KR101397961B1 - Composition comprising the extract of complex herb an active ingredient for preventing and alleviating allergic or non-allergic skin disease and the use thereof - Google Patents

Abstract

The present invention provides a composition containing a mixed herbal extract useful for the treatment and prevention of allergic or nonallergic skin diseases.

Description

Compositions for preventing and improving allergic or non-allergic skin diseases containing complex herbal extract (GST) as an active ingredient and uses thereof disease and the use thereof}

The present invention relates to a composition for prevention and improvement of an allergic or non-allergic skin disease containing an active ingredient of a complex herbal medicine extract (GST) consisting of gangjin, angelica, gossam, bucculaceae,

[1] Incorvaria C et al., Allergy and the skin Clin Exp Immunol 153 suppl 1: 27-29 (2008)

[2] Anna Paula Galli Snchez, Immunopathogenesis of psoriasis An Bras Dermatol 85 (5): 747-9 (2009)

[3] Werfel T, Wittmann M., T cell regulation in allergy, asthma and atopic skin disease Chem Immunol Allergy 94: 101-11 (2008)

[4] Asnis L. A et al., Cutaneous reaction to recombinant cytokine therapy J Am Acad Dermatol 24, 915-926, 1995

[Literature 5] Metaphorical Context of Information Extension, Young Lim, p489-490, 1998

[Literature 6] Metaphorical Information Extension, Young Lim, p407-408, 1998

[Literature 7] Ipseup et al. 1, Encyclopedia of Fragrances, Young Lim, pp. 707 ~ 708, 1998

[Literature 8] Ipseup et al. 1, Encyclopedia of Fragrances, Yeongrim Publishers, pp.277 ~ 278, 1998

[Literature 9] Ipseup et al., 1, pp. 416 ~ 418, 1998

[Literature 10] Ipseup et al., 1, pp. 152 ~ 154, 1998

In order to counteract external stimuli and antigens, various immune cells are present in the skin, forming a complex network between them and maintaining homeostasis (1). Epithelial tissues are mainly composed of keratinocytes, and there are Langerhans cells, T cells and macrophages (2). Most skin diseases are characterized by inflammatory responses by immune cells and are accompanied by clinical symptoms such as itching, edema, erythema, eczema, and scaling. When the antigen presenting cell recognizes an antigen that enters from the outside, the chemoattractant factor is secreted, eosinophils and mast cells are introduced, and T cells are activated and collected into damaged tissue. It is known that overexpression of specific cytokines secreted from activated T cells act as pathologic factors of dermatitis (3). They cause itching and increase the inflow of inflammatory cells to cause allergic or non-allergic skin diseases such as psoriasis as well as atopic dermatitis and contact dermatitis (Incorvaria C et al., Allergy and the Skin Clin Exp Immunol 153 Werfel T, Wittmann M., T cell regulation in allergy, asthma, and atopic skin: a prospective, randomized, double-blind, randomized, double-blind study. disease Chem Immunol Allergy 94: 101-11 (2008)).

IL-31 is produced in activated T cells (more expressed in Th2 cells) and belongs to the IL-6 cytokine family. The IL-31 receptor is composed of the gp-130 receptor (GPL, or IL-31RA) and the oncostatin M receptor (OSMR) and is constantly present in epithelial cells and keratinocytes. The expression of IL-31 in skin tissue of atopic dermatitis patients is markedly increased and is thought to induce an increase in Th2 cytokines such as IL-4 and IL-13. These Th2 cytokines act on B cells to increase the production of IgE, and IgE binds to receptors present in mast cells and mediates release of histamine and the like, resulting in inflammatory reactions and itching. In addition, IL-31 receptor expression was increased in epithelial and keratinocytes from patients with atopic dermatitis, and in macrophages isolated from patients. In addition, transgenic mice that inject IL-31 into the skin of mice or continue to express IL-31 exhibit severe itching, and significant inflow of eosinophils and mast cells into skin tissue is observed, . Meanwhile, IL-2 secreted from T cells stimulates and activates the proliferation of T cells. It is known that cancer patients treated with IL-2 exhibit severe skin pruritus and form swelling, erythema, necrosis, urticaria and blistering of the skin tissue (Asnis LA et al., Cutaneous reaction to recombinant cytokine therapy J Am Acad Dermatol 24, 915-926, 1995).

Clematis manshurica refers to the roots of the cranes and plants of the national distribution belonging to the Ranunculaceae, and its components are anemonin, anemonol, sterol, saponin saponin), and it is known to have a pharmacological action such as fever and analgesic action. (Information Extraordinary Exposure Metaphor, Young Lim, p489-490, 1998).

Angelica Radix is a perennial herb that belongs to the persimmon family, Angelica acutiloba or Angelica It is known that it contains the components such as ligustilide, butylidne and phthalide and has pharmacological actions such as inhibition of uterine contraction, treatment of dysmenorrhea, and antibacterial activity. p407-408, 1998).

Sophora flavescens is a perennial herbaceous plant of Leguminosae, and its root is called gossam. Matrin, oxymatrine, sophoranol, anagyrine, , Flavonoids such as xanthohumol and isoxanthohumol are known as diuretics, antiarrhythmic agents, antimicrobial agents, and the like. (Lee, Hyung - Sup, et al., The Essay on Enlightenment, Young Lim, pp. 707 ~ 708, 1998).

