KR101395343B1 - The method of distinguishing the sex of ginkgo - Google Patents

The method of distinguishing the sex of ginkgo Download PDF

Info

Publication number
KR101395343B1
KR101395343B1 KR1020120039889A KR20120039889A KR101395343B1 KR 101395343 B1 KR101395343 B1 KR 101395343B1 KR 1020120039889 A KR1020120039889 A KR 1020120039889A KR 20120039889 A KR20120039889 A KR 20120039889A KR 101395343 B1 KR101395343 B1 KR 101395343B1
Authority
KR
South Korea
Prior art keywords
primer
present
ginkgo
scar
gbm
Prior art date
Application number
KR1020120039889A
Other languages
Korean (ko)
Other versions
KR20130117435A (en
Inventor
홍용표
이제완
장경환
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020120039889A priority Critical patent/KR101395343B1/en
Priority to CN201310133068.2A priority patent/CN103374568B/en
Publication of KR20130117435A publication Critical patent/KR20130117435A/en
Application granted granted Critical
Publication of KR101395343B1 publication Critical patent/KR101395343B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 은행나무의 암나무와 수나무를 식별하기 위한 분자표지자에 관한 것으로써, 은행나무 수나무를 식별하는 유전양상을 나타내는 RAPD 단편의 염기서열로부터 개발된 수나무 특이적인 SCAR-GBM 프라이머와 기존에 개발된 미토콘드리아 DNA의 atp1 프라이머를 동시에 이용하는 multiplex PCR 방법을 통하여 임의 프라이머를 이용하는 방법보다 향상된 안정성을 나타내고 우성 표지자의 제한된 정보 제공력을 향상시킬 수 있는 은행나무 암수나무 식별 방법에 관한 것이다. The present invention relates to molecular markers for identifying ginkgo trees and vinegrowths of ginkgo biloba. The present invention relates to vine-specific SCAR-GBM primers developed from the nucleotide sequence of RAPD fragments, The present invention relates to a method for identification of a Ginkgo biloba tree, which is capable of improving the stability of a dominant marker and improving the information providing ability of a dominant marker over multiplex primer using a multiplex PCR method using the atp1 primer of mitochondrial DNA.

Description

분자표지자를 이용한 은행나무 암수나무 식별 방법{The method of distinguishing the sex of ginkgo}The method of distinguishing ginkgo trees from ginkgo trees using molecular markers

본 발명은 분자표지자를 이용한 은행나무의 암수나무 식별에 관한 것으로써 더욱 상세하게는 은행나무의 암수나무 식별이 가능한 분자표지자와 이를 이용한 식별과정에서 사용되는 멀티플렉스 중합효소 연쇄반응(multiplex PCR) 조건에 관한 것이다. The present invention relates to identification of male and female Ginkgo biloba using molecular markers, and more particularly, to molecular markers capable of identifying male and female Ginkgo biloba and multiplex PCR conditions .

