KR20070115321A - The inhibition method of microrna - Google Patents

Abstract

An inhibition method of microRNA is provided to inhibit RNA interfering by inhibiting production of mature microRNA by using an anti-oligonucleotide complementarily binding to a primary microRNA within a cell, so that the method is useful for treating cancer disease. An anti-oligonucleotide molecule capable of complementarily binding to a primary microRNA within a cell has the length of 15-40 nucleotides and is prepared by (1) selecting the target primary microRNA sequence, (2) sequencing a single strand end of the selected primary microRNA and (3) synthesizing the anti-oligonucleotide complementary to the identified sequence of single strand end. A recombinant expression vector contains a gene encoding the anti-oligonucleotide molecule and is selected from plasmid, lentiviral vector, retroviral vector and adenoviral vector. A disease treating agent contains the anti-oligonucleotide molecule or the recombinant expression vector. The RNA interfering is inhibited by in vivo, in vitro or exo vivo administration of the anti-oligonucleotide molecule in an amount sufficient to inhibit a process of target primary microRNA.

Description

{Inhibition method of microRNA}

1 is a conceptual diagram illustrating RNA interference between siRNA and microRNA (hereinafter referred to as “miRNA”).

FIG. 2 shows pri-miRNA process assay results of 16-ΔBS, 16-5′BS, 16-3′BS variants:

    A: structure of the variant; And

    B: pri-miRNA process assay gel.

3 shows the results of pri-miRNA process assay after anti-oligonucleotide treatment:

    A: pri-miRNA structure and antioligonucleotide sequence; And

    B: pri-miRNA process assay gel.

The present invention relates to a method of inhibiting microRNA, and more particularly, to a method of inhibiting microRNA using an anti-oligonucleotide that complementarily binds to primary microRNA (primary-microRNA).

Small RNA refers to ribonucleic acid having a length of about 17 to 25 nucleotides (hereinafter referred to as “nt”) that plays a role in regulating gene expression in vivo. sRNAs are largely classified into microRNAs (hereinafter referred to as "miRNA") and small interfering RNAs (hereinafter referred to as "siRNA") depending on the manner in which they are generated. miRNAs are partially produced from double-stranded hairpin RNAs, and siRNAs are derived from long double stranded RNAs (hereinafter referred to as “dsRNAs”). SRNAs are miRNAs, and sRNAs used to experimentally regulate the expression of specific genes are classified as siRNAs. MiRNAs are naturally produced in cells and are assigned to specific messenger RNAs (hereinafter referred to as `` mRNAs ''). It specifically binds to inhibit the process of protein production from mRNA, and siRNA is an sRNA that is artificially introduced into cells and is known to bind to specific mRNA having a complementary sequence to degrade the mRNA. RNA intergerence (hereinafter referred to as `` RNAi '') refers to the phenomenon of gene suppression by sRNA in a broad sense, and generally refers to a method of directly introducing a siRNA produced through chemical synthesis into a cell and a virus or plasmid. The method of generating siRNA in a cell using a vector is used (refer FIG. 1).

miRNAs are 19-25 nt long single stranded RNA (hereinafter referred to as 'ssRNA') molecules and are endogenous hairpin-shaped transcripts (Bartel, DP, Cell 116: 281-). 297, 2004; Kim, VN, Mol Cells 19:... is produced by the 1-15, 2005) is acting as a miRNA gene depressor (post-transcriptional gene suppressor) in conjunction with complementary to the target mRNA after transcription and, induced inhibition of translation and mRNA destabilization.. miRNA and a strong association between cancer has been proved recently emerged as a new field of research in cancer biology, and (Esquela-kerscher, A. and Slack , FJ, Nat. Rev. cancer 6 ( 4): 259-269, 2006), miRNA expression changes dramatically during development and cell differentiation, and the miRNA profiling has shown reliable results at the developmental line and disease stages (Lu, J. et. al ., Nature 435: 834-838, 2005). It could also be appreciated how the above molecule produced is controlled over a previous analysis of the control network for the miRNA function (Kim, VN Nat Rev Mol Cell Biol 6:..... 376-385, 2005).

