KR101441013B1 - Biomarker for diagnosing breast cancer - Google Patents

Biomarker for diagnosing breast cancer Download PDF

Info

Publication number
KR101441013B1
KR101441013B1 KR1020110065194A KR20110065194A KR101441013B1 KR 101441013 B1 KR101441013 B1 KR 101441013B1 KR 1020110065194 A KR1020110065194 A KR 1020110065194A KR 20110065194 A KR20110065194 A KR 20110065194A KR 101441013 B1 KR101441013 B1 KR 101441013B1
Authority
KR
South Korea
Prior art keywords
breast cancer
biomarker
mamdc2
gene
diagnosis
Prior art date
Application number
KR1020110065194A
Other languages
Korean (ko)
Other versions
KR20130003708A (en
Inventor
맹필재
송영자
박영우
송규상
서광선
이진선
성경미
유석호
Original Assignee
충남대학교산학협력단
주식회사 에이앤알티
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교산학협력단, 주식회사 에이앤알티 filed Critical 충남대학교산학협력단
Priority to KR1020110065194A priority Critical patent/KR101441013B1/en
Priority to PCT/KR2012/003882 priority patent/WO2013002490A1/en
Publication of KR20130003708A publication Critical patent/KR20130003708A/en
Application granted granted Critical
Publication of KR101441013B1 publication Critical patent/KR101441013B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57415Specifically defined cancers of breast
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

본 발명은 유방암 진단용 바이오마커에 관한 것으로서, 구체적으로는 MAMDC2의 특정 DNA 단편 또는 전장 DNA로 이루어진 유방암 진단용 바이오마커를 제공한다. 검체의 조직으로부터 본 발명의 유방암 진단용 바이오마커를 구성하는 유전자인 MAMDC2의 DNA 단편 또는 전장 DNA의 발현 수준을 측정하고 이를 정상 조직에서의 발현 수준과 비교하는 경우 유방암을 효과적으로 진단할 수 있고, 이를 통해 유방암을 조기에 치료할 수 있다. The present invention relates to a biomarker for breast cancer diagnosis, and more particularly, to a biomarker for breast cancer diagnosis comprising a specific DNA fragment or full-length DNA of MAMDC2. When the expression level of DNA fragment or full-length DNA of MAMDC2, which is a gene constituting the biomarker for breast cancer diagnosis of the present invention, is measured from the tissue of a specimen and compared with the expression level in normal tissues, breast cancer can be effectively diagnosed Breast cancer can be treated early.

Figure R1020110065194
Figure R1020110065194

Description

유방암 진단용 바이오마커{Biomarker for diagnosing breast cancer}Biomarker for diagnosing breast cancer "

본 발명은 유방암 진단용 바이오마커에 관한 것으로서, 구체적으로는 MAMDC2의 특정 DNA 단편 또는 전장 DNA를 포함하는 유방암 진단용 바이오마커를 제공한다.The present invention relates to a biomarker for breast cancer diagnosis, and more particularly, to a biomarker for breast cancer diagnosis comprising a specific DNA fragment or full-length DNA of MAMDC2.

전 세계에서 유방암은 폐암에 이어 두 번째로 흔히 발생되는 암이며, 사망률은 5위에 해당하는 위험한 암이다. 유방암의 경우 일단 암세포가 주변 조직에 침범하거나 림프절로 전이가 시작되면 완치가 어렵기 때문에 조기 발견이 다른 암보다 더 중요하다고 할 수 있다.Breast cancer is the second most common cancer in the world, following lung cancer, and is the fifth most dangerous cancer. In breast cancer, early detection is more important than other cancers, since once cancer cells invade surrounding tissues or metastasize to the lymph nodes, curing is difficult.

