KR101222281B1 - Novel galectin 9 modification protein and use thereof - Google Patents

Abstract

Recombinant galectin 9 produced by Escherichia coli as a host can be used to induce cancer metastasis inhibition and regression by direct action on tumor cells (activity that induces intercellular adhesion and apoptosis of tumor cells) and through the immune system. It is suggested that it also does not act on inactivated lymphocytes and induces apoptosis of activated T cells, especially CD4 positive T cells, which are responsible for a hyperimmune response, and is also potent apoptosis against synovial cells involved in joint deformation and the like in rheumatism. Although inducible, recombinant galectin 9 is highly susceptible to protease because the link region linking two CRDs is very easily enzymatically digested and loses this activity. I need a molecule. By modifying the link region linking the two CRDs of galectin 9, it was possible to obtain a modified molecule having improved stability while avoiding adverse effects on the activity.

Description

New galectin 9 modified protein and its use {NOVEL GALECTIN 9 MODIFICATION PROTEIN AND USE THEREOF}

The present invention relates to novel galectin 9 modified (variant) proteins and uses thereof. The present invention relates, in particular, to galectin 9 with altered link regions and biochemical, clinical examination, medical and pharmaceutical application techniques using the same.

Evidence suggests that certain sugar chains and proteins that bind to them play a variety of roles and functions in physiological phenomena, evolution and growth in mammals, and various diseases. It has been found in the living body that an animal lectin that specifically recognizes a sugar chain having a β-galactosidic structure exists. At least 14 genes have been identified as a military lectin of such lectins. The galectin family is classified from its structure into three subgroups: prototype, chimera, and tandem repeat, but little is known about its function in vivo. not. In particular, the tandem repeat galectin having two sugar chain recognition domains has a short history of research, and its function has not been elucidated since the target sugar chain (receptor) in vivo is not known. However, galectin is expected to be involved in cell adhesion, cell-to-cell information transfer, cell activation, etc., based on findings of proteins that detect complex sugar chains on the cell surface. It becomes and attracts attention. In addition to such functions, research achievements that lead to the expectation of having other important functions have also been continuously obtained.

Galectin 9, one of the tandem repeat galectins, is first identified in humans as an autoantigen in patients with Hodgkin's disease (Non-Patent Documents 1 and 2), a function important for interaction between immune cells. It was supposed to be doing it. Galectin 9 in mouse is mouse kidney cDNA by 5'-RACE PCR using degenerated primers designed based on sequences that are highly conserved in the sugar chain recognition domains of galectins. It is cloned from the library (Non Patent Literature 3). Antigen-stimulated human T cells have been found to produce ekalectin, an eucalectin factor, in vitro and in vitro, and the electin is structurally different from other eosinophils. Had a binding affinity for a sugar chain having a β-galactosidic structure, which may belong to the galectin family. Successful cloning of electin from mRNA obtained from human T cell-derived leukemia cell lines has shown that electin is one of the variants of galectin 9, and galectin 9 and electin are the same substance (Non-Patent Document 4). It is confirmed.

As wild type galectin 9, currently L type galectin 9 (galectin-9 long isoform or long type galectin-9: Gal-9L), M type galectin 9 (galectin-9 medium isoform or medium type galectin-9: Gal- 9M) and S-type galectin 9 (galectin-9 short isoform or short type galectin-9: Gal-9S) have been reported. Any galectin 9 consists of two sugar chain recognition sites (a carbohydrate recognition domain (CRD)) and link peptide regions connecting them, and L-type galectin 9 has the longest link peptide region, The N-terminal domain (NCRD) and the C-terminal domain (CCRD) are linked by a linking peptide region, while S-type galectin 9 has the shortest link peptide region, while M-type galectin 9 It is known that it possesses a link peptide region of medium length and is generally found to be present in tissues or cells in vivo rather than both. Moreover, evidence suggesting the existence of a genetic polymorphism has been confirmed among the galectin 9 genes cloned from human cells and tissues.

Wild type galectin 9 consists of two sugar recognition sites (CRDs) and linkages connecting them.Recombinant galectin 9 produced using Escherichia coli as a host has direct action on tumor cells (intercellular adhesion and By apoptosis (activity that induces apoptosis) and the action through the immune system, it has been suggested to induce cancer metastasis inhibition and regression. It has also been found that galectin 9 does not act on inactivated lymphocytes and induces apoptosis of activated T cells, particularly CD4 positive T cells, which are responsible for the hyperimmune response. It has also been found that rheumatoids possess strong apoptosis inducing ability against synovial cells involved in joint deformation and the like.

 Non-Patent Document 1

Sahin, U. et al., Proc. Natl. Acad. Sci. USA, 92, 11810-11813 (1995)

Non-Patent Document 2

Tureci, O. et al., J. Biol. Chem., 272 (10), 6416-6422 (1997)

<Non Patent Literature 3>

Wada, J. et al., J. Biol. Chem., 272 (9), 6078-6086 (1997)

Non-Patent Document 4

Matsumoto, R. et al., J. Biol. Chem., 273 (27), 16976-16984 (1998)

DISCLOSURE OF INVENTION

By using the multifaceted action of galectin 9, it is expected to treat cancer, treat refractory autoimmune diseases (including rheumatism), and treat allergic diseases. However, since recombinant galectin 9 is highly susceptible to protease, the link region connecting two CRDs is very easily enzymatically digested and loses its activity.

As a result of our intensive studies, the present inventors searched for a more stable molecular structure with respect to protease while maintaining the sugar chain recognition activity of galectin 9 and modifying the link region connecting two CRDs of galectin 9, While avoiding adversely affecting the same activity, it was successful to obtain a modified molecule having improved stability, and completed the present invention.

The present invention provides the following.

(1) A protein or a salt thereof, wherein the link peptide of the galectin 9 or a protein having an activity substantially equivalent thereto or a region adjacent thereto is modified.

(2) an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of a linking peptide of the protein whose activity is altered to galectin 9 or a protein substantially equivalent thereto; A protein or a salt thereof according to (1), wherein the degradation sensitivity to at least the link peptide is modified as compared to galectin 9.

(3) The protein according to (1) or (2) or a salt thereof, wherein the protein having an activity substantially equivalent to galectin 9 has at least 70% homology with the amino acid sequence of galectin 9.

(4) (1) a sugar chain recognition region (NCRD) on the N-terminal side of galectin 9 or a polypeptide having substantially the same activity and (2) a sugar chain recognition region (CCRD) on the C-terminal side of galectin 9 or its A polypeptide having an activity substantially equivalent to that of (3) a modified link peptide consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of the link peptide of galectin 9 The protein or a salt thereof in any one of said (1)-(3) characterized by the above-mentioned.

(5) (1) a polypeptide having an amino acid sequence represented by SEQ ID NO: 3 or a polypeptide having an amino acid sequence substantially identical thereto and having at least 70% homology with an amino acid sequence represented by SEQ ID NO: 3, or A polypeptide having an amino acid sequence of which at least one to eight amino acid residues of the amino acid sequence represented by SEQ ID NO: 3 is deleted, substituted or added, and (2) a polypeptide having the amino acid sequence represented by SEQ ID NO: 4 or substantially the same By deletion, substitution or addition of at least 1 to 21 amino acid residues of the polypeptide having an activity and having an amino acid sequence having at least 70% homology with the amino acid sequence represented by SEQ ID NO: 4 or the amino acid sequence represented by SEQ ID NO: 4 Polypeptides with Amino Acid Sequences (3) one or more amino acids are deleted in the amino acid sequence represented by any one of SEQ ID NOs: 7 to 9, provided that the deletions of 1 to 32 and 1 to 44 and SEQ ID NO: 8 in SEQ ID NO: 7 The protein according to any one of (1) to (4) or a salt thereof, wherein the protein is linked via a modified link peptide consisting of a substituted or added amino acid sequence.

(6) A nucleic acid having a nucleotide sequence encoding the protein according to any one of (1) to (5).

(7) The nucleic acid according to the above (6), which is a polynucleotide.

(8) The nucleic acid according to the above (6) or (7), which is DNA or RNA.

(9) The recombinant vector containing the nucleic acid as described in any one of said (6)-(8).

(10) The recombinant vector according to (9), wherein the recombinant vector contains a nucleotide sequence encoding a labeled protein and / or peptide in addition to the nucleic acid according to any one of (6) to (8).

(11) A transformant comprising the nucleic acid according to any one of (6) to (8) above or the recombinant vector according to (9) or (10) above.

(12) Transformant The transformant according to the above (11), wherein the host cell is a prokaryotic or eukaryotic cell.

(13) the protein according to any one of (1) to (5), the nucleic acid according to any one of (6) to (8), the recombinant vector according to (9) or (10), and (11) Or a pharmaceutical selected from the group consisting of the transformants described in (12).

(14) The pharmaceutical according to the above (13), which is an immunomodulator.

(15) The pharmaceutical according to the above (13), which is an anti-tumor drug.

(16) Brain tumors (polymorphic gliomas, etc.), spinal cord tumors, maxillary sinus cancers, pancreatic adenocarcinoma, dental carcinoma, tongue cancer, cleft lip, cancer, pharyngeal cancer, middle head cancer, hypopharyngeal cancer, laryngeal cancer, thyroid cancer, parathyroid cancer, lung cancer, pleural tumor, cancer peritonitis , Cancerous pleurisy, esophageal cancer, stomach cancer, colon cancer, cholangiocarcinoma, gallbladder cancer, pancreatic cancer, liver cancer, kidney cancer, bladder cancer, prostate cancer, penis cancer, testicular tumor, adrenal cancer, cervix cancer, uterine cancer, vaginal cancer, vulvar cancer, ovarian cancer, Cancers including ciliated epithelial tumors, malignant bone tumors, soft sarcomas, breast cancers, skin cancers, malignant melanoma, basal cell tumors, leukemias, myeloma with myelitis, malignant lymphomas, Hodgkin's disease, plasma cell tumors, gliomas, and the like; The drug according to the above (15), which is an anti-tumor drug against a tumor selected from the group consisting of sarcomas.

(17) The medicament according to the above (13), which is for the following diseases or diseases or pathological symptoms:

(A) an inflammatory disease, selected from the group consisting of various acute and chronic inflammations, allergic and autoimmune inflammations, infectious diseases, etc. occurring in each organ;

(B) acute and chronic diseases of the lung, including bronchitis, bronchial pneumonia, interstitial pneumonia, pneumonia, bronchiolitis, acute mediastinitis, epicarditis, endocarditis, myocarditis, stomatitis, stomatitis, tonsillitis, pharyngitis, laryngitis Diseases of organs other than lung, including esophagitis, peritonitis, acute gastritis, chronic gastritis, acute enteritis, appendicitis, ischemic colitis, drug colitis, proctitis, hepatitis A, hepatitis B, hepatitis C, extreme hepatitis, Acute and chronic hepatitis, cirrhosis, cholecystitis, acute pancreatitis, chronic pancreatitis, acute and chronic nephritis, mesenteric nephritis, glomerulonephritis, IgA nephritis, various cystitis, encephalitis, mastitis, dermatitis, superficial keratitis, dry keratitis, otitis media Or selected from the group consisting of rhinitis, sinusitis, nasal polyps, gingivitis, periodontitis, inflammation including periodontitis;

(C) neurological inflammation (e.g., nervous gastritis, cystitis, etc.), cancer or pain associated with inflammation;

(D) allergic inflammatory diseases, selected from the group consisting of systemic anaphylaxis, bronchial asthma, irritable pneumonia, hay fever, allergic rhinitis, allergic conjunctivitis, allergic diseases caused by immune complexes, angioedema;

(E) Autoimmune inflammation (autoimmune disease), systemic (chronic joint rheumatism, systemic erythromatodes, nodular polyarteritis, scleroderma, multiple myositis, skin myositis, Sjren's syndrome, Behcet's disease, etc.), nervous system (multiple) Sclerosis, myasthenia gravis, HAM (HTLV-1 myelopathy), amyotrophic lateral sclerosis, etc., endocrine (such as Vasedou's disease, Hashimoto's disease, type 1 diabetes, etc.), blood (idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, regeneration) Aplastic anemia, etc.), respiratory organs (sarcoidosis, pulmonary fibrosis, etc.), digestive tract (ulcerative colitis, Crohn's disease, etc.), liver (autoimmune hepatitis, primary biliary cirrhosis, primary sclerosing cholangitis, autoimmune cholangitis, etc.), kidney Selected from the group consisting of urinary tract (antineutrophil cytoplasmic antibody-related nephritis, vasculitis, Goodpasture syndrome, anti-glomerular basement membrane antibody disease, etc.);

(F) Infectious diseases caused by pathogens injuring cells, tissues, and organs of living bodies, or diseases caused by pathogens that cause infections in humans. 1) Bacteria (including spiroheta, chlamydia, and Rickettsia) , 2) viruses, 3) fungi, 4) plants (birds), 5) protozoa, 6) parasites (insects, nematodes, nematodes), 7) arthropods, bacterial infections (cholera, plague, E. coli) Infections, etc.), spirocheta infections (such as leptospirosis), chlamydia infections (such as scabies), Rickettsia infections (such as typhus, tetanus, etc.), viral infections (herpes zoster, viral hemorrhagic fever, rabies, etc.), fungal diseases (candidiasis, Cryptococcosis, Aspergillosis, etc.), protozoa diseases (ameba dysentery, malaria, toxoplasmosis, etc.), parasites (insectitis, nematodes, etc.), other mycoplasma infections (mycoplasma pneumonia, etc.) Selected from those including cobacterial infections (tuberculosis, atypical acidophilus, etc.);

(G) diseases in the dermatological area, i) dermatitis, including dermatitis, allergic or autoimmune inflammation, or skin diseases with specific inflammation, such as psoriasis, blisters, pustules, keratosis, keratinosis, ii A) a disorder or aging associated with cosmetic dermatology, selected from a) regulation of melanin metabolism (whitening), b) regulation of hair growth (hair growth), c) diseases of the dermatological region (including aging) related to regulation of collagen production;

(H) lifestyle disease, selected from those including hyperlipidemia, arteriosclerosis, hypertension, diabetes, and the like;

(I) abnormalities related to maintenance of normal bacterial flora;

(J) selected from those including amyloidosis, Alzheimer's disease, osteoporosis, fractures, and the like;

(K) inflammatory responses in the brain and nerve regions, such as inflammation and ataxia, which accompany the development of ischemic lesions such as cerebral infarction and myocardial infarction;

(L) gout;

(M) osteoporosis; or

(N) interstitial pneumonia.

(18) The protein according to any one of the above (1) to (5), the nucleic acid according to any one of the above (6) to (8), the recombinant vector according to the above (9) or (10), and the above (11) Or an assay or test reagent characterized in that it contains as an active ingredient one selected from the group consisting of the transformants described in (12).

Effects of the Invention

Since the galectin 9 modified substance obtained with respect to galectin 9 is stabilized with respect to protease compared with the wild type, it can be used for the elucidation of the in vivo function of galectin 9, and it can control and immunize tumor cells. It can be used to study the function and activity of galectin 9, which is involved in the control and regulation of various biological reactions, such as regulation and further control of allergy or inflammation. Further, the galectin 9 variants and related substances are promising as reagents and active agents in clinical applications, molecular biological applications, biochemical applications, medical applications.

Other objects, features, superiority and aspects of the present invention will be apparent to those skilled in the art from the following description. However, it is to be understood that the description of the specification including the description of the following description and the specific examples indicates a preferred embodiment of the present invention, and is shown only for explanation. It is easy for a person skilled in the art to make various changes and / or modifications (or modifications) within the intention and scope of the present invention disclosed herein by the following description and knowledge from other parts of the present specification. Will be self explanatory. All patent documents and references cited in the present specification are cited for the purpose of explanation, and they are to be interpreted to include the contents thereof as part of the present specification.

1 shows a method for constructing a galectin 9 modified (G9NC (null)) expression vector.

FIG. 2 shows electrophoretic photographs of galectin 9 modified (G9NC (null)) expressions and purification treatments.

Figure 3 shows the result of comparing the resistance to protease between wild type galectin 9 (G9 (M)) and galectin 9 modified (G9NC (null)). With respect to the purified title, resistance to E. coli protease present was examined. The figure shows an electrophoretic photograph.

Figure 4 shows the result of comparing the resistance to protease between wild type galectin 9 (G9 (S)) and galectin 9 modified (G9NC (null)). Resistance to matrix metalloprotease 3 (MMP-3) was investigated. The figure shows an electrophoretic photograph.

Figure 5 shows the result of comparing the resistance to protease between wild type galectin 9 (G9 (S)) and galectin 9 modified (G9NC (null)). Resistance to elastase was investigated. The figure shows an electrophoretic photograph.

Figure 6 shows the results of comparing the biological activity between wild type galectin 9 (G9 (S)) and galectin 9 modified (G9NC (null)). Apoptosis inducing activity (DNA laddering) on MOLT-4 cells was investigated. The figure shows an electrophoretic photograph.

Figure 7 shows the results of comparing the biological activity between wild type galectin 9 (G9 (S)) and galectin 9 modified (G9NC (null)). ECA activity against peripheral blood eosinophils was investigated.

8 shows the results of comparing the sequences of each clone from different sources by searching for BLAST sequences of galectin 9 EST clones. Each clone in the search shows 97-99% homology. The variation in the positions of 5, 88, 135, 238, and 281 is shown.

9 shows that Zymosan causes pleurisy but does not cause inflammation with the galectin 9 modification (h-gal9NC (nu11)) alone.

Fig. 10 shows the results of investigating the effects of the galectin 9 modification (h-gal9NC (nu11)) in the zymotic acid-induced pleurisy model.