miRNA biosynthesis is initiated by the transfer by the RNA polymerase raised Ⅱ (Cai X., et al, RNA 10: 1957-1966, 2004; Kim, VN Nat Rev Mol Cell Biol 6:....... 376- 385, 2005; Lee, Y., et al ., EMBO J 21: 4663-4670, 2002; Lee, Y., et al ., EMBO J 23: 4051-4060, 2004). Primary miRNAs (hereinafter referred to as "pri-miRNAs") are usually over several Kb in length and include a 5 'cap and a poly A tail. pri-miRNA has been described in ribocuclease III, Drosha (Lee, Y., et. al ., Nature 425: 415-419, 2003) and its subelements DGCR8 (Gregory, RI et. al ., Nature 432: 235-240, 2004; Han, J., et al ., Genes Dev . 18: 3016-3027, 2004; Landthaler, M., et al ., Curr . Biol . 14: 2162-2167, 2004), which was first cleaved by a complex called a microprocessor to separate the hairpin-structure precursor (pre-miRNA) on the order of 65 nt. Recombinant DGCR8 or Drosha protein singly does not have cleavage activity in the pri-miRNA process, and cleavage activity when the two proteins combine, indicating that the two proteins act as the most important role of the pri-miRNA process. Gregory, RI et al ., Nature 432: 235-240, 2004; Han, J., et al ., Genes Dev . 18: 3016-3027, 2004). The pri-miRNA process is a central step in miRNA biosynthesis and is defined as the process of generating one end of a molecule containing an mRNA sequence in a long pri-miRNA. The pre-miRNA generated after the initiation process is transported to the cytoplasm by nuclear transport element Exp5 (exportin-5) (Bohnsack, MT, et. al ., RNA 10: 185-191, 2004; Lund, E., et al., Science 303: 95-98, 2004; Yi, R., et al ., Genes Dev . 17: 3011-3016, 2003). In the cytoplasm, the pre-miRNA delivered by Dicer, a RNase III type protein in the cytoplasm, is cleaved to generate a miRNA duplex of about 22 nt. One strand of the Dicer product is a mature miRNA that is present in the cytoplasm and assembled with an effector complex called a microribonucleoprotein (miRNP) or a miRNA-induced silencing complex (miRISC) (Khvorova, A., et. al ., Cell 115: 209-216, 2003; Schwarz, DS, et al ., Cell 115: 199-208, 2003).

RNAi, a gene silecing mechanism by sRNA, has been used as an effective gene research tool in mammalian systems. Effective and stable gene knockdown occurs by expressing small hairpin RNA (hereinafter referred to as “shRNA”) and processing into small interfering RNA (siRNA). Recent breakthroughs in RNAi technology have been made by making shRNA expression cassettes that mimic natural miRNA genes (Dickins, RA, et. al ., Nat. Genet . 37: 1289-1295, 2005; Silva, JM et al ., Nat . Genet . 37: 1281-1288, 2005: Zeng, Y., et al ., Mol . Cell 9: 1327-1333. 2002). MiRNA-based shRNAs regulated by RNA polymerase II promoters effectively and stably induce gene silencing regulation in cultured cells such as animal models.

Recent reports suggest that overexpression of miRNA-17 clusters and miR-155 is associated with cancer development (Croce, CM and Calin, GA, Cell 122: 6-7, 2005; Hayashita Y., et. al ., Cancer Res ., 65 (21): 9628-32, 2005).

The present inventors have completed the present invention by making anti-oligonucleotides that complementarily bind to the single-stranded fragment portion of pri-miRNA, confirming that the pri-miRNA process is not efficient.

It is an object of the present invention to provide a method for inhibiting RNA interference using antioligonucleotides that complementarily bind to primary microRNAs in cells.

To achieve the above object, the present invention provides an antioligonucleotide molecule that complementarily binds to a target primary microRNA (hereinafter, referred to as “pri-miRNA”) in a cell.

The present invention also provides a gene encoding the anti-oligonucleotide sequence.

The present invention also provides a recombinant expression vector comprising a gene encoding the anti-oligonucleotide sequence.

In another aspect, the present invention provides a method for inhibiting RNA interference phenomenon comprising the step of tuning the anti-oligonucleotide molecule in vivo, ex vivo, exo vivo at a dose sufficient to inhibit the target pri-miRNA process do.

The present invention also provides a method for preparing an antioligonucleotide molecule.

Hereinafter, the words of the present invention are defined.

Small RNA (hereinafter referred to as "sRNA") refers to ribonucleic acid having a length of 19 to 25 nucleotides (hereinafter referred to as "nt") that plays a role in regulating gene expression in vivo.

MicroRNA (hereinafter referred to as “miRNA”) is a single-stranded RNA molecule that is produced from partially double-held hairpin RNA and is 19-25 nt in length and is referred to as a messenger RNA (hereinafter referred to as “mRNA”). ) Refers to sRNA that binds specifically to and plays an important role in various regulation processes in vivo.