Spirodela polyrrhiza is a perennial herbaceous plant of the genus Aglaminae . It is a small grass floating on the surface of the water. It is also called a goryeongeon, goryeon, gosam, and buchyeoncho. It is known that potassium oxide, potassium chloride and fluorine are components. (Lee et al., 1997), and others (Lee et al., 1992, pp. 277 ~ 278, 1998).

Casualties (Torilis japonica DC) refers to fruit of a perennial herbivorous insect deaths and related plants in the Central Northwest of the Republic of Korea. It is also known as l-pinene, l-camphene, borneol, isovaleric ester isovaleric ester), and its anticholinergic action and similar effects such as sex hormones have been known (1, 1, et al., Journal of the Korean Pharmacopoeia, Young Lim, pp. 416 ~ 418, 1998).

Stemona japonica MIQ is a perennial herb that originated in China and refers to the root of the plant and its related plants and is known as stemonine, stemonidine, and isostemonine. , And insecticidal action (1) (1). (2).

The present study was conducted to investigate the effects of oral herb extract (GST), which is composed of Ganjyun, Gangwoo, Gosam, Bucheoncho, Casualties, and Baekbun Root, on NC / Nga atopic dermatitis mice in a marked decrease of itching and increased thickness of skin epidermis and dermis And that the inflow of eosinophils and mast cells was significantly reduced. In addition, GST showed a reduction effect of IgE and Th2 cytokines IL-4, IL-5 and IL-13, which is a marker of dermatitis, and IL-31 mRNA, It can be applied as a therapeutic agent for various skin diseases by reducing the itching of diseases and suppressing the occurrence of pathological damage such as skin inflammation, swelling and thickening.

Accordingly, the present inventors have completed the present invention by confirming the inhibition of the occurrence of pathological damage such as itching, skin inflammation, erythema, edema thickening, and the like in the herbal medicine extract prepared from the mosquito line, Angelica gigas, Gosam, Bucheoncho, casualties and back muscles.

In order to achieve the above object, the present invention provides a preventive and therapeutic agent for an allergic or non-allergic skin disease comprising an extract of a herbal medicine extract (GST) consisting of a gestational line, Angelica gigas, Gosam, Bucheoncho, A pharmaceutical composition is provided.

The complex herbal medicine extract as defined herein may have a relative dry weight ratio (w / w) of 1: 10: 1 to 10: 1 to 10: 1 to 10: 1 to 10: 1, relative to dry weight, ginseng, 1 to 10: 1, preferably 1: 5: 1 to 5: 1 to 5: 1 to 5: 1 to 5: 1 to 5, more preferably 1: 3: : 1 to 3: 1 to 3.

An extract as defined herein is one or more solvents selected from the group consisting of water, ethanol, methanol, propanol, butanol, acetone, ethyl acetate, hexane, butylene glycol, propylene glycol, hydrolyzed butylene glycol, Preferably water and ethanol, most preferably 60% to 90% ethanol soluble extract.

Examples of allergic or nonallergic skin diseases as defined herein include allergic skin diseases such as hypersensitivity, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, allergic contact dermatitis, urticaria, Allergic contact dermatitis, allergic contact dermatitis, urticaria, food allergies or drug allergies, more preferably atopic dermatitis or contact dermatitis, allergic rhinitis, allergic rhinitis, allergic rhinitis, ; Non-allergic skin diseases include, but are not limited to, non-allergic eczema (irritative dermatitis, seborrheic dermatitis, mononuclear eczema, dyschritic dermatitis, chronic simplex poisoning, happosis, senile eczema), primary simple contact dermatitis, Includes irritative dermatitis or seborrheic dermatitis.

Hereinafter, the present invention will be described in detail.

For example, the relative compounding dry weight ratio (w / w) of the germplasm, dry ginseng, ginseng, gosam, bupyeongcho, casualties and back muscles in the dry state is from 1 to 10: 1 to 10: 1 to 10: 1 to 10: Preferably from 1: 5: 1 to 5: 1 to 5: 1 to 5: 1 to 5: 1 to 5, more preferably from 1: 3: 1 to 3: 1 to 3; Butanol, acetone, ethyl acetate, hexane, butylene glycol, propylene glycol, hydrolyzed butylene glycol, and the like, which are about 1 to 30 times, preferably about 1 to 15 times the weight of the mixture. At a temperature of from about 0 to 100 DEG C, preferably from 20 to 60 DEG C, at a temperature of from about 0 DEG C to about 100 DEG C, preferably from about 20 DEG C to about 60 DEG C, with at least one solvent selected from the group consisting of propylene glycol, propylene glycol and water glycerin, preferably water and ethanol, more preferably 60-90% For about 1 to 48 hours, preferably for 12 to 36 hours; A third step of repeating the second step about 1 to 10 times, preferably 2 to 7 times; And a fourth step of filtering and concentrating the same and freeze-drying the GST complex herbal extract of the present invention.

In addition, the complex herbal medicine of the present invention has been used for herbal medicine and food for a long time, and the herbal extract of the present invention extracted therefrom has no toxicity and side effects and has proved to be a non-irritant sample in the skin patch test. You can use it safely.

The present invention provides a pharmaceutical composition for the prevention and treatment of allergic or nonallergic skin diseases containing the herbal composition extract obtained by the above production method as an active ingredient.