은행나무는 살아 있는 화석으로 불릴 만큼 지구상에 나타난 역사가 길고 세계적으로 널리 퍼져 있는 수목으로서, 우리나라에서는 주로 가로수로 사용되며 은행을 수확하기 위한 용도로 주로 사용되고 있다. 은행나무는 결실을 위한 화분을 제공하는 수나무와 은행의 결실을 맺는 암나무가 각각의 다른 개체로 존재하는 암수 딴 그루(자웅이주) 식물이다. 그러나 은행나무가 가로수로 사용될 경우 가을철 은행 결실기에 은행의 독특한 악취와 낙과된 은행으로 인하여 도시 경관을 악화시키는 경우가 빈번하게 일어나고 있으며, 은행생산 농가에서는 암나무와 수나무의 식별이 어려워 은행생산용 암나무만을 생산하는데 어려움이 있는 실정이다. 지금까지는 은행나무의 성을 식별하기 위해서 꽃의 형태나 열매의 결실 여부를 확인하여 왔으나, 어린묘목에서는 확인하기가 어렵고 성목이 되어 개화가 가능한 시기가 되었을 때 확인이 가능하므로 시간이 오래 걸리며 성목이 되는 시간동안의 노동력과 경제적 기회비용의 증가로 은행나무 생산과 이용에 있어 효율성이 떨어지는 문제점이 발생되어 왔다. Ginkgo is a long-lived and widely distributed tree that has been shown on the earth to be called a living fossil. It is mainly used as a roadside tree in Korea and is mainly used for harvesting a bank. Ginkgo biloba is a mulberry tree that has a vase of fruit trees for fertility, and an amphibious tree of the bank as a separate entity. However, when Ginkgo biloba is used as a roadside tree, it often happens that the city's landscape is deteriorated due to the bank's unique odor and fallen banks in the autumn banking period. Which is difficult to produce. Until now, it has been confirmed whether or not the flower shape or fruit is defective in order to identify the gender of the ginkgo. However, since it is difficult to identify in young seedlings, The increase in labor and economic opportunity costs during the period of time has resulted in poor efficiency in ginkgo production and use.

상기한 문제를 해결하기 위한 기술은 국내에서는 아직까지 개발되어있지 않으며, 국외의 연구 사례를 살펴보면, Jiang et al (2003), Identification of a sex-associatied RAPD marker in Ginkgo biloba, Acta Botanica Sinica, 2003, 45:742-747 에서 은행나무의 암수나무가 식별되는 RAPD 유전양상을 보고하였으며, Liao et al (2009), Development and application of SCAR markers for sex identification in the dioecious species Ginkgo bilona L., Euphytica, 169: 49-55 에서는 은행나무의 암수나무 각각에 대한 SCAR 마커를 보고하였다. 그러나 상기 연구에서는 RAPD 기법상의 불안정성을 배제할 수 없으며, SCAR 마커의 우성 마커 성질을 보완할 수 없는 단점이 있었다. 또한, 상기 연구결과들은 본 발명의 분자표지자와 식별과정의 방법과는 상이하다.Techniques for solving the above problems have not yet been developed in Korea, and examples of research conducted outside the country include Jiang et al (2003), Identification of a sex-associatied RAPD marker in Ginkgo biloba , Acta Botanica Sinica, 2003, 45: 742-747 reported the genetic pattern of RAPD in which the male and female ginkgo trees were identified. Liao et get (2009), Development and application of SCAR markers for sex identification in the dioecious species Ginkgo bilona L., Euphytica, 169: 49-55 reported the SCAR markers for each of the male and female ginkgo trees. However, in the above study, the instability in the RAPD technique can not be excluded, and the dominant marker property of the SCAR marker can not be compensated. In addition, the results of the studies are different from those of the molecular markers of the present invention.

본 발명은 상기와 같은 문제점에 대한 해결 요구에 의해 안출된 것으로서, 임의 프라이머를 이용하는 RAPD 기법이 지니는 안정성에 대한 문제를 해결하고, RAPD 기법의 다형성으로부터 전환된 일반적인 SCAR 기법의 우성 표지자 형질을 해결하기 위하여, RAPD 기법에서 보고된 유전 염기서열을 기반으로 은행나무의 수나무에 대한 특이적인 SCAR 표지자를 개발하였으며, 미토콘드리아 DNA에서 은행나무의 성과 상관없이 모든 개체에서 안정적인 중합효소 연쇄반응 산물을 나타내는 프라이머인 atp1을 본 발명에서 개발된 은행나무의 수나무 특이 SCAR 표지자와 함께 동시 중합효소 연쇄반응(multiplex PCR)을 이용하여 안정성과 정보 제공력이 우수한 은행나무 암수나무 식별 방법을 제공하고자 한다.
DISCLOSURE OF THE INVENTION The present invention has been made in view of solving the above problems, and it is an object of the present invention to solve the problem of the stability of the RAPD scheme using arbitrary primers and to solve the dominance marker characteristic of the general SCAR technique converted from the polymorphism of the RAPD scheme We have developed a SCAR marker specific to the ginkgo biloba tree based on the genomic sequence reported in the RAPD technique. We have developed a novel SCAR marker for the Ginkgo biloba, which is a primer showing stable polymerase chain reaction The present invention provides a method for identifying Ginkgo biloba which is superior in stability and information providing ability by using the multiplex PCR technique together with the vine-specific SCAR markers of Ginkgo biloba developed in the present invention.

