KR101377824B1 - Primers for waterborne virus detection and kit comprising the primers - Google Patents

Abstract

The present invention relates to a primer for detecting waterborne viruses and a detection kit comprising the same, and more specifically, to a primer and a probe capable of detecting a norovirus, rotavirus, astrovirus, coxsackie virus and hepatitis A virus with a real time-polymerase chain reaction (real time-PCR). Upon using the composition and the kit comprising the primer and the probe of the present invention, five representative waterborne viruses can be detected in one sample. Therefore, the present invention is expected to be significantly applicable in rapidly and precisely detecting a causing virus when a patient displaying intestinal canal symptoms appears.

Description

Primers for waterborne virus detection and kit comprising the primers}

The present invention relates to a primer for detecting waterborne viruses and a detection kit including the same, more specifically, a norovirus, a Rotavirus, a Coxsackie virus, and a hepatitis A virus. virus) and Astrovirus (Real Time-PCR) to detect primers and probes that can be detected.

Waterborne infection is a disease transmitted by water contaminated with pathogenic microorganisms and refers to an infectious disease caused by a person ingesting water contaminated with pathogenic microorganisms. Water-borne infectious diseases cause causative pathogenic microorganisms to enter the stomach and intestine through the mouth, proliferate in the gastrointestinal tract, inflamed and excreted in the feces (fecal-oral propagation pathway). see.

Representative examples of waterborne viruses in Korea include Norovirus, Rotavirus, Coxsackie virus, Hepatitis A virus, and Astrovirus.

Norovirus is a representative winter food poisoning pathogen, and it has been reported that more than 50% of waterborne and foodborne food poisoning accidents occurred between 2007 and 2009. The main symptoms are nausea, vomiting, abdominal pain, diarrhea, fever, etc. In rare cases, the elderly or patients die from severe dehydration. The path of infection is so diverse that personal contact, feces, oral, aerosol infections and contaminated water and food infections are all possible. Varieties of viruses are also diverse, and simultaneous infection by two or more varieties of noroviruses is common, especially due to shellfish contamination or contaminated water. The reason why the virus spreads well is because small amounts of infection are easily caused by microscopic droplets, clothing or bedding, human-to-human transmission, and environmental pollution. Happens.

Rotavirus is a cause of rotavirus enteritis, which causes more than 600,000 deaths per year worldwide, and mainly infects infants under five years of age. The main symptom is dehydration due to acute diarrheal diseases. Patients in developing and developing countries have a high mortality rate because they do not receive adequate water for dehydration symptoms. In Korea, the virus is regularly reported to the surveillance system operated by the Centers for Disease Control and Prevention.

Coxsackieviruses are also a common oral infection in the summer and are prevalent among infants. Symptoms include gastrointestinal symptoms such as fever, vomiting and diarrhea, such as airway diseases such as pharyngitis or bronchitis, aseptic meningitis, central nervous system diseases such as encephalitis or paralysis, mucosal or skin rash, myositis or conjunctivitis There is also.

Hepatitis A virus is also a waterborne virus that causes mild gastrointestinal symptoms such as jaundice, severe abdominal pain, vomiting and diarrhea. In developed countries with good hygiene, infections are rapidly increasing. In Korea, the number of patients increased 19 times compared to 2005, and the number of patients rapidly increased to 789 in 2005, 2,081 in 2006, 2,233 in 2007, 7,895 in 2008, and 15,041 in 2009. It is increasing. Waterborne viruses are commonly found in people with weak immunity, such as infants and the elderly, but hepatitis A virus is the most common in the 20s and 30s age group with 79%.

Astroviruses are regularly reported to surveillance systems operated by the Centers for Disease Control and Prevention. It causes symptoms of rotavirus-like enteritis, which, once infected, has a 34-day incubation period, causing tremors, accompanied by diarrhea, headache, vomiting, abdominal pain, and fever. In Korea, infantile enteritis caused by viruses is prevalent every year from autumn to winter. Twenty-eight percent of children's diarrhea are attributed to the astrovirus.