The present invention also relates to a method of treating a patient suffering from allergic or non-allergic skin diseases, which comprises administering a herbal medicine extract (GST), which is made up of goryeon, angelica, gosam, buccylus, casualty and back muscles, to patients suffering from allergic or non- Lt; / RTI >

Further, the present invention provides the use of herbal medicine extract (GST) composed of gangjin, angelica, gossam, bucheoncho, casualty and back muscles for the manufacture of a medicament for treating allergic or nonallergic skin diseases.

The herbal medicine extract of the present invention, which is composed of gangsul, gangwi, gosam, bupyeongcho, casualties, and back muscles, showed inhibition of the occurrence of pathological damage such as itching, skin inflammation, erythema, In the treatment and prevention of cancer.

The present invention also provides a health functional food for preventing and improving an allergic or non-allergic skin disease containing an extract of a complex herbal medicine obtained by the above production method as an active ingredient.

The pharmaceutical composition for prevention and treatment of an allergic or nonallergic skin disease containing the herbal extract of the present invention comprises 0.1 to 50% by weight of the herbal extract of the present invention based on the total weight of the composition.

However, the composition is not limited thereto, and may vary depending on the condition of the patient, the type of disease, and the progress of the disease.

The pharmaceutical composition containing the herbal extract of the present invention may further comprise suitable carriers, excipients and diluents conventionally used in the production of pharmaceutical compositions.

The pharmaceutical composition containing the herbal medicine extract according to the present invention can be administered orally or parenterally in the form of oral, granule, tablet, capsule, suspension, emulsion, syrup, aerosol or the like, oral preparation, Can be used. Examples of carriers, excipients and diluents that may be contained in the composition containing the extract of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, , Alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil have. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose , Gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like.

The dose of the herbal extract of the present invention may vary depending on the age, sex and body weight of the patient, but may be 0.1 to 100 mg / kg, preferably 1 to 10 mg / kg, once to several times per day. The dosage may also be increased or decreased depending on the route of administration, degree of disease, sex, weight, age, and the like. Accordingly, the dosage is not limited in any way to the scope of the present invention.

The pharmaceutical composition may be administered to mammals such as rats, mice, livestock, humans, and the like in a variety of routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine dural or intracerebral injection.

The present invention provides a health functional food for prevention and improvement of an allergic or non-allergic skin disease containing an extract of a complex herbal medicine comprising a ginseng line, Angelica gigas, Gosam, Bucheoncho, Casualties, Examples of foods to which this can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, tea vitamins, and health functional foods.

Since the extract of the present invention has little toxicity and side effects, it can be safely used for long-term use for preventive purposes.

The extract of the present invention can be added to foods or beverages for the purpose of preventing and improving allergic or nonallergic skin diseases. At this time, the amount of the complex herbal medicine extract in the food or beverage may be 0.01 to 15% by weight of the total food, and the health functional beverage composition may be added in a proportion of 0.02 to 10 g, preferably 0.3 to 1 g, .

The health functional beverage composition of the present invention is not particularly limited to other ingredients other than the above-mentioned extract as an essential ingredient in the indicated ratio, and may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages . Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavors (tau martin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used as flavors other than those described above The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition to the above, the herbal extract of the present invention can be used as a herbal medicine such as various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and heavies (cheese, chocolate etc.), pectic acid and its salts, And salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like. In addition, the extracts of the present invention may contain flesh for the production of natural fruit juices and vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not so critical, but is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the extract of the present invention.

However, the composition is not limited thereto, and may vary depending on the condition and progress of the patient.

The present invention also relates to a cosmetic composition for preventing and improving an allergic or nonallergic skin disease, which comprises, as an active ingredient, a herbal medicine extract of a herbal medicine extract (GST) composed of a gestational line, Angelica gigas, Gosam, to provide.

In addition, the cosmetic composition includes formulations of lotion, skin, lotion, nutrition lotion, nutritional cream, massage cream, essence, and pack.

In addition, the herbal extract of the present invention can be used variously in cosmetics and cleansers having a whitening effect.

Examples of products to which the present composition can be added include cosmetics such as lotion, skin, lotion, nutrition lotion, nutritional cream, massage cream, essence, pack, cleansing, cleanser, soap, have.

The cosmetic composition of the present invention comprises a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, polymeric polysaccharides, sphingolipids and seaweed extracts.

The water-soluble vitamin is not particularly limited as long as it can be compounded in cosmetics. Preferably, vitamin B, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, And their salts (thiamine hydrochloride, sodium ascorbate, etc.) or derivatives (sodium ascorbic acid-2-phosphate, magnesium ascorbate-2-phosphate etc.) can also be added to water-soluble vitamins . The water-soluble vitamin can be obtained by a conventional method such as a microorganism conversion method, a purification method from a culture of a microorganism, an enzymatic method, or a chemical synthesis method.

Usable vitamins include vitamins such as vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol) , Derivatives thereof (such as palmitic acid ascorbin, stearic acid ascorbic acid, dipalmitic acid ascorbin, dl-alpha tocopherol acetic acid, dl-alpha tocopherol nicotinic acid vitamin E, dl-pantothenyl alcohol, D-pantothenyl alcohol, Ether, etc.) are also included in the usable vitamins used in the present invention. Usability Vitamins can be obtained by a conventional method such as a microorganism conversion method, a purification method from a culture of a microorganism, an enzyme or a chemical synthesis method.

The polymeric peptide may be any compound as long as it can be compounded in cosmetics, and examples thereof include collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, and keratin. The polymeric peptide can be obtained by a conventional method such as purification from a culture broth of a microorganism, an enzymatic method, or a chemical synthesis method, or it can be purified from natural products such as ducks such as pigs and cows and silk fiber of silkworms.

