KR101393978B1 - Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same - Google Patents
Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same Download PDFInfo
- Publication number
- KR101393978B1 KR101393978B1 KR1020120067253A KR20120067253A KR101393978B1 KR 101393978 B1 KR101393978 B1 KR 101393978B1 KR 1020120067253 A KR1020120067253 A KR 1020120067253A KR 20120067253 A KR20120067253 A KR 20120067253A KR 101393978 B1 KR101393978 B1 KR 101393978B1
- Authority
- KR
- South Korea
- Prior art keywords
- extract
- peptide
- present
- chungkukjang
- inflammation
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/18—Peptides; Protein hydrolysates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/02—Peptides of undefined number of amino acids; Derivatives thereof
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Engineering & Computer Science (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Veterinary Medicine (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nutrition Science (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medical Informatics (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Alternative & Traditional Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Medicines Containing Plant Substances (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 청국장 추출물의 제조 방법, 이로부터 제조된 청국장 추출물이나 펩타이드를 유효성분으로 함유하는 염증 관련질환의 예방 및 치료용 조성물에 대한 것으로, 본 발명의 청국장 추출물이나 펩타이드는 다수의 염증 관련 지표물질의 발현이나 활성을 감소시키고, 동물모델 실험에서도 부종이 억제되는 효과를 나타내기 때문에, 염증 관련질환의 예방 및 치료용 조성물로 유용하게 사용될 수 있다. The present invention relates to a method for producing an extract of Chungkookjang, a composition for preventing and treating inflammation-related diseases containing the chungkukjang extract or peptide as an active ingredient, and a method for producing the chungkukjang extract or peptide, And exhibits an effect of inhibiting edema in an animal model test. Therefore, the composition can be usefully used as a composition for preventing and treating inflammation-related diseases.
Description
본 발명은 염증의 예방 및/또는 치료에 유용한 청국장 추출물의 용도에 대한 것으로, 특히 다수의 염증 관련 지표물질의 발현이나 활성을 감소시킬 수 있는 청국장 추출물과 그로부터 분리된 펩타이드, 및 그것을 포함하는 염증 관련질환의 예방, 개선 및 치료용 조성물 또는 건강기능식품에 대한 것이다.
The present invention relates to the use of chungkookjang extract useful for the prevention and / or treatment of inflammation, and more particularly to a chungkookjang extract capable of reducing the expression or activity of a number of inflammation-related indicator substances and a peptide isolated therefrom, A composition for preventing, improving and treating diseases, or a health functional food.
염증 관련 질환은 치주염, 관절염, 위염, 장염, 비염, 부비동염, 인후염, 편도염, 폐렴 등 다양하다. 염증에는 병원균의 침범에 대비하는 급성염증과 만성염증이 있다. 염증반응은 면역반응의 일종으로 인체를 보호하는 역할을 하나, 과도하고 장기적인 만성염증은 인체에 해가 되며 이러한 질환으로는 자가면역, 알러지 등을 들 수 있다. 또한 만성염증은 심혈관계 질환, 암, 치매, 성인병 등과도 관련이 있다. iNOS (inducible nitric oxide synthase, 유도성 일산화질소합성효소), NO (일산화질소), 전사인자 NF-κB, 사이토카인 TNF-α, IL-6 등은 세포의 염증을 촉진시키는 인자이다. Inflammatory diseases include periodontitis, arthritis, gastritis, enteritis, rhinitis, sinusitis, sore throat, tonsillitis, and pneumonia. Inflammation has acute inflammation and chronic inflammation to prepare for pathogen invasion. Inflammation is a type of immune reaction that protects the human body, but excessive and long-term chronic inflammation is harmful to the human body, such as autoimmune and allergies can be mentioned. Chronic inflammation is also associated with cardiovascular disease, cancer, dementia, and adult diseases. Inducible nitric oxide synthase (iNOS), NO (nitric oxide), transcription factor NF-κB, cytokines TNF-α and IL-6 are the factors that promote inflammation in cells.
염증치료제로써 스테로이드, 아스피린 등의 약제가 개발되어 있으나, 이것들은 면역억제, 위장질환, 출혈, 간독성 등이 부작용이 알려져 있다. 이에 따라, 새롭거나 개선된 치료제 개발은 필수적이고 시급한 실정이다. 염증치료제의 개발은 염증물질의 분비 억제, 염증세포의 부착 방지등의 분야에서 진행되고 있고, 상기한 부작용을 극복하는 문제와 관련지어 천연물에서 그 활성 성분을 찾으려는 연구들이 활발히 진행되고 있다. Although drugs such as steroids and aspirin have been developed as inflammatory drugs, they are known to have side effects such as immunosuppression, gastrointestinal diseases, bleeding, and hepatotoxicity. Accordingly, the development of new or improved therapeutic agents is an essential and urgent reality. Development of an inflammatory drug has been under way in the fields of suppression of the secretion of inflammatory substances and prevention of adhesion of inflammatory cells. Studies related to the problem of overcoming the above-mentioned side effects have been actively pursued to find the active ingredient in natural products.
청국장은 콩을 원료로 한 우리나라의 대표적인 발효식품으로서, 간장, 된장, 고추장 등과 함께 오늘날까지 상용되어 온 전통 장류 중의 하나이며, 곡류를 주식으로 하는 우리민족에게 결핍되기 쉬운 필수아미노산 및 지방산을 공급시켜 주는 식품으로서 중요한 역할을 담당하여 왔다. 청국장은 삶은 콩을 볏짚에 붙어있는 고초균(枯草菌)이라 부르는 바실러스 서브틸리스(Bacillus subtilis)를 이용하여 띄워만든 것으로서, 발효과정 중에 고초균이 생산하는 효소에 의해서 그 특유의 맛과 냄새를 내는 동시에, 원료콩의 당질과 단백질에서 유래된 레반형 프룩탄(levan form fructan)과 폴리글루타메이트(polyglutamate)의 혼합물질인 점질물을 다량 생성하며, 이렇게 발효 제조된 청국장은 영양면에서 된장이나 고추장보다 단백질과 지방함량이 높은 양질의 콩 발효식품인 것이다.Cheonggukjang is one of the traditional fermented foods of Korea, which is one of the traditional fermented foods that have been used to date with soy sauce, miso, and kochujang, and supplies essential amino acids and fatty acids, which are deficient to Korean people, The state has played an important role as food. Cheonggukjang is made by using Bacillus subtilis called Bacillus subtilis, which is attached to rice straw, and gives its unique taste and smell by the enzyme produced by Bacillus subtilis during fermentation , Which is a mixture of levan form fructan and polyglutamate derived from protein-derived saccharides and protein soybean, and fermented thus produced fermented chongkukjang is more protein than soybean paste or kochujang. It is a high-quality soybean fermented food with high fat content.
최근, 많은 연구자들에 의하여 청국장 내에 포함된 활성성분 및 그 역할이 밝혀지고 있는바, 청국장은 콩에서 기인된 이소플라본(isoflavone), 피트산(phytic acid), 사포닌(saponin), 트립신 저해제(trypsin inhibitor), 불포화지방산, 식이섬유, 올리고당, γ-글루타밀트랜스펩티다제(γ-glutamyltranspeptidase; γ-GTP) 등의 각종 생리활성물질, 항산화물질 및 혈전용해 효소를 다량 함유하고 있기 때문에 기능성 식품으로서 그 중요성이 재조명되고 있다.Recently, many researchers have discovered the active ingredients and their roles in chongkukjang, and it has been shown that chonggukjang is an effective ingredient for the production of soybean-derived isoflavone, phytic acid, saponin, trypsin a large amount of various physiologically active substances such as an inhibitor, an unsaturated fatty acid, a dietary fiber, an oligosaccharide,? -glutamyltranspeptidase (? -GTP), an antioxidant substance and a thrombolytic enzyme, Its importance is being reexamined.
그 중에서, 콩에서 발견되는 이소플라본류는 이들 인자의 발현을 억제하는 항염증 효과를 갖고 있다. 대두발효식품인 청국장에는 제니스테인(genistein), 다이드제인(daidzein)과 같은 이소플라본과 단백질 분해산물인 아미노산 중합체, 펩타이드(peptide)류가 풍부하다. 이소플라본에 의한 항염효과는 비교적 많이 밝혀져 있으나, 청국장 펩타이드에 의한 항염효과에 관한 보고는 찾아보기 힘들다. Among them, isoflavones found in soybean have an anti-inflammatory effect which suppresses the expression of these factors. Soybean fermented food is rich in isoflavones such as genistein, daidzein, and amino acid polymers and peptides, which are protein degradation products. The antiinflammatory effect of isoflavones is relatively well known, but there is no report on the antiinflammatory effect of chongkukjang peptides.