Small interfering RNA (hereinafter referred to as "siRNA") is produced from long double stranded RNA and specifically binds to messenger RNA (mRNA). By inhibiting gene expression refers to sRNA plays an important role in various regulation processes in vivo.

Primary miRNA (hereinafter referred to as "pri-miRNA") is produced through transcription by RNA polymerase II from DNA, and includes a 5 'cap and a poly A tail, It is a molecule of hairpin structure, usually of several Kb in length.

A miRNA precursor (precursor microRNA: hereinafter referred to as 'pre-miRNA') is a molecule whose primary miRNA is cleaved by the Drosha-DGCR8 complex and has a hairpin-structure of about 65 nt.

Anti-oligonucleotides are molecules that complementarily bind to a single stranded fragment portion of pri-miRNA.

Hereinafter, the present invention will be described in detail.

The inventors made variants of the single stranded fragment portion of the pri-miRNA structure to perform the in vitro pri-miRNA process. As a result, the pri-miRNA molecule that lost the single stranded fragment portion did not undergo the in vitro pri-miRNA process (see FIG. 2). The present inventors speculate that an important element in the pri-miRNA process is the single-stranded fragment portion, and produced an antioligonucleotide that complementarily binds to the single-stranded fragment portion of the pri-miRNA, and reacted with the wild-type miRNA molecule. As a result, it can be seen that the efficiency of the ex vivo pri-miRNA process is reduced (see FIG. 3). The pri-miRNA process is an important part of the RNA interference by miRNA. If the efficiency of the pri-mRNA process decreases, it will affect the production of miRNA precursors and mature miRNA, which will affect the RNA interference phenomenon. Through these results, the anti-oligonucleotide of the present invention can reduce the efficiency of the pri-miRNA process, thereby reducing the production of miRNA precursors, affect the formation of mature miRNA, can suppress the phenomenon of RNA interference by mature miRNA It was confirmed that there is.

The present invention provides antioligonucleotide molecules that complementarily bind to a target pri-miRNA single strand fragment portion in a cell.

The antioligonucleotides of the present invention bind complementarily to a single stranded fragment portion of pri-miRNA, wherein the 5 'terminal portion of the anti-oligonucleotide binds complementarily to the 3' terminal portion of the single stranded fragment portion of pri-miRNA and The 3 'terminal portion of the antioligonucleotide binds complementarily with the 5' terminal portion of the single stranded fragment portion of the pri-miRNA. In this case, only one of the 5 'strand or the 3' strand may be complementarily bound, and the 5 'strand and the 3' strand may be complementarily bound to the DIDwhR. In addition, the center of the anti-oligonucleotide of the present invention includes an AA sequence, but is not limited thereto. It is preferable that the anti-oligonucleotide of this invention is 15-40 nucleotides in length. In addition, the anti-oligonucleotide is not limited to a specific nucleotide sequence, as long as the sequence complementary to the single-stranded fragment of the target pri-miRNA, any sequence can be used as the anti-oligonucleotide sequence of the present invention. In addition, the anti-oligonucleotide of the present invention may be deoxyribonucleic acid (DNA) or ribonucleic acid (DNA).

The present invention also provides a gene encoding the anti-oligonucleotide sequence.

The anti-oligonucleotide molecules of the present invention can be synthesized by standard methods known in the art, such as by an autocyclic DNA synthesizer (eg Bioserch, Applied Biosystems). Anti-oligonucleotides by this synthesis can be used directly as described below or cloned into expression vectors by methods known in the art.

The anti-oligonucleotide molecule of the present invention can be prepared in the form of a chemical modification such as 2-O-methyl group or locked nucleic acid.

The present invention also provides a recombinant expression vector comprising a gene encoding the anti-oligonucleotide sequence.

The recombinant expression vector of the present invention may be constructed by recombinant DNA methods known in the art. The expression vector may be selected from the group consisting of plasmids, lentiviral vectors, retroviral vectors, adenoviral vectors known in the art, which are used for replication and expression in mammalian cells or other target cell types. A gene encoding the nucleotide sequence of the recombinant pri-miRNA may be synthesized and inserted into an expression vector.