The polymeric polysaccharide may be any compound as long as it can be incorporated in cosmetics, and examples thereof include hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or a salt thereof (sodium salt, etc.). For example, chondroitin sulfate or a salt thereof can be usually purified from mammals or fish.

Sphingo lipids may be any as long as they can be incorporated into cosmetics, and preferable examples thereof include ceramides, phytosphingosine and sphingoglycolipids. Sphingoid lipids can be purified from ordinary mammals, fish, shellfish, yeast or plants by conventional methods or can be obtained by chemical synthesis.

The seaweed extract may be any of those which can be compounded in cosmetics. Preferably, the seaweed extract is selected from the group consisting of algae extract, red pepper extract, green algae extract and the like. Also, the algae extract may be colored guanine, arginic acid, Potassium alginate and the like are also included in the seaweed extract used in the present invention. Seaweed extract can be obtained from seaweed by a conventional method.

The cosmetic of the present invention may be blended with other essential ingredients, if necessary, in combination with the essential ingredients.

Examples of the compounding ingredients that may be added include organic solvents such as a preservative component, a moisturizer, an emollient, a surfactant, an organic and inorganic pigment, an organic powder, an ultraviolet absorbent, a preservative, a bactericide, an antioxidant, a plant extract, a pH adjuster, A blood circulation accelerator, a cold agent, an antiperspirant agent, and purified water.

Examples of the oil retaining component include ester-based oil retaining, hydrocarbon-based oil retaining, silicone-based oil retaining, fluoric oil retaining, animal retention and plant retention.

Examples of ester-based fats include glyceryl tri-2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isostearyl isostearate, Butyl isopropyl myristate, isopropyl myristate, isopropyl myristate, isopropyl myristate, isopropyl myristate, isopropyl myristate, butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isosilyl myristate, isostearic acid isostearyl, isostearyl palmitate, octyldodecyl myristate, Trimethylol propane, triisostearic acid trimethylol propane, tetra 2-ethylhexanoic acid pentaerythritol tetra (2-ethylhexanoate) , Decyl caprylate, decyl laurate, hexyl laurate, myristate decyl, myristyl myristate, myristine monoethyl stearate, stearyl stearate, decyl oleate, ricinoleic acid tri , Isostearyl stearate, isostearyl stearate, isodecyl stearate, octyldodecyl oleate, octyldodecyl linoleate, isopropyl isostearate, isopropyl stearate, isopropyl stearate, isopropyl stearate, -Hexyl stearate, stearyl ethylhexanoate, stearyl 2-ethylhexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicaprate, di (capryl, capric acid) propylene glycol, Propyleneglycol propionate, propyleneglycol propionate, dicaproic acid neopentyl glycol, dioctanoic acid neopentyl glycol, tricarboxylic acid glyceryl, triunsaturated glyceryl, triisopalmitic acid glyceryl, triisostearic acid glyceryl, neopentanoic acid octyldodecyl Octanoic acid octanoate, octanoic acid octanoate, octanoic acid octanoate, octanoic acid octanoate, octanoic acid octanoate, octanoic acid octanoate, Octyldecyl lactate, octyldecyl lactate, octyldecyl lactate, polyglycerin oleic acid ester, polyglycerin isostearic acid ester, triisocetyl citrate, triisobutyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, But are not limited to, ethyl, acetyltriethyl citrate, acetyltributyl citrate, trioctyl citrate, diisostearyl malate, 2-ethylhexyl hydroxystearate, di-2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, But are not limited to, dioctyl sebacate, stearic acid cholesteryl, isostearic acid cholesteryl, hydroxystearic acid cholesteryl, oleic acid cholesteryl, oleic acid dihydrocholesteryl, isostearic acid pitostearyl, Stearoyl hydroxystearic acid isostearyl, 12-stearoyl stearyl hydroxystearate, 12-stearo And monohydroxystearic acid and esters such as sostearyl.

Examples of the hydrocarbon hydrocarbon-based fats include hydrocarbon fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, floating isoparaffin, polybutene, microcrystalline wax and vaseline.

Examples of silicone based oils include polymethyl silicone, methylphenyl silicone, methyl cyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane-methylcetyloxysiloxane copolymer, dimethylsiloxane-methylstarchoxysiloxane copolymer, alkyl Modified silicone oils, and amino-modified silicone oils.

Examples of the fluorine-based oil include perfluoropolyether and the like.

Examples of animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, new flower oil, soybean oil, corn oil, rape oil, apricot kernel oil, palm kernel oil, palm oil, castor oil, , Corn oil, palm oil, palm oil, cucumber nut oil, wheat germ oil, rice germ oil, shea butter, coltsfoot colostrum, marker daisy nut oil, mead home oil, egg oil, , Canned wax, carnauba wax, liquid lanolin, hardened castor oil, and the like.

Examples of the moisturizing agent include water-soluble low-molecular moisturizing agents, oil-soluble molecular moisturizing agents, water-soluble polymers, and oil-soluble polymers.

Examples of the water-soluble low-molecular moisturizing agent include serine, glutamine, sorbitol, mannitol, sodium pyrrolidone-carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B Glycol (polymerization degree n = 2 or more), polyglycerin B (polymerization degree n = 2 or more), lactic acid, lactic acid salt and the like.

