KR101393978B1 - Composition comprising the extract or peptide of Chungkukjang for preventing and treating inflammatory disease and the method for preparing the same - Google Patents

Abstract

The present invention relates to a method for producing an extract of Chungkookjang, a composition for preventing and treating inflammation-related diseases containing the chungkukjang extract or peptide as an active ingredient, and a method for producing the chungkukjang extract or peptide, And exhibits an effect of inhibiting edema in an animal model test. Therefore, the composition can be usefully used as a composition for preventing and treating inflammation-related diseases.

Description

[0001] The present invention relates to a method for preparing an extract of Chungkookjang, a method for preparing the extract, a method for preparing the extract, a method for preparing the extract, a method for preparing the extract, same}

The present invention relates to the use of chungkookjang extract useful for the prevention and / or treatment of inflammation, and more particularly to a chungkookjang extract capable of reducing the expression or activity of a number of inflammation-related indicator substances and a peptide isolated therefrom, A composition for preventing, improving and treating diseases, or a health functional food.

Inflammatory diseases include periodontitis, arthritis, gastritis, enteritis, rhinitis, sinusitis, sore throat, tonsillitis, and pneumonia. Inflammation has acute inflammation and chronic inflammation to prepare for pathogen invasion. Inflammation is a type of immune reaction that protects the human body, but excessive and long-term chronic inflammation is harmful to the human body, such as autoimmune and allergies can be mentioned. Chronic inflammation is also associated with cardiovascular disease, cancer, dementia, and adult diseases. Inducible nitric oxide synthase (iNOS), NO (nitric oxide), transcription factor NF-κB, cytokines TNF-α and IL-6 are the factors that promote inflammation in cells.

Although drugs such as steroids and aspirin have been developed as inflammatory drugs, they are known to have side effects such as immunosuppression, gastrointestinal diseases, bleeding, and hepatotoxicity. Accordingly, the development of new or improved therapeutic agents is an essential and urgent reality. Development of an inflammatory drug has been under way in the fields of suppression of the secretion of inflammatory substances and prevention of adhesion of inflammatory cells. Studies related to the problem of overcoming the above-mentioned side effects have been actively pursued to find the active ingredient in natural products.

Cheonggukjang is one of the traditional fermented foods of Korea, which is one of the traditional fermented foods that have been used to date with soy sauce, miso, and kochujang, and supplies essential amino acids and fatty acids, which are deficient to Korean people, The state has played an important role as food. Cheonggukjang is made by using Bacillus subtilis called Bacillus subtilis, which is attached to rice straw, and gives its unique taste and smell by the enzyme produced by Bacillus subtilis during fermentation , Which is a mixture of levan form fructan and polyglutamate derived from protein-derived saccharides and protein soybean, and fermented thus produced fermented chongkukjang is more protein than soybean paste or kochujang. It is a high-quality soybean fermented food with high fat content.

Recently, many researchers have discovered the active ingredients and their roles in chongkukjang, and it has been shown that chonggukjang is an effective ingredient for the production of soybean-derived isoflavone, phytic acid, saponin, trypsin a large amount of various physiologically active substances such as an inhibitor, an unsaturated fatty acid, a dietary fiber, an oligosaccharide,? -glutamyltranspeptidase (? -GTP), an antioxidant substance and a thrombolytic enzyme, Its importance is being reexamined.

Among them, isoflavones found in soybean have an anti-inflammatory effect which suppresses the expression of these factors. Soybean fermented food is rich in isoflavones such as genistein, daidzein, and amino acid polymers and peptides, which are protein degradation products. The antiinflammatory effect of isoflavones is relatively well known, but there is no report on the antiinflammatory effect of chongkukjang peptides.

Peptides were expected to be able to identify substances with anti - inflammatory effects because of the diversity of amino acid combinations. Although many anti-inflammatory drugs have been developed in the meantime, it is necessary to develop drugs that do not have side effects even if taken for a long time. Peptides with anti-inflammatory properties found in fermented food materials could be developed as safe drugs with biological effects.