Fig. 11 shows the results of investigating the effects of galectin 9 modifications (Gal-9 = G9NC (null)) in PMA induced dermatitis (steroid sensitization model).

Fig. 12 shows the results of examining the effects of the galectin 9 modifications (Gal-9 = G9NC (null)) on arachidonic acid induced dermatitis (steroid insensitivity model).

Fig. 13 shows the results of investigating the effects of galectin 9 modified variants (Gal-9 = G9NC (null)) in the capsaicin-induced dermatitis model.

Fig. 14 shows the results of investigating the effects of galectin 9 modified variants (Gal-9 = G9NC (null)) in the DNFB induced contact dermatitis model.

Fig. 15 shows the results of investigating the effects of galectin 9 modified variants (Gal-9 = G9NC (null)) in the DNFB induced contact dermatitis model.

Fig. 16 shows the results of investigating the effects of galectin 9 modified variants (Gal-9 = G9NC (null)) in the FITC-induced atopic dermatitis model.

17 shows the results of investigating the effects of galectin 9 modifications (Gal-9 = G9NC (null)) on the dwarf model.

18 shows the results of investigating the effects of galectin 9 modifications (Gal-9 = G9NC (null)) on the dwarf model.

19 shows the results of investigating the effects of galectin 9 modifications (h-gal9NC (null)) on the arthritis model.

Fig. 20 shows the results of measuring tumor cell proliferation inhibitory effect, that is, antitumor activity (anticancer effect), of galectin 9 variants in a subcutaneous transplantation model. The top shows the control and the bottom shows the galectin 9 variant administration group (no tumors show up to 5 weeks).

Fig. 21 shows histograms of histopathological analysis as a result of measuring the tumor cell proliferation inhibitory effect, that is, antitumor activity (anticancer effect), of the galectin 9 variants in the subcutaneous transplantation model. The skin at 5 weeks in the case of LLC + galectin 9 modified (Gal9) administration (bottom) is shown. Visually white.

Fig. 22 shows the results of induction of apoptosis (cell interference activity) in cultured tumor cells (Meth A cells, 24 hours) of galectin 9 variants (stabilized galectin 9).

Fig. 23 shows the results of induction of apoptosis (cell interference activity) in cultured tumor cells (B16 / F10 cells, 24 hours) of galectin 9 modified substance (stabilized galectin 9).

Fig. 24 is a survival curve of the animal, showing that the galectin 9 modified substance had antitumor effect in the cancerous peritonitis model by Meth A cells.

Fig. 25 shows photographs showing the state of mice in the galectin 9-modified (Gal9) non-administered group (top) and administration group (bottom) in a cancerous peritonitis model by Meth A cells.

Fig. 26 shows the survival curves of the animals, showing that nine variants of galectin have an antitumor effect in a cancerous peritonitis model by B16 / F10 cells.

FIG. 27 shows the visceral tissue (day 14) photographs of cancerous peritonitis model mice with B16 / F10 cells (melanoma) compared to the galectin 9 modified (Gal-9) -administered group.

Fig. 28 shows the results of investigating the effects of galectin 9 modifications (stabilized galectin 9) on immune cells. Analysis results of B16 / F10 intraperitoneal (i.p.) infiltrating cells (24 hours).

Fig. 29 shows the results of adhesion inhibition experiments with galectin 9 modifications (stabilized galectin 9). The result of analysis of B16 / F10 cells (1 hour). In the figure, Collagen type I represents type I collagen, Collagen type IV represents type IV collagen, Laminin represents laminin, Fibronectin represents fibronectin, and Vitronectin represents vitronectin.

Fig. 30 shows the results of measuring the action effects of galectin 9 modified (Gal-9) and dexamethasone (Dex.) In the tick antigen-induced asthma model.

Fig. 31 shows the results of measuring the effect of the actions of galectin 9 modified (Gal-9) and dexamethasone (Dex.) In the tick antigen-induced asthma model. Each cell number which exists in BALF is shown.

Fig. 32 shows the results of measuring the effect of the galectin 9 modified substance (Gal-9) in the tick antigen-induced asthma model (photograph of the tissue around the bronchus).

Fig. 33 shows the results of measuring the effects of the galectin 9 modification (Gal-9) and dexamethasone (Dex.) In the OVA-induced asthma model (mouse).

Fig. 34 shows the results of measuring the action effects of galectin 9 modified variants (Gal-9) and dexamethasone (Dex.) In the OVA-induced asthma model (mouse). Each cell number which exists in BALF is shown.

Fig. 35 shows the effect of galectin 9 modifications (gal-9) on immediate asthma (IAR) and delayed asthma (LAR) in the OVA-induced asthma model (Molmot).

36 shows the results of measuring the effect of the galectin 9-modified substance (Gal-9) in the OVA-induced asthma model (molmot). Each cell number which exists in BALF is shown.

Fig. 37 shows the results (hematocrit (%)) of the action of the galectin 9-modified substance (Gal-9) in the autoimmune hemolytic anemia model (mouse).

Fig. 38 shows the results of measuring the effect of the actions of galectin 9-modified (Gal-9) and dexamethasone (Dex.) In the Arthus response (vasculitis) model (mouse).

Fig. 39 shows the results of measuring the action effects of the galectin 9 modified variants (Gal-9) and dexamethasone (Dex.) In the ARDS model (mouse).

Fig. 40 shows the results of measuring the effect of the actions of galectin 9 modified body (Gal-9) and dexamethasone (Dex.) In the ARDS model (mouse). Each cell number which exists in BALF is shown.

Fig. 41 shows the results of measuring the effect of the galectin 9 modified substance (Gal-9) (intravenous administration) in the capsaicin-induced inflammation model.

Figure 42 shows the results of testing the effect on osteoclast formation by galectin 9 modified (Gal-9). It is obvious that there is an inhibitory effect.

Fig. 43 shows the results of testing apoptosis induction (in the presence of M-CSF) of monocytes by stimulating galectin 9 variants (gal-9).

Figure 44 shows the results of testing the effect on the human osteoblast proliferation by galectin 9 modified (gal-9) stimulation.

Figure 45 shows the results of testing the effect on the expression of human osteoblast differentiation markers by galectin-9 modified (Galectin-9) stimulation (8 hours).

46 shows survival and the results of testing the action of the galectin 9 variant in the interstitial pneumonia model.

Fig. 47 shows the results of testing the action of the galectin 9 variants on the interstitial pneumonia model. Lung tissue (HE staining, photograph) of survival example at Day 14 is shown.

Fig. 48 is a survival curve of an animal, showing that the galectin 9 modified substance had an antitumor effect in a cancerous peritonitis model by LLG cells (apoptosis (+)).

Fig. 49 shows the results of the investigation of the action of galectin 9 variants in cancer metastasis model using B16 / F10 cells (appearance of the lungs of model animals).

Fig. 50 shows the results of investigating the action of the galectin 9 variant (G9NC (null)) on cancer metastasis model using B16 / F10 cells (result of lung nodule count).

Fig. 51 shows the results of measuring the effect of the action of galectin 9 (gal-9) (intravenous administration) in the carrageenan-induced inflammation model.

FIG. 52 shows to compare the result of measuring the effect of dexamethasone (Dex.) As a positive control in the carrageenan-induced inflammation model.

Fig. 53 shows the results of stained tissues examined by expression of galectin 9 in rheumatoid (RA) joint synovial membranes using immunohistostaining.

Fig. 54 shows the results of light microscopic observations examining the apoptosis-inducing activity of rheumatoid (RA) articular synovial cells by galectin 9.

Fig. 55 shows the results of measuring the apoptosis-inducing activity of rheumatoid (RA) articular synovial cells by galectin 9 by the PI method.

Fig. 56 shows the results of investigating the apoptosis-inducing activity of rheumatoid (RA) synovial cells by galectin.

Fig. 57 shows the results of investigating the proliferation inhibitory activity of rheumatoid (RA) synovial cells by galectin.

Fig. 58 shows the results of investigating the action (suppression of pain due to mechanical stimulation) of galectin 9 variants in the adjuvant arthritis model.

Fig. 59 shows the results of investigating the action (inhibition of pain due to mechanical stimulation) in the adjuvant arthritis model (action of indomethacin as a positive control).

Fig. 60 shows the results of investigating the action (suppression of pain due to mechanical stimulation) of galectin 9 variants in the carrageenan-induced acute inflammation model.

Fig. 61 shows the results of investigating the action (inhibition of pain by mechanical stimulation) in the carrageenan-induced acute inflammation model (action of dexamethasone as a positive control).

Fig. 62 shows the result of investigating the stability of the galectin 9 modified body in human joint fluid (SDS-PAGE).

Fig. 63 shows the results (intravenous administration) of investigating the action of the galectin 9 modified body (stabilized galectin 9) in the arthritis model (antibody cocktail causing model).

Fig. 64 shows the results (intraperitoneal administration) of the investigation of the action of the galectin 9 modified body (stabilized galectin 9) in the arthritis model (collagen arthritis model).

Fig. 65 shows the results (intravenous administration) of examining the action of the galectin 9 modified body (stabilized galectin 9) in the arthritis model (collagen arthritis model).

Fig. 66 shows the results (intravenous administration) of investigating the action of 9 galectin variants in the adjuvant arthritis model.

Fig. 67 is for comparing the results of the investigation in the adjuvant arthritis model (action of indomethacin as a positive control).

Fig. 68 shows the results (intravenous administration) of investigating the action of the galectin 9 variants in the rat CIA (collagen sensitization) model.

Best Mode for Carrying Out the Invention

Reference is made to published studies and ongoing patent applications, the contents of which are incorporated herein by reference.

"Galectin 9 modified substance" means an activity that is specifically bound to a specific sugar chain possessed by a sugar chain recognition site of galectin 9, or an activity similar thereto (the present activity includes qualitative activity and / or quantitative activity). May be used). Although galectin 9 has apoptosis-inducing activity against specific cells, this variant of galectin 9 may have apoptosis-inducing activity possessed by wild-type galectin 9 or a softening activity thereof. The biological activity may be modified or modified, which is preferable in some cases. Particularly preferred galectin 9 variants in the present invention are reagents having biological activity, and exhibiting properties that are preferable to wild type galectin 9 in the field of clinical examination, the field of analysis, or the field of medicine or medicine.

The galectin 9 variant is, for example, a protein or salt thereof modified with a link peptide of the galectin 9 or a protein having a substantially equivalent activity thereof, or a salt thereof, having a substantially equivalent activity to the galectin 9 or the same. One or more amino acids in the amino acid sequence of the link peptide of the protein or the region in the vicinity thereof are deleted, substituted or added, and the degradation susceptibility to the link peptide is modified at least compared to galectin 9 A modified protein or a salt thereof, a protein having substantially the same activity as galectin 9, and at least 70% homology, or at least 75% homology, or at least 80% to the amino acid sequence of galectin 9 At least homology, or at least 85% homology, or at least 90% homology, or at least 95% A protein having a homology to a phase or a salt thereof, (1) a sugar chain recognition region (NCRD) on the N-terminal side of galectin 9 or a polypeptide having an activity substantially equivalent thereto, and (2) a sugar chain on the C-terminal side of galectin 9 (3) a modified link consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence of a link peptide of galectin 9; The protein or its salt etc. which are couple | bonded through the peptide may be sufficient.

By the way, galectin 9, J. Biol. Chem., 272 (10): pp. In 6416-6422 (1997), a novel galectin was found in cDNA prepared from the spleen of a Hodgkin's disease patient, named this galectin 9, and the report was made, and at the same time, it was healthy to avoid sequence variation in Hodgkin's disease tumor. The sequence was reconfirmed with cDNA prepared from ordinary human peripheral blood to finally determine the sequence of galectin 9, and the sequence is shown in Fig. 1 on page 6418 of the document. On the other hand, for galectin 9, J. Biol. Chem., 273 (27): pp. In 16976-16984 (1998), lactose factor electin was isolated from c-DNA prepared from eosinophils-derived T cell line, STO-2, but it had high homology with the above-mentioned galectin 9. , The amino acid sequence position showed a difference in the 5th, 88th, 135th, 238th and 281th amino acids. Fig. 8 on page 1683 of the document describes the sequence of the electin, and therein, Lectins are believed to be variants of galectin 9.

In addition, J. Biol. Chem., 275 (12): pp. In 8355-8360 (2000), galectin 9 is isolated from cDNA prepared from Jurkat T-cells to produce a recombinant (recombinant) protein, but since the galectin 9 recombinant protein exhibited eosinophils, Shima et al. Decided to use galectin 9 having a sequence derived from Jurkat T-cell for further studies, where Gly, Lys was assigned to amino acids at positions 5, 88, 135, 238 and 281, respectively, in the amino acid sequence position. , Ser, Pro, and Glu are suitable, and the fifth amino acid is Ser, which is reported by Matsumoto et al. (J. Biol. Chem., 273 (27): pp. 16976-16984 (1998)). Although different in terms of Gly and Gly, there is no difference in eosinophil drip activity, and even if the sequence of galectin 9 (including partial sequences) registered in 17 EST databases is retrieved, 5, 88, 135, 238, 281 Gly, Lys, Ser, Pro, and Glu are suitable for the first amino acid, respectively. It is described that it is reasonable, and variations of galectin 9 are described in Table II on page 8959 of the document (see FIG. 8). In FIG. 8, it is Gly (G), Lys (K), Ser (S), Pro (P), and Glu (E).

J. Biol. Chem., 272 (9): pp. 6078-6086 (1997) (Non-Patent Document 3), the 26 amino acids of the two sugar recognition sites (CRD) and the link region connecting them from the similarity of the amino acid sequence (Galectin 9M) Type) (see Fig. 1 in the document). In other words, in the amino acid sequence shown in SEQ ID NO: 5, the C-terminal sugar chain recognition region (CCRD) is said to start at Met ¹⁷⁵ . Based on this, the CRD of the human galectin 9 and the link area are registered in the accession number NP_033665 of the NCBI database. Meanwhile, J. Biol. Chem., 273 (5): pp. In 2954-2960 (1998), galectins 4 and 6 are reported, among which CRD and link region settings are determined on the basis of amino acid sequence and gene sequence. Although shown in Fig. 2, when this setting is reflected in galectin 9, the link area and C are different from those of the former (J. Biol. Chem., 272 (9): pp. 6079-6086 (1997)). It is a different thing in CRD of a terminal side. That is, looking at the amino acid sequence shown in SEQ ID NO: 5, the CCRD starts at Phe ¹⁹⁵ .

The group of the present inventors said that the boundary of splicing by exon is between Gln ¹⁴⁸ -Pro ¹⁴⁹ , Ile ¹⁶⁰ -Thr ¹⁶¹ , and Ser ¹⁷⁷ -Thr ^178. Considering the presence at the C-terminal side, while examining the sugar binding capacity of CRD at the C-terminal side, that is, the amino acid sequence shown in SEQ ID NO: 5, the full-length CCRD starting at Thr ¹⁷⁸ was expressed. In the case of lactose binding ability, deletion of 6 amino acids (CCRD fragment starting at SEQ ID NO: ¹⁸⁴ ) and deletion of 12 amino acids (CCRD fragment starting at Ala ¹⁹⁰ ) also showed lactose binding ability, but deletion of 22 amino acids (Leu CCRD fragments starting at ²⁰⁰ ) have no expression in Escherichia coli, so the amino acid sequence shown in SEQ ID NO: 5 shows that the CCRD starts at Phe ¹⁹⁵ . Considering that it can be considered as well, it was assumed that Thr ¹⁷⁸ to Thr ³²³ of the amino acid sequence shown in SEQ ID NO: 5 as the CRD on the C-terminal side. Regarding the CRD (NCRD) at the N-terminal side of galectin 9, the amino acid sequence shown in SEQ ID NO: 5 showed lactose binding ability when the full-length NCRD up to Gln ¹⁴⁸ was expressed. ^In NCRD fragments ^{1 to} Ser ¹³⁹ ), the protein is expressed but the lactose binding ability is not seen. Therefore, the amino acid sequence shown in SEQ ID NO: 5 as the CRD on the N-terminal side is assumed to be Met ^{1 to} Gln ¹⁴⁸ .

In a preferred form, the galectin 9 variant is, for example, (1) the NCRD of galectin 9, wherein the amino acid sequence shown in SEQ ID NO: 2 or one or more amino acids in the sequence is deleted, substituted or added, or At least 70% homology, or at least 75% homology, or at least 80% homology, or at least 85% homology, or at least 90% homology to the amino acid sequence shown in SEQ ID NO: 2, or Have an amino acid sequence having at least 95% or more homology and also have lactose binding capacity, and (2) a deletion of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 3 as the CCRD of galectin 9 or a sequence thereof , Substituted or added, or at least 70% homology to the amino acid sequence set forth in SEQ ID NO: 3, or at least 75 Have an amino acid sequence having at least% homology, or at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology, and also have lactose binding capacity, (3) The link region joining (1) and (2) above, wherein the amino acid sequence shown in SEQ ID NO: 9 or one or more amino acids in the sequence is deleted, substituted or added, preferably a matrix It is mentioned that it is more stable than galectin 9 native to proteolytic enzymes, such as a metalloprotease. As the link region 3, one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 9 (e.g., 1 to 2, preferably 3 to 4, more preferably 5 to 6, more preferably Preferably, the deletion flexible body missing from 7 to 8, in particular 1 to 9, etc., one or more (eg 1 to 9, preferably 1 to 8, more preferably 1 to 6) amino acid residues thereof Dogs, even more preferably 1 to 4, in particular 1 to 2, etc., substituted with a different residue, one or more (eg 1 to 60, preferably 1 to 40, more preferably Preferably 1 to 20, more preferably 1 to 10, in particular 1 to 5, etc. amino acid residues (except the amino acid sequence shown in SEQ ID NO: 9 of the amino acid sequences shown in SEQ ID NO: 7 and 8) And additional flexible bodies to which the parts are added). In the typical case, the link region 3 may be one obtained by replacing an amino acid sequence shown in SEQ ID NO: 9 with a sequence of HM, RIP, or an arbitrary two amino acids. Substitution, deletion, or insertion of amino acids may be such that they do not cause significant changes in the physiological or chemical properties of the polypeptide, and in some cases, may impart desirable changes. As a substituent of an amino acid in the amino acid sequence, it can select from the other amino acids in the class to which the amino acid belongs. For example, examples of nonpolar (hydrophobic) amino acids include alanine, phenylalanine, leucine, isoleucine, valine, proline, tryptophan, methionine, and the like. Examples of the amino acid (basic amino acid) having a positive charge include arginine, lysine and histidine. Examples of the amino acid having a negative charge (acidic amino acid) include aspartic acid and glutamic acid.