The present invention also provides a transformant prepared by introducing the expression vector into a host cell. The expression vector into which the gene encoding the anti-oligonucleotide sequence is inserted can be introduced into a host cell by a method known to those skilled in the art. Introduction methods include, but are not limited to, electroporation and lipofection, and methods known in the art may be selected. Cells that can be used in the present invention may be selected from the group consisting of E. coli, yeast, heart cells, lymphocytes, liver cells, vascular endothelial cells, spleen cells, cancer cells, animal cell lines such as CHO, Cos7, NIH3T3, insect cells, Without limitation, all cells in which RNA transcription is caused by Polymerase II can be used as host cells.

In addition, the present invention provides a non-transformed animal in which at least one cell of an animal other than human contains the anti-oligonucleotide, and wherein the anti-oligonucleotide is expressed in the cell to inhibit RNA interference of a target miRNA. to provide.

Preferably, the animals are wild type or transgenic animal models. In addition, the animals can be used as a model system for the development of therapeutic agents that regulate gene or polypeptide activity or expression targeted to the study, destruction of diseases caused or exacerbated by overexpression or non-expression of target genes.

Transformed animals include breeding animals (pigs, goats, sheep, cows, horses, rabbits, etc.), rodents (rats, guinea pigs, mice), non-human primates (bibi, monkeys, chimpanzees), and pets (dogs, Cats). Invertebrates such as Caenorhabditis elegans and Drosophila and non-mammalian vertebrates such as fish such as zebrafish and birds such as chickens can also be used. The transformed animal can be used to breed additional animals carrying the transgene. In addition, cells obtained from the transformed animal or the progeny of the animal may be cultured to prepare primary, secondary, or immortalized cell lines containing the transplant gene. The production process of the transgenic animal may use a method known in the art.

The present invention also provides a therapeutic agent for diseases comprising the anti-oligonucleotide and / or the expression vector.

The anti-oligonucleotide and / or the expression vector of the present invention may be included in a pharmaceutical composition and used as a therapeutic agent for a disease. The therapeutic agent for a disease of the present invention includes a pri-miRNA molecule alone and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include solvents suitable for pharmaceutical administration, dispersion media, gotting, antibacterial and antimicrobial agents, isotonic and absorption delaying agents, and the like, and may further include reinforcing active compounds.

The therapeutic agent for a disease of the present invention may be formulated to be suitable for the route to be administered. Examples of routes of administration include parenteral or oral administration, such as intravenous, blood, subcutaneous, inhalation, transdermal (local), mucosal and rectal. Solutions or suspensions used for oral administration such as blood or subcutaneous administration include solvents for injection, saline solutions, fixed oils, aseptic diluents such as polyethylene glycol, glycerin, propylene glycol or other synthetic solvents, such as benzine alcohol or methyl parabens. Bacterial agents; Antioxidants such as ascorbic acid or sodium sulfite; Chelating agents such as ethylenediaminetetraacetic acid; Buffers such as acetate, citrate or phosphate and extender modifiers such as sodium chloride or dextrose may be included. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral formulations may be sealed with ampoules, disposable syringes, multiple dose vials made of glass or plastic.

Suitable disease therapeutic agents for injection include sterile aqueous solutions or dispersions and sterile powders for the instant preparation of sterile injections or dispersions. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, CremophorEL ^™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the disease treatment agent must be sterile and must be fluid to the extent that it can be easily injected. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be, for example, a solvent or spray medium containing water, ethanol, polyols (glycerol, propylene glycol and liquid polyreylene glycol, etc.), and suitable mixtures thereof. By using a coating such as for example lecithin, proper fluidity can be maintained by maintaining the required particle size in the case of by-products and by using surfactants. Microbial action can be prevented by various antibacterial and antibacterial agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. It is preferable that sugars, polyhydric alcohols such as mannitol, sorbitol, and isotonic agents such as sodium chloride are included in the disease treatment agent. Prolonged absorption of the injectable composition can be achieved by, for example, incorporating delayed absorption agents such as aluminum monostearate and gelatin in the treatment of disease.

Sterile injectable solutions can be prepared by incorporating the required active ingredient in one or a combination of the ingredients described above in a suitable solvent and, if necessary, by filter sterilization. Generally, dispersions can be prepared by incorporating a sterile vehicle in which the active ingredient can contain a basic dispersion medium and the required other ingredients from those described above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization, by which methods powders of the desired components can be obtained from the active ingredient and the previously sterilized filtration solution.