본 발명이 이루고자 하는 기술적 과제들은 이상에서 언급한 기술적 과제들로 제한되지 않으며, 언급되지 않은 또 다른 기술적 과제들은 본 발명의 기재로부터 당해 분야에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다. The technical objects to be achieved by the present invention are not limited to the above-mentioned technical problems, and other technical subjects which are not mentioned can be clearly understood by those skilled in the art from the description of the present invention .

상기 과제를 해결하기 위하여, 본 발명은 은행나무 암수나무의 다형적 RAPD 단편의 염기서열을 바탕으로 개발된 수나무 특이 SCAR 표지자인 1쌍의 ‘SCAR-GBM’프라이머를 제공한다. 또한 본 발명은 상기 기술된 프라이머와 함께 기존에 개발된 미토콘드리아 DNA의 특정부분을 증폭하는 프라이머인 atp1 프라이머를 동시에 중합효소 연쇄반응을 수행하는 식별 시스템에 대한 방법을 제공한다.
In order to solve the above problems, the present invention provides a pair of 'SCAR-GBM' primers, which are vine-specific SCAR markers developed based on the nucleotide sequence of polymorphic RAPD fragments of Ginkgo biloba. In addition, the present invention provides a method for an identification system for simultaneously performing a polymerase chain reaction with an atp1 primer, which is a primer for amplifying a specific portion of previously developed mitochondrial DNA together with the above-described primers.

요컨대, 본 발명에서는 서열번호 1의 포워드 프라이머와 서열번호 2의 리버스 프라이머로 구성된 SCAR-GBM 프라이머(primer)를 제공한다.
In short, the present invention provides a SCAR-GBM primer consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2.

나아가, 본 발명에서는 상기 SCAR-GBM 프라이머와 미토콘드리아 DNA의 atp1 프라이머를 동시에 multiplex PCR에 이용하는 방법을 제공한다.
Further, the present invention provides a method for simultaneously using the SCAR-GBM primer and the atp1 primer of mitochondrial DNA for multiplex PCR.

더 나아가, 본 발명에서는 상기 multiplex PCR에 이용하는 방법을 통해 은행나무의 암수를 식별하는 방법을 제공한다.
Furthermore, the present invention provides a method for identifying gender of ginkgo through the method used for multiplex PCR.

본 발명에 따르면, 은행나무의 암수나무를 개발된 SCAR-GBM 표지자를 이용하여 안정적이고 확실하게 구분할 수 있어, 은행나무의 암수나무 식별에 대한 과학적 보증을 위한 분자표지자로 활용할 수 있을 것이다. 또한, 본 발병의 방법을 이용할 경우, 기존의 방법에 비하여 시간과 노력을 절약할 수 있으며, 은행나무 이용에 있어, 가로수용 수나무를 조기 선발하여 암나무를 가로수로 식재하는 것을 방지함으로써 암나무 가로수로부터 방치되는 은행열매의 악취와 얼룩으로 인한 도시 환경 악화를 예방할 수 있을 것이며, 은행 생산 농가에서 암나무만을 조기 선별하여 식재함으로써 효과적인 은행생산을 하는데 도움이 될 것이다.According to the present invention, male and female ginkgo trees can be stably and reliably distinguished by using the developed SCAR-GBM markers, and thus they can be used as molecular markers for scientifically guaranteeing the identification of male and female ginkgo trees. In addition, when using the method of the present invention, time and effort can be saved as compared with the conventional method. In the case of using ginkgo, it is possible to prevent the planting of the tree by the early selection It will help prevent the deterioration of the urban environment caused by stench and stains of neglected bank fruit. It will help the bank to produce effective banking by early selection and planting of only the trees in bank production farms.