As the link region 3, the amino acid sequence shown in SEQ ID NO: 7 or 8 is substituted with a sequence of HM, RIP, or any two amino acids except for the amino acid sequence part shown in SEQ ID NO: 9. And the amino acid sequence shown in SEQ ID NO: 7 or 8, except for the amino acid sequence portion shown in SEQ ID NO: 9, leaving 6 amino acids therein, and deleting other residues. As the link region 3, the amino acid residue in the amino acid sequence shown in SEQ ID NO: 7 or 8 (except for example, the amino acid sequence part shown in SEQ ID NO: 9, or in the case of SEQ ID NO: 7) One or more (eg, 1 to 5, preferably 3 to 10, more preferably 5 to 15, more preferably 7 to 20) amino acid sequence portions shown in 8 may be excluded. , Especially 1 to 32 missing deletion flexible bodies, one or more (eg, 1 to 9, preferably 1 to 8, more preferably 1 to 6, still more preferably one or more amino acid residues thereof 1 or more substituted flexible bodies in which 1 to 4, especially 1 to 2, etc. are substituted with other residues, for example, 1 to 60, preferably 1 to 40, more preferably 1 to 20 More preferably 1 to 10, in particular 1 to 5, amino acid residues, provided that SEQ ID NO: 7 and Also included is an additional flexible body to which the amino acid sequence shown in 8 is added except for the part except the amino acid sequence shown in SEQ ID NO: 9).

As long as the domain structure or sugar binding ability, which is characteristic of the natural human galectin 9 protein, is maintained, all of the above-mentioned variants are included in the present invention. It is also contemplated that the peptides or polypeptides of the present invention may include those having a primary structural conformation or a portion thereof which is substantially equivalent to the natural human galectin 9 protein, and also having a biological activity substantially equivalent to that of natural. It is thought to be included. It may also be one of the naturally occurring variants. Human-derived proteins (or peptides or polypeptides) of the invention comprise, for example, 60%, and in some cases 70, amino acid sequences selected from the group consisting of SEQ ID NOs: 1-3 in the sequence listing of WO 02/37114 A1. The thing which has homology higher than% is mentioned, More preferably, the thing which has a homologous amino acid sequence of 80% or 90% or more with respect to it is mentioned. Some of the human-derived proteins of the present invention are peptides (ie, partial peptides of the protein) of the human-derived protein, and as long as they have substantially the same activity as the galectin 9 protein of the present invention. It may be a side. For example, the partial peptide of the protein of the present invention is at least 5 or more, preferably 20 or more, more preferably 50 or more, more preferably 70 or more, of the constituent amino acid sequences of human galectin 9, Most preferably peptides having at least 100, in some cases at least 200, amino acid sequences, preferably these correspond to contiguous amino acid residues, or for example in the sequence table of WO 02/37114 A1. The homology to the corresponding region among the amino acid sequences represented by any one of SEQ ID NO: 1 to 3 includes the same homology as above.

In the present specification, "substantially equivalent" refers to the activity of a protein, such as predetermined cytotoxic activity, apoptotic organic activity, anti-inflammatory activity, anti-allergic activity, immunomodulatory activity, sugar chain binding activity, physiological activity, biological activity This means substantially the same thing. Moreover, the meaning of the term may include the case of having substantially homogeneous activity, and examples of the substantially homogeneous activity include binding activity, cytotoxic activity, apoptosis organic activity, and the like. Substantially homogeneous activity indicates that their activity is homogeneous in nature, for example, physiologically, pharmacologically, or biologically homogeneous. For example, the activity of binding activity, cytotoxic activity, apoptosis organic activity, etc. is equivalent (e.g., about 0.001 to about 1000 times, preferably about 0.01 to about 100 times, more preferably about 0.1 to about 20 times, further Preferably, about 0.5 to about 2 times), but the quantitative factors such as the degree of these activities and the molecular weight of the protein may be different.

 The "galectin 9 modified polypeptide" includes a modified version of the native sequence of wild type galectin 9, its derivatives, analogs (analogs), fragments, chimeras and variants. Such polypeptides include those encoded by recombinantly produced polynucleotide sequences that are intended to be expressed in a host cell and are also designed to encode specific galectin 9 variant polypeptides.

The term "Galectin 9-modified therapeutic agent" means a molecule derived from a polynucleotide (Galectin 9-modified polynucleotide) or galectin 9-modified polypeptide sequence encoding a galectin 9-modified product, such a gamutin 9-modified polynucleotide Or at least one of a modified, variant, analogue, chimeric, fragment, etc. of the polypeptide. The galectin 9 modified therapeutic agent, which is a polynucleotide, generally includes a sequence encoding a galectin 9 modified polypeptide and can be expressed by a recombinant technique in a host cell. In addition, the galectin 9-modifying agent may be an active substance of galectin 9 activity. As another therapeutic agent for galectin 9, it is possible to prevent the disease, disease, and abnormal symptoms of donating galectin 9 variants, having the activity of galectin 9 variants, and related to the lack or lack of galectin 9 activity. Or a modulator of galectin 9 activity that produces a therapeutic effect. The modulator of galectin 9 activity may be, for example, a polynucleotide, a polypeptide, or a low molecule.

The term "diagnostic agent" used in the present specification means any drug that contributes to one or more of the diagnostic actions used in the diagnosis in the present invention. Use in these diagnostics may include a method for determining the presence of galectin 9 producing cells or a method for determining the presence of cells presenting galectin 9 binding substances. As the diagnostic agent, for example, one selected from the group consisting of DNA encoding a galectin 9-mutant mutein, a stabilized galectin 9-mutant mutein, and a cell or cell homogenate having the stabilized galectin 9-mutant mutein The thing containing is mentioned.

The term "therapeutic agent" used in the present specification may be any drug that contributes to or attains one or more of the therapeutic actions used in the treatment in the present invention. For example, if the therapeutic agent is a polynucleotide designed to express a galectin 9 modified polypeptide, the agent is a polynucleotide that can be administered to a mammal and expressed in a cell. In this case, the active form of the agent is an expressed polypeptide.

The galectin 9-modifying agent is a protease such as a therapeutic agent having a biological activity of the galectin 9-modifying agent or a polypeptide, matrix metalloprotease, which has a longer binding activity to a specific sugar chain than the natural galectin 9-modifying substance. It is a therapeutic agent derived from galectin 9 variants such as polynucleotides encoding galectin 9 modified polypeptides that are more stable than galectin 9 native to enzymes. This therapeutic agent, alone or in combination with the administration of another agent (eg, a galectin 9 variant, and in other known treatments for a particular tumor or autoimmune, etc., or a galectin 9 variant in a mammal) In combination with a gene delivery vehicle that can easily perform expression), thereby achieving the therapeutic purpose. For example, the therapeutic agent may include a galectin 9 modified substance developed for another purpose, and may further include an agent of galectin 9, a drug that modifies or modulates galectin 9 activity. For example, organic small molecule compounds or substances, peptides, peptide-like compounds or substances, polynucleotides encoding galectin 9 modified polypeptides, galectin 9 modified polypeptides, galectin 9 native to protease are more stable The cells may be expressed by transforming chimeric or mutant of galectin 9 variants.

In the present specification, the "combination therapeutic agent" refers to a therapeutic composition containing several components or several pharmaceutical agents, which, when administered together, produce their separate effects, and these are administered together to treat a disease or the like. If so, you may point to creating a synergy effect. Preferably, the separately acting effects obtained by each of several components or several agents in the combination therapy can yield greater therapeutic effects, such as loss or normalization of tumors, recovery from autoimmune disease and long-term survival. You can combine it so that it is. Examples of effects obtained by administering a combination therapy include a combination of short-term symptom recovery and recovery of symptoms obtained after long-term administration, or effects such as reducing autoimmune response to each of a particular type of cell in a patient. Combinations. As an example of the combination therapy of the present invention, a gene delivery vehicle containing a polynucleotide encoding a galectin 9 variant and a polynucleotide encoding at least one of cytokines such as IFNs and IL-2 can be administered. And the like. As another example, two gene delivery vectors may be used, for example, one expresses 9 galectin variants and the other may express at least one of cytokines. In addition, gene delivery vehicles expressing IFNs, IL-2, or IFN-γ or the like are administered to predict and upregulate administration of galectin 9 variants for inducing apoptosis in target cells. You may. Various therapeutic agents may be donated at the same time, for example, one or all of the individual agents may be repeatedly administered as necessary to streamline the treatment, or may be administered in the same pharmaceutically acceptable carrier. have.

The "gene delivery vehicle" refers to a component that facilitates delivery of a code sequence for expression of a polypeptide in a cell to a cell. The cells may be present in the mammal's body as in gene therapy in vivo, or once removed from the mammal for transfection treatment as in ex vivo gene therapy, and then presented to the mammal for expression of the polypeptide. It may be returned. The gene delivery vehicle may be any component or vehicle capable of achieving gene delivery to a cell, for example, liposomes, particles, vectors, or the like. Examples of gene delivery vehicles include a recombinant vehicle (e.g., a recombinant viral vector), a nucleic acid vector (e.g., a plasmid), a neutralized nucleic acid molecule (e.g., a gene), neutralizing negative charges on the nucleic acid molecule, and also aggregation of the nucleic acid molecule as a folded molecule. Nucleic acid molecules complexed with polycation molecules that can be incorporated, nucleic acids bound to liposomes (US Pat. No. 5,166,320; US Pat. No. 5,547,932; Wang et al., Proc. Natl. Acad. Sci. USA, 84 : 7851, 1987). The gene delivery vehicle may contain specific eukaryotic cells, such as producer cells, which are capable of delivering nucleic acid molecules biologically possessing one or more desired properties to the host cell. The desired properties may include the ability to express a desired substance and / or provide biological activity, as discussed below, for example, proteins, enzymes, antibodies, and the like. In other words, the nucleic acid molecule carried by the gene delivery vehicle may be an active agent in itself without requiring expression of a desired substance. One example of such biological activity is that found in gene therapy. In gene therapy, certain kinds of genes are inactivated, the products directed to the genes are prevented from being generated, and the genes are inserted into the genes to specifically express the delivered nucleic acid molecules. The gene delivery vehicle refers to an assembly (assembly) capable of directing expression of one or more target sequences or genes.

Gene delivery vehicles generally contain a promoter element and may contain a signal indicative of polyadenylation. In addition, the gene delivery vehicle is linked to one or more target sequences or genes so as to operate when they are transcribed and includes a sequence that acts as a translation initiation sequence. Gene delivery vehicles also include selectable markers such as Neo, SV ² Neo, TK, hyglomycin, bleomycin (pleomycin), puromycin, histidinol, DHFR, one or more restriction enzyme sites and translation termination The sequence may be included. As used herein, a gene delivery vehicle is a viral vector (Jolly, Cancer Gen. Therapy, 1: 51-64, 1994), nucleic acid vector, naked DNA, liposome DNA, cosmid, bacteria, specific eukaryotic cells And a recombinant vehicle such as (including producer cells; see US Pat. No. 6,333,195).

The term "biological activity" is used when referring to a molecule that retains specific activity. For example, a biologically active galectin 9 modified polypeptide has an activity that specifically binds to a specific sugar chain possessed by a sugar chain recognition site of galectin 9, or an activity substantially equivalent to that of a matrix metal. Maintain the ability to be more qualitatively and / or quantitatively stabilized than the native galectin 9 against the protease of the protease, activating the anti-tumor activity possessed by galectin 9 or the apoptosis pathway that induces apoptosis Seems.

As used herein, the term "nucleic acid molecule" or "polynucleotide" refers to a molecule such as RNA or DNA that encodes a specific amino acid sequence or its complement, or DNA: RNA hybrid. The "code sequence" used in this specification means either RNA or DNA which codes a specific amino acid sequence or its complementary chain, and also DNA: RNA hybrid. The polynucleotide may include, for example, an antisense oligonucleotide or ribozyme, and may also include sequences such as 3 'or 5' untranslated regions of genes, introns of genes, and other regions of genes that do not constitute a code region of genes. You may include it. DNA or RNA may be single- or double-stranded. Synthetic nucleic acids and synthetic polynucleotides may include those having chemically synthesized nucleic acid sequences, or may be partially modified chemically to impart resistance to denaturation to the molecule. Polynucleotides may be prepared, for example, by polymerase chain reaction (PCR) amplification, recombinant expression using complementary DNA or RNA, or may be produced by chemical synthesis.

As used herein, the term "expression control sequence" or "regulatory sequence" includes one or more components that affect the expression of a gene encoding a polypeptide and affect the expression of including a signal for transcription or translation. And sequences used in the field. Suitable expression control sequences for expression of the polypeptides of the invention vary depending on the host system in which the polypeptide is to be expressed.

As the "polypeptide" of the present invention, any one containing a galectin 9 modified polypeptide may be used, and any part of the galectin 9 modified protein containing a mature protein may be cited. Alleles, analogs, derivatives, and the like. The modified body may be derived from a spliced modified body expressed from the same gene as the related protein. Otherwise, unless specifically indicated, such polypeptides may be one or more of the biological activities possessed by the galectin 9 protein, such as, for example, affinity binding to specifically bind to specific sugar chains or binding activity to specific partners. It has biological activity. The term "polypeptide" is not limited to gene products of a specific length. Regardless of whether it is derived from a human or from a source other than human, for the N-terminal sugar chain recognition site (NCRD) and C-terminal sugar chain recognition site (CCRD) of galectin 9, the same as the target protein or mature protein, or Polypeptides having at least 60%, preferably 70%, more preferably 80%, and most preferably 90% and even 95% homology are included within this definition of the polypeptide. Thus, modifications based on alleles and variants of gene products including substitution, deletion or insertion of amino acids may also be included. Substitution of amino acid is to change the overlapping pattern by changing amino acid conservative substitution or substitution of amino acid which alters glycosylation site, phosphorylation site, acetylation site, or the position of cysteine residue which is not necessary for function, Moreover, the substitution which removes what is not an essential amino acid residue may be sufficient. A conservative substitution of an amino acid is generally a substitution which preserves the charge, hydrophobicity / hydrophilicity, and / or the three-dimensional size (size) of the amino acid to be substituted, for example, Gly / Ala, Val / Ile / Leu, Asp / Glu, Substitutions between members of the group, such as Lys / Arg, Asn / GIn, Ser / Cys / Thr and Phe / Trp / Tyr, are conservative substitutions.

An analog is a thing which has the activity of a target protein form, the peptide etc. which have one or more of the peptide mimetics which are widely known as a peptide form. The present definition includes, for example, polypeptides comprising analogues of one or more amino acids (eg, including non-natural amino acids, etc.), polypeptides with substituted linkages, naturally occurring variants, and non-naturally occurring variants; And other modifications and formulas known in the art.

As used herein, the term "polypeptide" may be one that is modified after polypeptide expression, such as glycosylation, acetylation, phosphorylation, myristoylation, or the like.

As used herein, the term "naked DNA" may refer to a polynucleotide DNA administered to a mammal for expression in a mammal. For example, the polynucleotide may be a code sequence, or the polynucleotide DNA may be directly or indirectly bound to an expression control sequence so that the code sequence is easily expressed once the DNA enters the cell. Indirect binding refers to two linkers or spacers via linkers or spacers for the purpose of facilitating the expression of DNA in mammalian cells, for binding regulatory regions and code sequences, for facilitating insertion of other sequences, and the like. The polynucleotide region may be joined together.

As used herein, "vector" refers to an assembly (assembly) capable of instructing the expression of one or more target sequences or genes. A vector may be a transcriptional promoter / enhancer, an element defining one or more loci, further alternative splicing, nuclear RNA transport, a modification that occurs after translation of a messenger, or a modification that occurs after transcription of a protein. And other elements that control the expression of other genes that direct or control such processes.

In addition, the vector must include sequences that are operatively linked to one or more sequences or genes of interest when transcribed and that also serve as translation initiation sequences. If desired, the vector may be a signal indicative of polyadenylation, selection markers such as Neo, TK, hyglomycin, bleomycin (pleomycin), histidinol, DHFR, etc., one or more restriction sites and translation termination sequences. It may include. In addition, if the vector is placed in a retrovirus, the vector must include a packaging signal, a long term repeat sequence (LTR), and, if it is not present, a plus or minus primer binding site suitable for the retrovirus used.

"Tissue-specific promoter" is preferentially active in a limited number of tissue types or cell types and refers to elements defining transcriptional promoters / enhancers or loci, or other elements that control gene expression as described above. Pointing. Representative examples of such tissue specific promoters include, for example, the PEPCK promoter, the HER2 / neu promoter, the casein promoter, the IgG promoter, the chorogenic embryo antigen promoter, the elastase promoter, the polphobininogen deaminase promoter, the insulin promoter, the growth hormone factor. Promoters, tyrosine hydroxylase promoters, albumin promoters, α-fetoprotein promoters, acetylcholine receptor promoters, alcohol dehydrogenase promoters, α or β globin promoters, T cell receptor promoters, osteocalcin promoters and the like.

