 3b). As a result, transfer to the HFF cells infected with the clone 3 Toledo A15kb induced down-regulation of mature miR-17 at the time of entry (Fig. 3c, left). In this case, it did not affect the pri-miR-17-92 concentration (Fig. 3c, right). Within the 3 kb region of clone 3, a main polycistron transcript of approximately 1.6 kb is located (He et al., 2011; Stern-Ginossar et al., 2012). This transcript (hereinafter UL144-145 RNA) includes the 5'UTR, the UL144 ORF, the intergenic region, the UL145 ORF, and the 3'UTR sequence (FIG. 3D). To investigate the association between viral RNA elements and miRNA degradation (Fig. 3A), whether the UL144-145 RNA element alone could mediate miRNA degradation was determined using the bioinformatic algorithm NA Hybrid rule. As a result, it was found that the miRNA binding site was located in the intergenic region of UL144-145 RNA (FIG. 3D). According to the previous analysis of the secondary structure of the intergenic region of the UL144-145 RNA (Zuker, 2003. Nucleic Acids Res 31: 3406-3415), the miR-17 binding site was divided into six base pairs complementary to miR-17 , And a nucleotide sequence that does not form a protruded base pair of two parts (FIG. 3E). According to a three-dimensional structural analysis using the Rosetta program (Das and Baker, 2007. Proc Natl Acad Sci USA 104: 937-945), the 6 base pair duplexes are flexed inward, 17 binding (see A in FIG. 3I).

Overexpression of UL144-145 RNA in HEK293T cells induced down-expression specific to miR-17 and miR-20a in a dose-dependent manner, with no change in miR-19a concentration (Fig. This result disappeared when the UL144-145 RNA was responsible for the degradation of miR-17 and miR-20a and contained a triple substitution mutation at the site of the binding site for miR-17 (Fig. 3g). These results indicate that UL144-145 RNA has sequence-specific interactions with miRNAs. UL144-145 To investigate the importance of sequence-specific interactions among RNA-mediated miRNA breakdowns, we examined whether UL144-145 RNA could be targeted to other miRNA families.

Substitution of the miR-17 binding site of UL144-145 RNA with the miR-18a binding site resulted in degradation of miR-18a, whereas miR-17 and miR-20a did not degrade (FIG. In addition, a point mutation complementary to the seed sequence of miR-92a was generated in UL144-145 RNA, resulting in miR-92a specific degradation (Fig. 3i). These results indicate that the degradation of UL144-145 RNA mediated miRNAs occurs in a sequence-specific manner.

Example 4 Identification of non-coding RNA elements of virus inducing miRNA degradation

To identify the core sequences involved in the degradation of the miR-17 family members and to characterize the interaction with the target, a series of fireflies based on the 240 nt intergenic region containing the miR-17 binding site Luciferase reporter vector was constructed (Fig. 4A). Firefly-736nt and firefly-240nt vectors regulated down-expression of miR-17 and miR-20a (FIG. 4b). This indicates that the 240 nt region of UL144-145 RNA (Fig. 7) is a sequence sufficient for down-regulation of the miR-17 family. Based on the luciferase activity of firefly-240 nt of cells overexpressing miR-17 or miR-20a, there was no miR-17 or miR-20a targeting firefly-240nt RNA. The absence of observed phenomena in normal miRNA-mRNA interactions suggests degradation of miRNA or mRNA. Firefly-30nt did not down-regulate the miR-17 transcript concentration, indicating that miR-17 alone was not sufficient for miR-17 binding alone (Fig. 4c). A series of deletion variants were constructed to identify the minimal sequence required for miR-17 degradation. As a result, it was found that a 20-nt (Δ3-2 to Δ3-6 region) sequence adjacent to the 30-nt miR-17 binding site was required (FIGS. 4d to 4f).