Waterborne epidemics are an important disease in terms of public health, as many patients can develop and explode at the same time. In order to prevent further development and treat patients early, the identification of the causative agent needs to be made quickly. However, the symptoms of water-borne infectious diseases are usually similar, making it difficult to identify the causative agent. In addition, pathogenic microorganisms causing water-borne infectious diseases include bacteria, viruses, protozoa, among which viruses are difficult to detect due to their small size and severe mutation of genes and antigens. Primers that can perform Real-time PCR for each waterborne virus have been reported ( Enteropathogenic). Viruses : Triggers for Exacerbation in IBD -A Prospective Cohort Study Using Real - time Quantitative Polymerase Chain Reaction , Gwen et al., Detection and Characterization of Norovirus Outbreaks in Germany : Application of a One - Tube RT - PCR Using a Fluorogenic Real - Time Detection System , M. Hohne et al., Et al.) Real-time PCR primers and probes have to be developed to identify different types of agents in a sample.

While the present inventors are studying a method for detecting and identifying a causative agent of a water-borne infectious disease showing gastrointestinal symptoms, the five representative waterborne factors are recognized in view of the fact that if a representative causal agent can be detected at the same time, rapid causative agent detection and differential diagnosis are possible. The present invention was completed by designing a primer and a probe capable of selecting viruses and detecting them simultaneously.

SUMMARY OF THE INVENTION The present invention has been made in view of the above background, and an object of the present invention is to provide a composition and kit for identifying a waterborne virus comprising primers and probes for five representative waterborne viruses.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention

       As intestinal symptom-inducing waterborne virus specific primers

Comprising a polynucleotide set forth in SEQ ID NOs: 1-10,

As Enteric Symptom-Induced Waterborne Virus Specific Probes

Polynucleotides set forth in SEQ ID NOs: 11-15,

here

i) Noroviruses type I and type II are identified as primer pairs consisting of polynucleotides set forth in SEQ ID NO: 1 and SEQ ID NO: 2 and probes described in SEQ ID NO: 11,

ii) the rotavirus G- and P-genotypes are identified as primer pairs consisting of polynucleotides set forth in SEQ ID NO: 3 and SEQ ID NO: 4 and probes described in SEQ ID NO: 12,

iii) coxsackievirus type I is identified as a primer pair consisting of a polynucleotide set forth in SEQ ID NO: 5 and SEQ ID NO: 6 and a probe described in SEQ ID NO: 13,

iv) Hepatitis A virus is identified by a primer pair consisting of a polynucleotide set forth in SEQ ID NO: 7 and SEQ ID NO: 8 and a probe described in SEQ ID NO: 14,

v) an astrovirus is identified by a primer pair consisting of a polynucleotide described by SEQ ID NO: 9 and SEQ ID NO: 10 and a probe described by SEQ ID NO: 15,

  Norovirus type I, norovirus type II, rotavirus G-type, rotavirus P-type, coxsackie virus type I, hepatitis A virus and astrovirus It provides a composition for identification.

Hepatitis A virus has a variety of types, the most common of which is type IA, IIA, IIIA. The primers and probes of the present invention can detect all types, including these types.

Astroviruses are type I to Ⅷ, and type I occurs most frequently in Korea. However, the primers and probes of the present invention can detect all types, including these.

In addition, the present invention comprises a primer described in SEQ ID NOS: 1 to 10 and a probe described in SEQ ID NOs: 11 to 15, norovirus type I, norovirus type II, rotavirus G-genotype, rotavirus P-genotype, cock Provided are kits for identifying any one or more intestinal symptomatic induced waterborne viruses selected from the group consisting of Sakivirus type I, Hepatitis A virus and Astrovirus.