"Idea-specific promoter" is an element that defines a transcriptional promoter / enhancer or locus, or other element that controls gene expression as described above, and whose transcriptional activity is changed in response to cellular stimulation. Is pointing. Representative examples of such event-specific promoters include thymidine kinase or thymidyrate synthase promoters, α or β interferon promoters, and also hormones (natural hormones, synthetic hormones, or hormones from other non-host organisms, such as insects). And a promoter that responds to the presence of a hormone or the like.

The term "fusion protein" or "fusion polypeptide" refers to the expression resulting from the use of a vector that results in the expression of one polypeptide comprising more than one protein or a portion of more than one protein, and also from one of the vectors or a sequence of It refers to a protein or polypeptide obtained by recombinant expression of many heterologous code sequences. Most preferably, the fusion protein has a polypeptide unit that retains at least one of the biological activities possessed by the derived protein or polypeptide used to construct it, and preferably, by combining separate protein portions Forming a signal polypeptide, which produces synergistically improved biological activity, is included. Examples of the fusion protein to be produced include those having a polypeptide having a function when expressed, and those having a peptide having no function when expressed. As this peptide which does not have a function in the case of being expressed, what is helpful in expressing the polypeptide which has activity preferably is mentioned. Examples of fusion proteins useful in the present invention include any genetically engineered galectin 9 variant that has several advantages from the use point of view, such as for treatment or for detection or measurement, and for analysis or isolation or purification. Fusion polypeptides.

The term "chimeric" or "chimeric protein" may be considered to have the same meaning as a fusion protein or a fusion polypeptide. The "chimeric molecule" may be a fusion polypeptide or a polynucleotide fusion molecule encoding a fusion polypeptide. Chimeras can be constructed from linked DNA code sequences and expressed in the cell system or administered in vector to be expressed in vivo in an animal. For example, chimeric or fusion proteins comprising galectin 9 variants can be administered in a gene therapy protocol in vivo or ex vivo.

As used herein, the term "patient" may refer to something that can be treated or prevented by a living organism, and includes, but is not limited to, eukaryotic or prokaryotic organisms. For example, the eukaryote as a patient may be a vertebrate or an invertebrate. Thus, for example, the patient may be a fish, bird, larva, insect, mammal, reptile, amphibian, fungus, plant, preferably a mammal. Mammals include, for example, humans.

The general preparation and use of the galectin 9 modified agent and / or diagnostic agent of the present invention is described below. In one aspect, the present invention provides a technique for treating a disease, disease, or abnormal condition caused by a lack or lack of physiological or biological activity possessed by galectin 9. This treatment technique includes, for example, providing a galectin 9-modifying agent and / or administering an effective amount of a galectin-9-modifying agent to a mammal having the disease and the like. Galectin 9 variants have cytotoxic activity against malignant tumor cells, apoptosis-inducing activity against malignant tumor cells, anti-tumor activity against malignant tumor cells (anticancer activity), apoptosis-inducing activity of activated T cells, in particular CD4-positive T By exhibiting apoptosis-inducing activity, immunomodulatory activity, anti-inflammatory action, and anti-allergic action of cells, it is expected to be antitumor agent (anticancer agent), antiallergic agent, immune modulator, autoimmune disease agent, anti-inflammatory agent and corticosteroid hormone replacement. It can be. This treatment technique includes a method of treating autoimmune diseases in which activated T cells are remarkable. Both "autoimmune disease" and "autoimmunity" refer to disorders characterized by autoimmunity in mammals (this is the immune system's response to its own components). An autoimmune response is one that can progress to symptoms that show clinical signs. Strictly speaking, transplant rejection is not an autoimmune response, but if the patient undergoes a surgical procedure to symptomatically replace or transplant cells, tissues or organs, then allogeneic transplantation is an immunological response to an outpatient transplant. To react. When allogeneic transplantation of cells, tissues, or organs from one member of a species to another species, the receptor (recipe) generates an immune response sufficient to reject the transplanted cell, tissue or organ. This is what happens.

As an example of the "tumor" which can be treated by the method and therapeutic agent of the present invention, a malignant tumor may be included. In some cases, cancer, sarcoma, leukemia, etc. may be thought of as being classified as "cancer".

In this specification, "cancer" should be interpreted in a broad sense, and should not be simply interpreted as an epithelial malignant tumor. As used herein, "cancer" may include epithelial malignant tumors and non-epithelial malignant tumors (including tumorigenic and non-malignant), skin cancer (may include melanomas), breast cancer and ovarian cancer. , Uterine cancer, testicular malignant tumor, prostate cancer, bladder cancer, kidney cancer, thyroid cancer, pharyngeal cancer, laryngeal cancer, tongue cancer, maxillary cancer, esophageal cancer, stomach cancer, colon and colorectal cancer, lung and bronchial cancer, liver cancer (including hepatocellular carcinoma, hepatobiliary cancer) , Extrahepatic bile duct, gallbladder cancer, pancreatic cancer, leukemia, malignant lymphoma, plasmacytoma, osteosarcoma, chondrosarcoma, leiomyosarcoma, rhabdomyosarcoma, liposarcoma, adenocarcinoma, malignant hemangioma, malignant hemangioendothelioma, brain tumor (meningioma, glioma, astrocytoma And the like, but the present invention is not limited thereto, and it is possible to obtain desirable results by using the galectin 9 modified product of the present invention, and furthermore, the galectin 9 modified product is involved. It should be understood that any physiological or biological response may be included.

Examples of "autoimmune diseases" that can be treated by the method and therapeutic agent of the present invention include multiple sclerosis, Hashimoto's thyroiditis, systemic erythematodes (SLE), Goodpasture syndrome, pemphigus, receptor autoimmunity, and autoimmunity. Hemolytic anemia, autoimmune thrombocytopenic purpura, deformed arthrosis, chronic arthritis rheumatoid, scleroderma caused by anti-collagen antibodies, complex connective tissue disease, multiple myositis, pernicious anemia, idiopathic Edison disease, spontaneous infertility, glomerulonephritis, Bullous swelling, adrenergic drug resistance, chronic active hepatitis, primary biliary cirrhosis, autoimmune base endocrine failure, vitiligo, vasculitis, post-myocardial infarction, cardiac puncture syndrome, gall margin, atopy Dermatitis, autoimmune base asthma, autoimmune base inflammatory response, granulomatous disorders, alkylizing spondylitis, Poststreptococcal glomerulonephritis, autoimmune hemolytic anemia, encephalitis, secondary autoimmune responses to lymphoma, degenerative disorders, and atrophic disorders. Examples of autoimmune diseases showing receptor autoimmunity include Graves' disease, myasthenia gravis, insulin resistance and the like. Examples of autoimmune diseases of adrenergic drug resistance include asthma and cystic seizures.

Other autoimmune diseases in the present invention include, for example, those in which animal models exist, such as, for example, Schagren's syndrome (autoimmune lacrimitis (dacryodentis) or immune-mediated salivaitis), autoimmune myocarditis, primary biliary cirrhosis (PBC), inflammatory heart disease, mercury-induced kidney autoimmunity, insulin-dependent diabetes mellitus (type 1 diabetes or IDD), autoimmunity after thymicectomy, central nervous system (CNS) dehydration disorders, CNS lupus, sleep attacks, immune-mediated PNS disorders, Deformable arthrosis, chronic arthritis rheumatoid, uveitis, medulla cystic fibrosis, autoimmune hemolytic disease, autoimmune vasculitis, ovarian autoimmune disease, human scleroderma and the like. Autoimmune diseases characterized by central nervous system (CNS) dehydration disorders include, for example, multiple sclerosis (MS). Peripheral nervous system (PNS) autoimmune diseases may be, for example, Guillain-Barré syndrome (GBS).

Examples of the galectin 9-modifying agent include polypeptides, polynucleotides, low molecular organic compounds, peptides, or peptide-like compounds or substances. In addition, the galectin 9-modified therapeutic agent includes a gamutin 9-modified polypeptide, a polynucleotide encoding a galectin-9 modified polypeptide, a fusion polypeptide comprising a portion of the galectin-9 modified polypeptide, and the galectin-9-modified product A polynucleotide encoding a fusion polypeptide comprising a portion of a polypeptide, a biologically active peptide derivative of a galectin 9 modified polypeptide, a biologically active peptide like compound or substance derived from a galectin 9 modified polypeptide, or a galectin A low molecular organic compound (for example, may contain an active substance), etc., which has 9 modified activity and mimics the structure of the galectin 9 modified product, may be contained. Galectin 9 modified polypeptides are biologically active galectins such as galectin 9 modified polypeptide variants, galectin 9 modified polypeptide derivatives, modified galectin 9 modified polypeptides, or shortened galectin 9 modified polypeptides. 9 may be a modified polypeptide. The polynucleotide encoding the galectin 9 modified polypeptide is a polynucleotide sequence encoding a modified polypeptide having the N-terminal CRD full length and the C-terminal CRD full length of galectin 9, the biologically A sequence encoding an active moiety, a sequence encoding a biologically active peptide derived from a galectin 9 modified polypeptide, a sequence encoding a soluble galectin 9 modified polypeptide, or the like may be used. Another embodiment of the invention is a composition having a gene delivery vehicle capable of expressing a polynucleotide sequence encoding a galectin 9 modified polypeptide.

In the present invention, using a "gene recombination technique", it is possible to construct or acquire a predetermined nucleic acid (polynucleotide) or a predetermined peptide (polypeptide), to isolate and sequence, or to produce a recombinant. Examples of the recombinant DNA technology which can be used in the specification (including recombinant DNA techniques), and include those known in the art, for example, J. Sambrook, EF Fritsch & T. Maniatis , "Molecular Cloning: A Laboratory Manual (2 nd edition) ", Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989); DM Glover et al. ed., "DNA Cloning", 2nd ed., Vol. 1 to 4, (The Practical Approach Series), IRL Press, Oxford University Press (1995); Japanese Biochemistry Sculpture, Genus Biochemistry Experiment Lecture 1, Gene Research Method II, Tokyo Chemistry (1986); Japanese Biochemistry Sculpture, New Biochemistry Experiment Lecture 2, Nucleic Acid III (Recombinant DNA Technology), Tokyo Chemical Drivers (1992); MJ Gait (Ed), Oligonucleotide Synthesis, IRL Press (1984); BD Hames and SJ Higgins (Ed), Nucleic Acid Hybridization, A Practical Approach, IRL Press Ltd., Oxford, UK (1985); BD Hames and SJ Higgins (Ed), Transcription and Translation: A Practical Approach (Practical Approach Series), IRL Press Ltd., Oxford, UK (1984); B. Perbal, A Practical Guide to Molecular Cloning (2 nd Edition), John Wiley & Sons, New York (1988); JH Miller and MP Calos (Ed), Gene Transfer Vectors for Mammalian Cells, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1987); RJ Mayer and JH Walker (Ed), Immunochemical Methods in Cell and Molecular Biology, Academic Press, (1987); RK Scopes et al. (Ed), Protein Purification: Principles and Practice (2 nd Edition, 1987 & 3 rd Edition, 1993), Springer-Verlag, NY; DM Weir and CC Blackwell (Ed), Handbook of Experimental Immunology, Vo1. 1, 2, 3 and 4, Blackwell Scientific Publications, Oxford, (1986); LA Herzenberg et al. (Ed), Weir's Handbook of Experimental Immuno1ogy, Vol. 1, 2, 3 and 4, Blackwell Science Ltd. (1997); RW Ellis (Ed), Vaccines new approaches to immunological problems, Butterworth-Heinemann, London (1992); R. Wu ed., "Methods in Enzymology", Vol. 68 (Recombinant DNA), Academic Press, New York (1980); R. Wu et al. ed., "Methods in Enzymology", Vol. 100 (Recombinant DNA, Part B) & 101 (Recombinant DNA, Part C), Academic Press, New York (1983); R. Wu et al. ed., "Methods in Enzymology", Vol. 153 (Recombinant DNA, Part D), 154 (Recombinant DNA, Part E) & 155 (Recombinant DNA, Part F), Academic Press, New York (1987); JH Miller ed., "Methods in Enzymology", Vol. 204, Academic Press, New York (1991); R. Wu et al. ed., "Methods in Enzymology", Vol. 218, Academic Press, New York (1993); S. Weissman (ed.), "Methods in Enzymology", Vol. 303, Academic Press, New York (1999); JC Glorioso et al. (Ed.), "Methods in Enzymology", Vol. 306, Academic Press, New York (1999) or the like, or the method described in the literature cited therein, or by substantially the same method or alteration method (the description among them is disclosed by reference thereto). (Hereinafter, all of them are referred to as "genetic recombination techniques").

In this specification, "homology" means the amino acid residues or the bases of each amino acid constituting the chain between the two lines of the chain in the polypeptide sequence (or amino acid sequence) or polynucleotide sequence (or nucleotide sequence) It refers to the amount (number) of what can be determined to be the same in the fit relationship with each other, and means the degree of sequence correlation between two polypeptide sequences or two polynucleotide sequences. Homology can be calculated easily. Many methods for determining homology between two polynucleotide sequences or polypeptide sequences are known, and the term "homology" (also called "identity") is well known to those skilled in the art (eg, Lesk, AM (Ed.) , Computational Molecular Biology, Oxford University Press, New York, (1988); Smith, DW (Ed.), Biocomputing: Informatics and Genome Projects, Academic Press, New York, (1993); Grifin, AM & Grifin, HG (Ed Computer Analysis of Sequence Data: Part I, Human Press, New Jersey, (1994); von Heinje, G., Sequence Analysis in Molecular Biology, Academic Press, New York, (1987); Gribskov, M. & Devereux, J. (Ed.), Sequence Analysis Primer, M-Stockton Press, New York, (1991), etc.). General methods used to determine homology of two sequences include Martin, J. Bishop (Ed.), Guide to Huge Computers, Academic Press, San Diego, (1994); Carillo, H. & Lipman, D., SIAM J. Applied Math., 48: 1073 (1988) and the like, but are not limited thereto. Preferred methods for measuring homology include those designed to obtain the largest fit relationship between the two sequences to be tested. Such a method can be mentioned assembled as a computer program. Preferred computer programming methods for determining homology between two sequences include GCG program packages (Devereux, J. et al., Nucleic Acids Research, 12 (1): 387 (1984)), BLASTP, BLASTN, FASTA ( Atschul, SF et al., J. Mol. Biol., 215: 403 (1990)), but are not limited to these, and methods known in the art can be used.

In the present specification, "polymerase chain reaction" or "polymerase chain reaction" or "PCR" generally refers to a method as described in the specification of US Pat. No. 4,683,195 and the like, for example, a desired nucleotide sequence. Refers to a method for enzymatic amplification in vitro. In general, the PCR method includes repeating a cycle for performing primer extension synthesis using a template nucleic acid and two oligonucleotide primers that can be hybridized preferentially. Typically, the primers used in the PCR method may use primers complementary to the nucleotide sequence to be amplified inside the template, for example, complementary to, or both ends of, the nucleotide sequence to be amplified. One adjacent to the nucleotide sequence to be amplified can be preferably used. The primer at the 5 'end is selected so as to contain at least the start codon or to include the start codon, and the primer at the 3' end contains at least the stop codon or the stop codon. It is desirable to choose to be amplified. The primer is preferably an oligonucleotide consisting of 5 or more bases, more preferably 10 or more bases, and more preferably an oligonucleotide consisting of 18 to 25 bases.

The PCR reaction can be carried out by a method known in the art or by a method or modification method substantially the same as that described in R. Saiki, et al., Science, 230: 1350, 1985; R. Saiki, et al., Science, 239: 487, 1988; HA Erlich ed., PCR Technology, Stockton Press, 1989; DM Glover et al. ed., "DM Cloning", 2 nd ed., Vol. 1, The Practical Approach Series, IRL Press, Oxford University Press (1995); MA Innis et al. ed., "PCR Protocols: a guide to methods and applications", Academic Press, New York (1990)); MJ McPherson, P. Quirke and GR Taylor (Ed.), PCR: a practical approach, IRL Press, Oxford (1991); MA Frohman et al., Proc. Natl. Acad. Sci. It can be performed according to the method described in USA, 85, 8998-9002 (1988) or the like or a method modified or modified. In addition, the PCR method can be performed using a commercially available kit suitable for it, and can also be performed in accordance with the protocol discovered by a kit manufacturer or a kit vendor.

PCR reactions typically include, for example, a template (e.g., DM synthesized with mRNA; 1st strand DNA) and a primer designed based on this gene in a 10x reaction buffer (attached to Taq DNA polymerase). , dNTPs (mixture of deoxynucleoside triphosphate dATP, dGTP, dCTP, dTTP), Taq DNA polymerase and deionized distilled water. The mixture is repeated 25 to 60 times under general PCR cycle conditions using an automatic thermal cycler such as, for example, the GeneAmp 240O PCR system, Perkin-Elmer / Cetus, but the number of cycles for amplification is appropriately determined according to the purpose. It can make a suitable collection | recovery. As the PCR cycle conditions, for example, a modified 90 to 95 ° C. 5 to 100 seconds, annealing 40 to 60 ° C. 5 to 150 seconds, an elongation 65 to 75 ° C. 30 to 300 seconds, preferably a modified 94 ° C. 15 seconds, annealing 58 ° C. 15 Although the cycle of elongation 72 degreeC 45 second can be mentioned, the reaction temperature and time of annealing can select an appropriate value suitably by experiment, and it depends on the time of denaturation reaction and elongation reaction, or the chain length of PCR product expected. You can choose the appropriate value. It is preferable to change the reaction temperature of annealing according to the Tm value of hybrid of a primer and template DNA normally. The time for the elongation reaction is generally about 1 minute per 1000 bp chain length, but a shorter time may be selected in some cases.