펩타이드류는 아미노산의 조합이 다양성을 띠므로 이 중에서 항염효과를 지니는 물질을 발굴할 수 있을 것으로 기대하였다. 그동안 많은 항염제가 개발되어 있으나 장기간 복용해도 부작용이 없는 약제의 개발도 필요한 실정이다. 발효식품소재에서 찾아낸 항염효과를 지닌 펩타이드는 생물학적 효과가 있으면서 안전한 약제로 개발될 수 있을 것이다.
Peptides were expected to be able to identify substances with anti - inflammatory effects because of the diversity of amino acid combinations. Although many anti-inflammatory drugs have been developed in the meantime, it is necessary to develop drugs that do not have side effects even if taken for a long time. Peptides with anti-inflammatory properties found in fermented food materials could be developed as safe drugs with biological effects.
본 발명은 상기한 문제점을 해결하기 위한 것으로, 염증의 예방, 개선 및/또는 치료용으로 사용될 수 있는 식품 소재 추출물과 그로부터 분리한 펩타이드의 용도를 제공하고, 특히 대식세포(macrophage) 또는 염증 관련 인자의 발현이나 활성을 억제할 수 있는 약제학적 조성물 또는 건강기능식품을 제공하는 것이 목적이다.
The present invention provides a food material extract which can be used for the prevention, improvement and / or treatment of inflammation, and its use as a peptide isolated therefrom, Which is capable of inhibiting the expression or activity of the compound of the present invention or the health functional food.
상기한 목적을 달성하기 위한 본 발명은, 삶은 대두에 바실러스 리케니포미스(Bacillus licheniformis) B1 균을 접종하고 30~50℃에서 2~4일간 발효시키는 단계; 상기 발효시킨 발효물을 동결건조해서 분말화하는 단계; 상기 분말화한 분말을 에탄올에 녹이는 단계; 상기 에탄올에 녹인 분말을 감압증류하는 단계; 및 상기 감압증류한 분말을 동결건조시키는 단계;를 포함하는 청국장 추출물의 제조방법이다.The present invention for achieving the above object, Bacillus Erie boiled soybean Kenny Po Ms (Bacillus licheniformis ) B1 and fermenting at 30 to 50 ° C for 2 to 4 days; Lyophilizing and fermenting the fermented material; Dissolving the powdered powder in ethanol; Decompressing the powder dissolved in ethanol; And lyophilizing the powder obtained by the vacuum distillation.
여기서, 상기 에탄올은 80% 에탄올인 것이 바람직하다. Here, the ethanol is preferably 80% ethanol.
그리고, 본 발명은 상기 제조방법으로 제조된 청국장 추출물을 유효성분으로 함유하는 염증 관련 질환의 예방 및 치료용 조성물일 수 있다.Further, the present invention may be a composition for preventing and treating inflammation-related diseases containing the chungkookjang extract prepared by the above-mentioned method as an active ingredient.
또한, 상기 제조방법으로 제조된 청국장 추출물을 유효성분으로 함유하는 염증 관련 질환의 예방 및 개선용 건강기능식품인 것도 가능하다.
Also, it is possible to be a health functional food for preventing and improving inflammation-related diseases containing the chungkookjang extract prepared by the above-mentioned method as an effective ingredient.
한편, 본 발명의 다른 실시형태는, 알라닌(Alanine, Ala)-페닐알라닌(Phenylalanine, Phe)-프롤린(Proline, Pro)-글리신(Glycine, Gly)의 서열을 포함하는 염증 세포 억제용 펩타이드이다. Meanwhile, another embodiment of the present invention is a peptide for inhibiting inflammation cells comprising a sequence of alanine (Alanine, Ala) -phenylalanine, Phe-proline, Pro-glycine (Glycine, Gly).
그리고, 글루탐산(Glutamic acid, Glu)-발린(Valine, Val)-타이로신(Tyrosine, Tyr)-타이로신(Tyrosine, Tyr)-메티오닌(Methionine, Met)-타이로신(Tyrosine, Tyr)의 서열을 포함하는 염증 세포 억제용 펩타이드인 것도 가능하다.And inflammation including a sequence of glutamic acid (Glu) -valine (Valine, Val) -tyrosine (Tyr) -tyrosine (Tyr) -methionine (Met) -tyrosine It is also possible to be a peptide for inhibiting cells.
상기 염증 세포 억제용 펩타이드는 청국장 추출물에서 분리된 것이 바람직하다. The inflammatory cytosolic peptide is preferably isolated from the extract of Chungkookjang.
그리고, 상기 염증 세포는 지질다당류(Lipopolysaccharide, LPS)에 의해 활성화된 대식세포(macrophage)일 수 있다. The inflammatory cells may be macrophages activated by lipopolysaccharide (LPS).
또한, 본 발명은 유도성 일산화질소합성효소(inducible nitric oxide synthase, iNOS), 일산화질소(NO), 전사인자 NF-κB, 사이토카인 TNF-α, 및 IL-6 로 이루어진 군에서 선택된 하나 이상의 발현 또는 활성을 감소시키는 것을 특징으로 하는 염증 세포 억제용 펩타이드인 것이 가능하다. The present invention also relates to a method of inhibiting the expression of at least one selected from the group consisting of inducible nitric oxide synthase (iNOS), nitric oxide (NO), transcription factor NF-κB, cytokine TNF- Or activity of the peptides of the present invention.
또한, 상기 펩타이드를 유효성분으로 함유하는 염증 관련 질환의 예방 및 치료용 조성물일 수 있다. Further, the composition may be a composition for preventing and treating an inflammation-related disease containing the peptide as an active ingredient.
또한, 상기 펩타이드를 유효성분으로 함유하는 염증 관련 질환의 예방 및 개선용 건강기능식품인 것도 가능하다.
It is also possible to be a health functional food for prevention and improvement of inflammation-related diseases containing the peptide as an active ingredient.
기타 실시예들의 구체적인 사항들은 상세한 설명 및 도면들에 포함되어 있다.
The details of other embodiments are included in the detailed description and drawings.
이러한 본 발명의 청국장 추출물이나 펩타이드는 대식세포 또는 다수의 염증 관련 지표물질의 발현이나 활성을 감소시키고, 동물모델 실험에서도 부종이 억제되는 효과를 나타내기 때문에, 염증 관련질환의 예방, 개선 및 치료용 조성물로 유용하게 사용될 수 있다.
Since the chungkookjang extract or peptide of the present invention reduces the expression or activity of macrophages or a large number of inflammation-related indicator substances and exhibits an effect of suppressing edema even in an animal model experiment, it can be used for preventing, May be useful as a composition.