The present invention provides a food material extract which can be used for the prevention, improvement and / or treatment of inflammation, and its use as a peptide isolated therefrom, Which is capable of inhibiting the expression or activity of the compound of the present invention or the health functional food.

The present invention for achieving the above object, Bacillus Erie boiled soybean Kenny Po Ms (Bacillus licheniformis ) B1 and fermenting at 30 to 50 ° C for 2 to 4 days; Lyophilizing and fermenting the fermented material; Dissolving the powdered powder in ethanol; Decompressing the powder dissolved in ethanol; And lyophilizing the powder obtained by the vacuum distillation.

Here, the ethanol is preferably 80% ethanol.

Further, the present invention may be a composition for preventing and treating inflammation-related diseases containing the chungkookjang extract prepared by the above-mentioned method as an active ingredient.

Also, it is possible to be a health functional food for preventing and improving inflammation-related diseases containing the chungkookjang extract prepared by the above-mentioned method as an effective ingredient.

Meanwhile, another embodiment of the present invention is a peptide for inhibiting inflammation cells comprising a sequence of alanine (Alanine, Ala) -phenylalanine, Phe-proline, Pro-glycine (Glycine, Gly).

And inflammation including a sequence of glutamic acid (Glu) -valine (Valine, Val) -tyrosine (Tyr) -tyrosine (Tyr) -methionine (Met) -tyrosine It is also possible to be a peptide for inhibiting cells.

The inflammatory cytosolic peptide is preferably isolated from the extract of Chungkookjang.

The inflammatory cells may be macrophages activated by lipopolysaccharide (LPS).

The present invention also relates to a method of inhibiting the expression of at least one selected from the group consisting of inducible nitric oxide synthase (iNOS), nitric oxide (NO), transcription factor NF-κB, cytokine TNF- Or activity of the peptides of the present invention.

Further, the composition may be a composition for preventing and treating an inflammation-related disease containing the peptide as an active ingredient.

It is also possible to be a health functional food for prevention and improvement of inflammation-related diseases containing the peptide as an active ingredient.

The details of other embodiments are included in the detailed description and drawings.

Since the chungkookjang extract or peptide of the present invention reduces the expression or activity of macrophages or a large number of inflammation-related indicator substances and exhibits an effect of suppressing edema even in an animal model experiment, it can be used for preventing, May be useful as a composition.

FIG. 1 is a photograph and a graph (Western blotting) of CHN (chungkukjang ethanol extract) showing reduction of iNOS protein concentration and reduction of NO production by chungkookjang extract according to a preferred embodiment of the present invention,
FIG. 2 is a graph showing real-time PCR test results showing the decrease in iNOS mRNA concentration by the extract of Chungkookjang according to a preferred embodiment of the present invention,
FIG. 3 is a graph showing a reporter assay experiment result showing reduction of NF-κB by the extract of Chungkookjang according to a preferred embodiment of the present invention,
FIG. 4 is a graph showing the results of an ELISA experiment showing a decrease in TNF-.alpha. Concentration by the extract of Chungkookjang extract according to a preferred embodiment of the present invention,
FIG. 5 is a graph showing an ELISA test result showing reduction of IL-6 concentration by the extract of Chungkukjang according to a preferred embodiment of the present invention,
FIG. 6 is a photograph of a Western blotting experiment showing decrease in iNOS protein concentration by the first peptide according to a preferred embodiment of the present invention,
FIG. 7 is a photograph of a Western blotting experiment showing decrease in iNOS protein concentration by a second peptide according to a preferred embodiment of the present invention,
8 is a graph showing the results of luciferase activity test showing the iNOS protein concentration by the third peptide and the fourth peptide according to the comparative example,
FIG. 9 is a graph showing real-time PCR experiment results showing decrease in iNOS mRNA concentration by the first peptide and the second peptide according to a preferred embodiment of the present invention,
FIG. 10 is a graph showing real-time PCR experiment results showing decrease in TNF-α mRNA concentration by the first peptide and the second peptide according to a preferred embodiment of the present invention,
FIG. 11 is a graph showing an experimental result showing an effect of suppressing edema by the extract of Chungkookjang extract according to a preferred embodiment of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS The present invention is capable of various modifications and various embodiments, and specific embodiments are illustrated in the drawings and will be described in detail in the detailed description. It is to be understood, however, that the invention is not to be limited to the specific embodiments, but includes all modifications, equivalents, and alternatives falling within the spirit and scope of the invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, the present invention will be described in detail with reference to the accompanying drawings.