Examples of the lipid-soluble low-molecular moisturizing agent include cholesterol and cholesterol ester.

Examples of the water-soluble polymer include carboxyvinyl polymer, polyaspartic acid, tragacanth, xanthan gum, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, water-soluble chitin, chitosan, dextrin, etc. .

Examples of the oil-soluble polymer include polyvinylpyrrolidone / eicosene copolymer, polyvinylpyrrolidone / hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and polymer silicone.

Examples of the emollients include long chain acyl glutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid and lanolin fatty acid cholesteryl ester.

Examples of the surfactant include nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants.

Examples of the nonionic surfactant include self emulsifying monostearate glycerin, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerin fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbit fatty acid ester, POE (Polyoxyethylene / polyoxypropylene) copolymer, POE.POP alkyl ether, polyether-modified silicone, polyether-modified silicone, polyoxyethylene-polyoxypropylene (POE) Alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

Examples of the anionic surfactant include fatty acid soap, alpha-acylsulfonate, alkylsulfonate, alkylarylsulfonate, alkylnaphthalenesulfonate, alkylsulfate, POE alkyl ether sulfate, alkylamide sulfate, alkyl phosphate, POE alkyl ginseng salt, Alkylsulfosuccinic acid salts, acylated hydrolyzed collagen peptide salts, and perfluoroalkyl phosphoric acid esters, and the like can be mentioned. have.

Examples of the cationic surfactant include alkyl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, stearyl trimethyl ammonium bromide, cetostearyl trimethyl ammonium chloride, distearyl dimethyl ammonium chloride, stearyl dimethyl benzyl ammonium chloride, behenyl trimethyl ammonium chloride, Benzalkonium, diethylaminoethylamide stearate, dimethylaminopropylamide stearate, quaternary ammonium salts of lanolin derivatives, and the like.

Examples of the amphoteric surfactant include carboxybetaine type, amide betaine type, sulfobetaine type, hydroxysulfobetaine type, amidosulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type and amide amine type Amphoteric surfactants and the like.

Examples of the organic and inorganic pigments include inorganic pigments such as silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, Bengala, clay, bentonite, titanium mica, titanium oxide, bismuth chloride, zirconium oxide, magnesium oxide, Inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, chromium oxide, chromium oxide, chromium hydroxide, But are not limited to, polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, Silk powder, cellulose, CI Pigment Yellow, CI Pigment Orange, and composite pigments of inorganic pigments and organic pigments thereof.

As the organic powder, metallic soap such as calcium stearate; Metal salts of alkyl phosphates such as sodium zinc cetylate, zinc laurylate and calcium lauryl laurate; Acylamino acid polyvalent metal salts such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc and N-lauroylglycine calcium; Amidosulfonic acid multivalent metal salts such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; Such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylidene, N-alpha-paratyylnitine, N-alpha-lauroyl arginine, Acyl basic amino acids; N-acylpolypeptides such as N-lauroylglycylglycine; Alpha-amino fatty acids such as alpha-aminocaprylic acid, alpha-aminoaurauric acid, and the like; Polyethylene, polypropylene, nylon, polymethylmethacrylate, polystyrene, divinylbenzene-styrene copolymer, ethylene tetrafluoride, and the like.

Examples of ultraviolet absorbers include paraaminobenzoic acid, ethyl parnamobenzoate, amyl paranobenzoate, octyl paranobenzoate, ethyleneglycol salicylate, phenyl salicylate, benzyl salicylate, benzyl salicylate, butylphenyl salicylate, homomenthyl salicylate, benzyl cinnamate , Octyl methoxycinnamate, dioctyl methoxycinnamate, mono-2-ethylhexane glyceryl dipyrromethoxycinnamate, isopropyl paratumoxycinnamate, diisopropyl-diisopropyl cinnamate ester mixture, Carninoic acid, ethyl urocanoate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenone sulfonic acid and salts thereof, dihydroxymethoxybenzophenone, sodium dihydroxymethoxybenzophenone disulfonate, dihydroxybenzophenone , Tetrahydroxybenzophenone, 4- tert -butyl-4'-methoxydibenzoylmethane, 2,4,6-trianylino- p- (carbo-2'-ethylhexyl-1'- , 3,5-triazine, 2- (2- And the like can be mentioned hydroxy-5-methylphenyl) benzotriazole.

Examples of the disinfectant include hinokitiol, trichloroacid, trichlorohydroxydiphenyl ether, crohexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zinc filitione, benzalkonium chloride, No. 301, mononitro and eicol sodium, and undecylenic acid.

Examples of the antioxidant include butylhydroxyanisole, gallic acid propyl, and eicosorbic acid.

Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogenphosphate and the like.

Examples of the alcohol include higher alcohols such as cetyl alcohol.

In addition, any of the above components may be blended within the range not to impair the objects and effects of the present invention, but it is preferably 0.01 to 5% by weight based on the total weight, Preferably 0.01 to 3% by weight.

The cosmetic of the present invention may take the form of a solution, an emulsion, a viscous mixture or the like.

The ingredients contained in the cosmetic composition of the present invention may contain, as an active ingredient, the ingredients commonly used in cosmetic compositions in addition to the herbal extract of the present invention. For example, conventional ingredients such as stabilizers, solubilizers, vitamins, Phosphorus auxiliaries and carriers.