Oral disease therapeutic agents generally include an inert diluent or an edible carrier. For oral therapeutic administration, the active ingredient is incorporated into excipients and used in capsules in the form of tablets, troches, or gelatin. Oral disease therapies can also be prepared using fluid carriers for use as mouthwashes. Pharmaceutically suitable binders and / or adjuvant materials may be included as part of the disease treatment. Tablets, pills, capsules, troughkeys, and the like may contain any or a mixture of similar properties of the following components: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; Excipients such as starch or lactose, disintegrants such as alginic acid, Primogel ^™ or corn starch; Lubricants such as magnesium stearate or Sterotes ^™ ; Gildants, such as silicon dioxide in the colloidal state; Sweetening agents such as sucrose or saccharin; Or flavoring agents such as peppermint, methyl salicylate, or orange flavor. Oral or parenteral disease therapeutic agents are advantageously formulated in dosage unit form to facilitate uniformity under dose administration.

Toxicity and therapeutic efficacy of a therapeutic agent for a disease of the present invention is determined by measuring LD ₅₀ (the dose at which 50% of the test group is lethal) and ED ₅₀ (the dose at which 50% of the test group is therapeutic). It can be measured by standard pharmaceutical procedures. The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio of LD50 / ED50. Preference is given to disease treatments which exhibit a high therapeutic index. Since therapeutic agents with toxic side effects may be used, delivery systems should be designed to target the site of affected tissues of such therapeutic agents in order to reduce side effects by minimizing possible damage to uninfected cells.

Suitable doses of the therapeutic agent for a disease of the invention depend on the efficacy of the molecule (pri-miRNA molecule of the invention) with respect to the expression or activity to be controlled. If the pri-miRNA molecule of the present invention is to be administered to an animal, the physician, veterinarian or researcher may first prescribe a low dose and then increase the dose until a suitable response is obtained. In addition, specific dosage levels for a particular subject may vary depending on the activity of the specific compound employed, the age, body weight, general health of the patient, sex and diet, time of administration, route of administration, rate of excretion, the drug being formulated, and the expression to be controlled or It depends on several factors, including the degree of activity.

The disease therapeutic agent of the present invention can be targeted to cancer, viral infections, genetic diseases, metabolic diseases, immune diseases, neurodegenerative diseases, eye diseases, and the like. The practitioner selects a protein having a significant influence on the cause or metabolism of the disease as a target protein, examines the pri-miRNA molecule complementary to the gene sequence encoding the target protein, and designs the anti-oligonucleotide of the present invention. The disease can be treated effectively by inhibiting gene silencing for the target protein (Dykxhoorn, DM, et. al ., Gene Ther . 13: 541-552, 2006; Gartel, AL, et al ., Biomol . Eng . 23: 17-34, 2006; Paulson, H. Neurology 66: S114-117, 2006; Rossi, JJ Biotechniques Suppl , 25-29, 2006). It can also be used to treat cancer by inhibiting miRNA-17 clusters and miR-155, which are associated with cancer development, according to recent studies (Croce, CM and Calin, GA, Cell 122: 6-7, 2005; Hayashita Y ., et al ., Cancer Res ., 65 (21): 9628-32, 2005).

In addition, the present invention is to inhibit the RNA interference phenomenon comprising the step of administering the anti-oligo cure oligonucleotide molecules in vivo, ex vivo, exo vivo at a dose sufficient to inhibit the process of the target pri-miRNA Provide a method. Dosage varies depending on the weight, age, sex, health condition, diet, time of administration, method of administration, rate of excretion and severity of the patient.

The present invention also provides a method for producing an anti-oligonucleotide molecule that suppresses RNA interference.

The present invention provides a method for preparing an anti-oligonucleotide molecule comprising the following steps: 1) selecting a pri-miRNA sequence to be inhibited; 2) identifying the sequence of single-stranded ends in the pri-miRNA selected in step 1); And 3) synthesizing an antioligonucleotide complementary to the single stranded terminal sequence identified in step 2).

In the production method, the selection method of step 1) is preferably using a known pri-miRNA gene sequence, or using a homology search or a prediction program using a genome sequence DB, http: // microrna .sanger.ac.uk / sequences /, http://genome.ucsc.edu/, http://www.bioinfo.rpi.edu/~zukerm/rna/mfold-3.html, http: // www. It is more preferable to search through a DB selected from the group consisting of ncbi.nlm.nih.gov / and the like.

In addition, the present invention provides a method for producing an anti-oligonucleotide recombinant expression vector.

The present invention provides a method for producing an anti-oligonucleotide recombinant expression vector comprising the following steps: 1) searching for a primary microRNA sequence having a sequence complementary to a target mRNA; 2) determining an antioligonucleotide sequence encoding a sequence complementary to the sequence retrieved in step 1); 3) preparing an expression vector comprising a gene encoding the determined antioligonucleotide sequence of step 2); And 4) transforming the expression vector of step 3) into an animal except a host cell and / or a human.