In this specification, an "oligonucleotide" is a relatively short single- or double-chain polynucleotide, Preferably polydioxynucleotide is mentioned, Angew. Chem. Int. Ed. Engl., Vol. 28, p. 716-734 (1989) to be chemically synthesized by known methods such as the phosphoester ester method, the phosphodiester method, the phosphite method, the phosphoramidite method, the phosphonate method and the like. Can be. It is known that synthesis | combination can be conveniently performed on a modified solid support normally, For example, it can carry out using an automated synthesis apparatus, The apparatus is commercially available. This oligonucleotide may contain one or more modified bases, for example, may contain a base which is not ordinary in nature such as inosine, a tritylated base, or the like. It may contain a base.

To identify predetermined nucleic acids, hybridization techniques can be used. This hybridization can be performed by the method described in the literature that discloses the "genetic recombination technique", or by a method or alteration method substantially the same as that described above. For example, hybridization transfers a sample containing a nucleic acid such as DNA to a carrier including a membrane such as a nylon filter and, if necessary, undergoes a denaturation treatment, an immobilization treatment, a washing treatment, and the like. Is transcribed into a labeled probe DNA fragment, if necessary, in a hybridization buffer solution.

The hybridization treatment is usually performed at about 35 to about 80 ° C, more preferably at about 50 to about 65 ° C, for about 15 minutes to about 36 hours, more suitably about 1 to about 24 hours, appropriately optimal. The condition can be selected. For example, the hybridization treatment takes place at about 55 ° C. for about 18 hours. As a hybridization buffer, it can select from what is normally used in this field, For example, a rapid hybridization buffer (Amersham) etc. can be used. Examples of the modification treatment of the transferred carrier (for example, a membrane) include a method of using an alkaline modification liquid, and after the treatment, treatment with a neutralizing solution or a buffer solution is preferable. As the immobilization treatment of the carrier (e.g. membrane), it is usually about 40 to about 100 ° C, more preferably about 70 to about 90 ° C, about 15 minutes to about 24 hours, more preferably about 1 to about 4 Although baking is carried out by time, preferable conditions can be selected and performed suitably. For example, immobilization is achieved by baking a carrier such as a filter at about 80 ° C. for about 2 hours. As a cleaning treatment of the transferred carrier (e.g., a membrane, etc.), 50 mM Tris-HCl buffer containing 1 M NaCl, 1 Mm EDTA and 0.1% sodium dodecyl sulfate (SDS), It can carry out by washing with pH 8.0 or the like. As a carrier including a membrane such as a nylon filter, it can be selected and used among those commonly used in this field.

As the alkali-modified liquid, the neutralizing liquid, and the buffer, it can be selected and used among those commonly used in this field. Examples of the alkali-modified liquid include liquids containing 0.5 M NaOH and 1.5 M NaCl, and the like. Examples include 1.5 M NaCl-containing 0.5 M Tris-HCl buffer, pH 8.0, and the like, for example, 2xSSPE (0.36 M NaCl, 20 mM NaH ₂ PO ₄ and 2 mM EDTA). have. In addition, prior to the hybridization treatment, in order to prevent the nonspecific hybridization reaction, it is preferable to carry out the preliminary hybridization treatment of the carrier (eg, a membrane, etc.) transferred as necessary. This preliminary hybridization treatment is, for example, preliminary hybridization solution [50% formamide, 5 × Denhardt solution (0.2% bovine serum albumin, 0.2% polyvinyl pyrrolidone), 5 × SSPE, 0.1% SDS, 100 μg / ml thermodenatured salmon sperm DNA] or the like, and reacting at about 35 to about 50 ° C, preferably at about 42 ° C for about 4 to about 24 hours, preferably about 6 to about 8 hours. However, such conditions can be appropriately repeated by those skilled in the art to determine more preferable conditions. The modification of the labeled probe DNA fragment used for hybridization can be performed, for example, by heating at about 70 to about 100 ° C., preferably at about 100 ° C., for about 1 to about 60 minutes, preferably about 5 minutes. On the other hand, the hybridization can be carried out by a method known per se or a method similar thereto, but stringent conditions herein refer to, for example, about 15 to about 50 mM, and preferably about 19 to about sodium concentration. About 40 mM, more preferably about 19 to about 20 mM, and about 35 to about 85 ° C., preferably about 50 to about 70 ° C., and more preferably about 60 to about 65 ° C. with respect to temperature. .

After the hybridization is completed, the carrier such as a filter may be sufficiently washed to remove a labeled probe other than a labeled probe DNA fragment subjected to a specific hybridization reaction, and the detection may be performed. The cleaning treatment of a carrier such as a filter can be carried out by selecting from among those usually used in this field, for example, by washing with a 0.5 x SSC (0.15 M NaCl, 15 mM citric acid) solution containing 0.1% SDS. It can be carried out. Hybridized nucleic acids can typically be detected by autoradiography, but may be appropriately selected from the methods used in this field and used for detection. The nucleic acid band corresponding to the detected signal is suspended in an appropriate buffer such as SM solution (50 mM Tris-HCl buffer containing 100 mM NaCl and 10 mM mgSO ₄ , pH 7.5), and the suspension is then diluted appropriately. Predetermined nucleic acids can be isolated, purified, and further amplified. In the present specification, when referred to as "high homology", depending on the length of the target sequence, for example, 50% or more, even 60% or more, preferably 70% or more, more preferably 80% or more, and specific In this case, 95% or more, particularly preferably 97% or more. This "base sequence of the same effect" may be hybridized to having a sequence in question under severe conditions, for example, 5 or more consecutive base sequences, preferably 10 or more base sequences in its base sequence. And, more preferably, 15 or more base sequences, still more preferably 20 or more base sequences, to encode an amino acid sequence substantially equivalent to the polypeptide. A nucleic acid can also be obtained by chemical synthesis. In that case, fragments may be chemically synthesized and these may be combined by enzymes.

The process of screening a target nucleic acid from a nucleic acid sample including a gene library, a cDNA library, or the like by hybridization processing can be performed repeatedly. Cloned human-derived cDNA libraries, such as various human-derived tissues or cultured cells (especially human kidney, brain, pineal gland, pituitary lobe, nerve cells, retina, retinal vascular cells, retinal nerve cells, thymus, Blood vessels, endothelial cells, vascular smooth muscle cells, blood cells, macrophages, lymphocytes, testes, ovaries, uterus, intestines, heart, liver, pancreas, small intestine, colon, gingival cells, skin-related cells, glomerular cells, tubule cells, Tissues such as connective tissue cells, cells, and various tumor tissues, cancer cells, etc.) cDNA library can be used. As a cDNA library used as a template, a cDNA library derived from various commercially available tissues can also be used directly. For example, a cDNA library commercially available from Stratagene, Invitrogen, Clontech, etc. can be used. As a typical example, gene libraries prepared from human tissues and cells, such as human P1 artificial chromosome genomic libraries (Human Genome Mapping Resource Center), human tissue cDNA libraries (for example, available from Clontech, etc.) can be used. . Human genomic DNA libraries or human-derived cDNA libraries constructed from various human tissues, cultured cells, and the like can be screened using probes. In order to label a probe etc. with a radioisotope etc., it can carry out using a commercially available marking kit, such as a random prime DNA labeling kit (Boehringer Mannheim). For example, using a random-priming kit (Pharmacia LKB, Uppsala) or the like, the probe DNA can be labeled with [? ^-32 P] dCTP (Amersham) or the like to obtain a probe having radioactivity.

Phage particles, recombinant plasmids, recombinant vectors, and the like, which possess a predetermined nucleic acid, can be purified and separated by methods commonly used in the art, for example, glycerol gradient eccentric ultracentrifugation (Molecular Cloning, a laboratory manual). , ed. T. Maniatis, Cold Spring Harbor Laboratory, 2nd ed. 78, 1989), and electrophoresis. From phage particles and the like, DNA can be purified and separated by a method commonly used in this field, for example, the obtained phage and the like are suspended in a TM solution (50 mM Tris-HCl buffer containing 10 mM mgSO ₄ , pH 7.8), and the like. After treatment with DNase I, RNase A, etc., 20 mM EDTA, 50 μg / ml Proteinase K, 0.5% SDS mixture, etc. were added, and the mixture was kept at about 65 ° C. for about 1 hour, followed by phenol extraction diethyl ether. After extraction, DNA was precipitated by ethanol precipitation, and the obtained DNA was then washed with 70% ethanol and dried to dissolve in TE solution (10 mM Tris-HCl buffer containing 10 mM EDTA, pH 8.0). Lose. In addition, the target DNA can be obtained in large quantities by subcloning or the like. For example, subcloning can be performed using a plasmid vector or the like using E. coli as a host. The DNA obtained by such subcloning can also be purified and separated in the same manner as described above by centrifugation, phenol extraction, ethanol precipitation or the like.

In the present specification, nucleic acids (including DNA) such as PCR products obtained are usually subjected to 1-2% agarose gel electrophoresis and cut out from the gel as specific bands, for example, gene clean kit (Bio 101) and the like. Extraction is performed using a commercially available extraction kit. The extracted DNA is cleaved with a suitable restriction enzyme, purified as needed, or further phosphorylated 5 'terminus by T4 polynucleotide kinase or the like, if necessary, and then lysed with a suitable plasmid vector such as a pUC vector such as pUC18. Gated to transform the appropriate competent cells. The cloned PCR product can interpret its base sequence. Cloning of PCR products includes commercially available plasmid vectors such as p-Direct (Clontech), pCR-Scrip ^™ SK (+) (Stratagene), pGEM-T (Promega), pAmpTM (Gibco-BRL). It is available. For transformation of host cells, for example, phage vectors are used, or calcium, rubidium / calcium, calcium / manganese, TFB high efficiency, FSB freeze-reactive cell, rapid colony, electroporation, etc. It can be carried out in a known manner or in substantially the same manner as that (D. Hanahan, J. Mol. Biol., 166: 557, 1983, etc.). To isolate the target DNA, polymerase chain reaction coupled reverse transcription (RT-PCR) and rapid amplification of cDNA ends (RACE) can be applied. RACE is described, for example, in MA Innis et al. ed., "PCR Protocols" (MA Frohman, "a guide to methods and applications"), pp. 28-38, Academic Press, New York (1990) and the like can be carried out according to the method.

DNA can be cloned as needed, for example, a plasmid, (lambda) phage, cosmid, P1 phage, F factor, YAC, etc. can be used. Preferably, a vector derived from lambda phage may be mentioned, and for example, Charon 4A, Charon 21A, lambdagt10, lambdagt11, lambda DASHII, lambda FIXII, lambda EMBL3, lambda ZAPIITM (Stratagene) and the like can be used. In addition, the obtained DNA is inserted into a suitable vector as described in detail below, for example, a vector such as plasmids pEX, pMAMneo, pKG5, and the like, and a suitable host cell as described in detail below, such as E. coli, yeast and CHO cells. , COS cells and the like. In addition, this DNA fragment can be inserted as it is, or as a DNA fragment to which an appropriate control sequence has been added, or inserted into an appropriate vector, and introduced into an animal to produce a transgenic animal expressing a predetermined gene. Animals include mammals, and examples thereof include mice, rats, rabbits, malmots, and cattle. Preferably, the transgenic animal can be prepared by introducing the DNA fragment into fertilized eggs of animals such as mice. Confirmation of a predetermined gene product can be performed using animal cells suitable for it, such as 293T cells and COS-1 cells which transfected the foreign gene.

As a method for introducing a foreign gene into an animal cell such as a mammal, a method known in the art or substantially the same as the method can be performed. For example, the calcium phosphate method (for example, FL Graham et al., Virology, 52: 456, 1973 et al.), DEAE-dextran method (e.g. D. Warden et al., J. Gen. Virol., 3: 371, 1968, etc.), electroporation method (e.g. E. Neumann et al., EMBO J) , 1: 841, 1982), microejection method, ribosomal method, virus infection method, phage particle method and the like. In this way, the gene product produced by the animal cell transfected with the given gene may interpret it.

As a plasmid into which a predetermined gene or the like (such as DNA obtained in the present invention) is inserted, eukaryotic cells such as prokaryotic host cells (e.g., E. coli, Bacillus subtilis), yeast, 293T cells, CHO cells, COS cells, etc. Any plasmid may be used as long as the DNA can be expressed in a host or an insect cell host such as Sf21). Of course, it can also be selected and used from the kit attached to a commercially available kit or reagent. Such sequences may include, for example, codons modified to be suitable for expression in a selected host cell, restriction enzyme sites may be provided, and expression control sequences, controls to facilitate expression of the gene of interest. Sequences such as linkers and adapters that help to bind genes of interest, such as sequences, antibiotic resistance, or metabolism control, or sequences useful for screening (hybrid or fusion proteins may also be encoded). And the like). Preferably, in a suitable promoter such as E. coli plasmid, tryptophan promoter (trp), lactose promoter (lac), tryptophan lactose promoter (tac), lipoprotein promoter (lpp), lambda phage P _L promoter and the like In the plasmid containing the animal cells as a host, the GAL1, GAL1O promoter and the like can be used in the plasmid containing the SV4O rate promoter, the MMTV LTR promoter, the RSV LTR promoter, the CMV promoter, the SRα promoter, and the like. It is also possible to use control systems such as CYC1, HIS3, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, EN0, TP1, AOX1 and the like.

An enhancer can be inserted into the vector to promote the transcription of the DNA encoding the desired polypeptide, and such enhancer usually has a cis action of about 10 to 100 bp, which acts on a promoter to promote transcription. The thing of the element which has is mentioned. Many enhancers are known from mammalian genes, such as globin, erastase, albumin, α-fetoprotein, insulin. Typically, an enhancer obtained from a eukaryotic cell infectious virus can be suitably used, for example, an SV40 enhancer (100-270 bp) in the rate region of a replication origin, an enhancer of an early promoter of cytomegalovirus, and a replication origin of polyoma. Examples thereof include an enhancer in the rate region of the adenovirus, an enhancer of an adenovirus, and the like. In addition, a signal sequence suitable for a host may be added as needed, and these may be those well known to those skilled in the art.

Examples of plasmids having E. coli as a host include pBR322, pUC18, pUC19, pUC118, pUC119, pSP64, pSP65, pTZ-18R / -18U, pTZ-19R / -19U, pGEM-3, pGEM-4, pGEM-3Z, pGEM -4Z, pGEM-5Zf - there may be mentioned, pBluescript KS ^TM (Stratagene Inc.), such as (). Examples of plasmid vectors suitable for expression in E. coli include pAS, pKK223 (Pharmacia), pMC1403, pMC931, pKC30, and pRSET-B (Invitrogen). Examples of plasmids having animal cells as hosts include SV40 vectors, polyoma virus vectors, vaccinia viruses, retroviral vectors, and the like. Specifically, pcD, pcD-SRα, CDM8, pCEV4, pME18S, pBC12BI, pSG5 (Stratagene) etc. are mentioned. Examples of the plasmid containing the yeast host include YIp-type vectors, YEp-type vectors, YRp-type vectors, and YCp-type vectors. Examples thereof include pGPD-2. Examples of the host cell include those derived from E. coli K12 strains when the host cell is Escherichia coli, for example, NM533, XL1-Blue, C600, DH1, DH5, DH11S, DH12S, DH5α, DH10B, HB101, MC1061, JM109, Examples of STBL2 and B834 strains include BL21 (DE3) pLysS. As expression systems in bacteria, for example, Chang et al., Nature (1978) 275: 615; Goeddel et al., Nature (1979) 281: 544; Goeddel et al., Nucleic Acid Res., (1980) 8: 4057; EP 36,776, US Pat. No. 4,551,433; deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80: 21-25; See Siebenlist et al., Cell (1980) 20: 269 and the like. When the host cell is a yeast, for example, Saccharomyces cerevisiae, Schizosaccharomyces prombe, Pichia pastoris, Kluyveromyces strain, Candida, Trichoderma reesia, and other yeast strains. As expression systems in yeast, for example, Hinnen et al., Proc. Natl. Acad. Sci. USA (1978) 75: 1929; Ito et al., J. Bacteriol. (1983) 153: 163; Kurtz et al., Mol. Cell. Biol. (1986) 6: 142; Kunze et al., J. Basic Micro Biol. (1985) 25: 141; Gleeson et al., J. Gen. Micro Biol. (1986) 132: 3459; Roggenkamp et al., Mol. Gen. Genet (1986) 202: 302; Das et al., J. Bacteriol. (1984) 158: 1165; De Louvencourt et al., J. Bacteriol. (1983) 154: 737; Van den Berg et al., Bio / Technology (1990) 8: 135; Kunze et al., J. Basic Micr Biol. (1985) 25: 141; Cregg et al., Mol. Cell. Biol. (1985) 5: 3376; US Pat. No. 4,837,148, US Pat. No. 4,929,555; Beach and Nurse, Nature (1981) 300: 706; Davidow et al., Curr. Genet. (1985) 10: 380; Gaillardin et al., Curr. Genet. (1985) 10: 49; Balance et al., Biochem. Biophys. Res. Commun. (1983) 112: 284-289; Tilburn et al., Gene (1983) 26: 205-221; Yalton et al., Proc. Natl. Acad. Sci. USA (1984) 81: 1470-1474; Kelly and Hynes, EMBO J., (1985) 4: 475479; EP 244,234; Reference may be made to WO 91/00357 and the like.