The terminology used in this application is used only to describe a specific embodiment and is not intended to limit the invention. The singular expressions include plural expressions unless the context clearly dictates otherwise. In the present application, the terms "comprises" or "having" and the like are used to specify that there is a feature, a number, a step, an operation, an element, a component or a combination thereof described in the specification, But do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.

The terms first, second, etc. may be used to describe various components, but the components should not be limited by the terms. The terms are used only for the purpose of distinguishing one component from another.

The chungkukjang extract according to the present invention can be obtained as follows.

First, the soybeans are washed, immersed in water, and boiled using a pressurizer. And, in this boiled soybeans, Bacillus ( Bacillus) licheniformis , preferably Bacillus licheniformis B1, and fermenting at 30 to 50 ° C for 2 to 4 days, preferably at 40 ° C for 3 days; Lyophilizing and fermenting the fermented material; Dissolving the powdered powder in a solvent selected from water, a lower alcohol having 1 to 4 carbon atoms or a mixed solvent thereof, preferably water, ethanol, butanol or a mixed solvent thereof, more preferably ethanol; Decompressing the powder dissolved in ethanol; And lyophilizing the vacuum distilled powder.

The soybean includes foreign soybeans such as Korean, Chinese, and Japanese.

In general, when soybean is used to produce chungkukjang, most of the Bacillus subtilis subtilis ), the present invention is particularly useful in the treatment of Bacillus subtilis licheniformis ), more preferably Bacillus licheniformis B1 bacteria.

In order to obtain the extract from the fermented soybean, the extraction method such as hot water extraction, cold extraction, reflux cooling extraction or ultrasonic extraction may be used. As the solvent, water, ethanol, butanol or a mixed solvent thereof, By using ethanol, more preferably 80% ethanol, an extract effective for inflammation was obtained.

In addition, the present invention can provide a pharmaceutical composition for preventing and treating an inflammation-related disease containing the chungkookjang extract prepared by the above-mentioned method as an active ingredient.

The composition for the prevention and treatment of inflammation-related diseases according to the present invention contains 0.1 to 50% by weight of the extract of Chungkookjang based on the total weight of the composition. However, the composition is not limited thereto, and may vary depending on the condition of the patient, the type of disease, and the progress of the disease.

The inflammation related diseases include inflammation, gastritis, colitis, rheumatoid arthritis, nephritis, hepatitis, arteriosclerosis, cancer or degenerative diseases, preferably inflammation, gastritis, rheumatoid arthritis or degenerative diseases, more preferably rheumatoid arthritis.

The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of pharmaceutical compositions.

The present invention can provide a health functional food for prevention and improvement of inflammation-related diseases containing the above-mentioned chungkukjang extract as an active ingredient.

The health functional food of the present invention may be in the form of tablets, capsules, pills, liquids, etc., and foods to which the composition of the present invention can be added include various foods, beverages, gums, tea, vitamins , And health functional foods.

It can also be added to foods or beverages for the purpose of preventing and improving inflammation-related diseases. At this time, the amount of the composition in the food or drink may be 0.01 to 15% by weight of the total food, and the health beverage composition may be added in a proportion of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml .

The health beverage composition of the present invention may contain various flavors or natural carbohydrates such as ordinary beverages as an additional ingredient, as long as it contains the extract as an essential ingredient at the indicated ratio, and there is no particular limitation to the liquid ingredient.

In addition, the present invention can provide a food and food additive containing fat-free defatted chongkukjang produced by the above-mentioned production method.