도 1은 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 iNOS 단백질 농도 감소와, NO 생산량 감소를 나타내는 Western bloting 실험 결과 사진 및 그래프이고(CHU: 청국장 에탄올 추출물),
도 2는 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 iNOS mRNA 농도 감소를 나타내는 Real time PCR 실험 결과 그래프이고,
도 3은 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 NF-κB 감소를 나타내는 reporter assay 실험 결과 그래프이고,
도 4는 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 TNF-α 농도 감소를 나타내는 ELISA 실험 결과 그래프이고,
도 5는 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 IL-6 농도 감소를 나타내는 ELISA 실험 결과 그래프이고,
도 6은 본 발명의 바람직한 일 실시예에 따른 제1펩타이드에 의한 iNOS 단백질 농도 감소를 나타내는 Western bloting 실험 결과 사진이고, ,
도 7은 본 발명의 바람직한 일 실시예에 따른 제2펩타이드에 의한 iNOS 단백질 농도 감소를 나타내는 Western bloting 실험 결과 사진이고, ,
도 8은 비교예에 따른 제3펩타이드와 제4펩타이드에 의한 iNOS 단백질 농도를 나타내는 루시페라아제(Luciferase) 활성 실험 결과 그래프이고,
도 9는 본 발명의 바람직한 일 실시예에 따른 제1펩타이드 및 제2펩타이드에 의한 iNOS mRNA 농도 감소를 나타내는 Real time PCR 실험 결과 그래프이고,
도 10은 본 발명의 바람직한 일 실시예에 따른 제1펩타이드 및 제2펩타이드에 의한 TNF-α mRNA 농도 감소를 나타내는 Real time PCR 실험 결과 그래프이고,
도 11은 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 부종 억제 효과를 나타내는 실험 결과 그래프이다.FIG. 1 is a photograph and a graph (Western blotting) of CHN (chungkukjang ethanol extract) showing reduction of iNOS protein concentration and reduction of NO production by chungkookjang extract according to a preferred embodiment of the present invention,
FIG. 2 is a graph showing real-time PCR test results showing the decrease in iNOS mRNA concentration by the extract of Chungkookjang according to a preferred embodiment of the present invention,
FIG. 3 is a graph showing a reporter assay experiment result showing reduction of NF-κB by the extract of Chungkookjang according to a preferred embodiment of the present invention,
FIG. 4 is a graph showing the results of an ELISA experiment showing a decrease in TNF-.alpha. Concentration by the extract of Chungkookjang extract according to a preferred embodiment of the present invention,
FIG. 5 is a graph showing an ELISA test result showing reduction of IL-6 concentration by the extract of Chungkukjang according to a preferred embodiment of the present invention,
FIG. 6 is a photograph of a Western blotting experiment showing decrease in iNOS protein concentration by the first peptide according to a preferred embodiment of the present invention,
FIG. 7 is a photograph of a Western blotting experiment showing decrease in iNOS protein concentration by a second peptide according to a preferred embodiment of the present invention,
8 is a graph showing the results of luciferase activity test showing the iNOS protein concentration by the third peptide and the fourth peptide according to the comparative example,
FIG. 9 is a graph showing real-time PCR experiment results showing decrease in iNOS mRNA concentration by the first peptide and the second peptide according to a preferred embodiment of the present invention,
FIG. 10 is a graph showing real-time PCR experiment results showing decrease in TNF-α mRNA concentration by the first peptide and the second peptide according to a preferred embodiment of the present invention,
FIG. 11 is a graph showing an experimental result showing an effect of suppressing edema by the extract of Chungkookjang extract according to a preferred embodiment of the present invention.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시 예를 가질 수 있는 바, 특정 실시 예들을 도면에 예시하고 상세한 설명에서 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.BRIEF DESCRIPTION OF THE DRAWINGS The present invention is capable of various modifications and various embodiments, and specific embodiments are illustrated in the drawings and will be described in detail in the detailed description. It is to be understood, however, that the invention is not to be limited to the specific embodiments, but includes all modifications, equivalents, and alternatives falling within the spirit and scope of the invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, the present invention will be described in detail with reference to the accompanying drawings.
본 출원에서 사용한 용어는 단지 특정한 실시예를 설명하기 위해 사용된 것으로, 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 출원에서, "포함하다" 또는 "가지다" 등의 용어는 명세서상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.The terminology used in this application is used only to describe a specific embodiment and is not intended to limit the invention. The singular expressions include plural expressions unless the context clearly dictates otherwise. In the present application, the terms "comprises" or "having" and the like are used to specify that there is a feature, a number, a step, an operation, an element, a component or a combination thereof described in the specification, But do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.
제1, 제2 등의 용어는 다양한 구성요소들을 설명하는데 사용될 수 있지만, 상기 구성요소들은 상기 용어들에 의해 한정되어서는 안 된다. 상기 용어들은 하나의 구성요소를 다른 구성요소로부터 구별하는 목적으로만 사용된다.
The terms first, second, etc. may be used to describe various components, but the components should not be limited by the terms. The terms are used only for the purpose of distinguishing one component from another.
본 발명에 따른 청국장 추출물은 하기와 같이 수득될 수 있다.The chungkukjang extract according to the present invention can be obtained as follows.
먼저, 대두를 세척하고, 물에 침지시킨 다음 가압증자기를 이용하여 삶는다. 그리고, 이렇게 삶은 대두에 바실러스 리케니포미스(Bacillus licheniformis), 바람직하게는 바실러스 리케니포미스 B1 균을 접종하고 30~50℃에서 2~4일간, 바람직하게는 40℃에서 3일간 발효시키는 단계; 상기 발효시킨 발효물을 동결건조해서 분말화하는 단계; 상기 분말화한 분말을 물, 탄소수 1 내지 4의 저급알코올 또는 이들의 혼합용매로부터 선택된 용매, 바람직하게는 물, 에탄올, 부탄올 또는 이들의 혼합용매, 더욱 바람직하게는 에탄올에 녹이는 단계; 상기 에탄올에 녹인 분말을 감압증류하는 단계; 및 상기 감압증류한 분말을 동결건조시키는 단계;를 거친다. First, the soybeans are washed, immersed in water, and boiled using a pressurizer. And, in this boiled soybeans, Bacillus ( Bacillus) licheniformis , preferably Bacillus licheniformis B1, and fermenting at 30 to 50 ° C for 2 to 4 days, preferably at 40 ° C for 3 days; Lyophilizing and fermenting the fermented material; Dissolving the powdered powder in a solvent selected from water, a lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, preferably water, ethanol, butanol or a mixed solvent thereof, more preferably ethanol; Decompressing the powder dissolved in ethanol; And lyophilizing the vacuum distilled powder.
상기 대두는 한국산 및 중국산, 일본산 등의 외국산 대두를 포함한다.The soybean includes foreign soybeans such as Korean, Chinese, and Japanese.
일반적으로, 대두를 이용하여 청국장 제조시에는 대부분 바실러스 서브틸리스(Bacillus subtilis) 균을 사용하지만, 본 발명은 특별히 바실러스 리케니포미스(Bacillus licheniformis), 더욱 바람직하게는 바실러스 리케니포미스 B1 균을 이용하는 것이 특징이다. In general, when soybean is used to produce chungkukjang, most of the Bacillus subtilis subtilis ), the present invention is particularly useful in the treatment of Bacillus subtilis licheniformis ), more preferably Bacillus licheniformis B1 bacteria.
그리고, 본 발명은 대두 발효물로부터 추출물을 얻기 위하여, 열수추출, 냉침추출, 환류 냉각 추출 또는 초음파 추출 등의 추출방법을 사용할 수 있지만, 특별히 용매로는 물, 에탄올, 부탄올 또는 이들의 혼합용매, 바람직하게는 에탄올, 더욱 바람직하게는 80% 에탄올을 이용함으로써, 염증에 효과적인 추출물을 얻을 수 있었다.
In order to obtain the extract from the fermented soybean, the extraction method such as hot water extraction, cold extraction, reflux cooling extraction or ultrasonic extraction may be used. As the solvent, water, ethanol, butanol or a mixed solvent thereof, By using ethanol, more preferably 80% ethanol, an extract effective for inflammation was obtained.
이와 함께, 본 발명은 상기 제조방법으로 제조된 청국장 추출물을 유효성분으로 함유하는 염증 관련 질환의 예방 및 치료용 약학 조성물을 제공할 수 있다. In addition, the present invention can provide a pharmaceutical composition for preventing and treating an inflammation-related disease containing the chungkookjang extract prepared by the above-mentioned method as an active ingredient.
본 발명의 염증 관련 질환 예방 및 치료용 조성물은 조성물 총 중량에 대하여 청국장 추출물을 0.1 내지 50 중량%로 포함한다. 그러나 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 종류 및 진행 정도에 따라 변할 수 있다.The composition for the prevention and treatment of inflammation-related diseases according to the present invention contains 0.1 to 50% by weight of the extract of Chungkookjang based on the total weight of the composition. However, the composition is not limited thereto, and may vary depending on the condition of the patient, the type of disease, and the progress of the disease.
상기 염증 관련 질환은 염증, 위염, 대장염, 류마티스 관절염, 신장염, 간염, 동맥경화, 암 또는 퇴행성 질환, 바람직하게는 염증, 위염, 류마티스 관절염 또는 퇴행성 질환, 더욱 바람직하게는 류마티스 관절염을 포함한다.The inflammation related diseases include inflammation, gastritis, colitis, rheumatoid arthritis, nephritis, hepatitis, arteriosclerosis, cancer or degenerative diseases, preferably inflammation, gastritis, rheumatoid arthritis or degenerative diseases, more preferably rheumatoid arthritis.
본 발명의 약학 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of pharmaceutical compositions.
그리고, 본 발명은 상기한 청국장 추출물을 유효성분으로 함유하는 염증 관련 질환의 예방 및 개선용 건강기능식품을 제공할 수 있다.The present invention can provide a health functional food for prevention and improvement of inflammation-related diseases containing the above-mentioned chungkukjang extract as an active ingredient.
본 발명의 건강기능식품은 정제, 캡슐제, 환제 또는 액제 등의 형태를 포함하여, 본 발명의 조성물을 첨가할 수 있는 식품으로는, 예를 들어, 각종 식품류, 음료, 껌, 차, 비타민 복합제, 건강 기능성 식품류 등이 있다.The health functional food of the present invention may be in the form of tablets, capsules, pills, liquids, etc., and foods to which the composition of the present invention can be added include various foods, beverages, gums, tea, vitamins , And health functional foods.