유방암으로 인한 사망률을 줄이기 위해서는 첫째, 유방암을 조기 진단하고, 둘째, 일차 수술에 의한 치료 이후 예후를 진단하여 적절한 부가 치료 (Adjuvant therapy)를 하는 것이 중요하다. 현재 유방암 진단에는 1차 촉진에 의한 자가 진단 외에, 유방 X-선 조영술, 초음파검사법 등이 예방차원에서의 검진방법으로 사용되고 있으며 이 방법은 초기의 유방암을 진단하는 데에도 가장 널리 사용되는 방법이다. 그러나 유방 X-선 조영술은 우리나라 여성들에서 흔히 발견되는 조밀유방일 경우 섬유질이 많아서, 진단율이 떨어지는 단점이 있으며, 특히 젊은 여성같이 유선이 많이 발달되어 있어도 진단율이 떨어진다. 또한, X-선을 사용하기 때문에 진단 과정에서 오히려 유방암이 생길 가능성도 배제할 수 없다. 그래서 대안으로 초음파검사법이 사용되고 있지만 이 역시 악성종양(cancer)과 양성종양(non-cancer)을 구별하기는 쉽지 않다. 실제 임상에서는 이상 소견이 있으면 세침흡입세포검사법, 자기공명촬영법 등을 부가적으로 사용하여 진단율을 높이고 있다. 그러나 이 방법들을 사용하더라도 정상조직과 비 정상조직을 형태상으로 구분할 뿐 악성종양(cancer)과 양성종양(non-cancer)을 구분하기가 쉽지 않기 때문에 확진을 위해서는 더욱 정밀한 조직검사를 하게 된다. 이와 같은 이유들로 인해 유방암은 다른 암에 비해 비교적 분자 유전학적인 방법으로 유방암을 진단하는 방법이 발달되어 있다. 조직검사에서 조직을 잘라서 병변을 확인한 다음 적출을 위한 1차 수술이 시행된다. 이후의 부가치료를 어떻게 할지 결정하기 위하여 에스트로겐 수용체(Estrogen receptor, ER)의 유무와 유방암 특이 종양표지자인 HER2/neu(Human Epidermal growth factor Receptor 2, ErbB-2 또는 ERBB2라고도 알려져 있다) 유전자의 수를 조직내 교잡법( in situ hybridization)을 통해 확인하는 방법을 사용한다. 만약, 발견된 암 조직이 에스트겐 수용체를 가지고 있으면, 타목시펜(Tamoxifen)과 같은 에스트로겐 유사체를 사용하여 치료를 하게 되고, HER2/neu 유전자가 과발현되어 있으면, HER2/neu 단클론항체인 trastuzumab을 제품화한 허셉틴(Herceptin)을 유방암의 치료에 사용하게 된다. 유방암의 진단 및 치료에 가장 유용하게 사용되는 유방암 특이 진단 마커인 HER2/neu 유전자의 증폭 및 과발현은 침습성 유방암의 20 ~ 35%에서 발견된다. 따라서. HER2/neu 검사는 에스트로겐 수용체 검사와 더불어 유방암 환자의 치료에 결정적인 역할을 한다.In order to reduce the mortality rate from breast cancer, it is important to first diagnose breast cancer early, and secondly to diagnose the prognosis after primary surgery and to perform appropriate adjuvant therapy. In addition to the self-diagnosis by the first promotion, mammography and ultrasonography are used as a preventive measure in breast cancer diagnosis. This method is the most widely used method for early breast cancer diagnosis. However, mammography has a disadvantage in that the diagnosis rate is low due to the high amount of fiber in the case of dense breast, which is commonly found in Korean women. In addition, because of the use of X-rays, it is not possible to rule out the possibility of breast cancer in the diagnosis process. So ultrasound is being used as an alternative, but it is also difficult to distinguish between malignant and non-cancer. In case of abnormal clinical findings, fine needle aspiration cytology, magnetic resonance imaging (MRI) are additionally used to improve diagnosis rate. However, even if these methods are used, it is difficult to distinguish malignant and non-cancer from normal and abnormal tissues, and therefore, more accurate biopsy is required for confirmation. For these reasons, breast cancer has developed a method of diagnosing breast cancer in a relatively molecular genetic way as compared to other cancers. Histopathologically, the tissue is cut and the lesion is confirmed, and the first operation for removal is performed. The presence of estrogen receptor (ER) and the number of HER2 / neu (Human Epidermal Growth Factor Receptor 2, also known as ErbB-2 or ERBB2) breast cancer-specific tumor markers And in situ hybridization. If the cancer tissue is found to have an estrogen receptor, treatment with estrogen analogs such as Tamoxifen will be used. If the HER2 / neu gene is over-expressed, Herceptin, a product of the HER2 / neu monoclonal antibody trastuzumab (Herceptin) will be used to treat breast cancer. Amplification and overexpression of the HER2 / neu gene, a breast cancer specific diagnostic marker that is most useful for the diagnosis and treatment of breast cancer, is found in 20 to 35% of invasive breast cancers. therefore. The HER2 / neu test plays a crucial role in the treatment of breast cancer patients with estrogen receptor testing.