In the above production method, the selection method of step 1) preferably uses a known pri-miRNA gene sequence or a search using a homology search or a prediction program using a genome sequence DB, and http: // microrna .sanger.ac.uk / sequences /, http://genome.ucsc.edu/, http://www.bioinfo.rpi.edu/~zukerm/rna/mfold-3.html, http: // www. It is more preferable to search through a DB selected from the group consisting of ncbi.nlm.nih.gov / and the like.

In the above production method, the expression vector of step 3) is preferably selected from the group consisting of plasmids, lentiviral vectors, retroviral vectors, adenovirus vectors.

In the production method, the host cell of step 4) is E. coli, yeast, animal cell line heart cells, lymphocytes, liver cells, vascular endothelial cells, spleen cells, cancer cells, CHO, Cos7, NIH3T3 cell line, insect cells It is preferred to be selected.

In the above production method, animals other than the human of step 3) are mammalian vertebrates such as mice, rats, rabbits, guinea pigs, pigs, sheep, goats, monkeys, baboons, chimpanzees, dogs, cats, Fish such as zebrafish, non-mammalian, including birds such as chickens, preferably selected from the group consisting of invertebrates, such as vertebrates, election, fruit flies, but is not limited thereto.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following Examples illustrate the present invention in detail, and the content of the present invention is not limited by the Examples.

< Example  1> recombination DGCR8  Protein and Drosha  refine

HEK293T cells (ATCC, USA) were transformed with FLAG-DGCR8 expression vector and purified by Han et al. (Han et. al . , GENES & DEVELOPMENT , 3016-3027, 2004). After 2 days, transformed HEK293 T cells were harvested and disrupted using cold buffer D-K'200 (20 mM Tris, pH 8.0, 200 mM KCl, 0.2 mM EDTA, 0.2 mM PMSF). The lysate was centrifuged at 13,200 rpm for 15 minutes at 4 ° C., and the supernatant was treated with 50 μg / ml of RNase A and reacted at 4 ° C. for 30 minutes. The reaction was reacted with agarose bead (Sigma, USA) to which anti-FLAG antibody (Sigma, USA) was bound for 120 minutes at 4 ° C while stirring. Beads four times with D-Na'2500 buffer (20 mM Trks, pH 8.0, 2.5 M NaCl, 0.2 mM EDTA, 0.2 mM PMSF, 1% Triton X-100), FLAG-elution buffer (50 mM Tris, pH 7.4 , 150 mM NaCl) three times. The protein was eluted at 4 ° C. for 60 min with FLAG-elution buffer containing 400 μg / ml, 3X FLAG peptide (Sigma, USA), and concentrated to 20 ng / ml with Centricon YM-30 (Millipore, USA).

< Example  2> single stranded fragment part Variant  Production and pri - miRNA  Process implementation

The inventors produced 16-ΔBS, 5'BS, 3'BS, BS-1, BS-2 molecules that mutated the single-stranded fragment of pri-miR-16-1, one of the pri-miRNAs (Fig. 2). The production method is shown in Table 1. Mutagenesis is a method of "minimal pri-miRNAs" developed by the inventors (Han, J., et. al ., Genes Dev . 18: 3016-3027, 2004). To prepare the variant, the pri-miR-16 gene operably linked to the T7 promoter was inserted into the p-GEM-T easy vector (Promega, USA) and named "pNKA57" and used as a template.

In vitro pri-miRNA process was performed using the prepared molecule and Lee et al. (Lee et al ., Nature 425: 415-419, 2003; Lee et al ., EMBO J. 21: 4663-4670, 2002). Specifically, 15 μl of 6.4 mM MgCl 2, 1 unit / μl, Ribonuclease inhibitors (Takara, Japen), 1 × 10 ⁴ to 1 × 10 ⁵ cpm labeled transcript, immunoprecipitation buffer D ′ in 30 μl reaction Included in the mixture. The reaction mixture was reacted at 37 ° C. for 60 minutes. RNA was phenol extracted from the reaction mixture and analyzed by electrophoresis on a 12.5% denaturing urea-polyacrylamide gel. As the RNA size marker (Decade marker, Ambion) was used labeled at the 5 'end. Essentially two synthetic RNAs of 23 nucleotides and 27 nucleotides were labeled at the 5 'end and used as additional size markers. The test subject fragment was then separated from the gel and connected to a 3 'adapter. The linked product was separated from the gel and connected to a 5 'adapter. The 3 'and 5' adapters used for cloning were respectively 5'-pUU Uaa ccg cga att cca gid T-3 '(uppercase: RNA; lowercase: DNA; p: phosphatate; idT: inserted deoxycity Deoxythymidine and 5'-acg gaa ttc ctc act AAA-3 '(uppercase: RNA; lowercase; DNA).

Reverse transcription was done using reverse transcription primer (5'-ACT GGA ATT CGC GGT TAA A-3 ') as set forth in SEQ ID NO: 8. Since the forward primer (5'-CAG CCA ACG GAA TTC CTC CTC ACT AAA-3 ') and reverse primer described in SEQ ID NO: 9 (5'-ACT GGA ATT CGC GGT TAA A) -3 ') was used to amplify by PCR. PCR conditions are as follows. After denaturing at 94 ° C. for 3 minutes, the reaction was repeated 25 times at 94 ° C. for 30 seconds, at 45 ° C. for 30 seconds, and at 72 ° C. for 30 seconds, followed by extension reaction at 72 ° C. for 7 minutes. PCR products were inserted into the pGEM-T-easy (Promega, USA) vector and 10 clones were sequenced.

As described above, as a result of performing the pri-miRNA process with the pri-miRNA single-stage fragment mutation, when the single-stranded fragment was removed from pri-miR-16-1, the in vitro pri-miRNA process did not occur (FIG. 12, 16-ΔBS). Variants with only one of the single stranded fragments (16-5'BS, 16-3'BS) are not effective, but the pri-miRNA process takes place (Figure 2), which leads to 5 'or 3 of the single stranded fragments. It can be seen that the pri-miRNA process can occur even if only one fragment of the strand is included.

Variant  For production PCR  With mold PCR primer Variant Primer sequence (5 '-> 3') (SEQ ID NO) template PCR conditions miR-16- △ BS S: BS-F (TAATACGACTCACTATAGGTCAGCAGTGCCTTAGCAGCAC) (1) AS: BS-R (GTCAACCTTACTTCAGCAGC) (2) pNKA-57 ((miR-16-1 pGEM-T esay) Initial denaturation process at 94 ° C. for 3 minutes, 30 seconds at 94 ° C., 30 seconds at 45 ° C., 30 seconds at 72 ° C., 20 times repeated, extended reaction at 72 ° C. for 7 minutes miR-16-5'BS S: 16-WT-F (TAATACGACTCACTATAGGTGATAGCAATGTCAGCAGTG) (3) AS: BS-R (2) pNKA-57 Same as above miR-16-3'BS S: BS-F (1) AS: 16-WT-R (GTAGAGTATGGTCAACCTTA) (4) pNKA-57 Same as above miR-16-BS1 S: BS1-F (TAATACGACTCACTATAGGCTTAAAATAAGTCAGCAGTGCCTTAGCAG) (5) AS: BS1-R (CATACATCGTGTCAACCTTACTTCAGCAG) (6) pNKA-57 Same as above miR-16-BS2 S: BS1-F (5) AS: BS2-R (GGCTTAAAATAAGCTAACCTTACTTCAGCAG) (7) pNKA-57 Same as above

< Example  3> Anti-oligonucleotide  Production and pri - miRNA  Process implementation

100 pmole of antioligonucleotide DNA was added and mixed with the process reactants. The anti-16-1 sequence used a sequence complementary to the pri-miR-16-1 single strand fragment (5'-GTA GAG TAT GAA ATT GCT ATC ACC-3 ': SEQ ID NO: 11). As a control, a sequence complementary to a single-stranded fragment of pri-miR-30a was used (5'-AAG TCC GAG GAA TCA ACA GCA ACC-3 ': SEQ ID NO: 12).

In vitro pri-miRNA process was carried out using the anti-oligonucleotide prepared above as in Example 2. As a result, the pri-miRNA process was specifically inhibited (FIG. 3).

In the method of inhibiting microRNA of the present invention, anti-oligonucleotide binds complementarily with a single-stranded fragment portion of the primary microRNA, thereby effectively inhibiting the primary microRNA process, thereby inhibiting the generation of mature microRNA, thereby interfering with RNA. It can be effectively used to treat diseases by inhibiting the action of micro RNAs associated with disease <miR-155, for example, considered cancer-causing micro RNA.