또한, 염증 관련 질환의 예방 및 개선 효과를 목적으로 식품 또는 음료에 첨가될 수 있다. 이때, 식품 또는 음료 중의 상기 조성물의 양은 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 음료 조성물은 100ml를 기준으로 0.02 내지 10 g, 바람직하게는 0.3 내지 1 g의 비율로 가할 수 있다.It can also be added to foods or beverages for the purpose of preventing and improving inflammation-related diseases. At this time, the amount of the composition in the food or drink may be 0.01 to 15% by weight of the total food, and the health beverage composition may be added in a proportion of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml .
본 발명의 건강 음료 조성물은 지시된 비율로 필수 성분으로서 상기 추출물을 함유하는 것 외에 액체성분에는 특별한 제한점은 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.The health beverage composition of the present invention may contain various flavors or natural carbohydrates such as ordinary beverages as an additional ingredient, as long as it contains the extract as an essential ingredient at the indicated ratio, and there is no particular limitation to the liquid ingredient.
또한, 본 발명은 상기 제조방법에 의해 제조된 지방이 제거된 탈지 청국장을 함유하는 식품 및 식품첨가제를 제공할 수 있다.In addition, the present invention can provide a food and food additive containing fat-free defatted chongkukjang produced by the above-mentioned production method.
본 발명의 탈지 청국장을 함유하는 식품첨가제에는 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성피로인산염, 폴리인산염 (중합인산염) 등의 인산염이나 폴리페놀, 카테킨(catechin), 알파-토코페롤, 로즈마리 추출물 (rosemary extract), 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제 중 어느 하나 또는 하나 이상을 추가로 포함할 수 있다.The food additive containing the defatted cheonggukjang of the present invention may be selected from the group consisting of organic acids such as citric acid, fumaric acid, adipic acid, lactic acid and malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate and polyphosphate one or more of natural antioxidants such as catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid and phytic acid.
이와 함께, 본 발명은 상기 제조 방법으로 제조된 청국장 추출물을 유효성분으로 함유하는 화장료 조성물을 제공하는 것도 가능하다.
In addition, it is possible to provide a cosmetic composition containing the chungkukjang extract prepared by the above-mentioned method as an active ingredient.
한편, 본 발명은 염증 관련 세포나 인자의 발현 또는 활성 억제용 펩타이드에 대한 것으로, 특히 염증의 예방, 개방 및/또는 치료용으로 사용되는 펩타이드 화합물을 제공하는 것이다. Meanwhile, the present invention relates to a peptide for inhibiting the expression or activity of an inflammation-related cell or factor, and in particular, to provide a peptide compound used for preventing, opening and / or treating inflammation.
본 발명자들은 수년간 연구하고 노력한 끝에, 염증 억제 효과를 가지는 펩타이드를 청국장 유래 펩타이드의 변형물에서 찾아내었다. 그 펩타이드의 서열(sequence)은 아미노기말단-Ala-Phe-Pro-Gly-카르복실기말단, 또는 아미노기말단-Glu-Val-Tyr-Tyr-Met-Tyr-카르복실기말단이다. 이에 따라, 본 발명에 따른 염증 억제용 펩타이드는, 알라닌(Alanine, Ala)-페닐알라닌(Phenylalanine, Phe)-프롤린(Proline, Pro)-글리신(Glycine, Gly)의 서열(제1펩타이드), 또는 글루탐산(Glutamic acid, Glu)-발린(Valine, Val)-타이로신(Tyrosine, Tyr)-타이로신(Tyrosine, Tyr)-메티오닌(Methionine, Met)-타이로신(Tyrosine, Tyr)의 서열(제2펩타이드)을 포함하는 것이 특징이다. 이러한 펩타이드는 펩타이드 자동 합성기에 의해 용이하게 제조될 수 있다.After years of research and effort, the present inventors have found peptides having an inflammation-suppressing effect in a modification of a peptide derived from chungkukjang. The sequence of the peptide is an amino terminal end -Ala-Phe-Pro-Gly-carboxyl terminal end or an amino terminal end -Glu-Val-Tyr-Tyr-Met-Tyr-carboxyl terminal end. Accordingly, the inflammation-inhibiting peptide according to the present invention can be used as a prophylactic and / or therapeutic agent for the prevention and treatment of inflammation such as alanine (Alanine), phenylalanine (Phe) -prolyine (Glycine, Gly) (Second peptide) of the tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, . Such peptides can be easily prepared by an automatic peptide synthesizer.
후술하는 실시예에 나타난 바와 같이, 대식세포(macrophage)에 LPS (Lipopolysaccharide)를 처리하면 대식세포가 활성화되면서, 염증지표인 iNOS의 단백질과 NO생산, iNOS mRNA 발현은 증가하고, NF-κB의 활성이 크게 증가하며, TNF-α와 IL-6의 발현 역시 크게 증가한다. 그런데, 본 발명에 따른 청국장 에탄올 추출물을 LPS 처리된 대식세포에 반응시키면 청국장 에탄올 추출물의 농도에 의존적으로 iNOS의 단백질, NO 생산, iNOS mRNA 발현이 감소하고, NF-κB의 활성이 크게 감소하며, TNF-α와 IL-6의 발현 역시 뚜렷하게 감소함을 확인하였다. 그리고, 상기 청국장 에탄올 추출물로부터 분리한 본 발명에 따른 제1펩타이드 및 제2펩타이드를 이용하는 경우에도 iNOS의 단백질, iNOS와 TNF-α mRNA의 발현 수준 역시 감소함을 확인하였다. As shown in the examples described later, when macrophages are treated with LPS (Lipopolysaccharide), the macrophage is activated, and the protein and NO production and iNOS mRNA expression of the inflammatory index iNOS are increased, and the activity of NF- And the expression of TNF-α and IL-6 is also greatly increased. However, when the ethanol extract of chungkukjang according to the present invention is reacted with LPS-treated macrophages, the expression of iNOS protein, NO production, and iNOS mRNA is decreased depending on the concentration of ethanol extract of chungkukjang, and the activity of NF- TNF-α and IL-6 expression were also significantly decreased. Also, the expression levels of iNOS, iNOS and TNF-α mRNA were also decreased when the first and second peptides according to the present invention isolated from the ethanol extract of chungkukjang were used.
이에 따라, 본 발명은 상기 제1펩타이드 및 제2펩타이드의 용도, 예를 들어 염증 관련 세포 또는 표지인자의 증식 또는 전이를 포함하는 염증 질환의 치료, 개선 및/또는 예방을 위해 사용되는 용도에 관한 것이다. Accordingly, the present invention relates to the use of said first peptide and said second peptide, for use for the treatment, improvement and / or prevention of an inflammatory disease comprising the proliferation or metastasis of inflammation-related cells or markers will be.
나아가 염증, 위염, 대장염, 류마티스 관절염, 신장염, 간염, 동맥경화, 암 또는 퇴행성 질환, 바람직하게는 염증, 위염, 류마티스 관절염 또는 퇴행성 질환, 더욱 바람직하게는 류마티스 관절염 등의 질환에 대한 약물 요법의 치료제 및 예방 및/또는 치료용 치료제로서의 용도도 가능하다. 본 발명은 바람직하게는 상기 펩타이드를 함유하는 동결건조물 또는 액상 완충액 또는 인공 모유 제제 형태의 약제학적 제제, 조성물 또는 키트도 가능하다. Further, the present invention relates to a therapeutic agent for drug therapy for diseases such as inflammation, gastritis, colitis, rheumatoid arthritis, nephritis, hepatitis, arteriosclerosis, cancer or degenerative diseases, preferably inflammation, gastritis, rheumatoid arthritis or degenerative diseases, more preferably rheumatoid arthritis And therapeutic agents for prevention and / or treatment. The present invention is preferably applicable to pharmaceutical preparations, compositions or kits in the form of lyophilizates or liquid buffers or artificial breast milk preparations containing the peptides.
이러한 약제학적 조성물은 적어도 하나의 약제학적으로 허용가능한 담체, 부형제, 결합제, 붕괴제, 글리덴트(glident), 희석제, 윤활제, 착색제, 감미제, 향미제, 방부제 등과 함께, 활성 성분으로서의 펩타이드 또는 펩타이드 배합물을 포함한다. 본 발명의 약제학적 조성물은 공지된 방법으로 적절한 용량 레벨로 통상적인 고체 또는 액체 담체 또는 희석제 및 통상적인 약제학적으로 제조된 애주번트 중에서 제조될 수 있다. Such a pharmaceutical composition may comprise a peptide or peptide combination as an active ingredient together with at least one pharmaceutically acceptable carrier, excipient, binder, disintegrant, glident, diluent, lubricant, colorant, sweetener, flavoring, preservative, . The pharmaceutical compositions of the present invention can be prepared in conventional manner in conventional solid or liquid carriers or diluents and conventional pharmaceutically-acceptable adjuvants, at the appropriate dosage levels by known methods.