The food additive containing the defatted cheonggukjang of the present invention may be selected from the group consisting of organic acids such as citric acid, fumaric acid, adipic acid, lactic acid and malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate and polyphosphate one or more of natural antioxidants such as catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid and phytic acid.

In addition, it is possible to provide a cosmetic composition containing the chungkukjang extract prepared by the above-mentioned method as an active ingredient.

Meanwhile, the present invention relates to a peptide for inhibiting the expression or activity of an inflammation-related cell or factor, and in particular, to provide a peptide compound used for preventing, opening and / or treating inflammation.

After years of research and effort, the present inventors have found peptides having an inflammation-suppressing effect in a modification of a peptide derived from chungkukjang. The sequence of the peptide is an amino terminal end -Ala-Phe-Pro-Gly-carboxyl terminal end or an amino terminal end -Glu-Val-Tyr-Tyr-Met-Tyr-carboxyl terminal end. Accordingly, the inflammation-inhibiting peptide according to the present invention can be used as a prophylactic and / or therapeutic agent for the prevention and treatment of inflammation such as alanine (Alanine), phenylalanine (Phe) -prolyine (Glycine, Gly) (Second peptide) of the tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, . Such peptides can be easily prepared by an automatic peptide synthesizer.

As shown in the examples described later, when macrophages are treated with LPS (Lipopolysaccharide), the macrophage is activated, and the protein and NO production and iNOS mRNA expression of the inflammatory index iNOS are increased, and the activity of NF- And the expression of TNF-α and IL-6 is also greatly increased. However, when the ethanol extract of chungkukjang according to the present invention is reacted with LPS-treated macrophages, the expression of iNOS protein, NO production, and iNOS mRNA is decreased depending on the concentration of ethanol extract of chungkukjang, and the activity of NF- TNF-α and IL-6 expression were also significantly decreased. Also, the expression levels of iNOS, iNOS and TNF-α mRNA were also decreased when the first and second peptides according to the present invention isolated from the ethanol extract of chungkukjang were used.

Accordingly, the present invention relates to the use of said first peptide and said second peptide, for use for the treatment, improvement and / or prevention of an inflammatory disease comprising the proliferation or metastasis of inflammation-related cells or markers will be.

Further, the present invention relates to a therapeutic agent for drug therapy for diseases such as inflammation, gastritis, colitis, rheumatoid arthritis, nephritis, hepatitis, arteriosclerosis, cancer or degenerative diseases, preferably inflammation, gastritis, rheumatoid arthritis or degenerative diseases, more preferably rheumatoid arthritis And therapeutic agents for prevention and / or treatment. The present invention is preferably applicable to pharmaceutical preparations, compositions or kits in the form of lyophilizates or liquid buffers or artificial breast milk preparations containing the peptides.

Such a pharmaceutical composition may comprise a peptide or peptide combination as an active ingredient together with at least one pharmaceutically acceptable carrier, excipient, binder, disintegrant, glident, diluent, lubricant, colorant, sweetener, flavoring, preservative, . The pharmaceutical compositions of the present invention can be prepared in conventional manner in conventional solid or liquid carriers or diluents and conventional pharmaceutically-acceptable adjuvants, at the appropriate dosage levels by known methods.

Preferably, the peptide or peptide combination is suitable for intravenous administration, is suitable for oral administration, or is suitable for inhalation administration. Dosage forms include, for example, pills, tablets, film tablets, coated tablets, capsules, liposomal preparations, micro and nano preparations, powders, and deposits. The present invention also encompasses the use of a compound of formula (I) as described herein for the manufacture of a medicament for the treatment of a disease or condition selected from the group consisting of skin, intradermal, intragastric, intracutaneous, intravascular, intravenous, intramuscular, intraperitoneal, intranasal, intrathecal, intraoral, percutaneous, , Or transdermal administration, the preparations containing the peptides or peptide formulations of the present invention, in addition to the typical vehicles and / or diluents.

The present invention also relates to pharmaceutical formulations and / or nutritional supplements which are formulated for oral administration of peptide formulations to newborn, toddler, and infant, such as mammalian milk, artificial mammalian milk, Includes animal milk substitutes.