Thus, this ~ 50-nt viral gene interregional coding region sequence indicates that the miRNA decay element (miRDE, see SEQ ID NO: 7) acts as a degradation element. The miRDE-50-mer_WT oligomer corresponding to the miRDE was prepared and transferred to the cells. As a result, the miR-17 level was decreased in a concentration-dependent manner (FIG. 4g). On the other hand, this phenomenon was not observed when miRDE-50-mer-seed mut mutagenesis transferred to the miRDE-17 mutant site (FIG. 4h). The down-regulation efficiency was also decreased in the case of the 30-mer RNA oligo (miRDE-30-mer) containing only the miR-17 binding site (Fig. These results indicate that the RNA sequence of the 50-mer viral gene-coding region is important for miR-17 family microRNA regulation and is independent of mRNA context.

Example 5 Differential regulatory loss of miR-17-92 clusters of HCMV including miR-17 binding site mutations

Following miR-17 and miR-20a regulatory testing using expression vectors and RNA oligomers as described above, miRNA-mediated miRNA regulation by viral infection was tested. To this end, a Toledo mutant virus (Toledo [Delta] 17Seed) and its revertant virus (Toledo-Rev) containing a mutation with three nucleotide sequences at the miRDE seed binding site for miR-17 was generated (Fig. The concentrations of miR-17 and miR-20a matured in cells infected with Toledo-WT and Toledo-Rev were reduced, while their concentrations were significantly increased in cells infected with ToledoΔ17 Seed (FIG. miR-17 transcript precursor concentrations were increased in all three viral infections (Fig. 5b), with similar concentrations of pri-miR-17-92 and UL144-145 transcripts (Fig. 5c and Fig. 5d).

We then investigated whether miRDE degrades mature miR-17 through a pulse chase experiment using the synthesized miR-17 duplex. The amount of exogenous miR-17 / miR-17 * duplex was adjusted to the titer of endogenous miR-17. HFF was transfected into the miR-17 / miR-17 * duplex after infection with Toledo-WT or ToledoΔ17Seed. The residual miR-17 concentration was then measured over time. As a result, Toledo-WT infected cells showed a higher rate of exogenous miR-17 degradation compared to ToledoΔ17Seed (FIG. 5e). These results indicate that miRDE promotes degradation of mature miR-17 even in viral infections.

Example 6 miRDE - Mediated miR -17 family  Facilitation of virus generation by regulation

HFF cells were infected with 2 MOI of Toledo-WT or Toledo [Delta] 17 Seed, and the effect on miRDE-mediated miR-17 regulation in the lytic state was tested to see the effect in real physiological condition. At 2-4 days post-infection (dpi), ToledoΔ17Seed-infected HFFs produced less virus production than Toledo-WT infected HFFs. Virus production peaked at 5 dpi in Toledo-WT and ToledoΔ17 Seed, presumably due to limited environmental conditions (FIG. 6A). The synthesis of viral genome was delayed and decreased in the cells infected with ToledoΔ17Seed (FIG. 6b), and the expression of the viral gene was partially reduced at 2 dpi, but at 3-4 dpi, the expression was similar to that of Toledo-WT infected cells 6c). In particular, ToledoΔ15kb has a slower growth rate compared to parental virus, and it is believed that delayed growth of ToledoΔ15kb is due to an abnormality in miR-17 regulation in light of the previous report that it produces infectious virus later in the day. Taken together, these results indicate that degradation of miR-17 promotes viral growth during lytic infection and miR-17 degradation is a necessary process for the synthesis of an effective viral genome. The functional significance of the regulation of the miR-17 family of miRDE-mediated miR-17-92 clusters can also be verified from the fact that the miRDE sequences of all clinically isolated HCMV are conserved (Figure 6d). A comparison of the sequence of the 4.2-kb genomic region encoding UL147 in UL142 from 14 HCMV clinical isolates showed that sequences were conserved at a significantly higher level in the intergenic region containing miRDE. In particular, the miR-17 binding site was almost completely conserved in all HCMV clinical isolates, indicating that the virus was adapted to respond to modulation by intracellular miRNAs during evolution.

While the present invention has been described in connection with what is presently considered to be the preferred embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, .