<110> Seoul National University Industry Foundation <120> the inhibition method of microRNA <130> 6p-05-08 <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 40 <212> DNA <213> BS-F <400> 1 taatacgact cactataggt cagcagtgcc ttagcagcac 40 <210> 2 <211> 20 <212> DNA <213> BS-R <400> 2 gtcaacctta cttcagcagc 20 <210> 3 <211> 39 <212> DNA <213> 16-WT-F <400> 3 taatacgact cactataggt gatagcaatg tcagcagtg 39 <210> 4 <211> 20 <212> DNA <213> 16-WT-R <400> 4 gtagagtatg gtcaacctta 20 <210> 5 <211> 48 <212> DNA <213> BS1-F <400> 5 taatacgact cactataggc ttaaaataag tcagcagtgc cttagcag 48 <210> 6 <211> 29 <212> DNA <213> BS1-R <400> 6 catacatcgt gtcaacctta cttcagcag 29 <210> 7 <211> 31 <212> DNA <213> BS2-R <400> 7 ggcttaaaat aagctaacct tacttcagca g 31 <210> 8 <211> 19 <212> DNA <213> oligomer <400> 8 actggaattc gcggttaaa 19 <210> 9 <211> 27 <212> DNA <213> oligomer <400> 9 cagccaacgg aattcctcct cactaaa 27 <210> 10 <211> 19 <212> DNA <213> oligomer <400> 10 actggaattc gcggttaaa 19 <210> 11 <211> 24 <212> DNA <213> oligomer <400> 11 gtagagtatg aaattgctat cacc 24 <210> 12 <211> 24 <212> DNA <213> oligomer <400> 12 aagtccgagg aatcaacagc aacc 24

Claims (15)

An anti-oligonucleotide molecule that complementarily binds to a single stranded fragment portion of a target primary microRNA (pri-miRNA) in a cell. The anti-oligonucleotide of claim 1 wherein the 5 'terminal portion complementarily binds to the 3' terminal portion of the single-strand fragment portion of the pri-miRNA, and the 3 'terminal portion of the anti-oligonucleotide single strand of the pri-miRNA An antioligonucleotide molecule, characterized in that it binds complementarily with the 5 'terminal portion of the fragment portion. The antioliponucleotide molecule of claim 1, wherein the antioligonucleotide is 15 to 40 nucleotides in length. The antioligonucleotide molecule of claim 3, wherein the antioligonucleotide is 24 nucleotides in length. 2. The antioliponucleotide molecule of claim 1, wherein a spacer consisting of 1 to 6 nucleotides in length is additionally inserted in the center of the antioligonucleotide. A gene encoding the anti-oligonucleotide molecule sequence of claim 1. Recombinant expression vector comprising a gene encoding the anti-oligonucleotide sequence of claim 6. 8. The recombinant expression vector of claim 7, wherein the expression vector is selected from the group consisting of plasmids, lentiviral vectors, retroviral vectors, and adenovirus vectors. A disease therapeutic agent comprising the anti-oligonucleotide molecule of claim 1 and / or the recombinant expression vector of claim 6. The disease treatment agent according to claim 9, wherein the disease is cancer or a viral disease. A method of inhibiting RNA interfering, comprising administering the antinucleotide molecule of claim 1 in an in vivo, ex vivo, or exo vivo dose to the extent of inhibiting the process of the target pri-miRNA. 1) selecting a pri-miRNA sequence to be inhibited; 2) identifying the sequence of single-stranded ends in the pri-miRNA selected in step 1); And 3) A method for preparing an anti-oligonucleotide molecule, comprising synthesizing an anti-oligonucleotide complementary to the single-stranded terminal sequence identified in step 2). The method of claim 12, wherein the selection method of step 1) is http://microrna.sanger.ac.uk/sequences/ , http://genome.ucsc.edu/, http://www.bioinfo.rpi.edu /~zukerm/rna/mfold-3.html, http://www.ncbi.nlm.nih.gov / The anti-oligonucleotide molecule production method characterized in that using a search using a DB selected from the group consisting of. 1) selecting a pri-miRNA sequence to be inhibited; 2) identifying the sequence of single-stranded ends in the pri-miRNA selected in step 1); 3) synthesizing an anti-oligonucleotide complementary to the single-stranded terminal sequence identified in step 2); 4) preparing a gene encoding the synthesized antioligonucleotide of step 3); And 5) A method for producing an anti-oligonucleotide recombinant expression vector comprising the step of preparing a recombinant expression vector comprising the gene of step 4). 15. The method of claim 14, wherein the expression vector of step 5) is selected from the group consisting of plasmids, lentiviral vectors, retroviral vectors, and adenovirus vectors.

Images