바람직하게, 상기 펩타이드 또는 펩타이드 배합물은 정맥내 투여에 적합하거나, 경구 투여에 적합하거나, 흡입 투여에 적합하다. 투여 형태로는 예를 들면, 환약, 정제, 필름 정제, 코팅 정제, 캡슐, 리포좀 제제, 마이크로 및 나노 제제, 분말 및 침착물을 들 수 있다. 또한, 본 발명은 또한 피부, 피내, 위내, 피부내 (intracutan), 혈관내, 정맥내, 근육내, 복강내, 비강내, 질내, 구강내, 경피적 (percutan), 직장, 피하, 설하, 국소, 또는 경피 투여를 포함한 비경구 투여용 약제학적 제제를 포함하며, 제제는 전형적인 비히클 및/또는 희석제 이외에도, 본 발명의 펩타이드 또는 펩타이드 배합물을 함유한다.Preferably, the peptide or peptide combination is suitable for intravenous administration, is suitable for oral administration, or is suitable for inhalation administration. Dosage forms include, for example, pills, tablets, film tablets, coated tablets, capsules, liposomal preparations, micro and nano preparations, powders, and deposits. The present invention also encompasses the use of a compound of formula (I) as described herein for the manufacture of a medicament for the treatment of a disease or condition selected from the group consisting of skin, intradermal, intragastric, intracutaneous, intravascular, intravenous, intramuscular, intraperitoneal, intranasal, intrathecal, intraoral, percutaneous, , Or transdermal administration, the preparations containing the peptides or peptide formulations of the present invention, in addition to the typical vehicles and / or diluents.
본 발명은 또한 약제학적 제제 및/또는 영양 보조 식품으로서 신생아 (newborn), 유아 (toddler), 및 소아(infant)에게 펩타이드 배합물을 경구 투여하기 위한 제제로서 포유동물 밀크, 인공 포유동물 밀크, 및 포유동물 밀크 대용품을 포함한다.The present invention also relates to pharmaceutical formulations and / or nutritional supplements which are formulated for oral administration of peptide formulations to newborn, toddler, and infant, such as mammalian milk, artificial mammalian milk, Includes animal milk substitutes.
본 발명의 펩타이드 또는 펩타이드 배합물은 또한 이의 약제학적으로 활성인 염의 형태로 투여될 수 있다. 적절한 약제학적으로 활성인 염은 산부가염 및 알칼리염 또는 알칼리 토금속염을 포함한다. 예를 들면, 나트륨, 칼륨, 리튬, 마그네슘 또는 칼슘 염이 얻어질 수 있다. 본 발명의 펩타이드 또는 펩타이드 배합물은 유기산 및 무기산과 약제학적으로 허용가능한 염을 생성한다.The peptide or peptide combination of the present invention may also be administered in the form of its pharmaceutically active salts. Suitable pharmaceutically active salts include acid addition salts and alkali salts or alkaline earth metal salts. For example, sodium, potassium, lithium, magnesium or calcium salts may be obtained. The peptide or peptide combination of the present invention produces organic and inorganic acids and pharmaceutically acceptable salts.
본 발명의 약제학적 조성물은 전형적으로 원하는 투여 형태에 대하여, 즉, 정제, 캡슐 (고체, 반고체 또는 액체 충전), 구성용 분말, 통상적인 약무와 일치하는 에어로졸 제제 형태의 경구 투여를 위해 선택된 적절한 담체 물질과 함께 투여될 수 있다.The pharmaceutical compositions of the present invention are typically formulated for a desired dosage form, that is, tablets, capsules (solid, semi-solid or liquid), powders for constitution, suitable carriers selected for oral administration in the form of aerosol preparations, ≪ / RTI >
본 발명의 또 하나의 측면은 영양 보조 식품으로서의 개시된 펩타이드 및 펩타이드 배합물의 용도에 관한 것이다. 영양 보조 식품은 경구 투여용으로 바람직하고, 특히 신생아, 유아, 및/또는 소아에로의 투여에 바람직하나, 이에 한정되지 않는다. 영양 보조 식품은 일상의 음식물을 보충하는데 사용된다. 이들 제품의 "식이 성분"은 또한 비타민, 미네랄, 허브 또는 다른 식물 성분, 아미노산, 및 물질, 예컨대 효소, 장기 조직, 선 (glandular), 및 대사 산물을 포함할 수 있다. 영양 보조 식품은 예컨대, 정제, 캡슐, 소프트젤, 젤캡, 액체, 또는 분말 형태로 제조될 수 있다.Another aspect of the present invention relates to the use of the disclosed peptides and peptide formulations as nutritional supplements. Nutritional supplements are preferred for oral administration, and are preferred, but not exclusively, for administration to neonates, infants, and / or children. Nutritional supplements are used to supplement daily food. The "dietary components" of these products may also include vitamins, minerals, herbs or other plant components, amino acids, and substances such as enzymes, organ systems, glands, and metabolites. Nutritional supplements may be prepared, for example, in the form of tablets, capsules, soft gels, gel caps, liquids, or powders.
본 발명의 또 하나의 측면은 본 발명의 펩타이드 또는 펩타이드 배합물을 포함하는 약제학적 조성물을 후술하는 질환을 치료하는데 효과적인 치료적 유효량으로 이를 필요로 하는 환자에게 투여하는 것을 포함하는, 염증 관련 질환의 예방 및/또는 치료 방법에 관한 것이다.Another aspect of the present invention is the use of a pharmaceutical composition comprising a peptide or a peptide combination of the present invention in a patient in need thereof in a therapeutically effective amount effective to treat a disease, And / or a method of treatment.
이와 함께, 펩타이드 또는 펩타이드 배합물은 a) 내지 g)에 열거된 하기 활성 중 어느 하나를 증명한다면, 치료 활성을 갖는 것으로 간주된다:Together, the peptide or peptide combination is considered to have therapeutic activity if it proves any of the following activities listed in a) to g):
a) 펩타이드는 과잉으로 활동하는 생물학적 경로의 활성을 억제할 수 있다.a) Peptides can inhibit the activity of an overactive biological pathway.
b) 펩타이드는 과잉으로 생산된 생체 분자의 생산을 억제할 수 있다.b) Peptides can inhibit the production of biomolecules produced in excess.
c) 펩타이드는 과잉으로 생산된 생체 분자의 활성을 억제할 수 있다.c) Peptides can inhibit the activity of biomolecules produced in excess.
d) 펩타이드는 활성이 저하된 생물학적 경로의 활성을 증가시킬 수 있다.d) Peptides can increase the activity of degraded biological pathways.
e) 펩타이드는 불충분하게 생산된 생체 분자의 생산을 증가시킬 수 있다.e) Peptides can increase the production of biomolecules that are poorly produced.
f) 펩타이드는 불충분하게 생산된 생체 분자의 활성을 모방할 수 있다.f) Peptides can mimic the activity of biomolecules that are poorly produced.
g) 펩타이드는 염증, 위염, 대장염, 류마티스 관절염, 신장염, 간염, 동맥경화, 암 또는 퇴행성 질환 또는 본 명세서에 기재된 다른 질환의 증상 및/또는 진행을 예방, 억제, 또는 저지할 수 있다.
g) Peptides may prevent, inhibit, or inhibit the symptoms and / or progression of inflammation, gastritis, colitis, rheumatoid arthritis, nephritis, hepatitis, arteriosclerosis, cancer or degenerative diseases or other diseases described herein.
본 발명은 하기의 실시예에 의하여 보다 더 잘 이해 될 수 있으며, 하기의 실시예는 본 발명의 예시 목적을 위한 것이며, 첨부된 특허청구범위에 의하여 한정되는 보호범위를 제한하고자 하는 것은 아니다.
The present invention may be better understood by the following examples, which are for the purpose of illustrating the invention and are not intended to limit the scope of protection defined by the appended claims.
실시예Example
1: 청국장 추출물의 제조 1: Preparation of Chungkookjang Extract
삶은 대두에 Bacillus licheniformis B1균을 접종하고, 40도에서 3일간 발효시킨 후, 진공동결 건조시켜서 분말로 만들었다. 그런 다음, 상기 분말을 80% 에탄올에 녹이고, 이를 감압증류시킨 후 다시 진공동결 건조시켜서 청국장 추출물을 얻었다.