The peptide or peptide combination of the present invention may also be administered in the form of its pharmaceutically active salts. Suitable pharmaceutically active salts include acid addition salts and alkali salts or alkaline earth metal salts. For example, sodium, potassium, lithium, magnesium or calcium salts may be obtained. The peptide or peptide combination of the present invention produces organic and inorganic acids and pharmaceutically acceptable salts.

The pharmaceutical compositions of the present invention are typically formulated for a desired dosage form, that is, tablets, capsules (solid, semi-solid or liquid), powders for constitution, suitable carriers selected for oral administration in the form of aerosol preparations, ≪ / RTI >

Another aspect of the present invention relates to the use of the disclosed peptides and peptide formulations as nutritional supplements. Nutritional supplements are preferred for oral administration, and are preferred, but not exclusively, for administration to neonates, infants, and / or children. Nutritional supplements are used to supplement daily food. The "dietary components" of these products may also include vitamins, minerals, herbs or other plant components, amino acids, and substances such as enzymes, organ systems, glands, and metabolites. Nutritional supplements may be prepared, for example, in the form of tablets, capsules, soft gels, gel caps, liquids, or powders.

Another aspect of the present invention is the use of a pharmaceutical composition comprising a peptide or a peptide combination of the present invention in a patient in need thereof in a therapeutically effective amount effective to treat a disease, And / or a method of treatment.

Together, the peptide or peptide combination is considered to have therapeutic activity if it proves any of the following activities listed in a) to g):

a) Peptides can inhibit the activity of an overactive biological pathway.

b) Peptides can inhibit the production of biomolecules produced in excess.

c) Peptides can inhibit the activity of biomolecules produced in excess.

d) Peptides can increase the activity of degraded biological pathways.

e) Peptides can increase the production of biomolecules that are poorly produced.

f) Peptides can mimic the activity of biomolecules that are poorly produced.

g) Peptides may prevent, inhibit, or inhibit the symptoms and / or progression of inflammation, gastritis, colitis, rheumatoid arthritis, nephritis, hepatitis, arteriosclerosis, cancer or degenerative diseases or other diseases described herein.

The present invention may be better understood by the following examples, which are for the purpose of illustrating the invention and are not intended to limit the scope of protection defined by the appended claims.

Example  1: Preparation of Chungkookjang Extract

Bacillus in boiled soybeans Licheniformis B1 was inoculated, fermented at 40 ° C for 3 days, and vacuum lyophilized to powder. Then, the powder was dissolved in 80% ethanol, distilled under reduced pressure, and vacuum lyophilized again to obtain a chungkookjang extract.

Example  2: From Chungkukjang extract Of peptide  detach

Example for first obtaining the peptides present in the soybean ethanol extract obtained in the CH is ODS contain (manufacturer Waters, 5C18-AR-300 ( 4.6 × 250 mm)) using the column and, 0.1% TFA ₃ CN ( 20-50%) as a solvent at a flow rate of 0.5 ml / min.

As a result, the following four kinds of peptides were obtained.

- first peptide: amino terminus -Ala-Phe-Pro-Gly-carboxyl terminus

- Second Peptide: Amino group end-Glu-Val-Tyr-Tyr-Met-Tyr-carboxyl end

- tertiary peptide: amino terminus-Lys-Pro-carboxyl terminus

- fourth peptide: amino-terminal-Gln-Lys-carboxyl-terminal

Experimental Example  1: inflammation related Display factor  Inhibition experiment

Macrophage ( macrophage ) Culture

Raw 264.7 macrophages were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), 50 U / ml penicillin and 50 μg / ml streptomycin at 37 ° C and 5% CO ₂ .

NO  Determination of yield

LPS and chungkukjang extract were mixed with Griess reagent (1% sulfanilamide, 0.1% N- 1-naphthylenediamine dihydrochloride, 2.5% phosphoric acid) and then absorbance was measured at 540 nm.

NF -KB reporter assay

Transfection of plasmid with transfected NF-κB-binding site and luciferase reporter gene was performed. We compared the expression of reporter in the control group treated with LPS alone and in the experimental group treated with LPS and chongkukjang ethanol extract.

Real time PCR

RNA was isolated from macrophages using Trizol reagent (Invitrogen), and cDNA was synthesized with AMV reverse transcriptase (Promega) and oligo dT ₁₆ primer. Two primers, 5'CCTCCTCCACCCTACCAAGT3 'and 5'CACCCAAAGTGCTTCAGTCA3', were used to determine the expression level of iNOS (inducible nitric oxide synthase) mRNA. In the case of TNF-α, 5'GGTGAGGAGCACGTAGTCGG3 'and 5'TCCCAGGTTCTCTTCAAGGGA3' Real-time PCR was performed to quantify the amount of each mRNA.

Western blotting

The macrophage extract was centrifuged and the submerged cell debris was discarded and SDS-polyacrylamide gel electrophoresis was performed on the remaining liquid. Peroxidase - conjugated anti - rabbit antibody was used as a secondary antibody to identify protein bands by enzymatic and substrate chemical reactions.

Enzyme - linked immunosorbent assay  ( ELISA )

Chungkookjang extract was incubated with macrophage for one hour and then incubated for 6 hours with TNF-α and 18 hours with IL-6. The concentration of TNF-α and IL-6 in the cell culture medium was determined by using secondary antibody with each antibody and biotinyl.

Experimental results are shown in Figs. 1 to 11. Fig.

1 is a photograph and a graph (CHU: chungkukjang ethanol extract) of a Western blotting experiment showing decrease in iNOS protein concentration and decrease in NO production by an extract of Chungkookjang according to a preferred embodiment of the present invention; FIG. 2 is a graph showing a real-time PCR experiment showing reduction of iNOS mRNA concentration by the extract of Chungkookjang according to an embodiment.

As shown here, treatment of macrophage Raw264.7 with LPS (Lipopolysaccharide) increases macrophage activation, iNOS protein and NO production and iNOS mRNA expression, which are inflammatory indicators, Treatment with LPS-treated macrophages results in a decrease in iNOS protein, NO production and iNOS mRNA expression depending on the concentration of ethanol extract of chungkookjang.

FIG. 3 is a graph showing a reporter assay experiment result showing reduction of NF-κB by the extract of Chungkookjang according to a preferred embodiment of the present invention.

As shown in the figure, the activity of NF-κB is greatly increased by treatment of macrophages with LPS, but the activity of NF-κB is greatly reduced by treating the ethanol extract of chungkukjang according to the present invention.

FIG. 4 is a graph showing the results of an ELISA experiment showing reduction of TNF-.alpha. Concentration by the extract of Chungkukjang according to a preferred embodiment of the present invention. FIG. 5 is a graph showing the decrease of IL- ≪ / RTI >

The macrophages were treated with 1 mg / ml of the ethanol extract of chungkookjang for 1 hour, followed by addition of LPS (03 μg / ml), followed by 6 hours of TNF-α treatment and 18 hours of IL- Cells were cultured. As a result, the expression of inflammatory markers TNF-a and IL-6 was greatly increased by treating LPS with macrophages. However, when the extract of Lactobacillus casei according to the present invention was added with LPS, expression of TNF-a and IL-6 As shown in Fig.

FIG. 6 is a photograph (# 1 peptide: first peptide) of a Western blotting experiment showing a decrease in iNOS protein concentration by a first peptide according to a preferred embodiment of the present invention, (# 2 peptide: second peptide) showing the decrease of iNOS protein concentration by the second peptide according to the second peptide, and Figure 8 shows the concentration of iNOS protein by the third peptide and the fourth peptide according to the comparative example (# 3: the third peptide, # 4: the fourth peptide, Veh: nothing is treated).

Treatment of macrophages with LPS increased expression of inflammatory markers gene iNOS. However, the peptide Ala-Phe-Pro-Gly (# 1 peptide) or Glu-Val-Tyr-Tyr-Met-Tyr (# 2 peptide) isolated by HPLC in the ethanol extract of chrysinaceous cells according to the present invention was changed to LPS / ml) for 18 hrs. After iNOS western blotting was performed on the cell extracts, the expression of iNOS protein, which is an inflammatory indicator, decreased depending on the concentration of each peptide.

In contrast, treatment of Lys-Pro (# 3) or Gln-Lys (# 4) isolated from the extract of chungkukjang ethanol according to the present invention with LPS showed no significant difference in iNOS expression. This means that these peptides do not have anti-inflammatory effects.

FIG. 9 is a graph showing real-time PCR experiment results showing decrease in iNOS mRNA concentration by the first peptide and the second peptide according to a preferred embodiment of the present invention. And a decrease in TNF-α mRNA concentration by the second peptide.

MRNA was extracted from macrophages cultured under the above conditions and real time PCR was performed to determine the expression levels of iNOS and TNF-α mRNA. The expression of iNOS mRNA was also decreased in a concentration-dependent manner by the two kinds of peptides according to the present invention, and the expression of TNF-α mRNA decreased in a concentration-dependent manner.

Experimental Example  2: Edema experiment using animal model

300 mg / kg of ethanol extract of chungkukjang was orally administered to the rats in four times a week for one week. On the next day of the last administration, inflammation-inducing carageenan was intradially injected into the hind paw of the rat.

FIG. 11 is a graph showing an experimental result showing an effect of suppressing edema by the extract of Chungkookjang extract according to a preferred embodiment of the present invention.

As shown here, rats (Vehicle) not taking Chungkookjang extract can be seen to have increased inflammation (edema volume) in the edema. On the other hand, in rats (CHU) taking Chungkookjang extract according to the present invention, edema was suppressed after 30 minutes and 2 hours. As a result, it can be confirmed that the extract of Chungkookjang extract has an anti-inflammatory effect not only in the test tube but also in the body.

As described above, the ethanol extract of chungkukjang according to the present invention showed anti-inflammatory effects such as reduction of protein, NO production and iNOS mRNA expression of iNOS, which is an inflammation index in macrophages, by inhibiting the activity of NF-κB. The ethanol extract of chungkukjang showed anti-inflammatory effect which suppresses the expression of TNF-α and IL-6, which are other inflammation indicators. The ethanol extract of chungkukjang was found to have anti-inflammatory effect in the body not only in the test tube but also in the experiment of reducing the edema of the rat. Two peptides isolated from the ethanol extract of chungkukjang inhibited the expression of the iNOS protein, which is an inflammatory marker, and showed marked anti-inflammatory effects such as inhibiting the expression of iNOS and TNF-α mRNA.

While the present invention has been particularly shown and described with reference to preferred embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, It will be apparent to those skilled in the art that changes may be made.

Claims (11)

delete delete delete delete A peptide comprising a sequence of alanine (Alanine, Ala) -phenylalanine (Phe) -proline, Pro-glycine (Glycine, Gly)
(S) selected from the group consisting of inducible nitric oxide synthase (iNOS), nitric oxide (NO), transcription factor NF-κB, cytokine TNF-α and IL-6 Wherein the extract is an extract of chungkukjang for inhibiting inflammation cells.
A peptide in which the sequences of Glutamic acid (Glu) -Valin (Val) -Tirosine (Tyr) -Tirosine (Tyr) -Methionine (Met) -Tirosine Lt; / RTI >
(S) selected from the group consisting of inducible nitric oxide synthase (iNOS), nitric oxide (NO), transcription factor NF-κB, cytokine TNF-α and IL-6 Wherein the extract is an extract of chungkukjang for inhibiting inflammation cells.
delete The method according to claim 5 or 6,
Wherein said inflammatory cells are macrophages activated by lipopolysaccharide (LPS). ≪ RTI ID = 0.0 > 15. < / RTI >
delete A composition for preventing and treating inflammation-related diseases, comprising the ethanol extract of chungkukjang of claim 5 or 6 as an active ingredient.
A health functional food for preventing or ameliorating an inflammation-related disease containing the ethanol extract of Chungkookjang as an active ingredient of claim 5 or 6.

Images