도 1은 은행나무 암수 식별 SCAR-GBM 분자표지자를 이용한 multiplex PCR 분획양상에 관한 것이다(♂: 수나무, ♀: 암나무)Figure 1 is a multiplex PCR fragmentation pattern using the molecular markers of SCAR-GBM identification of gingko ginseng (male: male vetch, female: female)

본 발명의 목적을 달성하기 위하여, 본 발명은 SCAR-GBM 으로 명명된 1쌍의 올리고뉴클레오티드 프라이머 세트를 제공한다.
In order to achieve the object of the present invention, the present invention provides a pair of oligonucleotide primer sets named SCAR-GBM.

본 발명에서 제공하는 은행나무 암수식별 프라이머인 SCAR-GBM 분자표지자의 염기서열은 RAPD 단편의 염기서열을 바탕으로 개발되었으며, 본 발명에 의해 처음으로 개시되는 것이다.
The nucleotide sequence of the SCAR-GBM molecule marker, which is a ginkgo biloba identification primer provided in the present invention, was developed based on the nucleotide sequence of the RAPD fragment and was first disclosed by the present invention.

본 발명에서 있어서, “프라이머”는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고튜클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 표적의 복합도, 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.
In the present invention, the term " primer " refers to a single-stranded oligotreotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as the complexity of the desired DNA target, temperature and ionic strength.

본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating angent)를 포함할 수 있다.
As used herein, an oligonucleotide used as a primer may also include a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid, or alternatively, And may include intercalating angents.

본 발명에서 제작된 SCAR-GBM 프라이머와 기존에 개발된 atp1 프라이머를 이용하여 은행나무 시료를 대상으로 multiplex PCR 을 실행한 후 아가로스 겔에서 전기영동 하여 나타나는 유전적 다형성을 관찰하면, 수나무에서는 약 1050bp의 DNA 단편과 약 675bp의 DNA 단편이 동시에 관찰되었으며, 암나무에서는 약 1050bp의 DNA 단편만 관찰되었다. 증폭된 DNA 단편중 1050bp DNA 단편은 atp1 프라이머에 의해서 증폭된 단편이고, 675bp DNA 단편은 SCAR-GBM 프라이머에 의해 증폭된 단편을 나타낸다. 1050bp DNA 단편의 경우 PCR 증폭산물과 함께 전기영동 된 DNA size marker를 기준하여 시각적으로 관찰된 값이며 675bp의 DNA 단편은 DNA size marker와 프라이머 합성에 이용된 염기서열로부터 프라이머가 증폭하는 염기서열을 기준으로 하여 계산된 길이에 준하여 관찰된 값으로 전기영동 시 시각적 관찰에 의하여 관찰자에 따라 근소하게 상이한 값을 나타낼 수 있으나 큰 오차가 나지 않는 이상 목표로 하는 DNA 부위를 정확히 증폭해 내는 것으로 간주 할 수 있다.
The genetic polymorphism of the Ginkgo biloba samples from the SCAR-GBM primer prepared in the present invention and the previously developed atp1 primer was examined by agarose gel electrophoresis. A DNA fragment of 1050 bp and a DNA fragment of about 675 bp were observed at the same time. Among the amplified DNA fragments, the 1050 bp DNA fragment was amplified by the atp1 primer and the 675 bp DNA fragment was amplified by the SCAR-GBM primer. The 1050bp DNA fragment was visually observed based on the size of the electrophoretic DNA size marker as well as the PCR amplification product. The 675bp DNA fragment was amplified using the DNA size marker and the base sequence used for primer synthesis , It can be regarded as a precise amplification of the target DNA region as long as there is no large error, although it can be slightly different according to the observer by visual observation at the time of electrophoresis .