그러나 유방암 환자 모두가 ER 유전자나 Her2/neu 유전자가 과발현되어 있는 것은 아니므로, 이러한 진단 방법들의 단점을 보완하고 좀 더 빠르고 확실하게 암을 구분하기 위하여 암 특이적 종양표지자(biomarker)를 찾기 위한 시도가 다양하게 이루어지고 있으며, 이를 이용한 새로운 진단 방법들이 최근 소개되고 있다. 최근 미국에서 Oncotype DX라고 하는 21-gene assay (Oncotype DX, Genomic Health, Redwood City, CA)와 MammaPrint라고 하는 70-gene assay (MammaPrint, Agendia, Amsterdam, the Netherlands)가 제품화되어 임상에서 실제 사용되고 있다. Oncotype DX는 실시간 정량 PCR 방법으로 16개의 유방암 관련 유전자와 5개의 대조군 유전자를 검사는 방법이고, MammaPrint는 70개의 유전자를 마이크로어레이 방법으로 검사하는 방법이다. 이들 두 방법은 1차 수술 이후, 부가 치료를 어떠한 방식으로 할지에 관한 표준을 제시하고 있으며, 이로 인해 개인 맞춤 치료가 가능하게 되었다(Am J Health-Syst PharmVol 65 Jan 1, 2008 23-28).However, since all breast cancer patients are not overexpressed in the ER gene or the Her2 / neu gene, attempts to find cancer-specific tumor markers (biomarkers) in order to make up for the shortcomings of these diagnostic methods, And new diagnostic methods using the same have recently been introduced. Recently, Oncotype DX 21-gene assay (Oncotype DX, Genomic Health, Redwood City, CA) and MammaPrint 70-gene assay (MammaPrint, Agendia, Amsterdam, the Netherlands) Oncotype DX is a real-time quantitative PCR method for examining 16 breast cancer-related genes and 5 control genes, and MammaPrint is a method for examining 70 genes by microarray method. These two methods provide a standard on how to perform adjunctive therapy after the first operation, which allows for personalized treatment (Am J Health-Syst PharmVol 65 Jan 1, 2008 23-28).

본 발명자들은 임상조직을 이용한 NanoString's nCounter Analysis System을 이용하여 조직 내에 포함되어 있는 MAMDC2 유전자의 발현 정도, 특히 상기 유전자 전사체의 특정 부위의 발현 정도가 유방암과 유의적으로 관련이 있음을 발견하여 본 발명을 완성하였고, 상기 유방암 관련 유전자의 DNA 단편 또는 전장 DNA를 유방암 진단용 바이오마커로 사용함으로써 유방암 유무를 간단하게 확인할 수 있는 방법을 제시하고자 한다.
Using the NanoString's nCounter Analysis System using a clinical tissue, the present inventors discovered that the expression level of the MAMDC2 gene contained in the tissues, in particular, the expression level of the specific region of the gene transcript was significantly related to breast cancer, And a method of simply identifying the presence or absence of breast cancer by using DNA fragment or full-length DNA of the breast cancer-related gene as a biomarker for breast cancer.

그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

본 발명의 목적은 서열번호 1의 폴리뉴클레오티드를 포함하는 MAMDC2 유전자의 DNA 단편 또는 전장 DNA로 이루어지고, 유방암 조직에서 특이적으로 발현되는 것을 특징으로 하는 유방암 진단용 바이오마커를 제공하는 것이다.An object of the present invention is to provide a biomarker for breast cancer diagnosis, which comprises a DNA fragment or an integral DNA of MAMDC2 gene comprising the polynucleotide of SEQ ID NO: 1 and is specifically expressed in breast cancer tissues.