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. The contents of all publications referred to herein are incorporated herein by reference.

Claims (16)

With a polynucleotide for microRNA regulation
The microRNA is a microRNA of a family of miR-17, miR-18, miR-19, or miR-92 belonging to the miR-17-92 microRNA cluster,
The polynucleotide comprises the sequence of 5'-X ₁ -YX ₂ -CGUGUCUGAWUAUCUGUGGG-3 'as an RNA,
W is G or A in the above sequence, X ₂ is a sequence complementary to the seed sequence of the microRNA having a length of 8 to 10 nt, Y is a sequence of the microRNA having no internal secondary structure of 7-8 nt in length And X ₁ is a sequence complementary to a consecutive 7 to 9 nt sequence located 3 to 4 nt from the seed sequence of the microRNA in the 3 'direction. 2. The polynucleotide according to claim 1,
2. The method of claim 1, wherein X ₂ is a micro adjustment RNA polynucleotide comprising the sequence of a complementary, GCACUUU, GCACCUU, UUUGCAC GUGCAAU or to the seed sequence of each family.
The microRNA-regulating polynucleotide according to claim 1, wherein the polynucleotide for regulating microRNA controls microRNAs of a family of miR-17, miR-18, miR-19, or miR-92 belonging to miR-17-92 microRNA clusters, -17 is 5'-UCCUGCACUAAAAAAAGAAGCACUUUACGGCGUGUCUGAGUAUCUGUGGG-3 'or 5'-UCCUGCACUAAAAAAAGAAGACAUUUACGGCGUGUCUGAWUAUCUGUGGG-3';5'-UUCUGCACUAAAAAAAGAUGCACCUUACGGCGUGUCUGAGUAUCUGUGGG-3'for miR18 regulation; miR_19 modulator is 5'-UGUUUUGCAAAAAAAAGGAUUUGCACACGGCGUGUCUGAGUAUCUGUGGG-3 '; And the miR92 regulatory sequence comprises 5'-UAGGCCGGGAAAAAAAGAAGUGCAAUACGGCGUGUCUGAGUAUCUGUGGG-3 '.
2. The polynucleotide of claim 1, wherein the modulation is by the binding of the polynucleotide to the microRNA, wherein each microRNA is degraded.
A vector comprising DNA corresponding to the polynucleotide according to claim 1.
6. A cell comprising a vector according to claim 5.
A composition for treating cancer comprising the polynucleotide according to claim 1.
delete 8. The composition according to claim 7, wherein the cancer is lymphocytic leukemia, undifferentiated thyroid cancer, or malignant lung cancer.
8. The composition of claim 7, wherein the cancer is cancer associated with a miR-17-92 microRNA cluster.
11. The composition according to claim 10, wherein the cancer associated with the miR-17-92 microRNA cluster is a lymphoma, a lymphoma, a lymphocytic leukemia, or a leukemia.
As an HCMV proliferation inhibitor screening method,
providing at least one of the microRNAs of a miR-17-92 cluster comprising miR-17, miR-18, miR-19, and miR-92 family;
HCMV having a sequence which binds to the seed sequence of each of the above-mentioned families including GCACUUU, GCACCUU, UUUGCAC or GUGCAAU which binds to the microRNA of each of the above-mentioned families, and a sequence containing CGUGUCUGAWUAUCUGUGGG-3 ' Providing a polynucleotide for regulating the microRNA derived from the microRNA;
Treating the test substance expected to inhibit the interaction of the microRNA and the polynucleotide; And
Selecting a candidate compound as a candidate compound that inhibits the interaction with the test substance in comparison with a control group not treated with the test substance.
delete 13. The method according to claim 12, wherein the microRNA is provided in the form of a cell containing the HCMV virus.
15. The method of claim 14 wherein the cells HEK293T, HFF, HUVEC, THP-1, U373MG or in, HCMV virus proliferation inhibitor screening method.
A method of modulating microRNAs in a cell or an Invitro comprising contacting a polynucleotide according to claim 1 with a microRNA.

Images