Bacillus in boiled soybeans Licheniformis B1 was inoculated, fermented at 40 ° C for 3 days, and vacuum lyophilized to powder. Then, the powder was dissolved in 80% ethanol, distilled under reduced pressure, and vacuum lyophilized again to obtain a chungkookjang extract.
실시예Example
2: 청국장 추출물로부터 2: From Chungkukjang extract
펩타이드의Of peptide
분리 detach
상기 실시예 1에서 얻은 청국장 에탄올 추출물에 존재하는 펩타이드를 얻기 위해 ODS(제조회사 Waters, 5C18-AR-300 (4.6×250 mm))칼럼을 이용하고, 0.1% TFA가 포함되어 있는 CH3CN (20-50%)를 용매로 하여, 유속 0.5 ml/분의 조건에서 HPLC를 수행하였다. Example for first obtaining the peptides present in the soybean ethanol extract obtained in the CH is ODS contain (manufacturer Waters, 5C18-AR-300 ( 4.6 × 250 mm)) using the column and, 0.1% TFA 3 CN ( 20-50%) as a solvent at a flow rate of 0.5 ml / min.
그 결과, 아래와 같은 4종류의 펩타이드를 얻었다.As a result, the following four kinds of peptides were obtained.
- 제1펩타이드 : 아미노기말단-Ala-Phe-Pro-Gly-카르복실기말단- first peptide: amino terminus -Ala-Phe-Pro-Gly-carboxyl terminus
- 제2펩타이드 : 아미노기말단-Glu-Val-Tyr-Tyr-Met-Tyr-카르복실기말단- Second Peptide: Amino group end-Glu-Val-Tyr-Tyr-Met-Tyr-carboxyl end
- 제3펩타이드 : 아미노기말단-Lys-Pro-카르복실기말단- tertiary peptide: amino terminus-Lys-Pro-carboxyl terminus
- 제4펩타이드 : 아미노기말단-Gln-Lys-카르복실기말단
- fourth peptide: amino-terminal-Gln-Lys-carboxyl-terminal
실험예Experimental Example
1: 염증 관련 1: inflammation related
표시인자의Display factor
억제 실험 Inhibition experiment
대식세포 (Macrophage ( macrophagemacrophage ) 배양) Culture
Raw264.7 대식세포를 10% fetal bovine serum (FBS), 50 U/m1 penicillin, 50 μg/ml streptomycin을 포함한 Dulbecco's modified Eagle's medium (DMEM)에서 37℃, 5% CO2 조건에서 배양하였다.
Raw 264.7 macrophages were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), 50 U / ml penicillin and 50 μg / ml streptomycin at 37 ° C and 5% CO 2 .
NONO 생산량 결정 Determination of yield
LPS 및 청국장 추출물을 처리한 대식세포 배양액과 Griess 시약 (1% sulfanilamide, 0.1% N-1-naphthylenediamine dihydrochlorie, 2.5% phosphoric acid)섞은 후, 540 nm에서 흡광도를 측정하였다.
LPS and chungkukjang extract were mixed with Griess reagent (1% sulfanilamide, 0.1% N- 1-naphthylenediamine dihydrochloride, 2.5% phosphoric acid) and then absorbance was measured at 540 nm.
NFNF -κB -KB reporterreporter assayassay
전사인자 NF-κB가 부착할 수 있는 사이트와 luciferase reporter 유전자를 갖고 있는 plasmid를 세포에 transfection시켰다. LPS만 처리한 대조군과 LPS와 청국장 에탄올 추출물을 같이 처리한 실험군에서의 reporter의 발현을 비교하였다.
Transfection of plasmid with transfected NF-κB-binding site and luciferase reporter gene was performed. We compared the expression of reporter in the control group treated with LPS alone and in the experimental group treated with LPS and chongkukjang ethanol extract.
RealReal timetime PCRPCR
대식세포로부터 Trizol reagent (Invitrogen)을 이용하여 RNA를 분리한 후, AMV 역전사효소 (Promega)와 oligo dT16 primer를 넣어 cDNA를 합성하였다. iNOS (inducible nitric oxide synthase) mRNA의 발현정도를 알기 위해서는 5‘CCTCCTCCACCCTACCAAGT3', 5'CACCCAAAGTGCTTCAGTCA3'의 2개 primer를 이용하고 TNF-α의 경우는 5’GGTGAGGAGCACGTAGTCGG3', 5'TCCCAGGTTCTCTTCAAGGGA3'의 2개 primer를 이용하여 real-time PCR을 수행하여 각각의 mRNA의 양을 정량하였다.
RNA was isolated from macrophages using Trizol reagent (Invitrogen), and cDNA was synthesized with AMV reverse transcriptase (Promega) and oligo dT 16 primer. Two primers, 5'CCTCCTCCACCCTACCAAGT3 'and 5'CACCCAAAGTGCTTCAGTCA3', were used to determine the expression level of iNOS (inducible nitric oxide synthase) mRNA. In the case of TNF-α, 5'GGTGAGGAGCACGTAGTCGG3 'and 5'TCCCAGGTTCTCTTCAAGGGA3' Real-time PCR was performed to quantify the amount of each mRNA.
WesternWestern blottingblotting
대식세포 추출물을 원심분리하여 가라앉은 세포 debris는 버리고 나머지 액에 대해 SDS-polyacrylamide gel 전기영동을 수행하였다. Peroxidase가 연결되어 있는 항토끼 항체를 이차 항체로 이용하여 효소와 기질의 화학반응을 이용하여 단백질 band를 확인하였다.
The macrophage extract was centrifuged and the submerged cell debris was discarded and SDS-polyacrylamide gel electrophoresis was performed on the remaining liquid. Peroxidase - conjugated anti - rabbit antibody was used as a secondary antibody to identify protein bands by enzymatic and substrate chemical reactions.
EnzymeEnzyme -- linkedlinked immunosorbentimmunosorbent assayassay ( ( ELISAELISA ))
청국장 추출물을 대식세포에 한 시간 처리한 후, LPS와 함께 TNF-α 처리 시는 6시간, IL-6 처리 시는 18시간 세포를 배양하였다. 세포배양액 속의 TNF-α와 IL-6의 농도는 각각의 항체와 biotinyl이 붙은 2차 항체를 이용하여 결정하였다.
Chungkookjang extract was incubated with macrophage for one hour and then incubated for 6 hours with TNF-α and 18 hours with IL-6. The concentration of TNF-α and IL-6 in the cell culture medium was determined by using secondary antibody with each antibody and biotinyl.
실험 결과는, 도 1 내지 도 11에 나타난 바와 같다.Experimental results are shown in Figs. 1 to 11. Fig.
도 1은 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 iNOS 단백질 농도 감소와, NO 생산량 감소를 나타내는 Western bloting 실험 결과 사진 및 그래프이고(CHU: 청국장 에탄올 추출물), 도 2는 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 iNOS mRNA 농도 감소를 나타내는 Real time PCR 실험 결과 그래프이다. 1 is a photograph and a graph (CHU: chungkukjang ethanol extract) of a Western blotting experiment showing decrease in iNOS protein concentration and decrease in NO production by an extract of Chungkookjang according to a preferred embodiment of the present invention; FIG. 2 is a graph showing a real-time PCR experiment showing reduction of iNOS mRNA concentration by the extract of Chungkookjang according to an embodiment.
여기에 나타난 바와 같이, 대식세포 Raw264.7에 LPS (Lipopolysaccharide)를 처리하면 대식세포가 활성화되면서, 염증지표인 iNOS의 단백질과 NO생산, iNOS mRNA 발현은 증가하는데, 본 발명에 따른 청국장 에탄올 추출물을 LPS처리된 대식세포에 처리하면 청국장 에탄올 추출물의 농도에 의존적으로 iNOS의 단백질, NO 생산, iNOS mRNA 발현이 감소함을 확인할 수 있다.
As shown here, treatment of macrophage Raw264.7 with LPS (Lipopolysaccharide) increases macrophage activation, iNOS protein and NO production and iNOS mRNA expression, which are inflammatory indicators, Treatment with LPS-treated macrophages results in a decrease in iNOS protein, NO production and iNOS mRNA expression depending on the concentration of ethanol extract of chungkookjang.
도 3은 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 NF-κB 감소를 나타내는 reporter assay 실험 결과 그래프이다. FIG. 3 is a graph showing a reporter assay experiment result showing reduction of NF-κB by the extract of Chungkookjang according to a preferred embodiment of the present invention.