The present invention comprises the step of performing a real-time polymerase chain reaction (Real-time Polymerase Chain Reaction) from a sample taken from the sample using the composition comprising the primer and probe, norovirus type I, norovirus type II Provided are methods for identifying any one or more enteric symptom-induced waterborne viruses selected from the group consisting of, rotavirus G-type, rotavirus P-type, coxsackievirus type I, hepatitis A virus, and astroviruses.

In one embodiment of the present invention, the step of performing a real-time polymerase chain reaction (Real-time Polymerase Chain Reaction),

Performing 1 cycle at 95 ° C. for 2 minutes; And

To perform 30 to 45 cycles for 10 seconds at 95 ℃, 45 seconds at 55 ℃ to 60 ℃; characterized in that it comprises a.

The compositions and kits containing the primers of the invention allow the detection of five representative waterborne viruses in one sample. Therefore, it is expected to be an important application for the rapid and accurate identification of the causative virus in patients with intestinal symptoms.

1A is an illustration of using the Oligo6 program, and FIG. 1B shows an example of the search for the best conserved site of the virus.
Figure 2 is a diagram comparing the sensitivity with Conventional PCR using Hepatitis A virus. The upper figure shows the detection limit by performing real-time PCR, and the lower figure shows the detection limit by electrophoresis by performing conventional PCR.
3 is a view showing a CFX96 Touch Real-Time PCR Detection System and iQ Multiplex Powermix used in the present invention.
Figure 4 is a diagram confirming the virus detection by applying the composition comprising the primer and probe of the present invention to environmental samples and clinical samples.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  1. Collection of Positive Samples

Stool was collected as a clinical sample. 50 mg of fecal suspension was suspended in 500 μl of PBS. Vortex this suspension vigorously for 30 minutes, centrifuge at 10,000 rpm for 10 minutes in a micro centrifuge, extract 140 μl of supernatant, extract viral RNA with Qiagen viral RNA mini kit, and finally make 80 μl Viral RNA solution. Store at 70 ℃

Groundwater and river water were used as environmental samples. About 500-1000 L of groundwater and river water were adsorbed on 1 MDS (Cuno) filter, and then desorbed using 1.5% Beef extract, and the virus was concentrated by acid concentration. In order to sterilize the final concentrated 20 ~ 30 ml, filtered by membrane filter and 140 ㎕ viral RNA was extracted with Qiagen viral RNA mini kit as in the clinical sample. Finally, 80 μl of Viral RNA solution was prepared and stored at -70 ° C.

Example  2. Viral RNA  extraction

After adding 560 uL of Buffer AVL containing Carrier RNA into a 1.5 mL tube, 100-140 uL of sample was added and mixed (pulse-vortex) for 15 seconds. After standing at room temperature for 10 minutes, spin down lightly, add 560 uL of ethanol (96-100%), mix for 15 seconds, and spin down again. The mixed sample was placed in a QIAamp Mini spin column, followed by an RNA adsorption step of centrifugation at 6,000 xg for 1 minute. Buffer AW1 500 uL was added thereto and centrifuged at 6,000 xg for 1 minute. After transferring the QIAamp spin column to a new 2 mL tube, 500 uL of Buffer AW2 was added and centrifuged at 20,000 xg for 3 minutes. After centrifuging the QIAamp spin column for 1 minute at the maximum speed, transfer the QIAamp spin column to a 1.5 mL tube, inject about 60 uL of Buffer AVE, let stand for 1 minute, and centrifuge for 1 minute at 6,000 xg for viral RNA. Got. The obtained RNA was used immediately or stored at -70 ° C.

Example  3. Primer  And probe making

In addition to the nucleotide sequences of viruses isolated from clinical samples and environmental samples isolated in Examples 1 and 2, the nucleotide sequences of domestic isolates and foreign isolates were obtained from NCBI, EMBL, and DDBJ.

Based on the obtained nucleotide sequence, primers and probes were selected using DNAStar's Meg align program. The information of each primer and probe is as follows.