When the host cell is an animal cell, for example, COS-7 cells derived from African Midorisal fibroblasts, COS-1 cells, CV-1 cells, 293 cells derived from human kidney cells, A431 cells derived from human epidermal cells, 205 derived from human colon Cells, COP cells derived from mouse fibroblasts, MOP cells, WOP cells, CHO cells derived from Chinese hamster cells, CHO DHFR ^- cells, human HeLa cells, mouse cells-derived C127 cells, mouse cells-derived NIH 3T3 cells, mouse L cells And 9BHK, HL60, U937, HaK, Jurkat cells, other transformed cell lines, normal diploid cells, cell lines derived from in vitro primary cultured tissues, and the like. Mammalian expression is described, for example, in Dijkema et al., EMBO J. (1985) 4: 761; Gorman et al., Proc. Natl. Acad. Sci. USA (1982b) 79: 6777; Boshart et al., Cell (1985) 41: 521; US Patent No. 4,399,216; Ham and Wallace, Methods in Enzymology (1979) 58: 44; Barnes and Sato, Anal. Biochem. (1980) 102: 255; US Patent No. 4,767,704; 4,657,866; US Patent No. 4,927,762; US Pat. No. 4,560,655; WO 90/103430; WO 87/00195; Reference may be made to those disclosed in US Patent No. RE30,985 and the like. As insect cells, Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melangaster fruitfly, silkworm larvae or silkworm cultured cells such as BM-N cells and the like (see, eg, Luckow et al., Bio / Technology, 6, 47-55 (1988); Setlow, JK et al. (eds.), Genetic Engineering, Vol. 8, pp. 277-279, Plenum Publishing, 1986; Maeda et al., Nature, 315, pp. 592-594 (1985)). Expression of heterologous genes in insects is described, for example, in US Pat. No. 4,745,051; Friesen et al. (1986), "The Regulation of Baculovirus Gene Expression", The Molecular Biology of Baculoviruses (W. Doerfler (Ed)); EP 127,839; EP 155,476; Vlak et al., J. Gen. Virol., (1988) 69: 765-776; Miller et al., Ann. Rev. Micro Biol. (1988) 42: 177; Carbonell et al., Gene (1988) 73: 409; Maeda et al., Nature, (1985) 315: 592-594; Lebacq-Verheyden et al., Mol. Cell. Biol. (1988) 8: 3129; Smith et al., Proc. Natl. Acad. Sci. USA, (1985) 82: 8404; Miyajima et al., Gene (1987) 58: 273; See Martin et al., DNA (1988) 7: 99 et al. In addition, for a number of baculovirus strains and corresponding acceptable insect host cells from modified and host, see, eg, Luckow et al., Bio / Technology (1988) 6: 47-55; Miller et al., Generic Engeneering (Serlow, JK et al. (Ed)) Vol. 8 (Plenum Pub1ishing, 1986) pp. 277-279; See Maeda et al., Nature (1985) 315: 592-594 and the like.

It is also possible to use plant cells as host cells using Agrobacterium tumefaciens and the like, together with suitable vectors for them, these are well known in the art. In the genetic engineering technique of the present invention, a DNA modification / degrading enzyme, DNA polymer which is an enzyme for modifying or converting a restriction enzyme, reverse transcriptase, or DNA fragment known or widely used in the art into a structure suitable for cloning. Lases, terminal nucleotidyl transferases, DNA ligase and the like can be used. Restriction enzymes include, for example, R. J. Roberts, Nucleic Acids Res., 13: r165, 1985; S. Linn et al. ed. Nucleases, p. 109, Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982; R. J. Roberts, D. Macelis, Nucleic Acids Res., 19: Suppl. 2077, 1991, etc. are mentioned.

According to the present invention, a transformant transformed with an expression vector containing a nucleic acid encoding a polypeptide (or protein) is stably possessed high expression capacity by repeat cloning using an appropriate selection marker as necessary. Cell lines can be obtained. For example, in a transformant using an animal cell as a host cell, when the dhfr gene is used as a selection marker, the DNA encoding the polypeptide of the present invention is amplified by gradually increasing the MTX concentration and selecting a resistant strain, Cell lines capable of obtaining higher expression can be obtained. The transformant of the present invention can be cultured under conditions in which the nucleic acid encoding the polypeptide of the present invention can be expressed to produce and accumulate a target product. This transformant can be cultured in a medium widely used in this field. For example, a transformant having a prokaryotic cell host such as Escherichia coli, Bacillus subtilis, yeast, or the like as a host can use a liquid medium suitably. The medium contains a carbon source, a nitrogen source, an inorganic substance, and the like necessary for the growth of the transformant. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc., as a nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, malt extract, soybean meal, potato extract, etc. Or as an organic substance and an inorganic substance, calcium chloride, sodium dihydrogen phosphate, magnesium chloride, calcium carbonate etc. are mentioned, for example. In addition, yeast, vitamins, casamino acids, growth promoting factors and the like may be added. Moreover, in order to make a promoter work efficiently as needed, a chemical | medical agent, such as 3 (beta) -indolyl acrylic acid, can be added, for example. The pH of the medium is preferably about 5 to about 8.

Incubation is usually carried out at about 15 to about 45 ° C. for about 3 to about 75 hours in Escherichia coli, for example, and it is also possible to add aeration or agitation as necessary. When culturing a transformant whose host is an animal cell, for example, MEM medium, PRMI1640 medium, DMEM medium and the like containing about 5 to about 20% fetal calf serum are used. The pH is preferably about 6 to about 8. The culture is usually carried out at about 30 to about 40 ° C for about 15 to about 72 hours, and aeration or agitation is added as necessary. A transformant expressing a predetermined gene product can be used as it is, but can also be used as the cell homogenate, but it is also possible to isolate and use a predetermined gene product. In extracting from the cultured cells, after culturing, the cells or cells are collected by a known method, suspended in a suitable buffer, and disrupted the cells or cells by ultrasonication, rising and / or lyolysis, and then centrifugation or the like. The method of obtaining a crude extract by filtration, etc. can be used suitably. In the buffer, protein denaturants such as urea and guanidine hydrochloride, and surfactants such as Triton X-100 (trade name) and Tween 20 (trade name) may be added. When the desired product is secreted in the culture solution, after completion of the culture, the cells or cells and the supernatant are separated by a method known per se, and the supernatant is collected.

The desired product contained in the culture supernatant or extract obtained in this way can be purified by appropriately combining the known separation and purification methods, for example, gel filtration by salting out such as ammonium sulfate precipitation method, Sephadex, etc. Ion exchange chromatography using a carrier having a diethylaminoethyl group or a carboxymethyl group or the like, for example, a hydrophobic chromatography method using a carrier having a hydrophobic group such as a butyl group, an octyl group or a phenyl group, a dye gel chromatography method, an electrophoresis method, It can obtain by purifying by a dialysis, an ultrafiltration method, an affinity chromatography method, a high performance liquid chromatography method, etc. Preferably, polyacrylamide gel electrophoresis, affinity chromatography on which a ligand, etc. are immobilized, etc. can be processed and purified and separated. As this ligand, the antibody containing the monoclonal antibody which carries out specific recognition, its fragment, lectin, sugar, one of a binding pair, etc. are mentioned. For example, immuno affinity chromatography, gelatin agarose affinity chromatography, heparin agarose chromatography, and the like can be given.

In addition, the obtained polypeptide (or protein) of the present invention may modify the amino acid residues contained therein by chemical techniques, and may be used by enzymes such as peptidase such as pepsin, chymotrypsin, papain, bromelain, endopeptidase, exopeptidase, and the like. It can be used as a modification or partial decomposition thereof to form a derivative thereof. Polypeptide of the present invention, C-terminal is normally carboxyl group (-COOH) or carboxylate (-COO ^-), but, C-terminal may be an amide (-CONH ₂₎ or ester (-COOR). Here, as R in the ester, for example, C _1-6 alkyl groups such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, C _3-8 cycloalkyl groups such as cyclopentyl, cyclohexyl, such as phenyl , C _6-12 aryl groups such as α-naphthyl, for example, phenyl-C _1-2 alkyl groups such as benzyl and phenethyl or α-naphthyl-C _1-2 alkyl groups such as α-naphthylmethyl _In addition to the _7-14 aralkyl group, a pivaloyloxymethyl group or the like which is commonly used as an oral ester is used. When the protein of the present invention has a carboxyl group (or carboxylate) in addition to the C terminus, the polypeptide of the present invention also includes amidated or esterified carboxyl group. As ester in this case, the above-mentioned ester of C terminal etc. are used, for example.

In the polypeptide (or protein) of the present invention, the amino group of the N-terminal methionine residue in the polypeptide described above is a C _1-6 sub such as a C _1-5 alkyl-carbonyl group such as formyl group or acetyl. Protected with a practical group), a N-terminal side cleaved in vivo to form a glutamyl group pyroglutamyl, a substituent on the side chain of an amino acid in the molecule (e.g., -OH, -COOH, amino group, imida) A sol, indole, guanidino group, etc.) is protected by a suitable protecting group (e.g., C _1-6 acyl groups such as formyl group, acetyl group, etc.), or complex proteins such as sugar proteins to which sugar chains are bound. Included.

In addition, by using a method that is genetically compatible based on the nucleotide sequence of the gene according to the present invention, substitution, deletion, insertion, transfer or addition of one or more amino acids in the amino acid sequence of a given polypeptide as appropriate. Corresponding polypeptides incorporating such mutations can be prepared. As such a variation, a transformation, and a formula, For example, Japanese Biochemistry Sculpture, Genus Biochemistry Experiment Lecture 1, Gene Research Method II, p105 (Hirossushimu), Tokyo Chemical Driver (1986); Japanese Biochemistry Sculpture, "New Biochemistry Experiment Lecture 2, Nucleic Acid III (Recombinant DNA Technology)", p233 (Hirossushimu), Tokyo Chemical Drivers (1992); R. Wu, L. Grossman, ed., "Methods in Enzymology", Vol. 154, p. 350 & p. 367, Academic Press, New York (1987); R. Wu, L. Grossman, ed., "Methods in Enzymology", Vol. 100, p. 457 & p. 468, Academic Press, New York (1983); J. A. Wells et al., Gene, 34: 315, 1985; T. Grundstroem et al., Nucleic Acids Res., 13: 3305, 1985; J. Taylor et al., Nucleic Acids Res., 13: 8765, 1985; R. Wu ed., "Methods in Enzymology", Vol. 155, p. 568, Academic Press, New York (1987); A. R. Oliphant et al., Gene, 44: 177, 1986 and the like. Site-directed mutagenesis (eg, site-specific mutagenesis) using synthetic oligonucleotides (Zoller et al., Nucl. Acids Res., 10: 6487, 1987; Carter et al., Nucl. Acids Res., 13: 4331) , 1986), cassette mutagenesis: Wells et al., Gene, 34: 315, 1985, restriction selection mutagenesis: Wells et al., Philos. Trans.R. Soc. London Ser A, 317: 415, 1986), alanine scanning method (Cunningham & Wells, Science, 244: 1081-1085, 1989), PCR mutation introduction method, Kunkel method, dNTP [αS] method (Eckstein), sulfurous acid, nitrous acid, etc. Methods, such as the area | region specification variation introduction method to be used, are mentioned.

In addition, the gene may be expressed as a fusion polypeptide (fusion protein) when produced by a genetic recombination method, and may be transformed and processed to have a biological activity substantially the same as that of the desired polypeptide in vivo or ex vivo. Although fusion production methods commonly used for genetic engineering can be used, such fusion polypeptides can also be purified by affinity chromatography or the like using the fusion units. Such fusion polypeptides are those fused to histidine tags or β-galactosidase (β-gal), maltose binding protein (MBP), glutathione-S-transferase (GST), thioredoxin (TRX) Or fused to an amino acid sequence of Cre Recombinase. Similarly, a polypeptide can add a tag of heterogeneous epitopes, and can also be purified by immuno affinity chromatography using an antibody that specifically binds to the epitope. In a more preferred embodiment, the poly-His or poly-His-Gly tag, and also the epitope tag, for example, AU5, c-Myc, CruzTag 09, CruzTag 22, CruzTag 41, Glu-Glu, HA, Ha.11, KT3, FLAG (registered trademark, Sigma-Aldrich), Omni-probe, S-probe, T7, Lex A, V5, VP16, GAL4, VSV-G, etc. (Field et al., Molecular and Cellular Biology, 8: pp. 2159-2165 (1988); Evan et al., Molecular and Cellular Biology, 5: pp. 3610-3616 (1985); Paborsky et al., Protein Engineering, 3 (6): pp. 547-553 (1990); Hopp et al., BioTechnology, 6: pp. 1204-1210 (1988); Martin et al., Science, 255: pp.192-194 (1992) Skinner et al., J. Biol. Chem., 266: pp. 15163-15166 (1991); Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87: pp. 6393-6397 ( 1990). Two-hybrid method using yeast can also be used.

Moreover, as a fusion polypeptide, the marker used as a detectable protein can also be attached. In a more suitable embodiment, the detectable marker may be a biotin avitag of biotin / streptoavidine, a fluorescing substance, or the like. Examples of the fluorescing substance include green fluorescent protein (GFP) derived from a luminescent jellyfish such as Aequorea victorea, and a GFP variant such as EGFP (Enhanced-humanized GFP). , red-shift GFP (rsGFP), yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), blue fluorescent protein: BFP), GFP from Renilla reniformis, etc. (Atsu Miyawaki, an experimental medical book, 3-GFP, Bioimaging and Yodosha (2000)). It is also possible to detect using an antibody (including monoclonal antibodies and fragments thereof) that specifically recognize the fusion tag. Expression and purification of such fusion polypeptides can be carried out using a commercially available kit suitable for the fusion polypeptide, and can also be carried out according to a protocol known by the kit manufacturer or the kit vendor.

The obtained protein (which may contain a peptide or polypeptide) can be solidified by combining it with a suitable carrier or solid phase by a known method such as enzyme immunoassay. Solidified proteins and solidified peptides can be conveniently used for binding assays and screening of materials.

 For example, modifications and modifications of the structure of polypeptides and proteins are described in reference to Japanese Biochemistry Sculpture, "New Biochemistry Experiment Course 1, Protein VII, Protein Engineering", Tokyo Chemical Drivers (1993), or cited therein. The method described in the above-described literature, and furthermore, can be carried out in substantially the same manner as these. As described below, the biological activity may include immunologically active, for example, antigenicity. During this modification / modification, acylation, esterification, amidation, ring opening, ring closure, glycosylation, containing sugar chains such as deamination, hydroxylation, carboxylation, phosphorylation, alkylation such as sulfation, methylation, and acetylation It is possible to change the type of to another, to increase or decrease the number of sugar chains, lipid binding, substitution with D-form amino acid residues. These methods are known in the art (eg, T. E. Creighton, Proteins: Structure and Molecular Properties, pp. 79-86 W. H. Freeman & Co., San Francisco, USA (1983), etc.).

By using the gamutine 9 modified product of the present invention, the functions such as predetermined biological activity of the galectin 9 (e.g., cytotoxic activity, apoptosis inducing activity, glucocolticoid-flexible activity, and malignant cell metastasis) Compounds (acting agents), inhibitors (antagonists) or salts thereof that promote the inhibitory activity, etc.) can be screened. This also means providing the screening reagent. Thus, the activity exhibited by polypeptides such as the galectin 9 protein, a part of the peptides thereof or salts thereof, as described in the present invention is used. Regarding various substances, compounds (activators) or compounds (antagonists) which promote certain functions, such as biological activities exhibited by the galectin 9 protein, peptides thereof or salts thereof of the present invention, or the like, or Methods of screening their salts are also provided.

In this screening, for example, when (i) a galectin 9-mutant protein, a part of a peptide thereof or a salt thereof (which may include a transformant expressing this protein, the same applies below) is contacted with a suitable test sample, (ii) A comparison is made when a test sample in question does not exist in the protein of the present invention, a peptide thereof or a salt thereof. Specifically, in the screening, the biological activity (for example, activity related to the interaction between each galectin 9 protein and a biological component, etc.) is measured and compared.

In this screening system, a suitable detection substrate may be present to facilitate the measurement. As this substrate, any one can be used effectively for measurement. For example, it can select and use from what is known as a well-known substrate, Preferably, the synthesize | combined compound etc. can be used. The substrate can be used as it is, but preferably labeled with fluorescence, enzymes or radioactive materials such as fluorescein.

Examples of test samples include proteins, peptides, non-peptidic compounds, synthetic compounds, fermented products, plant extracts, tissue extracts such as animals, and cell extracts. Examples of test compounds used in test samples may preferably include anti-gallectin antibodies, enzyme inhibitors, cytokines, compounds having various inhibitory activities, in particular synthetic compounds. These compounds may be novel compounds or known compounds. This screening can be carried out in accordance with a conventional method for measuring binding activity or enzyme activity, and can be carried out with reference to methods known in the art, for example. Moreover, it can carry out according to the operation etc. which were used here, using various markings, buffer systems, other suitable reagents, etc. The used peptide may be treated with an activator, or the precursor or latent type may be converted into an active type in advance. The measurement can usually be performed at a pH of about 4 to about 10 (preferably pH of about 6 to about 8), for example, in a buffer which does not adversely affect the reaction of Tris-HCl buffer, phosphate buffer and the like. In these individual screenings, common technical considerations of those skilled in the art are applied to the usual conditions and manipulations in the respective methods, to the galectin 9 protein of the present invention or a polypeptide or peptide having an activity substantially equivalent thereto. You can build a related measurement system. For details of these general technical means, reference can be made to the general text, the Bible, and the like (for example, Methods in Enzymology, issued by Academic Press, USA). For apoptosis-inducing activity assay, etc., please refer to Danichi Seichi, `` Cellification Engineering Book: Experimental Protocol Series, Apoptosis Experimental Protocol, '' Shushun, Inc., January 20, 1995 (first edition second edition) and the like. And commercially available measurement kits can be used.