여기에 나타난 바와 같이, 대식세포에 LPS를 처리하여 NF-κB의 활성이 크게 증가하지만, 본 발명에 따른 청국장 에탄올 추출물을 같이 처리해 주면 NF-κB의 활성이 크게 감소함을 확인할 수 있다.
As shown in the figure, the activity of NF-κB is greatly increased by treatment of macrophages with LPS, but the activity of NF-κB is greatly reduced by treating the ethanol extract of chungkukjang according to the present invention.
도 4는 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 TNF-α 농도 감소를 나타내는 ELISA 실험 결과 그래프이고, 도 5는 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 IL-6 농도 감소를 나타내는 ELISA 실험 결과 그래프이다. FIG. 4 is a graph showing the results of an ELISA experiment showing reduction of TNF-.alpha. Concentration by the extract of Chungkukjang according to a preferred embodiment of the present invention. FIG. 5 is a graph showing the decrease of IL- ≪ / RTI >
대식세포에 1 mg/ml의 청국장 에탄올 추출물을 1시간 처리하고, 계속해서 LPS (03 μg/ml)을 추가로 집어 넣은 다음, TNF-α 처리 시는 6시간, IL-6 처리 시는 18시간 세포를 배양하였다. 그 결과, 대식세포에 LPS를 처리하면 염증지표 TNF-α와 IL-6의 발현은 크게 증가하였으나, 본 발명에 따른 청국장 추출물을 LPS와 같이 넣을 경우 염증지표인 TNF-α와 IL-6의 발현을 뚜렷하게 억제함을 확인할 수 있다.
The macrophages were treated with 1 mg / ml of the ethanol extract of chungkookjang for 1 hour, followed by addition of LPS (03 μg / ml), followed by 6 hours of TNF-α treatment and 18 hours of IL- Cells were cultured. As a result, the expression of inflammatory markers TNF-a and IL-6 was greatly increased by treating LPS with macrophages. However, when the extract of Lactobacillus casei according to the present invention was added with LPS, expression of TNF-a and IL-6 As shown in Fig.
도 6은 본 발명의 바람직한 일 실시예에 따른 제1펩타이드에 의한 iNOS 단백질 농도 감소를 나타내는 Western bloting 실험 결과 사진이(#1 peptide : 제1펩타이드)고, 도 7은 본 발명의 바람직한 일 실시예에 따른 제2펩타이드에 의한 iNOS 단백질 농도 감소를 나타내는 Western bloting 실험 결과 사진이며(#2 peptide : 제2펩타이드), 도 8은 비교예에 따른 제3펩타이드와 제4펩타이드에 의한 iNOS 단백질 농도를 나타내는 루시페라아제(Luciferase) 활성 실험 결과 그래프이다(#3 : 제3펩타이드, #4 : 제4펩타이드, Veh: 아무 것도 처리하지 않음).FIG. 6 is a photograph (# 1 peptide: first peptide) of a Western blotting experiment showing a decrease in iNOS protein concentration by a first peptide according to a preferred embodiment of the present invention, (# 2 peptide: second peptide) showing the decrease of iNOS protein concentration by the second peptide according to the second peptide, and Figure 8 shows the concentration of iNOS protein by the third peptide and the fourth peptide according to the comparative example (# 3: the third peptide, # 4: the fourth peptide, Veh: nothing is treated).
대식세포에 LPS를 처리하면 염증 지표 유전자 iNOS 발현은 증가되었다. 그러나, 본 발명에 따른 청국장 에탄올 추출물에서 HPLC에 의해 분리된 펩타이드 Ala-Phe-Pro-Gly (#1 peptide) 혹은 Glu-Val-Tyr-Tyr-Met-Tyr (#2 peptide)를 LPS (03 μg/ml)와 함께 대식세포에 18시간 처리하여 배양한 후, 세포 추출액에 대해 iNOS에 대한 western blotting을 수행한 결과, 염증지표인 iNOS 단백질의 발현은 각각의 펩타이드의 농도 증가에 의존적으로 감소하였다. Treatment of macrophages with LPS increased expression of inflammatory markers gene iNOS. However, the peptide Ala-Phe-Pro-Gly (# 1 peptide) or Glu-Val-Tyr-Tyr-Met-Tyr (# 2 peptide) isolated by HPLC in the ethanol extract of chrysinaceous cells according to the present invention was changed to LPS / ml) for 18 hrs. After iNOS western blotting was performed on the cell extracts, the expression of iNOS protein, which is an inflammatory indicator, decreased depending on the concentration of each peptide.
이와 비교하여, LPS와 함께 본 발명에 따른 청국장 에탄올 추출물에서 분리한 다른 펩타이드 Lys-Pro (#3), 혹은 Gln-Lys (#4)를 처리하면 iNOS발현은 별다른 차이를 보이지 않았다. 이는 이들 펩타이드들이 항염증 효과가 없음을 의미한다.
In contrast, treatment of Lys-Pro (# 3) or Gln-Lys (# 4) isolated from the extract of chungkukjang ethanol according to the present invention with LPS showed no significant difference in iNOS expression. This means that these peptides do not have anti-inflammatory effects.
도 9는 본 발명의 바람직한 일 실시예에 따른 제1펩타이드 및 제2펩타이드에 의한 iNOS mRNA 농도 감소를 나타내는 Real time PCR 실험 결과 그래프이고, 도 10은 본 발명의 바람직한 일 실시예에 따른 제1펩타이드 및 제2펩타이드에 의한 TNF-α mRNA 농도 감소를 나타내는 Real time PCR 실험 결과 그래프이다.FIG. 9 is a graph showing real-time PCR experiment results showing decrease in iNOS mRNA concentration by the first peptide and the second peptide according to a preferred embodiment of the present invention. And a decrease in TNF-α mRNA concentration by the second peptide.
위와 같은 조건에서 배양한 대식세포에서 mRNA를 추출하고 real time PCR을 수행하여 iNOS와 TNF-α mRNA의 발현수준을 결정하였다. iNOS mRNA의 발현도 본 발명에 따른 2 종류의 펩타이드에 의해 농도의존적으로 감소했으며, TNF-α mRNA의 발현도 농도의존적으로 감소하였다.
MRNA was extracted from macrophages cultured under the above conditions and real time PCR was performed to determine the expression levels of iNOS and TNF-α mRNA. The expression of iNOS mRNA was also decreased in a concentration-dependent manner by the two kinds of peptides according to the present invention, and the expression of TNF-α mRNA decreased in a concentration-dependent manner.
실험예Experimental Example
2: 동물모델 이용한 부종 실험 2: Edema experiment using animal model
청국장 에탄올 추출물 300mg/kg을 rat 에 1주일동안 4번 격일로 경구투여하였다. 마지막 투여 다음날, 염증을 유발하는 carageenan을 rat의 뒷발에 intradermal injection하였다. 300 mg / kg of ethanol extract of chungkukjang was orally administered to the rats in four times a week for one week. On the next day of the last administration, inflammation-inducing carageenan was intradially injected into the hind paw of the rat.
도 11은 본 발명의 바람직한 일 실시예에 따른 청국장 추출물에 의한 부종 억제 효과를 나타내는 실험 결과 그래프이다.FIG. 11 is a graph showing an experimental result showing an effect of suppressing edema by the extract of Chungkookjang extract according to a preferred embodiment of the present invention.
여기에 나타난 바와 같이, 청국장 추출물을 복용하지 않은 rat (Vehicle)을 보면 부종계로 측정한 발의 염증 (부종부피)이 커지는 것을 볼 수 있다. 반면에 본 발명에 따른 청국장 추출물을 복용한 rat(CHU)에서는 30분과 2시간이 지나면서 부종이 억제되었다. 이로써 청국장 추출물이 시험관 뿐만 아니라 체내에서도 항염효과가 있음을 확인할 수 있다.
As shown here, rats (Vehicle) not taking Chungkookjang extract can be seen to have increased inflammation (edema volume) in the edema. On the other hand, in rats (CHU) taking Chungkookjang extract according to the present invention, edema was suppressed after 30 minutes and 2 hours. As a result, it can be confirmed that the extract of Chungkookjang extract has an anti-inflammatory effect not only in the test tube but also in the body.
상기한 바와 같이, 본 발명에 따른 청국장 에탄올 추출물이 대식세포에서 염증지표인 iNOS의 단백질, NO 생산, iNOS mRNA 발현을 감소시키는 등 항염효과를 확인하였으며 이는 NF-κB의 활성을 억제함으로써 이루어졌다. 청국장 에탄올 추출물은 또 다른 염증지표인 TNF-α와 IL-6의 발현을 억제시키는 항염효과를 보여 주었다. 청국장 에탄올 추출물은 시험관에서 뿐만 아니라 쥐의 부종을 감소시키는 실험을 통해 체내에서도 항염효과가 있음을 확인하였다. 청국장 에탄올 추출물에서 분리된 2개의 펩타이드는 염증지표인 iNOS 단백질의 발현을 억제하고 iNOS와 TNF-α mRNA의 발현을 억제하는 등 뚜렷한 항염효과를 보여 주었다.
As described above, the ethanol extract of chungkukjang according to the present invention showed anti-inflammatory effects such as reduction of protein, NO production and iNOS mRNA expression of iNOS, which is an inflammation index in macrophages, by inhibiting the activity of NF-κB. The ethanol extract of chungkukjang showed anti-inflammatory effect which suppresses the expression of TNF-α and IL-6, which are other inflammation indicators. The ethanol extract of chungkukjang was found to have anti-inflammatory effect in the body not only in the test tube but also in the experiment of reducing the edema of the rat. Two peptides isolated from the ethanol extract of chungkukjang inhibited the expression of the iNOS protein, which is an inflammatory marker, and showed marked anti-inflammatory effects such as inhibiting the expression of iNOS and TNF-α mRNA.
한편, 상기에서는 본 발명을 특정의 바람직한 실시예에 관련하여 도시하고 설명하였지만, 이하의 특허청구범위에 의해 마련되는 본 발명의 기술적 특징이나 분야를 이탈하지 않는 한도 내에서 본 발명이 다양하게 개조 및 변화될 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게 명백한 것이다.
While the present invention has been particularly shown and described with reference to preferred embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, It will be apparent to those skilled in the art that changes may be made.
Claims (11)
유도성 일산화질소합성효소(inducible nitric oxide synthase, iNOS), 일산화질소(NO), 전사인자 NF-κB, 사이토카인 TNF-α, 및 IL-6 로 이루어진 군에서 선택된 하나 이상의 발현 또는 활성을 감소시키는 것을 특징으로 하는 염증 세포 억제용 청국장 에탄올 추출물.
A peptide comprising a sequence of alanine (Alanine, Ala) -phenylalanine (Phe) -proline, Pro-glycine (Glycine, Gly)
(S) selected from the group consisting of inducible nitric oxide synthase (iNOS), nitric oxide (NO), transcription factor NF-κB, cytokine TNF-α and IL-6 Wherein the extract is an extract of chungkukjang for inhibiting inflammation cells.
유도성 일산화질소합성효소(inducible nitric oxide synthase, iNOS), 일산화질소(NO), 전사인자 NF-κB, 사이토카인 TNF-α, 및 IL-6 로 이루어진 군에서 선택된 하나 이상의 발현 또는 활성을 감소시키는 것을 특징으로 하는 염증 세포 억제용 청국장 에탄올 추출물.
A peptide in which the sequences of Glutamic acid (Glu) -Valin (Val) -Tirosine (Tyr) -Tirosine (Tyr) -Methionine (Met) -Tirosine Lt; / RTI >
(S) selected from the group consisting of inducible nitric oxide synthase (iNOS), nitric oxide (NO), transcription factor NF-κB, cytokine TNF-α and IL-6 Wherein the extract is an extract of chungkukjang for inhibiting inflammation cells.
상기 염증 세포는 지질다당류(Lipopolysaccharide, LPS)에 의해 활성화된 대식세포(macrophage)인 것을 특징으로 하는 염증 세포 억제용 청국장 에탄올 추출물.
The method according to claim 5 or 6,
Wherein said inflammatory cells are macrophages activated by lipopolysaccharide (LPS). ≪ RTI ID = 0.0 > 15. < / RTI >
A composition for preventing and treating inflammation-related diseases, comprising the ethanol extract of chungkukjang of claim 5 or 6 as an active ingredient.
A health functional food for preventing or ameliorating an inflammation-related disease containing the ethanol extract of Chungkookjang as an active ingredient of claim 5 or 6.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120067253A KR101393978B1 (en) | 2012-06-22 | 2012-06-22 | Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120067253A KR101393978B1 (en) | 2012-06-22 | 2012-06-22 | Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20140000727A KR20140000727A (en) | 2014-01-06 |
KR101393978B1 true KR101393978B1 (en) | 2014-05-12 |
Family
ID=50138478
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120067253A KR101393978B1 (en) | 2012-06-22 | 2012-06-22 | Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101393978B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017138788A1 (en) * | 2016-02-12 | 2017-08-17 | 호서대학교 산학협력단 | Anti-inflammatory and antibacterial composition containing, as active ingredients, peptide derived from chungkukjang extract and natural extract or fermentation product, and cosmetic composition for preventing or alleviating immune skin diseases, containing same |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105168865A (en) * | 2015-10-22 | 2015-12-23 | 黄鸿新 | Traditional Chinese medicine oral liquid for treating nephritis |
KR102281774B1 (en) * | 2018-08-16 | 2021-07-27 | 주식회사 펠리즈코스 | Composition for enhancing skin condition having skin regeneration and anti-inflammation effect |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100850443B1 (en) * | 2007-03-30 | 2008-08-07 | 한국식품연구원 | Composition comprising the extract of defatted chungkukjang for preventing and treating inflammatory disease and the method for preparing the same |
-
2012
- 2012-06-22 KR KR1020120067253A patent/KR101393978B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100850443B1 (en) * | 2007-03-30 | 2008-08-07 | 한국식품연구원 | Composition comprising the extract of defatted chungkukjang for preventing and treating inflammatory disease and the method for preparing the same |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017138788A1 (en) * | 2016-02-12 | 2017-08-17 | 호서대학교 산학협력단 | Anti-inflammatory and antibacterial composition containing, as active ingredients, peptide derived from chungkukjang extract and natural extract or fermentation product, and cosmetic composition for preventing or alleviating immune skin diseases, containing same |
Also Published As
Publication number | Publication date |
---|---|
KR20140000727A (en) | 2014-01-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101767244B1 (en) | Composition for prevention and treatment of muscular disorder or improvement of muscular functions comprising balloon-flower extract | |
KR101832897B1 (en) | Composition for prevention and treatment of muscular disorder or improvement of muscular functions comprising Mori Cortex Radicis extract, morusin, or kuwanon G | |
KR101364234B1 (en) | Pharmaceutical composition for prevention or treatment of atopic dermatitis comprising the extract Daphne genkwa, fraction of thereof or compound isolated therefrom as an active ingredient | |
KR101997060B1 (en) | Composition for prevention or treatment of muscular disorder, or improvement of muscular functions comprising fermented deer antler | |
KR20100124519A (en) | Compositions containing green tea extracts | |
JP5128826B2 (en) | Novel methylated catechins and compositions containing them | |
KR101393978B1 (en) | Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same | |
JP5403942B2 (en) | Glutathione production promoter and preventive / therapeutic agent for diseases caused by glutathione deficiency | |
KR101618116B1 (en) | Composition of extracts of Arctium lappa or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease | |
KR101530125B1 (en) | Novel Peptide derived from oyster hydrolysate with collagenase inhibitory activity and their application | |
KR101776001B1 (en) | Composition for treating, preventing or improving born loss containing panduratin or fingerroot(boesenbergia pandurata) extract | |
US20100240603A1 (en) | Expression inhibitor of nuclear transcription factor ap-1 and pharmaceuticals and products using the same | |
KR101567573B1 (en) | Composition comprising extracts of Codonopsis lanceolata or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease | |
KR102478759B1 (en) | Peptides for liver protection, hangover relief, antioxidant and anti-inflammation | |
JP7479833B2 (en) | Estrogenic Active Agent Compositions | |
KR101651082B1 (en) | A Composition Comprising the Fermentate of Puerariae Radix extract for protecting liver damage | |
KR101557934B1 (en) | Composition comprising extracts of Codonopsis lanceolata or compounds isolated therefrom for preventing, improving or treating obesity or obesity-related disease | |
KR101830395B1 (en) | Composition comprising squalene for enhancement of muscle function and prevention of muscle damage | |
JP2013166719A (en) | Ampk activator | |
WO2021065307A1 (en) | Angiotensin-converting enzyme inhibitor, blood pressure-lowering agent, and beverages and food products | |
JP2003026584A (en) | Therapeutic agent for liver disease | |
KR20150113709A (en) | Skin whitening composition containing Allium hookeri extract | |
KR102624902B1 (en) | Novel use of a nona-peptide | |
KR101855962B1 (en) | Composition for increase of exercise capacity comprising extract of Sigesbeckia spp. | |
KR20190107366A (en) | A composition comprising Micrandilactone C for preventing or treating inflammatory disease |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20170502 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20180503 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20190503 Year of fee payment: 6 |