The cosmetic composition of the present invention can be prepared into any formulation conventionally produced in the art, and examples thereof include emulsions, creams, lotions, packs, foundations, lotions, essences, and hair cosmetics.

Specifically, the cosmetic composition of the present invention can be used as a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, Packs, soaps, cleansing foams, cleansing lotions, cleansing creams, body lotions and body cleansers.

When the formulation of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component .

In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. Especially, in the case of a spray, a mixture of chlorofluorohydrocarbons, propane / Propane or dimethyl ether.

In the case of the solution or emulsion of the present invention, a solvent, a solvent or an emulsifier is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

When the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolenic derivatives or ethoxylated glycerol fatty acid esters.

The herbal medicine extract of the present invention, which is composed of the goryeon, gangwi, gosam, bupyeongcho, casualties, and back muscles, has been shown to inhibit the occurrence of pathological damage such as itching, skin inflammation, erythema, Or a pharmaceutically acceptable salt thereof.

FIG. 1 shows the effect of GST on scraping behavior in NC / Nga mice, and animals were exposed to saline (Naive) or Dex (Dexamethasone) (3 mg / kg / (* <0.05, ** p <0.01, *** p , p <0.01), and GST (50 mg / kg / day) and GST <0.001);
Figure 2 shows the results of histological examination of the dissected skin in NC / Nga mice. Hematoxylin and eosin (H & E) (A) and toluidine blue (B) were performed to examine inflammatory cells and mast cells (50 mg / kg / day), E (A), Na, B, Control, C, Dex, D, and the stained tissue was observed with a light microscope (Nikon, Japan, orignalmagnification, GST (200 mg / kg / day), Toluidine blue - (B) A, Naive, B; Control, day));
FIG. 3 shows the effect of NC / Nga mouse on serum cytokine (IgE) isolated from the blood of NC / Nga mouse. NC / Nga mice induced by DNCB were anesthetized with ethyl ether, Serum was obtained and the IgE concentration was measured using an ELISA kit;
FIG. 4 shows the effect of NC / Nga mice induced by DNCB on serum cytokines isolated from the blood of NC / Nga mouse. After NCA / Nga mice were anesthetized with ethyl ether, blood was collected by cardiac puncture and serum was obtained IL-5 concentration was measured using an ELISA kit;
FIG. 5 shows the effect of NC / Nga mice induced by DNCB on serum cytokines isolated from the blood of NC / Nga mice. The NC / Nga mice were anesthetized with ethyl ether, IL-13 concentration was measured using an ELISA kit;
FIG. 6 shows the effect of NC / Nga mouse on cytokines in the culture medium of spleen cells. The cells were isolated from NC / Nga mice and cultured in 96-well culture plates coated with anti-CD3 (1 μg / plate for 48 hours, and then the culture was taken and the concentration of IL-4 was measured using an ELISA kit;
FIG. 7 shows the effect of NC / Nga mouse on the cytokines in the culture medium of splenocytes. NC / Nga mice were immunized with anti-CD3 (1 μg / ml) plate for 48 hours, and the concentration of IFN-γ was measured using an ELISA kit;
Figure 8 FIG. 3 is a graph showing the effect of GST on IL-31 in NC / Nga mouse skin, and the expression level of IL-31 and β-actin mRNA was measured by RT-PCR.

Below, The present invention will be described in detail by the following examples and experimental examples.

However, the following examples and experimental examples are illustrative of the present invention, and the content of the present invention is not limited by the following examples and experimental examples.

Example  1. Plant Extract GST Manufacturing

Six dry agents (gangjin, gangwoo, gosam, bupyeongcho, casualties and back muscles) purchased from Herb Fuyu Co., Ltd. ( http://www.herbforyou.net , Daejeon, Korea) were mixed in an Erlenmeyer flask at an equal ratio. 300 g of the drug mixture was extracted with 80% ethanol mixed with 95% ethanol and distilled water at room temperature for 1 day. The extract obtained by repeating the extraction three times in this manner was filtered, concentrated under reduced pressure using a rotary evaporator, and freeze-dried to obtain 70 g of the ethanol extract of the present invention and named GST. GST was stored at -20 ℃ in powder form.

Reference example  1. Materials and Methods

1. Materials

(1) Animals and cell lines

NC / Nga mice (Male, 6 weeks old) were purchased from the Central laboratory animals and supplied with solid feed (Samyang Feed Co.) and water at room temperature 22 ± 2 ℃, humidity 50 ~ 70%, illumination time 12 (08: 00 ~ 20: 00) and illuminance of 150 ~ 300Lux for 1 week.

(2) reagents and appliances

1) Reagent

GST (Herb Mammal), Dexamethasone (Sigma, St. Louis, MO, USA), 2,4-Dinitrochlorobenzene (Sigma, St. Louis, MO, USA), anti-CD3 (BD biosciences Co USA), isopropanol, chloroform (Sigma, St. Louis, Mo., USA), Trizol, DEPC water (Invitrogen Co., USA), SYBRPCR Master Mix, TaqMan Expression Master Mix (Applied Biosystems Co., USA) , PrimeScript ™ RT reagent kit (TAKARA Co., JAPAN), IgE ELISA kit for mouse (SAIBAYAGI Co., Itd. JAPAN), IL-4, IL-5, IL-13, IFN- (Gibco) were used for this study. The results are shown in Table 1. The results are shown in Table 1.

2) Devices

The instrument used in this experiment was a microplate spectrophotometer (Molecular Devices, USA), CO ₂ (Visionscientific Co., Korea), autoclave (Sanyo, Japan), micro-pipet (Gilson, France), waterbath (Visionscientific Co., Korea), vortex mixer (Visionscientific Co., USA). (Sigma Chemical Co., USA) and Microscopy (Nikon, JAPAN) were used for PCR analysis.

Experimental Example  One. NC / Nga  Experimental effect on atopic dermatitis

In order to confirm the effect of oral administration of the samples obtained in the above examples on NC / Nga atopic dermatitis (Matsuda, H et al., Development of atopic dermatitis like skin lesions with IgE hyperproduction in NC / Nga mice. Int Immunol., 9, 461-466, 1997).

1.1. Atopic dermatitis model NC / Nga  mouse)

1.1.1. Nc / Nga  Induction of dermatitis and treatment of samples

After 6 weeks of age, the entire back of the NC / Nga mice was removed from the lower part of the ear to the upper part of the tail, and left to stand for 24 hours to heal the fine wounds of the skin. 100 쨉 l of a 1% DNCB (2,4-Dinitrochlorobenzene) solution (acetone: olive oil = 3: 1) was applied to the depilated area and treated with 100 쨉 l of a 0.2% DNCB solution for 3 weeks. Experimental groups were divided into 5 groups. Oral saline was administered to the normal group and the control group at a dose of 3 mg / kg every other day in the positive control group Dex, and GST was administered at a dose of 50 mg / kg and 200 mg / kg in the experimental group Orally for 5 weeks.

1.1.2. NC / Nga  Effect on the itching of mice

To evaluate the effect of GST on pruritus, the number of scratches was measured for 20 minutes. As the experimental period elapsed, it was observed that the number of scratches increased in all groups, and reached the peak at 4 weeks. In the normal group, about 20 times were observed at 20 minutes, and the number was increased to about 40 times in the control group, about 28 times in the Dex (Dexamethasone) group and about 35 times in the GST 50 mg / kg group It was also confirmed that itching was reduced to about 25 times in the GST 200 mg / kg-treated group at a level similar to that of the positive control (Fig. 1).

1.1.3. NC / Nga  Effect on the skin tissue of mice

In order to investigate the effect of GST on atopic dermatitis, NC / Nga mice were treated with DNCB at a dose of 50 mg / kg and 200 mg / kg for 6 weeks with or without dermatitis. After the experiment, the skin was cut and H & E staining and toluidine blue staining were performed. In the H & E staining, the control epidermis and dermis were significantly expanded by edema and leukocyte infiltration was also observed (Fig. 2 (A) -B). In contrast, the GST-treated group showed a decrease in the thickness of the epidermis and dermis and a suppression of leukocyte infiltration compared with the control group (Fig. 2 (A) DE). When the mast cells were stained with the Toluidine blue staining method, it was observed that mast cells were remarkably infiltrated around the dermis in the control group (Fig. 2 (B) -B). On the other hand, almost no mast cells were observed in the GST-treated group as shown in the figure (Fig. 2 (B) DE).

1.1.4. NC / Nga  Isolated from blood of mice Serum  Cytokine analysis

NC / Nga mice induced by DNCB were anesthetized with ethyl ether and blood was collected by cardiac puncture. Then, serum was separated by centrifugation at 6,500 rpm for 20 minutes.

IL-5, 13, and IgE concentrations were measured using an ELISA kit as follows. Antibodies were diluted in coating buffer, coated on microwells and incubated overnight at 4 ° C. Each well was washed three times with washing buffer and 100 ㎕ of serum (100-fold dilution) was dispensed. This was incubated for 1 hour at room temperature, washed twice with washing buffer, treated with avidin-HRP conjugated antibody (100 μl), left at room temperature for 1 hour, and then washed again. 100 μl of TMB substrate was dispensed into each well and incubated in a dark place for 30 minutes. Then 50 μl of stop solution was treated and absorbance was measured at 450 nm in an ELISA reader.

RESULTS: IgE (FIG. 3) and IL-5 (FIG. 4) and 13 (FIG. 5) as Th2 cytokines were decreased in the GST-treated group in the concentration-dependent manner and the inhibition of inflammatory cytokines expressed in Th2 cells It seems to be effective.

1.1.5. NC / Nga  Of mice Splenocyte  Cytokine analysis in culture

The cells were harvested by centrifugation (1200 rpm) for 5 min in DMEM (5% FBS), and the ACK solution (8.3 g NHCl, 1 g KHCO in 1 L of demineralized water + 0.1 mM EDTA) was treated at room temperature for 5 minutes to dissolve red blood cells. Separated spleen cells (1 × 10 6 cells / well) were cultured in a 96-well culture plate coated with anti-CD3 antibody (1 μg / ml) for 48 hours. ) And IFN-y (Fig. 7). The measurement method is the same as that for measuring cytokines in serum.

Results: Th1 cytokine IFN-γ (FIG. 7) did not show a significant reduction effect, and Th2 cytokine IL-4 (FIG. 6) It seems that there is a modulating effect of cine.

1.1.6. NC / Nga  In skin tissue of mice IL -31 mRNA  Effect on expression

Real-time PCR experiments were performed to confirm the effect of IL-31 mRNA expression on NC / Nga mouse skin tissue (Takaoka A, Arai I et al., Expression of IL-31 gene transcripts in NC / Nga mice with atopic dermatitis Eur J Pharmacol 516 (2), 180-181 2005).