상기 다형성을 관찰하기 위하여 수행한 multiplex PCR 반응 혼합물(12㎕)의 조성은 다음과 같다: 은행나무 게놈 DNA 10ng, 한쌍의 SCAR-GBM 프라이머 각 0.3μM, 한쌍의 atp1 프라이머 각 0.3μM,10×PCR 완충용액 1.2㎕, dNTP 0.25mM, BSA 25㎍/ml, 1 unit DNA 중합효소 및 나머지 증류수. PCR 반응의 온도 조건은 94℃에서 5분간 주형 DNA를 변성시킨후, 94℃에서 1분간 변성; 63℃에서 1분간 어닐링; 및 72℃에서 1분간 연장을 총 35회 반복 수행하고, 마지막으로 72℃에서 10분간 연장하였다. 증폭된 산물은 2% 아가로스겔에서 180volt 로 1시간 반 동안 전기영동 되었으며, UV 광선을 조사하여 밴드의 증폭양상을 확인하였다. 하기 표 1은 본 발명의 SCAR-GBM 프라이머 세트 및 multiplex PCR 을 위한 apt1 프라이머 세트의 염기서열 정보에 관한 것이다.
The composition of the multiplex PCR reaction mixture (12 쨉 l) performed to observe the polymorphism was as follows: 10 ng of ginkgo genomic DNA, 0.3 μM of each pair of SCAR-GBM primers, 0.3 μM of each pair of atp 1 primers, PCR buffer solution, 0.25 mM dNTP, 25 μg / ml BSA, 1 unit DNA polymerase and the remaining distilled water. The temperature conditions for the PCR reaction were denaturation of the template DNA at 94 DEG C for 5 minutes, denaturation at 94 DEG C for 1 minute, Annealing at 63 DEG C for 1 minute; And extension at 72 캜 for 1 minute was repeated 35 times in total, and finally, extension was performed at 72 캜 for 10 minutes. The amplified product was electrophoresed at 180volt for 1 hour and 2 hours on 2% agarose gel, and the amplification pattern of the band was confirmed by UV light irradiation. Table 1 below shows the nucleotide sequence information of the SCAR-GBM primer set of the present invention and the apt 1 primer set for multiplex PCR.

프라이머primer 염기서열(5′→3′)The base sequence (5 '- > 3') 순방향Forward direction 역방향Reverse SCAR-GBMSCAR-GBM GCTGATTAAATATGGGAGTATGCGCTGATTAAATATGGGAGTATGC GGTGCTGAGAAGGAACTTTTACGGTGCTGAGAAGGAACTTTTAC atp1atp1 TTTGCCAGCGGTGTGaAAAGGTTTGCCAGCGGTGTG a AAAGG CTTCGCGATATTGTGCCAATCTTCGCGATATTGTGCCAAT

aG or I= Inosine(2´-deoxy-Inosine)
 a G or I = Inosine (2'-deoxy-Inosine)

이상 본 발명의 구체적 실시형태와 관련하여 본 발명을 설명하였으나 이는 예시에 불과하며 본 발명은 이에 제한되지 않는다. 당업자는 본 발명의 범위를 벗어나지 않고 설명된 실시형태를 변경 또는 변형할 수 있으며, 이러한 변경 또는 변형도 본 발명의 범위에 속한다. 또한, 본 명세서에서 설명한 각 구성요소의 물질은 당업자가 공지된 다양한 물질로부터 용이하게 선택하여 대체할 수 있다. 또한 당업자는 본 명세서에서 설명된 구성요소 중 일부를 성능의 열화 없이 생략하거나 성능을 개선하기 위해 구성요소를 추가할 수 있다. 뿐만 아니라, 당업자는 공정 환경이나 장비에 따라 본 명세서에서 설명한 방법 단계의 순서를 변경할 수도 있다. 따라서 본 발명의 범위는 설명된 실시형태가 아니라 특허청구범위 및 그 균등물에 의해 결정되어야 한다.
Although the present invention has been described in connection with the specific embodiments of the present invention, it is to be understood that the present invention is not limited thereto. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. In addition, the materials of each component described herein can be readily selected and substituted for various materials known to those skilled in the art. Those skilled in the art will also appreciate that some of the components described herein can be omitted without degrading performance or adding components to improve performance. In addition, those skilled in the art may change the order of the method steps described herein depending on the process environment or equipment. Therefore, the scope of the present invention should be determined by the appended claims and equivalents thereof, not by the embodiments described.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (3)