검체의 조직으로부터 본 발명의 유방암 진단용 바이오마커를 구성하는 유전자인 MAMDC2의 DNA 단편 또는 전장 DNA의 발현 수준을 측정하고 이를 정상 조직에서의 발현 수준과 비교하는 경우 유방암을 효과적으로 진단할 수 있고, 이를 통해 유방암을 조기에 치료할 수 있다. When the expression level of DNA fragment or full-length DNA of MAMDC2, which is a gene constituting the biomarker for breast cancer diagnosis of the present invention, is measured from the tissue of a specimen and compared with the expression level in normal tissues, breast cancer can be effectively diagnosed Breast cancer can be treated early.

도 1은 MAMDC2에 대하여 유방암 진단 성능을 확인한 결과를 나타낸 도면이다.FIG. 1 is a diagram showing the results of confirming the diagnostic performance of breast cancer for MAMDC2. FIG.

본 발명은 유방암 조직에서 정상 조직보다 특이적으로 발현되는 유전자의 특정 DNA 단편 또는 전장 DNA를 이용하는 유방암 진단용 바이오마커에 관한 것으로서, 서열번호 1의 폴리뉴클레오티드를 포함하는 MAMDC2 유전자의 DNA 단편 또는 전장 DNA를 이용한다. MAMDC2 유전자는 유방암 조직에서 정상 조직보다 특이적으로 발현되는 것을 특징으로 하기 때문에 유전자의 전장 DNA를 유방암 진단용 바이오마커로 사용될 수 있으며, 특히 검체 조직에서의 서열번호 1의 폴리뉴클레오티드를 포함하는 MAMDC2 유전자의 DNA 단편의 양을 통해 MAMDC2 유전자의 정량적인 발현 수준을 간접적으로 측정할 수 있으므로 DNA 단편 또한 유방암 진단용 바이오마커로 사용될 수 있다. The present invention relates to a biomarker for breast cancer diagnosis using a specific DNA fragment or full-length DNA of a gene specifically expressed in breast cancer tissues more specifically than a normal tissue, and more particularly, to a DNA fragment or full-length DNA of MAMDC2 gene comprising the polynucleotide of SEQ ID NO: 1 . Since the MAMDC2 gene is characterized in that it is expressed more specifically than the normal tissue in breast cancer tissues, it is possible to use the full-length DNA of the gene as a biomarker for the diagnosis of breast cancer. In particular, the MAMDC2 gene comprising the polynucleotide of SEQ ID NO: 1 Because quantitative expression levels of the MAMDC2 gene can be measured indirectly through the amount of DNA fragments, DNA fragments can also be used as biomarkers for breast cancer diagnosis.

본 발명의 유방암 진단용 바이오마커를 이용하여 유방암을 진단하는 방법은 당업계에서 사용되는 방법이라면 특별히 제한되지 않는다.The method for diagnosing breast cancer using the biomarker for breast cancer diagnosis of the present invention is not particularly limited as long as it is a method used in the art.

예를 들면, NanoString's nCounter를 사용할 수 있다. NanoString's nCounter Analysis system은 Digital mRNA profiling이 가능한 분석 장비로, cDNA의 합성 과정이나 측정하고자 하는 목표물의 증폭과정이 필요 없다는 장점이 있고, 따라서 mRNA 수준에서의 발현양을 측정하는데 total RNA, cell lysates, blood lysates, FFPE 시료처럼 보다 간편한 시료만 준비되면 분석이 가능하다는 장점이 있다. For example, you can use NanoString's nCounter. NanoString's nCounter Analysis System is an analytical instrument capable of profiling digital mRNAs. It has the advantage that it does not need to synthesize cDNA or amplify the target to be measured. Therefore, total RNA, cell lysates, blood lysates, and FFPE samples.