The back skin tissue of NC / Nga mice was removed, 500 μl of Trizol reagent was added, and 100 μl of chloroform was added to the tube. After separation of the layers by centrifugation, 200 μl of the aqueous phase solution was taken and transferred to a tube. The same amount of isopropanol was added, and the mixture was allowed to stand at room temperature for 10 minutes and centrifuged. The supernatant was removed and 1 ml of 75% ethanol was added. The supernatant was completely removed by centrifugation. The supernatant was completely removed, dried until clear, and dissolved in 20 ~ 50 μl of DEPC water according to the amount of RNA. RNA was quantitated to 200 ng / μl, and cDNA was synthesized according to the manufacturer's instructions using Prime Script ™ RT reagent kit. After the cDNA was prepared, RT-PCR was performed 25-30 times at 94 ° C for 30 seconds, 57 ° C for 30 seconds, and 72 ° C for 30 seconds after loading the cDNA into Maxime PCR PreMix Kit (see Table 1).

Mouse IL-31 primer sets forward;  5- TCGGTCAT AT GCCE CTGGAG -3 reverse;  5- GCACAGTC CTTTGGAGTTAAGTC -3 Mouse β-actin primer sets   forward;  5- CGGGGACCTGACTGACTACC -3 reverse;  5-AGGAAGGCTGGAAGAGTGC -3

RESULTS: IL-31 mRNA expression was significantly higher in the control group than in the normal group, and the expression of IL-31 mRNA was significantly suppressed in the positive control group, Dex, IL-31 mRNA expression was also inhibited in the GST 200 mg / kg administration group (FIG. 8).

1.1.7. Statistical processing

Statistical analysis was performed using unpaired student's T-test, and significance was tested at the level of P <0.05 (* p <0.05, ** p <0.01, *** p < 0.001).

Formulation examples of the composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically described.

Formulation Example  One. Sanje  Produce

GST extract 20 mg

Lactose 100 mg

Talc 10 mg

The above components are mixed and filled in airtight bags to prepare powders.

Formulation Example  2. Preparation of tablets

GST extract 10 mg

Corn starch 100 mg

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above components, tablets are prepared by tableting according to the usual preparation method of tablets.

Formulation Example  3. Preparation of capsules

GST extract 10 mg

Crystalline cellulose 3 mg

Lactose 14.8 mg

Magnesium stearate 0.2 mg

The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

Formulation Example  4. Preparation of injections

GST extract 10 mg

180 mg mannitol

Sterile sterilized water for injection 2974 mg

Na ₂ HPO _{4 ,} 12H ₂ O 26 mg

(2 ml) per 1 ampoule according to the usual injection preparation method.

Formulation Example  5. Liquid  Produce

GST extract 20 mg

10 g per isomer

5 g mannitol

Purified water quantity

Each component was added to purified water in accordance with the usual liquid preparation method and dissolved, and the lemon flavor was added in an appropriate amount. Then, the above components were mixed, and purified water was added thereto. The whole was adjusted to 100 ml with purified water, And sterilized to prepare a liquid preparation.

Formulation Example  6. Manufacture of health food

1000 mg of GST extract

Vitamin mixture quantity

70 [mu] g of vitamin A acetate

Vitamin E 1.0 mg

0.13 mg vitamin B1

0.15 mg of vitamin B2

0.5 mg vitamin B6

0.2 [mu] g vitamin B12

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 90 mg

100 mg of calcium carbonate

Hereinafter, formulations of cream, massage cream, lotion, skin lotion, essence, pack, and cleansing foam are exemplified as the formulation examples of the present invention, but the formulations including the cosmetic composition of the present invention are not limited thereto.

Formulation Example  7. Cream composition

Formulation Example  8. Massage Cream  Composition

The oil phase and water phase are mixed by heating at 75 DEG C and then cooled to room temperature.

Formulation Example  9. Lotion composition

The oil phase and water phase are mixed and emulsified by heating at 75 ° C and then cooled to room temperature.

Formulation Example  10. Skin lotion composition

The water phase and the ethanol phase are respectively prepared and mixed and then filtered.

Formulation Example  11. Essence composition

The water phase and the ethanol phase are respectively prepared and mixed and then filtered.

Formulation Example  12. Pack composition

The water phase and the ethanol phase are dispersively dissolved and mixed, and then cooled to room temperature.

Formulation Example  13. Cleansing Foam  Composition

The water phase and the oil phase are dispersed and dissolved, mixed and sieved, and then cooled to room temperature.

Claims (11)

(W / w) ratio of 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10 A pharmaceutical composition for the prevention and treatment of atopic dermatitis, which comprises, as an active ingredient, a mixed solvent extract of water and ethanol of a herbal medicine. delete delete delete The method of claim 1, wherein
Wherein the pharmaceutical composition is a cream, gel, patch, spray, ointment, warning, lotion, liniment, pasta or cataplasma formulation. delete delete (W / w) ratio of 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10 A health functional food for prevention and improvement of atopic dermatitis containing an extract of a mixture of water and ethanol of herbal medicine as an active ingredient. delete (W / w) ratio of 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10: 1 ~ 10 A cosmetic composition for the prevention and improvement of atopic dermatitis containing an extract of a mixed drug of water and ethanol as an active ingredient. The method of claim 10, wherein
The cosmetic composition is a formulation of lotion, skin, lotion, nutrition lotion, nutritional cream, massage cream, essence, or pack.

Images