서열번호 1의 포워드 프라이머와 서열번호 2의 리버스 프라이머로 구성된 SCAR-GBM 프라이머(primer).
A SCAR-GBM primer consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2.
제1항의 SCAR-GBM 프라이머와 서열번호3의 포워드 프라이머와 서열번호 4의 리버스 프라이머로 구성된 미토콘드리아 DNA의 atp1 프라이머를 동시에 multiplex PCR에 이용하는 방법.
A method for simultaneous multiplex PCR using the SCAR-GBM primer of claim 1, the forward primer of SEQ ID NO: 3 and the atp1 primer of mitochondrial DNA consisting of the reverse primer of SEQ ID NO: 4.
제2항의 multiplex PCR에 이용하는 방법을 통해 은행나무의 암수를 식별하는 방법.A method for identifying gonorrhea in ginkgoos through the method used in the multiplex PCR of claim 2.
KR1020120039889A 2012-04-17 2012-04-17 The method of distinguishing the sex of ginkgo KR101395343B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020120039889A KR101395343B1 (en) 2012-04-17 2012-04-17 The method of distinguishing the sex of ginkgo
CN201310133068.2A CN103374568B (en) 2012-04-17 2013-04-17 Use molecular markers for identification Sex Locus In Ginkgo Biloba L

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120039889A KR101395343B1 (en) 2012-04-17 2012-04-17 The method of distinguishing the sex of ginkgo

Publications (2)

Publication Number Publication Date
KR20130117435A KR20130117435A (en) 2013-10-28
KR101395343B1 true KR101395343B1 (en) 2014-05-19

Family

ID=49460401

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120039889A KR101395343B1 (en) 2012-04-17 2012-04-17 The method of distinguishing the sex of ginkgo

Country Status (2)

Country Link
KR (1) KR101395343B1 (en)
CN (1) CN103374568B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102026397B1 (en) 2018-11-19 2019-09-27 충북대학교 산학협력단 Primer set for loop-mediated isothemal amplification for gender identifying of ginkgo biloba and loop-mediated isothemal amplification using the same
KR102641939B1 (en) 2023-07-12 2024-02-29 애플(주) Composition for controlling the fruiting of ginkgo tree comprising nitrogen and method for controlling the fruiting of ginkgo tree using the same

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101716021B1 (en) * 2014-02-17 2017-03-14 충북대학교 산학협력단 Primer and method for diagnosting sex of ginkgo
CN105087813B (en) * 2015-09-21 2019-01-15 南京林业大学 A kind of Cultivars of Ginkgo biloba L molecular detection primer composition and its kind detection method
CN106555006B (en) * 2016-11-30 2020-05-12 青海大学 SCAR molecular marker for identifying sea buckthorn gender and application thereof
CN110195068B (en) * 2019-06-21 2021-01-15 中国农业科学院农业基因组研究所 Polynucleotide for identifying male and female ginkgo plants and application thereof
CN110484642B (en) * 2019-08-20 2023-05-05 宁波检验检疫科学技术研究院 Kit, application thereof and real-time fluorescence PCR detection method of ginkgo
CN110923304B (en) * 2019-11-29 2022-01-04 浙江大学 Molecular marker, primer pair and method for identifying sex of ginkgo biloba
CN111270002A (en) * 2020-03-22 2020-06-12 临沂大学 SCAR marking method for sex early identification of male and female ginkgo plants
CN111323509B (en) * 2020-03-24 2021-12-03 中国农业科学院农业基因组研究所 Plant sex identification method based on metabolome global analysis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Euphytica, Vol. 169, pp. 49-55 (2009.03.14.) *
Int. J. Mol. Sci., Vol. 12, pp. 857-864 (2011.01.24.) *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102026397B1 (en) 2018-11-19 2019-09-27 충북대학교 산학협력단 Primer set for loop-mediated isothemal amplification for gender identifying of ginkgo biloba and loop-mediated isothemal amplification using the same
KR102641939B1 (en) 2023-07-12 2024-02-29 애플(주) Composition for controlling the fruiting of ginkgo tree comprising nitrogen and method for controlling the fruiting of ginkgo tree using the same