본 발명의 유방암 진단용 바이오마커와 유방암 진단제를 이용하여 유방암을 진단하는 방법의 바람직한 일실시예로서 a) 검체의 유방 조직으로부터 전체 RNA(total RNA)를 reporter probe와 capture probe로 구성된 nCounter probe에 직접 혼합시키는 단계; b) hybridization 반응을 수행하는 단계; c) 결합하지 않은 과량의 probe들은 affinity-purification을 통해 제거하는 단계; d) 정제된 reporter probe, capture probe, RNA의 3중 complex를 imaging surface에 부착시키고 전압을 걸어주어 molecule들을 잡아 늘여 일렬로 정렬하고 고정화 시키는 단계; e) Digital Analyzer로 옮겨서 imaging processing을 수행하여 reporter probe들을 해독함으로써 MAMDC2 유전자의 발현수준을 측정하는 단계; 및 f) 측정된 검체 유방 조직의 MAMDC2 유전자의 발현 수준과 정상 조직의 MAMDC2 유전자의 발현 수준을 비교하여 유방암 여부를 판정하는 단계를 포함한다.As a preferred embodiment of the method for diagnosing breast cancer using the biomarker for breast cancer diagnosis and the breast cancer diagnostic agent of the present invention, a) a total RNA (total RNA) from a breast tissue of a sample is directly transferred to an nCounter probe composed of a reporter probe and a capture probe Mixing; b) performing a hybridization reaction; c) removing excess unbound probes through affinity-purification; d) attaching the purified reporter probe, capture probe, and RNA triple complex to the imaging surface and applying voltage to stretch the molecules, aligning and immobilizing the molecules; e) measuring the expression level of the MAMDC2 gene by reading the reporter probes by performing imaging processing by transferring to a digital analyzer; And f) comparing the expression level of the MAMDC2 gene in the measured breast tissue and the expression level of the MAMDC2 gene in normal tissue to determine whether or not the breast cancer is present.

본 발명의 일실시예에서 유방암 진단용 바이오 마커로 사용되는 MAMDC2 유전자의 정보 및 상기 프로브에 대한 정보는 표 1과 같다. Table 1 shows information on the MAMDC2 gene used as a biomarker for breast cancer diagnosis and information on the probe in one embodiment of the present invention.

GeneGene AccessionAccession Targeted RegionTargeted Region Tm_CPTm_CP Tm_RPTm_RP PN(CP;RP)PN (CP; RP) NSIDNSID MAMDC2MAMDC2 MM_153267.3MM_153267.3 1525-16251525-1625 7878 8282 326439;226439326439; 226439 NM_153267.3:1525NM_153267.3: 1525 Target Sequence (서열번호 1)Target Sequence (SEQ ID NO: 1) AGGGAGGTTATGTTGCCCTGGATGATATTTCATTCTCTCCTGTTCACTGCCAGAATCAGACAGAACTTCTGTTCAGTGCCGTGGAAGCCAGCTGCAATTT≪

이하, 실시예를 통하여 본 발명을 보다 구체적으로 설명한다. 다만, 하기의 실시예는 본 발명을 보다 명확하게 설명하기 위한 것 일뿐, 본 발명의 권리범위가 실시예에 의해 제한되지 않는다.
Hereinafter, the present invention will be described more specifically by way of examples. It should be noted, however, that the following examples are for the purpose of more clearly illustrating the present invention, and the scope of the present invention is not limited by the examples.

실시예Example 1. 유방암 진단용  1. Diagnosis of breast cancer 바이오마커의Biomarker 선별 및 유방암 진단 성능 확인 Screening and breast cancer diagnosis

공공으로 이용할 수 있도록 개방된 microarray data set을 이용하여 신규 유방암 진단용 바이오마커의 검색을 실시한 결과 20종류의 후보 바이오마커를 검색하였다. 그리고, 미국의 NanoString이라는 회사에서 개발한 nCounter Analysis system을 통해 유방암 환자 76명의 정상조직과 암조직에서 동시에 추출한 total RNA를 사용하여 이들 후보 바이오마커의 mRNA의 발현 분석을 의뢰하였다. 분석은 duplicate로 수행하였고, 분석결과는 표 2에 나타내었다.We searched biomarkers for new breast cancer using publicly available microarray data sets and found 20 candidate biomarkers. We also analyzed the mRNA expression of these candidate biomarkers using total RNA extracted from 76 normal breast tissues and cancer tissues through the nCounter Analysis system developed by NanoString, USA. The analysis was performed in duplicate, and the analysis results are shown in Table 2.

상기 유방암 임상 조직은, 유방암 환자의 암 조직과 동일 환자의 암 조직 인접부위에서 병리학적으로 정상으로 판정된 조직 (matched normal and cancer tissue)을 IRB 승인을 거쳐 충남대병원 한국 인체자원 거점은행( National BioBank of Korea )을 통해 100명 환자의 조직을 공급받았고, 유방암 임상 조직은 -70℃에 동결 상태로 보관 중인 것을 사용하였으며, 유방암 임상 조직에서 total RNA의 추출은 TRI REAGENT(MRC)를 사용하여 권장하는 방법에 따라 total RNA를 추출하였고 DEPC( RNase inhibitor )-treated water에 녹였다. The above breast cancer clinical tissue is matched normal and cancer tissues which are determined to be normal in the cancer tissue of the breast cancer patient and adjacent to the cancer tissue of the same patient through the IRB approval and the National BioBank of Chungnam National University Hospital of Korea). The breast tissue was stored frozen at -70 ° C. Total RNA was extracted from breast cancer tissues using TRI REAGENT (MRC). Total RNA was extracted according to the method and dissolved in DEPC (RNase inhibitor) -treated water.

Figure 112011050337587-pat00001
Figure 112011050337587-pat00001

상기 결과로부터, 이전에 알려지지 아니한 신규한 유방암 진단 마커 MAMDC2(MS014)를 발견하게 되었다.From the above results, we found a novel breast cancer diagnostic marker MAMDC2 (MS014) which was not previously known.

상기 신규한 MAMDC2에 대하여 유방암 진단 성능을 확인한 결과를 도 1에 나타내었다. 도 1에 나타난 바와 같이 MAMDC2는 유방암 조직에서 발현이 떨어지는 결과를 보여 유방암 진단용 바이오마커로서 가치가 있음을 검증할 수 있었다. 또한, 유방암 진단에 대한 특이성(Specificity) 및 민감도(Sencitivity)를 살펴보면, 도 1에서 알 수 있는 바와 같이, 본 발명의 유방암 진단 바이오마커(MAMDC2)는 유방암 진단에 높은 특이도(95.7)와 민감도(93.4)를 나타내었다.
The results of confirming the diagnosis of breast cancer for the novel MAMDC2 are shown in FIG. As shown in FIG. 1, MAMDC2 showed a low expression level in breast cancer tissue, and thus it can be verified that it is valuable as a biomarker for breast cancer diagnosis. As shown in FIG. 1, the breast cancer diagnostic biomarker (MAMDC2) of the present invention has high specificity (95.7) and sensitivity (95.7) for diagnosis of breast cancer and specificity and susceptibility 93.4).

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 아닌 것으로 이해해야만 한다.It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative and non-restrictive in every respect.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) A&R therapeutics co., ltd. <120> Biomarker for diagnosing breast cancer <130> PB11-09371 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> polynucleotide fragment of MAMDC2 gene <400> 1 agggaggtta tgttgccctg gatgatattt cattctctcc tgttcactgc cagaatcaga 60 cagaacttct gttcagtgcc gtggaagcca gctgcaattt 100 <110> The Industry & Academic Cooperation in Chungnam National University (IAC)          A & R therapeutics co., Ltd. <120> Biomarker for diagnosing breast cancer <130> PB11-09371 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> polynucleotide fragment of MAMDC2 gene <400> 1 agggaggtta tgttgccctg gatgatattt cattctctcc tgttcactgc cagaatcaga 60 cagaacttct gttcagtgcc gtggaagcca gctgcaattt 100

Claims (3)

서열번호 1의 염기서열로 이루어진 MAMDC2 유전자를 함유하는, 유방암 진단용 조성물.1. A composition for diagnosing breast cancer comprising the MAMDC2 gene consisting of the nucleotide sequence of SEQ ID NO: 1. 삭제delete 하기의 단계를 포함하는 생체외(in vitro) 유방암 진단을 위한 정보제공방법:
a) 검체의 유방 조직으로부터 전체 RNA(total RNA)를 분리하는 단계;
b) 상기 전체 RNA에 서열번호 1의 프로브를 반응시키는 단계;
c) MAMDC2 유전자의 발현수준을 측정하는 단계; 및
d) 측정된 검체 유방 조직의 MAMDC2 유전자의 발현 수준과 대조군의 발현 수준을 비교하는 단계.
A method of providing information for in vitro breast cancer diagnosis comprising the steps of:
a) separating total RNA (total RNA) from the breast tissue of the specimen;
b) reacting the probe of SEQ ID NO: 1 with the whole RNA;
c) measuring the level of expression of the MAMDC2 gene; And
d) comparing the expression level of the MAMDC2 gene of the test sample breast tissue with the expression level of the control group.
KR1020110065194A 2011-06-30 2011-06-30 Biomarker for diagnosing breast cancer KR101441013B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020110065194A KR101441013B1 (en) 2011-06-30 2011-06-30 Biomarker for diagnosing breast cancer
PCT/KR2012/003882 WO2013002490A1 (en) 2011-06-30 2012-05-17 Biomarker for diagnosing breast cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110065194A KR101441013B1 (en) 2011-06-30 2011-06-30 Biomarker for diagnosing breast cancer

Publications (2)

Publication Number Publication Date
KR20130003708A KR20130003708A (en) 2013-01-09
KR101441013B1 true KR101441013B1 (en) 2014-09-18

Family

ID=47424347

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110065194A KR101441013B1 (en) 2011-06-30 2011-06-30 Biomarker for diagnosing breast cancer

Country Status (2)

Country Link
KR (1) KR101441013B1 (en)
WO (1) WO2013002490A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105624279A (en) * 2015-01-22 2016-06-01 香港中文大学深圳研究院 Stomach cancer marker as well as expression and methylation detection method, kit and application thereof
KR102424255B1 (en) * 2020-10-30 2022-07-22 경북대학교 산학협력단 Use of SMP30 as a biomarker for diagnosis and malignancy assessment of human breast cancer and animal mammary cancer

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120034593A (en) * 2009-03-09 2012-04-12 유니버시티 오브 조지아 리서치 파운데이션 인코퍼레이티드 Protein markers identification for gastric cancer diagnosis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2005325716A1 (en) * 2005-01-25 2006-08-03 Sky Genetics, Inc. Nucleic acids for apoptosis of cancer cells
WO2010127399A1 (en) * 2009-05-06 2010-11-11 Walter And Eliza Hall Institute Of Medical Research Gene expression profiles and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120034593A (en) * 2009-03-09 2012-04-12 유니버시티 오브 조지아 리서치 파운데이션 인코퍼레이티드 Protein markers identification for gastric cancer diagnosis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Cancer Research, Vol. 69, pp. 5946-5953 (2009.07.07.) *
NCBI, GenBank Accession No. BC040299 (2007.03.19.) *

Also Published As

Publication number Publication date
WO2013002490A1 (en) 2013-01-03
KR20130003708A (en) 2013-01-09

Similar Documents

Publication Publication Date Title
CN102549169B (en) The marker of carcinoma of endometrium
KR101437718B1 (en) Markers for predicting gastric cancer prognostication and Method for predicting gastric cancer prognostication using the same
AU2013281355B2 (en) Targeted RNA-seq methods and materials for the diagnosis of prostate cancer
WO2006105642A1 (en) Biomarkers for the detection of lung cancer and uses thereof
KR101441013B1 (en) Biomarker for diagnosing breast cancer
EP2004857B1 (en) Breast cancer markers
WO2010126338A2 (en) Biomarker for breast cancer diagnosis, and breast cancer diagnostics
EP1682679B1 (en) Molecular marker
CN110331207A (en) Adenocarcinoma of lung biomarker and related application
KR102643326B1 (en) Biomarker for distinguishing cancer from benign tumors or nodules
RU2537263C2 (en) Method of screening and monitoring cancerous diseases and kit therefor (versions)
TWI417546B (en) Dna methylation biomarkers for prognosis prediction of lung adenocarcinoma
WO2022210783A1 (en) Follicular thyroid cancer-specific marker
JP4923252B2 (en) Cancer determination method and cancer diagnostic kit
JP2016198094A (en) Prognosis inspection and diagnostic method of ovarian cancer
KR101755792B1 (en) Biomarker for diagnosing or prognosing cancer and uses thereof
JP5410722B2 (en) Method for detecting pancreatic tissue injury or cell proliferative disease
CN117512112A (en) Method, primer and probe for screening NAB2-STAT6 fusion condition and kit
EP1797196B1 (en) Detection of breast cancer
JP2007503826A (en) Diagnosis of breast cancer risk

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20170905

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180906

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190904

Year of fee payment: 6