Compounds or salts thereof obtained using the screening method or screening kit of the present invention may be prepared by the above-described test compounds, such as peptides, proteins, nonpeptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, and animal tissue extracts. It is a compound chosen from these etc., and is a compound which accelerates | stimulates or inhibits functions, such as the protein of this invention. As a salt of this compound, a pharmaceutically acceptable salt etc. are mentioned, for example. Examples thereof include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. Suitable examples of salts with inorganic bases include alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as calcium salts and magnesium salts, and aluminum salts and ammonium salts. Suitable examples of salts with organic bases are, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N And salts with '-dibenzylethylenediamine and the like. Suitable examples of salts with inorganic acids include, for example, salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and the like. Suitable examples of salts with organic acids include, for example, salts with formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid and the like. Suitable examples of salts with basic amino acids include, for example, salts with arginine, lysine, ornithine and the like, and suitable examples of salts with acidic amino acids include, for example, salts with aspartic acid, glutamic acid and the like.

An active ingredient of the present invention, such as (a) the galectin 9 modified polypeptide, a portion of a peptide or a salt thereof, a peptide associated therewith, and the like (b) a DNA encoding the gamutine 9 modified or related polypeptide thereof (C) a compound that controls the activity of the galectin 9 protein (the cytotoxic activity, the apoptosis-inducing activity of the galectin 9 protein, and to perform a predetermined effect without adversely affecting normal cells) Phenomena such as promoting or inhibiting or inhibiting activity or the like or compounds that promote or inhibit and / or inhibit biological activity such as alteration, overproduction or degradation of tissues or proteins) or salts thereof; A compound to be controlled or a salt thereof, (d) an active substance found using the present invention, or the like] is usually alone or pharmacologically acceptable. It can be mixed with various formulation adjuvant and can be administered as a pharmaceutical composition or a pharmaceutical preparation. Preferably, it is administered in the form of a preparation formulation suitable for use such as oral administration, topical administration, or parenteral administration, and may be in any dosage form (including inhalation or rectal administration) depending on the purpose.

The active ingredient of the present invention may also be used in combination with various medicines, such as antitumor agents (anticancer agents), tumor metastasis inhibitors, thrombus formation inhibitors, joint destruction treatments, analgesics, anti-inflammatory agents, immunomodulators and / or immunosuppressants, These may be used without limitation as long as they have an advantageous function, and for example, may be selected from those known in the art.

And parenteral dosage forms may include topical, transdermal, intravenous, intramuscular, subcutaneous, intradermal or intraperitoneal administration, although direct administration to affected areas is also possible and suitable in some cases. Preferably orally or parenterally (e.g., intracellular, intramuscular, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, intrathoracic, intrathecal, drip, assertive) to mammals, including humans. Viii), the intestinal tract and the moles can be administered by eye drops, nasal drops, teeth, application to the skin or mucous membranes, and the like. Specific forms of preparations include solution preparations, dispersion preparations, semisolid preparations, granular preparations, molding preparations, leaching preparations, and the like. For example, tablets, coated tablets, dragged preparations, pills, troches, and light preparations. Capsules, soft capsules, microcapsules, landfills, powders, powders, granules, fines, injections, solutions, elixirs, emulsions, irrigation, syrups, homemade, emulsions, suspensions, linings, Lotions, aerosols, sprays, inhalants, sprays, ointments, warning preparations, additives, pastes, poultices, creams, oils, suppositories (e.g. rectal suppositories), tinctures, skin preparations, eye drops, drops Powders, freeze-dried preparations, gel preparations, etc. for nasal drops, ear drops, coating agents, infusions, injectable solutions and the like.

The composition for medical use can be formulated according to a conventional method. For example, as appropriate, a physiologically acceptable carrier, a pharmaceutically acceptable carrier, an adjuvant, an excipient, an excipient, a diluent, a flavor, a flavor, a sweetener, a vehicle, a preservative, a stabilizer, a binder, a pH adjuster, Buffers, surfactants, bases, solvents, fillers, extenders, solubilizers, solubilizers, isotonic agents, emulsifiers, suspending agents, dispersants, thickeners, gelling agents, curing agents, absorbents, pressure sensitive adhesives, elastomers, plasticizers, disintegrants, propellants A unit required for the implementation of a generally identified formulation by using a preservative, an antioxidant, a light-shielding agent, a humectant, an emollient, an antistatic agent, a non-fatting agent, or the like alone or in combination with the protein of the present invention. It may be prepared in a dosage form.

Suitable formulations for parenteral use include, for example, sterile solutions or suspensions of the active ingredient with water or other pharmaceutically acceptable media, for example injections and the like. Generally, glycols such as water, saline solution, dextrose aqueous solution, other related sugar solutions, ethanol, propylene glycol, polyethylene glycol and the like can be cited as preferred liquid carriers for injection. When preparing injectables, injectable forms such as solutions, suspensions, emulsions, and the like are known in the art using distilled water, Ringer's solution, carriers such as physiological saline, suitable dispersing or wetting agents and suspending agents, and the like. To prepare.

Aqueous solutions for injection include, for example, physiological saline, isotonic solutions containing glucose and other auxiliary agents (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable pharmacologically acceptable dissolution aids; For example, alcohol (such as ethanol), polyalcohol (such as propylene glycol, polyethylene glycol, and the like), nonionic surfactant (such as polysorbate 80 ^™ , HCO-50, etc.) may be used in combination. Sesame oil, soybean oil, etc. are mentioned as an oil-based liquid, You may use together with benzyl benzoate, benzyl alcohol, etc. as a dissolution adjuvant. In addition, buffers (e.g., phosphate buffers, sodium acetate buffers, etc.) or reagents for adjusting the penetration pressure, analgesic agents (e.g. benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g. human serum albumin, polyethylene glycol, etc.), preservatives (Eg, benzyl alcohol, phenol, etc.), antioxidants such as ascorbic acid, absorption accelerators, and the like. The prepared injection solution is usually filled in a suitable ampoule.

Parenteral administration is formulated in the form of a solution or suspension in a sterile pharmaceutically acceptable liquid, such as water, ethanol or oil, with or without surfactant and other pharmaceutically acceptable preparations. As the oily vehicle or solvent used in the preparation, natural or synthetic or semisynthetic mono or di or triglycerides, natural or semisynthetic or synthetic oils or fatty acids, and the like, for example, peanuts oil, corn oil, soybean oil, sesame oil, etc. Vegetable oils. For example, the injection may be prepared to generally contain about 0.1 to 10% by weight of the compound of the present invention.

Suitable formulations for topical use such as oral or rectal use include mouthwashes, dentifrices, mouth sprays, inhalants, ointments, dental fillers, dental coatings, dental pastes, suppositories, and the like. As mouthwashes and other dental agents, they are prepared by a conventional method using a pharmaceutically acceptable carrier. As an oral nebulizer and an inhalant, the compound of the present invention or the pharmacologically acceptable inert carrier can be dissolved in a solution for aerosol or nebulizer, or can be administered to a tooth or the like as a fine powder for inhalation. Ointment is prepared by a conventional method by adding a base commonly used, for example, ointment base (white petrolatum, paraffin, olive oil, macrogol 400, macrogol ointment, etc.).

The chemical | medical agent for topical application to a tooth and skin can be prepared with the solution or suspension of the water or nonaqueous excipient | suitably sterilized suitably. As the additive, for example, a buffer such as sodium hydrogen sulfite or disodium edite; Examples of the acetic acid or phenyl nitrate include preservatives containing bactericidal and antifungal agents such as benzalkonium chloride or chlorohexidine and thickeners such as hypromellose.

Suppositories are carriers well known in the art, preferably non-irritating suitable prostheses such as polyethylene glycols, lanolin, cacao oil, fatty acid triglycerides, preferably solid at room temperature but liquid at the intestinal temperature and rectal It melt | dissolves in an inside and releases a drug, etc., It is prepared by the conventional method, Usually, it is prepared to contain about 0.1-95 weight% of compounds of this invention. Depending on the excipient and concentration used, the drug may be suspended or dissolved in the excipient. Adjuvants such as local anesthetics, preservatives and buffers are soluble in excipients. Suitable formulations for oral use include solid compositions such as tablets, pills, capsules, powders, granules and troches, and liquid compositions such as liquids, syrups and suspensions. When preparing a preparation, preparation aids or the like known in the art are used. Tablets and pills may also be prepared by further enteric coating. If the dosage unit form is a capsule, it may contain a liquid carrier such as oil or fat in addition to the above type of material.

In addition, when the active ingredient is a protein or a polypeptide, polyethylene glycol (PEG) is very low in mammals, and therefore it is particularly useful to bind it. In addition, binding of PEG can sometimes effectively reduce the immunogenicity and antigenicity of heterologous compounds. The compound may be added to a microcapsule device. Polymers such as PEG include the α-amino group of amino-terminal amino acids, the ε-amino group of lysine side chains, the carboxyl group of aspartic acid or glutamic acid side chains, the α-carboxyl group of the carboxy-terminal amino acids or glyco attached to certain kinds of aspartic acid, serine or threonine residues. To activated derivatives of the full chain, they can simply be attached.

Many activated forms of PEG are known that are suitable for direct reaction with proteins. As PEG reagents useful for reacting amino groups of proteins, active esters of carboxylic acids, carbonate derivatives, in particular leaving groups, are N-hydroxysuccinimides, p-nitrophenols, imidazoles, or 1-hydroxy The thing of 2-nitrobenzene- 4-sulfonate is mentioned. Similarly, PEG reagents containing aminohydrazine or hydrazide groups are useful for reaction with aldehydes produced by oxidation of perureates in proteins.

Diagnosis and treatment of the present invention is carried out by diagnosing the mammal so as to be appropriate for a tumor, an allergic disease, inflammation, etc., including a malignant tumor such as a disease, a disease, or cancer, such as a specific autoimmune that may be indicated by the mammal. Is disclosed. Diagnosis may also continue during treatment as a treatment procedure to monitor the progress of the treatment, and to determine whether to change parameters such as, for example, the dosage or frequency of administration being made. As a diagnostic method that can help determine the adequacy of administration of the galectin 9 modified drug, the analysis of the expression level of galectin 9 in mammals, and the autoimmunity of cells such as lymphocytes away from the autoimmune site And a comparison of these levels with cells such as lymphocytes adjacent to the site. Tumors including allergic diseases, inflammation, etc., including malignant tumors such as cancer, diseases, diseases such as autoimmune diseases, etc. of mammals to be treated can be monitored by detecting intracellular intracellular galectin 9 antigen. This monitoring may include contacting a sample derived from a mammal with a galectin 9 specific antibody and detecting binding of the antibody to the sample.

A gene therapy vehicle is a construct containing a code sequence (eg, a galectin 9 variant code sequence) that is a therapeutic agent of the invention that must be delivered to a mammal for expression in a mammal. ), Or to deliver the construct comprising a nucleic acid sequence that is all or part of the galectin 9 variant and also for delivery, which can be administered either locally or systemically. It is. These constructs can be used in an in vivo or ex vivo form, either with a viral vector or with a nonviral vector approach. In order to express such a code sequence, it can carry out by using an endogenous mammalian promoter or a heterologous promoter. Expression of a code sequence in vivo is either one of constructive or controlled regulation. When galectin 9 variants are expressed in mammals, they may be expressed as soluble galectin 9 variants, and in some cases, may be expressed as precursor type galectin 9 variants. In either or both of these, they may be, for example, all galectin 9 variants, or biologically active moieties, variants, derivatives or fusions of the galectin 9 variants.

The present invention provides a gene delivery vehicle capable of expressing a nucleic acid sequence of required galectin 9 variants. As a gene delivery vehicle, Preferably, a viral vector is mentioned, More preferably, viral vectors, such as a retrovirus, adenovirus, adeno-associated virus (AAV), a herpes virus, or an alpha virus, etc. are mentioned. As a viral vector, viral vectors, such as an astrovirus, a coronavirus, an ortho myxovirus, a papovavirus, a paramyxovirus, a parvovirus, a picornavirus, a poxvirus, a togavirus, are also mentioned. For this gene delivery vehicle, D. Jolly, Cancer Gene Therapy, 1 (1): 51-64 (1994); 0. Kimura et al., Human Gene Therapy, 5: 845-852 (1994); S. Connelly et al., Human Gene Therapy, 6: 185-193 (1995); M. G. Kaplitt et al., Nature Genetics, 8: 148-153 (1994) and the like.

Retroviral vectors are well known in the art and include, for example, type B, C, and D retroviruses, xenotropic retroviruses (eg, NZB-X1, NZB-X2, NZB9.1 (RR 0). Neill, J. Virol., 53: 100-106 (1985), etc.), polytropic retroviruses (eg, MCF, MCF-mlV (M. Kelly, J. Virol., 45: 291-). 298 (1983), and the like), spumaviruses, lentiviruses, etc. (see RL Weiss et al. (Eds.), RNA Tumor Viruses, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, 1985). Retroviral gene therapy vectors of can be used in the present invention.

Part of the gene therapy retroviral vector may be derived from another retrovirus. For example, the LTR of the retro vector may be derived from murine sarcoma virus, the tRNA binding site may be derived from Loose sarcoma virus, the packaging signal may be derived from murine leukemia virus, and the second chain synthetic origin may be avian bag. It may be derived from a blood virus. These recombinant retroviral vectors can be used to form transfectable retroviral vector particles by introducing them into appropriate packaging cell lines (see US Pat. No. 5,591,624). Retroviral vectors can be constructed by having an insertion enzyme in a retroviral particle having the ability to site-specifically insert a target DNA called integrase into the DNA of a host cell. As a recombinant viral vector, it is preferable that it is a replication-defective recombinant virus.

Suitable packaging cell lines for use with the aforementioned retroviral vectors include those well known in the art and can also be readily prepared (see US Pat. No. 6,013,517, WO 92/05266). This packaging cell line can be used to produce a producer cell line (vector cell line, VCL) for producing recombinant vector particles. Preferably, a packaging cell line is produced from human parent cells (for example, HT1080 cells) or mink parent cell lines so as not to inactivate in human serum.

Preferred retroviruses for constructing retroviral gene therapy vectors include avian leukemia virus, bovine leukemia virus, rat leukemia virus, mink cell focus forming virus, rat sarcoma virus, reticuloendothelial virus, Loew's sarcoma virus, and the like. . Particularly preferred as murine leukemia virus are, for example, 4070A and 1504A (Hartley & Rowe, J. Virol., 19: 19-25 (1976)), Abelson (ATCC No. VR-999), Friend (ATCC No. VR). -245), Graffi, Gross (ATCC No. VR-590), Kirsten, Harvey's sarcoma virus, and Rauscher (ATCC No. VR-998) and Moroni mouse leukemia virus (ATCC No. VR-190). .

Such retroviruses are available from depository or conservation organizations such as the American Type Culture Collection (ATCC, Rockville, Maryland, USA), or can be isolated from known sources using commonly available techniques. .

Examples of known retroviral gene therapy vectors for use in the present invention include GB 2200651, EP 0415731, EP 0345242, WO 89/02468, WO 89/05349, WO 89/09271, WO 90/02806, WO 90/07936, WO. 94/03662, WO 93/25698, WO 93/25234, WO 93/11230, WO 93/10218, WO 93/10218, WO 91/02805, US Patent No. 5,219,740, US 4,405,712, US 4,861,719 4,980,289, 4,777,127, 5,591,624, Vile, Cancer Res, 53: 3860-3864 (1993), Vile, Cancer Res, 53: 962-967 (1993), Ra Cancer Res, 53: 83-88 (1993), Takamiya, J Neurosci Res, 33: 493-503 (1992), Baba, J Neurosurg, 79: 729-735 (1993), Mann, Cell 33: 153 (1983 ), Cane, Proc Natl Acad Sci USA, 81: 6349 (1984), Miller, Human Gene Therapy, 1: 5-14 (1990) and the like.

Human adenovirus gene therapy vectors are also known in the art and can be used in the present invention, see, eg, Berkne, Biotechniques, 6: 616 (1988); Rosenfeld, Science, 252: 431 (1991); WO 93/07283; WO 93/06223; See WO 93/07282 and the like. Examples of known adenovirus gene therapy vectors for use in the present invention include those described in the above-mentioned references, but are described, for example, in WO 94/12649; WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984; WO 95/00655; WO 95/27071; WO 95/29993; WO 95/34671; WO 96/05320; WO 94/08026; WO 94/11506; WO 93/06223; WO 94/24299; WO 95/14102; WO 95/24297; WO 95/02697; WO 94/28152; WO 94/24299; WO 95/09241; WO 95/25807; WO 95/05835; WO 94 / l8922; And those described in WO 95/09654 and the like. In addition, as described in Curiel, Human Gene Therapy, 3: 147-154 (1992), a DNA linked to a dead adenovirus may be administered.