Also Published As

Publication number Publication date
CN103374568A (en) 2013-10-30
KR20130117435A (en) 2013-10-28
CN103374568B (en) 2015-09-23

Similar Documents

Publication Publication Date Title
KR101395343B1 (en) The method of distinguishing the sex of ginkgo
KR101361730B1 (en) DNA Polymorphism Marker for Identification of Cucumis sativus L.
Brown et al. Anchored reference loci in loblolly pine (Pinus taeda L.) for integrating pine genomics
Kim et al. A western Eurasian male is found in 2000‐year‐old elite Xiongnu cemetery in Northeast Mongolia
Teasdale et al. Paging through history: parchment as a reservoir of ancient DNA for next generation sequencing
CN105779636A (en) PCR primer used for amplifying human breast cancer susceptibility gene BRCA1 and BRCA2 coding sequence and application thereof
WO2017028752A1 (en) Multiplex pcr primer and application thereof
US12000005B2 (en) Polynucleotide for identifying the sex of a Ginkgo biloba plant and use thereof
KR102606300B1 (en) DNA marker for discriminating genotype of Brassica rapa, Brassica oleracea and their interspecific hybrid and uses thereof
Oreshkova et al. Analysis of genetic structure and differentiation of the bog and dry land populations of Pinus sibirica Du Tour based on nuclear microsatellite loci
JP6193593B2 (en) Sex identification method for yellowtail
Nayak et al. Detection and evaluation of genetic variation in 17 promising cultivars of turmeric (Curcuma longa L.) using 4C nuclear DNA content and RAPD markers
CN101165193B (en) EST-STS marking primer 1 with differential rye1RS chromosome, screening method and use
Casado-Amezúa et al. Development of microsatellite markers as a molecular tool for conservation studies of the Mediterranean reef builder coral Cladocora caespitosa (Anthozoa, Scleractinia)
Song et al. Polymorphic microsatellite markers in the traditional Chinese medicinal plant Paris polyphylla var. yunnanensis
KR102172478B1 (en) DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof
CN103525822B (en) The molecular mark detection method that a kind of piglet diarrhea resistance is relevant and application
Ramasetty et al. Identification and genetic diversity analysis of Memecylon species using ISSR, RAPD and Gene-Based DNA barcoding tools
Yun et al. Next-generation sequencing identification and characterization of microsatellite markers in Aconitum austrokoreense Koidz., an endemic and endangered medicinal plant of Korea
KR101716021B1 (en) Primer and method for diagnosting sex of ginkgo
Ahn et al. Complete genome sequencing and analysis of Capsicum annuum varieties
CN106755558B (en) A set of primer special and its application for willow excellent variety Genetic identification
KR101783347B1 (en) CAPS marker for discriminating presence or absence of pollen in pear and uses thereof
Raposo et al. Development of novel simple sequence repeat markers from a genomic sequence survey database and their application for diversity assessment in Jatropha curcas germplasm from Guatemala.
KR101361732B1 (en) DNA Polymorphism Marker for Identification of Cucumis sativus L.

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant