KR101383829B1 - Mutant Strains for Producing 2,3-butanediol - Google Patents

Abstract

The present invention is a wabG gene activation (inactivation) represents a non-pathogenic and non-related to 2,3-butane diol when producing ability similar keulrep Ella (Klebsiella) mutant strain compared to the wild-type gene having a wabG. According to the present invention, the Klebsiella for the production of non-pathogenic 2,3-butanediol of the present invention stably produces 2,3-butanediol with similar growth rates as compared to wild species. In addition, since it is Klebsiella for the production of non-pathogenic 2,3-butane iol, it can be used safely to produce 2,3-butanediol.

Description

Mutant strains for producing 2,3-butanediol

The present invention relates to a Klebsiella mutant strain for producing 2,3-butanediol, 2.3-butanediol using the same, and 2,3-butanediol produced therefrom.

2,3-butanediol is a type of bulk chemical obtained through various bioprocesses. In addition, chemical conversion such as dehydrogenation and esterification leads to the conversion of substances such as 1,3-butadiene, diacetyl and methyl ethyl ketone, which can be applied to rubber materials, fuel additives, antifreeze, cosmetics and pharmaceuticals. It can be converted into high value materials with a very wide range of applications. Representative microorganisms that produce such 2,3-butanediol are klebsiella pneumoniae), keulrep when Ella oxy cytokine (klebsiella oxytoca ), enterobacter aerogenes ( enterobacter aerogenes ). This one (klebsiella pneumoniae in keulrep when Ella pneumoniae ) and klebsiella oxytoca are known to produce many 2,3-butanediol strains and many studies are underway. However, klebsiella pneumoniae and klebsiella oxytoca are opportunistic and are the main cause of pathogen infection. It causes pneumonia through respiratory infections and causes bacteremia, urinary tract infections, and wound infections. Eliminating the pathogenicity of Klebsiella spp. That causes these various diseases could be used safely in 2,3-butanediol production. The main causes of pathogenicity of Klebsiella spp. Include capsulpolysaccharide, lipopolysacchardie and flagella. Lipopolysaccharide (Lipopolysacchardie) is one of the components of the outer membrane, has endotoxins and serves to protect Klebsiella from various chemical attacks.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made intensive studies to develop a safe non-pathogenic when keulrep Ella (klebsiella) mutant strain capable of producing 2,3-butane diol for the preparation of compounds of hydrocarbon type of renewable energy sources. As a result, by inactivating the wabG gene of Klebsiella spp. Producing 2,3-butanediol, it was confirmed that a safe Klebsiella mutant strain for producing 2,3-butanediol can be prepared. The invention was completed.

Accordingly, it is an object of the present invention to provide a Klebsiella mutant strain.

Another object of the present invention is to provide a method for producing 2,3-butanediol.

It is another object of the present invention to provide 2,3-butanediol.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the invention there is provided wabG gene is inactivated (inactivation), and is to indicate the non-pathogenic compared to the wild type gene with the wabG 2,3-butane diol similar keulrep when Ella (Klebsiella) ability producing mutant strain To provide.

The present inventors have made intensive studies to develop a safe non-pathogenic when keulrep Ella (klebsiella) mutant strain capable of producing 2,3-butane diol for the preparation of compounds of hydrocarbon type of renewable energy sources. As a result, it was confirmed that by inactivating the wabG gene of Klebsiella spp. Producing 2,3-butanediol, a safe Klebsiella mutant strain for producing 2,3-butanediol can be prepared.

The basic strategy of the present invention is to inactivate wabG found in various Klebsiella. wabG is involved in the core biosynthesis of lipopolysaccharide, one of the components that make up the outer membrane of Klebsiella.

Inactivating wabG has been found and identified in various Klebsiella. In the following examples, wabG of Klebsiella pneumoniae and Klebsiella oxytoca of SEQ ID NOS: 1 to 6 are exemplified, but various wabGs are included in the present invention. For example, GenBank Accession Number JN377744 ( Klebsiella pneumoniae ), Accession Number NC_013508 ( Edwardsiella tarda ), accession number A6RW62 ( Botryotinia fuckeliana ), accession number NC_014378 ( Acetohalobium arabaticum ) and wabG disclosed in accession number JH417870 ( Yokenella regensburgei ) may be subject to inactivation in the present invention.

The term " inactivation " as used herein in reference to wabG refers to modifications in the genomic lobes of wabG that result in transcription or translation of the gene or impairment of activity of the gene product . Such genetic modification may include not only inactivation of the wabG coding sequence but also inactivation of its promoter. The specific inactivation of only the gene of interest in the yeast genome is possible by mutation through substitution, insertion, deletion, or a combination thereof in all or at least one subdomain of the coding gene. For example, deletion of a gene and insertion of a heterogenous sequence into a gene can be accomplished by truncation of a gene, nonsense mutation, frameshift mutation, missense mutation, etc. . Specific deactivation of these genes can be accomplished through methods established in the art.

The term " deletion " as used herein in reference to wabG has the meaning of including all deletion mutations that disrupt the function of wabG . For example, deletion of the wabG gene includes both partial deletion or complete deletion of the wabG coding sequence.

Deletion of such wabG coding sequences can be accomplished through a variety of mutagenesis methods known in the art. For example, deletion of the wabG coding sequence can be carried out by PCR mutagenesis and cassette mutagenesis (Sambrook, J. et al., Molecular Cloning . A Laboratory Manual , 3rd ed. Cold Spring Harbor Press (2001).

Preferably, the Klebsiella Klebsiella pneumoniase ), Klebsiella oxytoca ), Klebsiella granulomatis ) or Klebsiella terigena ), more preferably Klebsiella pneumoniase ) or Klebsiella oxytoca .

Preferably, the Klebsiella mutant strain that inactivates the wabG gene is free of capsule polysaccharides.

According to a preferred embodiment of the present invention, the Klebsiella mutant strain lacking the wabG gene of the present invention, compared with the Klebsiella wild type, is not homogeneous in cluster form and deletes the capsular polysaccharide.

According to Klebsiella's glucose metabolism, glucose produces 2,3-butanediol via pyruvic acid and by-products such as acetate and lactate. For efficient production of 2,3-butanediol, the production of by-products must be reduced.

According to a preferred embodiment of the present invention, the Klebsiella mutant strains of the present invention have similar 2,3-butanediol production capacity as compared to the Klebsiella wild type.

As used herein, the term “similar” means that the 2,3-butanediol production capacity of the Klebsiella mutant strain has a difference within the range of 0-40% compared to the 2,3-butanediol production capacity of the Klebsiella wild species. Means that.

Preferably, the Klebsiella mutant strains of the present invention have the same 2,3-butanediol production capacity or 1-40% reduction compared to wild type.

As used herein, the term “2,3-butanediol producing ability” refers to the ability of a Klebsiella strain to produce 2,3-butanediol as a metabolite, and is commonly used using a suitable carbon source (eg, glucose). When culturing Klebsiella strains according to the culture method, the amount of 2,3-butanediol produced by Klebsiella strains at the stationary phase time point is analyzed by a suitable analyzer (eg, HPLC (High-performance). liquid chromatography).

More preferably, the Klebsiella mutant strain of the present invention has a 1-35% reduction in 2,3-butanediol production capacity, and most preferably 1-30% reduction compared to the wild type. The cause of this decrease is that the production of 2,3-butanediol is reduced due to the decrease in productivity by gene removal and relatively low carbon consumption compared to wild type. This may increase the carbon consumption through repeated cultures to increase the production capacity of 2,3-butanediol.

Preferably, the Klebsiella mutant strains of the present invention have the same or 1-15% reduced glucose consumption in culture compared to the wild type.

As used herein, the term “glucose consumption capacity” refers to the ability of a Klebsiella strain to consume glucose as a carbon source according to a conventional culture method, and glucose added to the Klebsiella culture medium at the initial stage of culture is a source of carbon as Klebsiella grows. Phosphorus glucose is consumed as an early metabolite, and gradually decreases. The amount of glucose in Klebsiella culture medium is quantified by a suitable assay method (eg, Benedict method and DNS (Dinitrosalicylic acid method) method).

 More preferably, the Klebsiella mutant strain has a 1-10% decrease in glucose consumption in culture compared to the wild type.

Preferably, the Klebsiella mutant strain of the present invention has a lactate production capacity of 80-100% reduced in culture compared to the wild type.

As used herein, the term “lactate producing ability” refers to the ability of Klebsiella strains to produce lactate as a metabolite by-product, and to cultivate Klebsiella strains according to conventional culture methods using a suitable carbon source (eg, glucose). In this case, it means that the amount of lactate produced by the Klebsiella strains at the stationary phase time point is quantified by a suitable analyzer (eg, high-performance liquid chromatography).

More preferably, the Klebsiella mutant strain of the present invention is 90-100% reduced, most preferably 95-100% lactate production in culture compared to the wild type. If a lot of lactate is produced during the cultivation, the pH in the medium is lowered, in order to maintain a constant cultivation conditions, additional salts should be added, so it is ideal to produce less during cultivation. The Klebsiella mutant strain of the present invention produced 2,3-butanediol with little production of lactate.

According to another aspect of the present invention, the present invention provides a method for producing 2.3-butanediol comprising culturing the Klebsiella mutant strain of the present invention described above.

Since the method of the present invention utilizes the Klebsiella mutant strain, the common content between the two is omitted in order to avoid excessive complexity of the present specification.

Cultivation in the present invention can be carried out using a method commonly known in the art.

For example, to culture Klebsiella of the present invention, 1-5 g / L sodium chloride, 1-5 g / L monohydrogen sodium phosphate, 1-3 g / L sodium acetate, 20-60 g / L peptone and 2-10 g / L glucose. The culture medium is inoculated with Klebsiella and shaken at 37 ° C.

According to a preferred embodiment, the carbon source used in the process of the present invention may be a variety of carbohydrates, preferably glucose, sucrose, fructose, galactose, arabinose and lactose, most preferably glucose. As the nitrogen source used in the method of the present invention, an organic nitrogen source is used, preferably yeast extract and peptone, and most preferably yeast extract.

According to another aspect of the present invention, there is provided a 2,3-butanediol prepared by the Klebsiella mutant strain for producing non-pathogenic 2,3-butanediol of the present invention.

The 2,3-butanediol prepared by the Klebsiella mutant strain of the present invention can be applied to rubber materials, fuel additives, antifreeze, cosmetics and pharmaceuticals through chemical conversion.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a Klebsiella mutant strain for producing non-pathogenic 2,3-butanediol.

(b) Klebsiella for producing non-pathogenic 2,3-butanediol of the present invention stably produces 2,3-butanediol with similar growth rates as compared to wild species.

(c) The present invention can be safely used for the production of 2,3-butanediol using Klebsiella for producing non-pathogenic 2,3-butaneiol.

FIG. 1 is a schematic diagram showing the removal process of the wabG gene.
Figure 2 shows the results of electrophoresis that the wabG gene of KCTC 2242, Klebsiella oxytoca KCTC 1686 and Klebsiella ATCC 43863 were removed from Klebsiella pneumoniae.
3 is a result of confirming the lipopolysaccharide through tricin-SDS-page and silver staining by extracting the lipopolysaccharide of the Klebsiella wild type and Klebsiella mutants. Column 1 of FIG. 3 shows the results of KCTC 2242 in wild type Klebsiella pneumoniae, column 2 shows mutant Klebsiella pneumoniae KCTC 2242, column 3 shows wild type Klebsiella oxytoca KCTC 1686, row 4 mutant Ciella oxytoca KCTC 1686, column 5 shows the results of wild type Klebsiella oxytoca ATCC 43863, column 6 mutant Klebsiella oxytoca ATCC 43863.
4 shows the results of observing the cluster edges of the Klebsiella wild type and Klebsiella mutants through an optical microscope. 4 (A) shows microscopic results of KCTC 2242 in wild Klebsiella pneumoniae, (B) KCTC 2242 in mutant Klebsiella pneumoniae, (C) wild Klebsiella oxytoca KCTC 1686, ( D) shows microscopic observations of mutant Klebsiella oxytoca ATC 43863, (E) wild Klebsiella oxytoca ATCC 43863, (F) mutant Klebsiella oxytoca ATCC 43863.
FIG. 5 shows the results of observing capsular polysaccharides through an optical microscope by staining Klebsiella wild type and Klebsiella mutants with India ink and crystal violet. 5 (A) shows the results of KCTC 2242 in wild Klebsiella pneumoniae, (B) mutant Klebsiella pneumoniae KCTC 2242, (C) is wild Klebsiella oxytoca KCTC 1686, (D ) Mutant Klebsiella oxytoca KCTC 1686, (E) wild Klebsiella oxytoca ATCC 43863 and (F) mutant Klebsiella oxytoca ATCC 43863).
Figure 6 shows the results observed through field emission scanning microscope to confirm the surface changes of Klebsiella wild type and Klebsiella mutants. FIG. 6A shows the results of KCTC 2242 in wild Klebsiella pneumoniae, (B) mutant Klebsiella pneumoniae KCTC 2242, (C) wild Klebsiella oxytoca KCTC 1686, (D ) Mutant Klebsiella oxytoca KCTC 1686, (E) wild Klebsiella oxytoca ATCC 43863, (F) mutant Klebsiella oxytoca ATCC 43863.
7 shows the growth rate and glucose consumption of KCTC 2242 wild-type and Klebsiella pneumoniae KCTC 2242 mutants.
FIG. 8 shows the results of 2,3-butanediol production of KCTC 2242 wild type and KCTC 2242 mutants in Klebsiella pneumoniae.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1 Strains Used

Klebsiella pneumoniae ( KCTC 2242) and Klebsiella oxytoca ( KCTC 1686 and ATCC 43863)

Example 2: wabG  Gene deletion

Linear gene production

Primers (Table 1) having a base sequence of FRP (Flip-Recombinase Targets) of 34 bp (base pair) and chloramphenicol of 20 bp on both sides and a pKOV plasmid having a chloramphenicol resistant base sequence were used as a template for polymerase chain reaction PCR) was performed to prepare a cassette (FCF) having FRT-chloramphenicol-FRT. Chloramphenicol is an antibiotic resistance protein to confirm homologous recombination, and FRT knock-out the target gene and then deletion of the chloramphenicol gene (FIG. 1). The polymerase chain reaction conditions for preparing FCF were as follows: 95 ° C for 5 minutes, followed by 95 ° C for 30 seconds, 66 ° C for 55 seconds, and 72 ° C for 60 seconds. After insertion of the FCF having the nucleotide sequence of 891 bp into the T-vector, PCR was carried out using a primer (Table 1) having a 50 bp base sequence complementary to the start and end portions of wabG and a base sequence homologous to FRT (WFCFW) for the deletion of the wabG gene. The reaction conditions were 95 ° C for 5 minutes, followed by 95 ° C for 30 seconds, 65.2 ° C for 60 seconds, and 72 ° C for 60 seconds. The obtained WFCFW has a base sequence of 991 bp.

primer order FCF Forward GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGAGACGTTGATCGGCACGT FCF reverse direction GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCATTCAGGCGTAGCACCAGGC WFCFW Forward (2242) ATGAGTAAATTCAGGCTGGCTCTGGTGCGGCAGAAGTACCGC CCGGACGGGAAGTTCCTATTCTCTAGAA WFCFW Reverse (2242) TTAATTCACCAGATCCTGATAAAGAGAAAGCAGCTGGGTTGAGAG TCGCTGAAGTTCCTATACTTTCTAG WFCFW Forward (1686, 43863) ATGAGTAAATTCAGGCTGGCTCTGGTACGCCAGAAGTATCGCCCG GACGGGAAGTTCCTATTCTCTAGAA WFCFW Reverse (1686, 43863) TTATTTCACCAAATCCTGATAGAGGGAGAGCAGCTGCGCCGA GAGACGTTGAAGTTCCTATACTTTCTAG

Homologous recombination  To increase efficiency Red Lambda ( Red lambda ) Recombination

PRedET, a plasmid expressing alpha, beta and gamma proteins, which prevents degradation of the linear gene introduced into the cell and enhances homologous recombination efficiency, was used (Daiguan Yu, Hilary M. Ellis, E-Chiang Lee, Nancy A. Jenkins, Neal G. Copeland, and Donald L. Court, PNAS May 23, 2000 vol 97, No. 11, 5978-5983). This pRedET plasmid was used to transform pRedET into wild Klebsiella spp. To prepare mutations. To this end, wild Klebsiella spp. Were cultured at 37 ° C. and optical density (600 nm) until 0.2-0.3, and ethylenediaminetetraacetic acid (EDTA) was added to 0.7 mM in the total amount of liquid LB medium. When ethylenediamine acetic acid is added, the efficiency of the electroporation method becomes high (Fournet-Fayard, S., B. joly, and C. Forestier J. Microbiol Meth, 1995. 24: p.49-54). The cultured Klebsiella spp. Was washed three times with cold sterile water containing 10% glycerol to remove impurities. The final wash was carried out with 150 ng pRedET in wild Klebsiella spp. Contained in 40 μl of cold sterile water. After mixing and put into a cooled electroporation cuvette gave a pulse of 1.8 ㎸, 5 msec. After culturing at 30 DEG C for one hour, the cells were plated on solid LB medium containing tetracycline (3 mu g / mL) and cultured at 30 DEG C for 16 hours. The reason for culturing in LB medium containing tetracycline at 30 ° C is because the pRedET plasmid has tetracycline resistance and is replicated at 30 ° C. Next, Klebsiella spp. Transformed with pRedET plasmid to express alpha, beta and gamma proteins were placed in liquid LB medium and cultured until 600 nm optical density became 0.2-0.3 value. At this time, L-arbinose corresponding to 0.5% was added to the total amount of liquid LB medium. Then, 150 ng of WFCFW was mixed with pRedET in the same manner as in the transformation, and electroporation was performed under the above conditions. After culturing at 37 占 폚 for 3 hours, the cells were plated on solid LB medium containing chloramphenicol (20 占 퐂 / ml) and cultured at 37 占 폚 for 16 hours. Klebsiella spp. Grown in chloramphenicol medium was again cultured in a liquid medium containing chloramphenicol (20 μg / ml), followed by genomic DNA extraction using a genomic DNA extraction kit, and mutations were identified through polymerase chain reaction.

FRT - chloramphenicol - FRT Fruit of

A 707-Flpe plasmid (Thomas Schlake and Jurgen Bode 'Biochemistry 1994, 33, 12746-12751) expressing flippase recombinase was used for the deletion of FRT-chloramphenicol-FRT inserted into mutant Klebsiella spp. Similar to the method of transforming pRedET into wild Klebsiella spp., Transfected Klebsiella mutant spp. With 707-Flpe plasmid and WFCFW and containing tetracycline (3 μg / ml) after one hour incubation at 30 ° C Were plated in solid medium. The 707-Flpe was cultured at 30 ° C for 16 hours because it replicates at 30 ° C. Populations of Klebsiella mutants grown in this way were cultured in 1 ml liquid LB medium without antibiotics for 3 hours after inoculation. The cultured mutant Klebsiella spp. Were again incubated for 16 hours at 37 ° C. because the flippase recombinase is expressed at 37 ° C. A part of the cultured Klebsiella mutant species was confirmed to not grow after incubation in liquid LB medium containing chloramphenicol, and genomic DNA was extracted using a genomic DNA extraction kit. The polymerase chain reaction confirmed the deletion of the chloramphenicol resistance gene (Fig. 2).

Example  3: wabG  Characterization according to gene deletion

Confirmation through electrophoresis

Wild species and wabG Mutant species from which the gene was deleted were identified by electrophoresis. Column 1 of FIG. 2 is a size marker, and column 2 is wild wabG Genes, row 3 are mutant Klebsiella spp. Transformed with chloramphenicol resistant genes, and row 4 are mutant Klebsiella spp., Which have deleted chloramphenicol resistant genes.

Tricin- SDS -Page( Tricine - SDS - Page ) And silver  Staining LPS  Confirm

Tricine-SDS-page (Sch, H. and G. von Jagow. Analytical Biochemistry, 1987. 166 (2): p.368-379), which can detect small size proteins up to 10 kda and less than 5 ng WabG gene was removed by lipopolysaccharide (Chao-Ming Tsai, Carl E. Frasch. ANALYTICAL BIOCHEMISTRY 119, 115-I 19 (1982)), which can stain small amounts of lipopolysaccharide. Changes in polysaccharide (Lipopolysaccharide; LPS) were analyzed. First lipopolysaccharide was extracted using lipopolysaccharide extraction kit, followed by loading buffer (0.1 M Tris, pH 6.8), 2% sodium dodecyl sulfate (SDS), 20% sucrose, 2% mercaptoethanol And 0.001% bromo phenol), and then reacted at 100 ° C. for 5 minutes and separated by electrophoresis with 15% SDS-tricine-PAGE. Electrophoresis was carried out at 20 kPa and 100 V for 2 hours. Then, lipopolysaccharide was observed through silver staining. As shown in FIG. 3, since the core portion of the lipopolysaccharide was removed in the mutant Klebsiella species, it can be seen that the size is smaller than that of the lipopolysaccharide of the wild Klebsiella species (FIG. 3).

Observation of cluster shape differences through an optical microscope

To determine the difference between lipopolysaccharide-depleted mutants and wild Klebsiella spp., The differences in the shape of the colony edges were examined by light microscopy. For this purpose, as can be seen in Figure 4, Figures 4 (A), (C) and (E) of the wild Klebsiella species edges are well maintained and uniform, while Figures 4 (B), (D ) And (E) show that the mutant Klebsiella spp. Are not well maintained and uniform (Lawlor MS, Hsu J, Rick PD, Miller VL. Molecular Microbiology (2005) 58 (4), 10541073). . Capsule polysaccharides allow a constant distance between bacteria when forming biofilms. In mutant species, however, the elimination of lipopolysaccharides reduces the capsular polysaccharides, leading to a close distance between the fungi, but the distance is not constant. This results in uneven clustering (Agladze, K., X. Wang, and T. Romeo. J. Bacteriol, 2005. 187 (24): p. 8237-8246, Balestrino, D., et al. Microbiology, 2008. 10 (3): p. 685-701)

capsule Polysaccharide  dyeing

The removal of lipopolysaccharides results in changes in the constituents of the outer membrane and in the encapsulated polysaccharides surrounding them. To confirm this change, dyeing was performed using India ink and Crystal violet and observed through an optical microscope. First, wild Klebsiella spp. Or mutant Klebsiella spp. On the cover glass were stained with India ink and dried at 15-20 ° C. for 15 min. Dried bacteria were stained using crystal violet, washed three times with sterile water and dried. Upon drying, it proceeds at room temperature to prevent the breakdown of the capsule polysaccharides. Staining the surface of wild Klebsiella spp. And mutant Klebsiella spp. With India ink and staining peptidoglycan on the outer membrane with crystal violet leaves the Klebsiella's capsular polysaccharide white and the rest Becomes 5 (A), (C) and (E) show the presence of capsular polysaccharides in wild Klebsiella spp. And mutant Klebsiella spp. 5 (B), 5 (D) and 5 (E) ) Confirmed that the capsule polysaccharide was not visible.

Field Radiation  Scanning microscope FE - SEM Surface changes using

Field Emission-Scanning Electron Microscopy (FE-SEM) was used to observe surface changes of mutant Klebsiella spp. due to deletion of the wabG gene. First, a polycarbonate filter (0.2 μm) was sterilized at 120 ° C. using an autoclave and then dried in a dryer. The sufficiently dried polycarbonate filter was placed on LB solid medium and incubated for 5 hours with either wild Klebsiella spp. Or mutant Klebsiella spp. After incubation, the polycarbonate filter was placed on a petri dish and then reacted with the first fixed solution at 4 ° C. for 2 hours. The composition of the fixed solution is 75 mM Lysine, 2.5% Glutaraldehyde, 2% Paraformaldehyde and 0.1 M Sodium Cacodylate solution (pH 7.4). Next, the sample was reacted with a 0.1% poly-L-lysine solution for 3 minutes, and then the 0.1% poly-L-lysine solution was removed and dried at room temperature for 10 minutes for 16 hours at 4 ° C. Stored. Next, reacted with the sample in 0.1 M sodium cacodylate solution (pH 7.4), and the solution was removed and dried for 10 minutes at 4 ℃. This procedure was repeated three times and stored at 4 ° C. for 16 hours. Next, the sample was treated with a second fixed solution composed of 1.0% osmium tetraoxide and 1.5% red blood salt (Potassium ferricyanide) at 4 ° C. for 2 hours. Next, react with 10, 30, 50, 60, 70, 80, and 90% ethanol for 20 minutes, and then react with 100% ethanol three times for 20 minutes, followed by 20 minutes with hexamethyldisilizane. Treatment was repeated several times and dried at room temperature. Finally, the dried samples were coated with platinum and observed with a field scanning scanning microscope (3 ㎸) (Monson, BK, et al. Journal of Ocular Pharmacology and Therapeutics, 2010. 26 (2) ): p. 133-136.). 6 (A), (C) and (E) are wild Klebsiella species, and FIG. 6 (B), (D) and (F) are mutant Klebsiella species. In Figures 6 (A), (C) and (E), the encapsulating polysaccharides thickly enclose the surface, whereas in Figures 6 (B), (D) and (F) the capsule polysaccharides are present on the surface. It can be seen that the rough surface is exposed.

Example  5: 2,3- Butanediol  production

To determine if the removal of lipopolysaccharides affects the productivity of 2,3-butanediol, glucose (Glucose) according to the optical density of KCTC 2242 and mutant Klebsiella pneumoniae KCTC 2242 in wild Klebsiella pneumoniae ) Consumption and productivity of 2,3-butanediol were compared. 1 g of sterile distilled water, 5 g yeast extract, 5.25 g dipotassium phosphate, 9.5 g monopotassium phosphate, 6.6 g ammonium sulfate, 0.25 g magnesium sulfate heptahydrate, 0.05 g ferrous sulfate heptahydrate, 0.001 g zinc sulfate heptahydrate, 0.001 g manganese sulfate, 0.001 g calcium chloride dihydrate and 80 g glucose ( pH culture was shaken for 72 hours at 37 ° C., 170 rpm.For wild species, ampicillin (50 μg / ml) was added to the medium, and the mutations were ampicillin (50 μg / ml) and Chloramphenicol (25 μg / ml) was added, and centrifugation (12000 rpm, 10 minutes) of the sample taken at regular time during the culture to measure the concentration of 2,3-butanediol in the culture medium followed by separation of the supernatant from the cells. Stored at 40 ℃ The supernatant separated from the culture was purified using a 0.2 μm filter for 1 ml each, and then subjected to high performance liquid chromatography (HPLC) quantitative analysis under the following conditions. The growth curve of the mutant Klebsiella pneumoniae KCTC 2242 developed in the present invention showed a similar tendency compared to the KCTC 2242 of the wild species Klebsiella pneumoniae and the glucose consumption was similar tendency (Fig. 7). As a result of the mutation, the productivity of 2,3-butanediol was reduced by 30% compared to wild species, which resulted in better 2,3-butanediol production than expected due to the deletion of genes. In addition, it is possible to increase the carbon consumption through repeated cultures to increase the production capacity of 2,3-butanediol.

In mucosal-producing cells and in animal studies, mutant species without capsules have been reported to reduce adherence and toxicity to epithelial cells (Struve, C. and KA Krogfelt, FEMS Microbiol Lett, 2003. 218: p149-154). These results indicate that the mutant strain from which the capsule polysaccharide has been removed by wabG inactivation of the present invention has reduced pathogenicity.

subject Condition HPLC model   (Youngin appliance, Korea), UV730D (Youngin appliance, Korea) column Aminex HPX-87H (Biorad, USA) Flow rate 0.8 mi / min Injection volume 30 μl Mobile phase 0.001 N sulfuric acid Oven temperature 60 ° C Operating time 20 minutes

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Attach an electronic file to a sequence list

Claims (8)

A Klebsiella mutant strain in which the wabG gene is inactivated and nonpathogenic and similar in ability to produce 2,3-butanediol as compared to the wild type with the wabG gene.
According to claim 1, wherein the Klebsiella Klebsiella pneumoniase ( Klebsiella pneumoniase ), Klebsiella Oxytokka ( Klebsiella) oxytoca ), Klebsiella granulomatis ) or Klebsiella terigena.
The mutant strain of claim 1, wherein the Klebsiella mutant strain is free of capsule polysaccharide.
The mutant strain of claim 1, wherein the Klebsiella mutant strain has the same 2,3-butanediol production capacity or a 1-40% reduction compared to the wild type.
The mutant strain of claim 1, wherein the Klebsiella mutant strain has the same or reduced 1-15% glucose consumption in culture compared to the wild type.
According to claim 1, wherein the Klebsiella mutant strain is a mutant strain characterized in that the lactate (lactate) production capacity is reduced by 80-100% in culture compared to the wild type.
Method for producing 2.3-butanediol comprising culturing the strain of any one of claims 1 to 6.

delete

Images