Norovirus is genogroup I (GI-1 ~ GI-8), Genogroup II (infected by humans in the outermost P2 domain of the capsid region of ORF2 in the entire genome (7.6Kb) consisting of ORF1, ORF2 and ORF3). Primers and probes capable of detecting both GI and G II were designed with a size of 40-70 bp by analyzing specific nucleotide sequences of GII-1 ~ GII-17).

Rotavirus is an 11-segment double-stranded RNA virus. Among them, VP4 (P) and VP7 (G) are located at the outermost part of rotavirus and are important sites for genotyping. Rotaviruses reported to date are known as G-types G1-G16 and P-types P1-P27. Therefore, we designed primers and probes with a size of 40-70bp that can detect both G- and P-types by analyzing specific sequences of each type.

Coxsackie virus is a nucleotide sequence specific for VP1, and designed primers and probes capable of detecting coxsackie virus type I.

Hepatitis A virus is a nucleotide sequence specific to the VP1 / 2A site, and designed primers and probes capable of detecting all types of hepatitis A virus.

Astrovirus is a single positive stranded virus consisting of non-structural proteins (viral serine protease and RNA dependent RNA polymerase) and capsid proteins. Especially, we designed the size of 40 ~ 70 bp to detect all types of astroviruses by analyzing the nucleotide sequence at well-preserved serine protease and 3 terminal regions of genome.

For the prepared primers and probes, melting temperature or secondary structure was calculated using the Oligo6 program. The conserved site of each virus was selected as the primer and probe of the present invention by reflecting the calculated Tm value, reaction time, and temperature conditions. At both ends of the base sequence to be probed, a fluorescent substance and a quencher were attached.

1 is an example (A) using the Oligo6 program and a search example (B) of the best conserved site of the virus.

Table 1 is a table showing the nucleotide sequences of the prepared primers and probes.

Virus
( target ) Primer Sequence  (5 3) Target Region
Refs . Norovirus NV F CARGARBCNATGTTYAGRTGGATGAG
(SEQ ID NO: 1) ORF2 This Study NV R TCGACGCCATCTTCATTCACA (SEQ ID NO: 2) NV Probe FAM-AGC CAN TGG GAG GGC GAT CGC A
(SEQ ID NO: 11) -BHQ Rotavirus HRV F ACAGGTTGGTGGCTCAGATGTACT (SEQ ID NO: 3) VP7 This Study HRV R GCGAGTGAATTGGAAGAAATGGTGGC (SEQ ID NO: 4) HRV Probe ROX- ACA GCT GAT CCA ACG ACA ATG CCA CA (SEQ ID NO: 12) -BHQ2 Coxsackievirus CVB F AAACCCAAACATGTGAAGGCGTGG (SEQ ID NO: 5) VP1 This Study CVB R CCACAACGCGCTCAAACATTACCA (SEQ ID NO: 6) CVB Probe HEX- ACC GCC GAG GCT ATG TCA ATA TGA GA (SEQ ID NO: 13) -BHQ1 Hepatitis A virus HAV F TCT TGC CGT TGA TAC TCC TTG GGT
(SEQ ID NO: 7) VP1 / 2A This Study HAV R ATC CAG TGC TCC AGA CAC AGC ATA
(SEQ ID NO: 8) HAV Probe TYE-GCT CTT GGA GCT GTC AGA TTT AAC ACA AGG (SEQ ID NO: 14) -3IABkFQ Astrovirus HAstV F TAC CAC CAG CAC TCT TCA AGC ACA
(SEQ ID NO: 9) ORF2 This Study HAstV R TGT CTG CAA GGT GAC TTC ACC AGA
(SEQ ID NO: 10) HAstV Probe Cy5-ACC TCC TTA ATC GCC ATG TAC TTC TAC CA (SEQ ID NO: 15) -BHQ2

Example  4. Real - time PCR  Establish condition

Real-time PCR was performed by monoplex for each virus to establish reaction time and temperature conditions. The PCR reaction time and temperature were adjusted when the primer showed nonspecific reaction to the sample or no positive sample was detected when the temperature conditions were calculated using Oligo6 program.

Example  5. Conventional PCR Sensitivity comparison

A large amount of RNA transcript of each virus was produced, and then the RNA transcript was diluted in multiples of 10 times. The virus RNA samples thus prepared were subjected to real-time PCR using the primers and probes of the present invention to confirm the detection limits. The results are shown in the figure at the top of FIG.

In order to compare the results with the real-time PCR, the same RNA transcript was diluted by 10-fold step by step and the detection limit was confirmed by conventional reverse transcription PCR by applying the primer and probe of the present invention. The results are shown in the figure at the bottom of FIG.

As shown in FIG. 2, the conventional PCR showed a detection limit of 2.8 x 10 ⁷ but the multiplex real-time PCR showed a detection limit of 2.8 x 10 ⁵ . Therefore, the detection limit of 2.8 x 10 ² is shown to be superior in Multiplex Real-time PCR.

Example  6. multiplex Real - time PCR  Perform and monoplex Real - time PCR Comparison with

6-1. Multiplex Real - time PCR  Perform

Reverse transcription (RT) was performed to synthesize cDNA on the extracted viral RNA (4-40 ng). Standard RT reactions were performed in a buffer (50 mM Tris-HCl; pH 8.3, 75 mM KCl, 10 mM DTT, 3 mM MgCl 2, 0.5 mM dNTP) for 42 ° C., 50 minutes.

Multiplex Real-time PCR composition is composed of Bio-rad's iQ Multiplex Powermix (2x reaction buffer with dNTPs 12 Mm MgCl ₂ ) in one tube. iTaq DNA polymerase, and stabilizers) 25 μl, 5 simultaneous detection of forward primer 1, reverse primer 1 μl, probe 1 μl and extracted cDNA 10 μl were added to a total of 50 μl with distilled water. The equipment and Powermix used are shown in FIG.

Multiplex real-time PCR reaction conditions are shown in Table 2 below.

Temperature time Cycle Initial denaturation 95 ℃ 2 min 1 cycle denaturation
annealing 95 ℃
55-60 ℃ 10 sec
45 sec 30 ~ 45 cycle

6-2. monoplex Real - time PCR Sensitivity comparison

In general, the monoplex method has less inhibitory factors such as dimer formation due to one virus reacting to a pair of primers, whereas the multiplex method tends to be less sensitive due to the introduction of several pairs of primers and various viruses. Since the present invention is characterized by being able to identify several viruses in one sample, the following experiment was performed to confirm whether the sensitivity is maintained even when multiplex real-time PCR is performed.

Real-time PCR was performed with multiplexes of each virus to check and establish the cross-reaction of primers and probes of the produced waterborne viruses. RNA of each virus was diluted 10-fold through cDNA synthesis and compared with each PCR reaction.

The results are shown in Table 3 below.

Mean C _T value  monoplex ( SD ) Mean C _T value multiplex  ( SD ) Astrovirus Multiplex PCR 10 ¹ dilution 32.8 (0.23) 34.9 (0.14) 10 ² dilution 36.4 (0.25) 38.0 (0.80) 10 ³ dilution 41.1 (0.99) 42.6 (2.90) 10 ⁴ dilution 47.2 46.6 (0.46) Norovirus genogroup  I Multiplex PCR 10 ¹ dilution 36.3 (0.34) 36.7 (0.38) 10 ² dilution 39.3 (0.59) 41.0 (0.57) 10 ³ dilution 41.1 41.5 10 ⁴ dilution Negative Negative Rotavirus group  A Multiplex PCR 10 ¹ dilution 29.0 (0.46) 33.3 (0.67) 10 ² dilution 32.3 (0.42) 36.4 (1.16) 10 ³ dilution 34.2 (2.92) 39.5 (1.63) 10 ⁴ dilution 38.8 (1.55) 42.0 (1.29) Coxsackievirus Multiplex PCR 10 ² dilution 32.9 (0.46) 33.9 (0.27) 10 ³ dilution 35.7 (0.88) 37.6 (1.15) 10 ⁴ dilution 38.8 (3.46) Negative Norovirus genogroup II Multiplex PCR 10 ² dilution 39.0 (0.94) 42.5 (0.83) 10 ³ dilution 41.7 (1.60) 45.8 (0.18) 10 ⁴ dilution Negative Negative

As shown in Table 3, the primers and probes of the present invention obtained excellent sensitivity even in Multiplex. This means that the primers and probes of the present invention are designed to minimize the inhibitory factors that may occur when performing the Multiplex method. Viruses not listed in Table 3 can also be easily inferred by those skilled in the art because they are designed in the same manner as the viruses identified in Table 3 and have the same effect.

Example  7. Applied to environmental and clinical samples

Multiplex Real-time PCR was performed by applying the primers and probes of the present invention to environmental samples and clinical samples. The experimental method is the same as in Example 6. Four water viruses were mixed and added to one tube, and the experiments were performed. As a result, four viruses could be detected simultaneously. The results are shown in Fig.

Using the present invention, five viruses can be detected at the same time, but due to the limitations of the laboratory equipment, the phenomenon of overlapping probe wavelength values has not been obtained. This problem can be solved if the modification value of the probe is designed according to the performance of the equipment or if the reaction is not duplicated using two tubes in a two-plex method, which is obvious to those skilled in the art.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Attach an electronic file to a sequence list

Claims (4)

As intestinal symptom-inducing waterborne virus specific primers
Comprising a polynucleotide set forth in SEQ ID NOs: 1-10,
As Enteric Symptom-Induced Waterborne Virus Specific Probes
Polynucleotides set forth in SEQ ID NOs: 11-15,
here
i) Noroviruses type I and type II are identified as primer pairs consisting of polynucleotides set forth in SEQ ID NO: 1 and SEQ ID NO: 2 and probes described in SEQ ID NO: 11,
ii) the rotavirus G- and P-genotypes are identified as primer pairs consisting of polynucleotides set forth in SEQ ID NO: 3 and SEQ ID NO: 4 and probes described in SEQ ID NO: 12,
iii) coxsackievirus type I is identified as a primer pair consisting of a polynucleotide set forth in SEQ ID NO: 5 and SEQ ID NO: 6 and a probe described in SEQ ID NO: 13,
iv) Hepatitis A virus is identified by a primer pair consisting of a polynucleotide set forth in SEQ ID NO: 7 and SEQ ID NO: 8 and a probe described in SEQ ID NO: 14,
v) an astrovirus is identified by a primer pair consisting of a polynucleotide described by SEQ ID NO: 9 and SEQ ID NO: 10 and a probe described by SEQ ID NO: 15,
Norovirus type I, norovirus type II, rotavirus G-type, rotavirus P-type, coxsackie virus type I, hepatitis A virus and astrovirus Identification composition.
Norovirus type I, Norovirus type II, Rotavirus G-type, Rotavirus P-type, Coxsackievirus type I, comprising primers set forth in SEQ ID NOs: 1 to 10 and probes set forth in SEQ ID NOs: 11 to 15 And at least one enteric symptom-inducing waterborne virus identification kit selected from the group consisting of hepatitis A virus and astrovirus.
The method comprising the step of performing a real-time polymerase chain reaction (Real-time Polymerase Chain Reaction) from a sample taken from the sample using the composition of claim 1, norovirus type I, norovirus type II, rotavirus G-gene type, A method for identifying any one or more intestinal symptomatic waterborne viruses selected from the group consisting of rotavirus P-genotype, coxsackievirus type I, hepatitis A virus and astrovirus. The method of claim 3,
Performing the real-time polymerase chain reaction (Real-time Polymerase Chain Reaction),
Performing 1 cycle at 95 ° C. for 2 minutes; And
Performing 30 to 45 cycles at 95 ° C. for 10 seconds and 55 ° C. to 60 ° C. for 45 seconds.

Images