In addition, examples of the gene delivery vehicle of the present invention include adenovirus-associated virus (AAV) vectors. Preferred examples of such vectors for use in the present invention include AAV-2 based vectors, such as those disclosed in WO 93/09239. Most preferred AAV vectors include the reverse terminal repeat sequences of two AAVs. This means that the native D sequence is modified by nucleotide substitution, resulting in at least 5 native nucleotides and up to 18 native nucleotides (preferably at least 10 native nucleotides and up to 18 native) Type nucleotides, most preferably 10 native type nucleotides), wherein the remaining nucleotides of the D sequence are deleted or replaced with non-natural nucleotides. The native D sequence of the AAV reverse terminal repeat region is a sequence having 20 contiguous nucleotides in each AAV reverse terminal repeat sequence (ie, one sequence at each end), which is not involved in HP formation. not. The non-natural substituted nucleotide may be any nucleotide different from the nucleotide found in the native D sequence at the same site. Examples of other usable AAV vectors include pWP-19, pWN-1, and the like (Nahreini, Gene, 124: 257-262 (1993)). Another example of such a vector is psub201 and the like (Samulski, J. Virol., 61: 3096 (1987)). As an example of another AAV vector, a Double-D ITR vector etc. are mentioned. Methods of making Double-D ITRs are disclosed in US Pat. No. 5,478,745. In addition to this, AAV vectors include those disclosed in, for example, US Pat. No. 4,797,368, 5,139,941, 5,474,935, WO 94/288157, and the like. Another example of the AAV vector usable in the present invention is SSV9AFABTKneo, which includes an AFP enhancer and an albumin promoter and is intended for preferential expression in the liver. The structure and manufacturing method are disclosed in Su, Human Gene Therapy, 7: 463-470 (1996). As another AAV gene therapy vector, what is described in US Patent 5,354,678 specification, 5,173,414 specification, 5,139,941 specification, 5,252,479 specification, etc. are mentioned.

The gene therapy vector of the present invention may be a herpes vector. Preferred examples of major herpes vectors include simple herpesvirus vectors (eg, vectors disclosed in US Pat. No. 5,288,641 and EP 0176170) that contain sequences encoding thymadin kinase polypeptides. Further examples of simple herpesvirus vectors include pHSVlac, Fink, described in HFEM / ICP6-LacZ, Geller, Science, 241: 1667-1669 (1988), WO 90/09441, WO 92/07945, etc., disclosed in WO 95/04139 and the like. Deposited to ATCC as HSV Us3 :: pgC-lacZ, EPV453242A, HSV7134, 2RH 105 and GAL4, Accession No. ATCC VR-977 and ATCC VR-260, described in Human Gene Therapy, 3: 11-19 (1992). The vector etc. which were made are mentioned.

In the present invention, alpha viral gene therapy vectors can also be used. Preferred alphavirus vectors include Sindbisvirus vectors, togaviruses, Semliki Forest virus (ATCC VR-67; ATCC VR-1247), Middleberg virus (ATCC VR-370), Ross River (Ross River) virus (ATCC VR-373; ATCC VR-1246), Venezuelan encephalitis virus (ATCC VR923; ATCC VR-1250; ATCC VR-1249; ATCC VR-532), US Pat. No. 5,091,309, 5,217,879 And the vector described in WO 92/10578. Further, usable alphavirus vectors are described in U.S. Patent Nos. 5,091,309, 5,217,879, 5,843,723, 6,376,236, WO 94/21792, WO 92/10578, WO 95/07994 and the like. It may be mentioned. Such alphaviruses are available from depository or preservation agencies, such as ATCC (Rockville, Maryland, USA) or can be isolated from known sources using commonly available techniques. Preferably, alphavirus vectors with reduced cytotoxicity can be used (see US Pat. No. 6,391,632).

DNA vector systems (eg, eukarytic layered expression systems, etc.) are useful for expressing the nucleic acid of the galectin 9 variant of the invention. See WO 95/07994 for details of eukaryotic hierarchical expression systems. Preferably, as a eukaryotic hierarchical expression system of this invention, what originates in an alphavirus vector is mentioned, Preferably, what originates in a sindbis virus vector is mentioned.

Other viral vectors suitable for use in the present invention are described in polioviruses (e.g., ATCC VR-58, Evans, Nature, 339: 385 (1989), Sabin, J. Biol. Standardization, 1: 115 (1973), etc.). Viruses, etc.); Rhinoviruses (eg, viruses described in ATCC VR-1110 and Arnold, J. Cell Biochem, L401-405 (1990), etc.); Poxviruses (eg, canary foxvirus, etc.) or vaccinia virus (eg, ATCC VR-111, ATCC VR-2010, etc., Fisher-Hoch, Proc Natl Acad Sci USA, 86: 317 (1989), Flexner, Ann NY Acad Sci, 569: 86 (1989), Flexner, Vaccine, 8: 17 (1990), US Pat. Nos. 4,603,112 and 4,769,330, and WO 89/01973 and the like); SV40 virus (eg, viruses described in ATCC VR-305 and Mulligan, Nature, 277: 108 (1979) and Madzak, J. Gen. Vir, 73: 1533 (1992), etc.); Influenza virus (eg, ATCC VR-797, etc.), US Pat. No. 5,166,057, Enami, Proc Natl Acad Sci USA, 87: 3802-3805 (1990), Enami & Palese, J Virol, 65: 2711-2713 (1991 ), Luytjes, Cell, 59: 110 (1989), McMicheal., NEJ Med, 309: 13 (1983), Yap, Nature, 273: 238 (1978), and Nature, 277: 108 (1979) and the like. Recombinant influenza viruses produced using reverse genetics techniques such as; Human immunodeficiency virus described in EP 0386882, Ruchschacher, J. Vir., 66: 2731 (1992) and the like; Measles virus (eg, viruses described in ATCC VR-67, VR-1247 and EP 0440219, etc.); Auraviruses (eg, ATCC VR-368, etc.); Bevaruviruses (eg, ATCC VR-600 and ATCC VR-1240, etc.); Cabassou virus (eg, ATCC VR-922, etc.); Chikungnya virus (eg, ATCC VR-64, ATCC VR-1241, etc.); Fort Morgan virus (eg, ATCC VR-924, etc.); Geta virus (eg, ATCC VR-369, ATCC VR-1243, etc.); Kyzylagach virus (eg, ATCC VR-927, etc.); Maya virus (eg, ATCC VR-66, etc.); Ndumu virus (eg, ATCC VR-580, ATCCVR-1244, etc.); Loose virus (eg, ATCC VR-371, etc.); Pick count or virus (eg, ATCC VR-372, ATCC VR-1245, etc.); Tonate virus (eg, ATCCVR-925, etc.); Trinity virus (eg, ATCC VR-469, etc.); Yuna virus (eg, ATCC VR-374, etc.); Wataro virus (eg, ATCC VR-926, etc.); Y-62-33 virus (eg, ATCC VR-375, etc.); O'Nyong virus, eastern encephalitis virus (eg, ATCC VR-65, ATCC VR-1242, etc.); Western encephalitis viruses (eg, ATCC VR-70, ATCC VR-125L, ATCC VR-622, ATCC VR-1252, etc.); And vectors derived from corona viruses (eg, the viruses described in ATCC VR-740, Hamre, Proc Soc Exp Biol Med, 121: 190 (1966)).

Delivery of the composition of this invention to a cell is not limited to the viral vector mentioned above. Other delivery methods and media may also be used, such as, for example, nucleic acid expression vectors, polycationic complex DNA linked only to dead adenoviruses (see, eg, Curiel, Hum Gene Ther, 3: 147-154 (1992)). Ligand-linked DNA (see, eg, Wu, J Biol Chem, 64: 16985-16987 (1989)), eukaryotic cell delivery vehicle cells (see, eg, US Pat. No. 6,013,517, 6,015,686, etc.), photopolymerization Hydrogel material precipitates, portable gene transfer particle guns as described in US Pat. No. 5,149,655, ionizing radiation methods as described in WO 92/11033, nuclear charge neutralization methods, or fusion with cell membranes, and the like. have. Other methods include those described in Philip, Mol Cell Biol, 14: 2411-2418 (1994), Woffendin, Proc Natl Acad Sci USA, 91: 1581-585 (1994).

Particle mediated gene transfer techniques can also be used, and the sequences are inserted into conventional vectors containing conventional control sequences for high level expression, followed by synthetic gene transfer molecules (eg, cell target ligands (eg, Wu et al., Asialorosomucoid, such as described in J. Biol. Chem., 262: 4429-4432 (1987), Hucked, Biochem Pharmacol, 40: 253-263 (1990) Incubated with a polymeric DNA binding cation such as polylysine, protamine and albumin) linked to insulin, Plank, Bioconjugate Chem, 3: lactose, lactose, or transferrin, as described in 3: 533-539 (1992) do.

Naked DNA may also be used, and examples of the method for introducing naked DNA include those described in WO 90/11092 and US Pat. No. 5,580,859. Obtaining efficiency can be improved by using biodegradable latex beads. DNA coat latex beads are efficiently transported to the cell after the beads have been endocytosis. This method can be further improved by beading treatment which increases hydrophobicity and thus facilitates endosomal rupture and release of DNA into the cytoplasm.

 Liposomes that can act as gene delivery vehicles are described in US Pat. No. 5,422,120, WO 95/13796, WO 94/23697, WO 91/144445 and EP 524,968. In nonviral delivery, the nucleic acid sequence encoding the galectin 9 variant polypeptide can be inserted into a conventional vector containing conventional control sequences for high level expression, followed by incubation with synthetic transgenic molecules. Can be. Examples of the synthetic gene-introducing molecule include polymeric DNA binding cations linked to cell target ligands (e.g., asialolosomucoid, insulin, galactose, lactose, transferrin and the like). Examples of the polymeric DNA binding cation include polylysine, protamine, albumin and the like. Other delivery systems include the use of liposomes for encapsulating DNA containing genes under various tissue specific or ubiquitously active promoter control. Non-viral delivery methods suitable for use also include mechanical delivery systems (e.g., the techniques described in Woffendin et al., Proc. Natl. Acad. Sci. USA, 91 (24): 11581-11585 (l994)). Can be.

In addition, the code sequence and the product of such expression can be delivered by precipitation of the photopolymerized hydrogel material. Other methods of gene delivery that can be used to deliver code sequences include, for example, the use of a hand-held transgenic particle gun as described in US Pat. No. 5,149,655, the gene being introduced as described in WO 92/11033. And use of ionizing radiation for activation.

Examples of ribosomal and polycationic gene delivery vehicles include US Pat. Nos. 5,422,120 and 4,762,915, WO 95/13796, WO 94/23697, WO 91/14445, EP 0524968, Stryer, Biochemistry, 236-240. 1975), WH Freeman et al., Biochem Biophys Acta, 600: 1 (1980), Bayer, Biochem Biophys Acta, 550: 464 (1979), Rivnay, Meth Enzymol, 149: 119 (1987), Wang, Proc Natl Acad Sci USA, 84: 7851 (1987), Plant, Anal Biochem, 176: 420 (1989), etc. are mentioned.

The present invention provides an autoimmune including tumors including malignant tumors such as cancer, allergic diseases, inflammation, immune disorders, and activated lymphocytes (in particular, activated T cells may be included and activated B cells may be included). A mammal suffering from a disease or disease, such as a disease, is selected from a galectin 9 or a galectin 9 modified therapeutic agent (eg, a galectin 9 modified polypeptide as a therapeutically active ingredient or a galectin 9 for expression in a mammal). Disclosed is a method of treating by administering a composition comprising a polynucleotide or the like encoding a modified polypeptide). Examples of autoimmune diseases that can be treated by the methods and compositions of the present invention include any autoimmune disease or transplant rejection (eg, but not limited to, autoimmune diseases listed herein). .

The galectin 9 variant may be administered, for example, as a polypeptide expressed by recombinant technology, or as a variant, derivative thereof, or fusion protein of a galectin 9 modified polypeptide, and in mammalian, either in local or systemic form. It can be served by one. Nucleic acids (DNA, RNA, etc.) encoding galectin 9 variants, derivatives or variants of galectin 9 variants, or galectin 9 variant fusions are regulated for expression in mammals in gene therapy protocols. It can be administered as naked plasmid DNA comprising a region or as a viral vector for expression in mammals. Delivery of the galectin 9 modified polypeptide for expression can be accomplished using a pharmaceutically acceptable carrier that can facilitate delivery. Mammals with autoimmune diseases can be treated with therapeutic agents derived from galectin 9 variants to allow for the improvement or alleviation of autoimmune diseases or the disappearance of clinical signs due to autoimmunity.

The present invention is not limited to the theory of how what is disclosed in the present invention works, but it will be determined by activated T cells or the like that induce self-awareness and then impair autoimmunity. By expressing the galectin 9 variants, or by expressing the galectin 9 variants, or by administering a therapeutic agent derived from the galectin 9 variants, the activating lymphocytes in question are affected by the available galectin 9 variants. Receive and preferentially receive apoptosis. The therapeutic agent derived from the galectin 9 modified polypeptide or the galectin 9 modified may be administered to a region exhibiting autoimmunity (eg, a local region characterizing the specific autoimmune disease in which the treatment is performed). As a result, contact between the nine modified variants of galectin, and other therapeutic agents, and activated T cells having a target expressed by the cells of the region is optimized. Thus, the cells of the region are good candidates for expressing polynucleotides encoding the galectin 9 modified polypeptides administered to the region with the help of gene delivery vehicles. Thus, various modifications or applications of the present invention can be made to express the galectin 9 modified polypeptide so that expression can occur in cells under attack by activated T cells or the like. In the case of transplant rejection, galectin 9 modified polypeptides fused with binding sites of molecules capable of binding proteins ubiquitously expressed on the cell surface of many cell types. This binding moiety may be, for example, heparin, and the molecule on the cell surface to be bound may be glycosaminoglycan. The binding moiety may also be the binding domain of a single chain antibody specific for any selected cell surface antigen.

With respect to the present invention, a tumor injury, an antiallergic effect, an anti-inflammatory action, normalizes immune abnormalities, or activates lymphocytes (especially for tumor cells including malignant tumor cells such as cancer) Induction of apoptosis in the presence of activated T cells) may be understood in the same manner as in the case of autoimmunity.

As used herein, "administration" or "administering" refers to a process of delivering a therapeutic agent or a combination of therapeutic agents to a mammal. The administration process can be varied by the therapeutic agent (single or plural therapeutic agents) and the desired effect. Administration can be accomplished by any means suitable for therapeutic agents, such as, for example, parenteral or oral delivery. Parenteral delivery includes, for example, subcutaneous, intravenous, intramuscular, intraarterial delivery, injection into organ tissues, mucosal, pulmonary, local, or catheter delivery. Oral means are achieved via the mouth, for example by the use of tablets or other gastrointestinal delivery means (including drinkable liquids). Examples of delivery through the mucosa include intranasal (i.n.) delivery and the like. As delivery of the pulmonary oil, the drug may be inhaled. Administration may generally be by delivery using a pharmaceutically acceptable carrier (eg, buffer, polypeptide, peptide, polysaccharide conjugate, liposome, lipid, etc.). Gene therapy protocols include cases in which a polynucleotide capable of achieving a therapeutic purpose when expressed as a transcript or polypeptide in a mammal may be considered as a therapeutic agent, wherein the parenteral delivery means and Any of the oral delivery means may be applied. Such means of administration is selected to be suitable for the disease to be treated. For example, if the disease is an organ base, delivery may be local, eg, if the disease is systemic, delivery may be systemic. Concomitant administration refers to administration of one or more therapeutic agents in the treatment being given to a patient. The therapeutic agent may be administered using the same pharmaceutical carrier, or may be administered using another carrier. These may be administered by the same or different means of administration. The drug may be the same type of drug or a different type of drug. For example, a polynucleotide, a polypeptide, or a small molecule may be mentioned as another type. The administration time may be exactly the same time, and one therapeutic agent may be administered before or after the other agent. Therefore, concurrent administration may be simultaneous and may be continuous. The exact protocol for bringing the therapeutic agent into the desired combination is determined by considering the condition being treated taking into account the agent and others.

The term "in vivo administration" refers to administration of a polynucleotide encoding a polypeptide to a patient (for example, a mammal) for expression in a mammal. In particular, direct in vivo administration includes transfecting mammalian cells with code sequences without removing the cells from the mammal. Therefore, as direct in vivo administration, direct injection of DNA encoding a target polypeptide into a region suffering from an autoimmune disease so that expression in a patient cell occurs.

The term "ex vivo administration" refers to transfecting a cell (eg, a cell derived from a cell population under autoimmune attack) after removing the cell from the patient (eg, a mammal). After trackspection, the cells are returned to the mammal. In vitro administration removes cells from mammals, selects cells to be transformed as needed (i.e., cells under attack by autoimmune devices), renders the selected cells non-replicable, and expresses the selected cells for expression. Transformed with a polynucleotide encoding a gene (ie, a gamutine 9 variant) (which also includes a regulatory region to facilitate expression) to transform the cells transformed for expression of the galectin 9 variant Is achieved by returning.

A therapeutically effective amount refers to the amount which produces a desired therapeutic result. For example, when the desired therapeutic effect is remission from autoimmunity, a therapeutically effective amount refers to an amount that facilitates remission. A therapeutically useful amount may be, for example, an amount to be administered in a dosage protocol that includes administration for days or weeks. When the therapeutic effect is to reduce the influence of the mammalian autoimmune response while the signs of autoimmune disease are present, for example, the effective amount of the drug for achieving this in the mammal is to reduce the signs of autoimmunity. Say the amount to bring it.

The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent (e.g., polypeptide, polynucleotide, small molecule, peptidic material, peptide, etc.), and itself to an individual that receives the composition. Any pharmaceutically acceptable carrier which does not induce the production of a harmful antibody and is free of problematic toxicity and can be administered therein. In another aspect of the invention, there is provided a pharmaceutical composition comprising such a recombinant viral vector in combination with a pharmaceutically acceptable carrier or diluent. Such pharmaceutical compositions may be in the form of liquid solutions or may be prepared as solid forms (eg, lyophilized solids) that can be suspended in the solution prior to administration. The composition may also be formulated using a carrier or diluent suitable for administration to the surface, injection, oral administration, or rectal administration. Pharmaceutically acceptable carriers or diluents are those that are substantially nontoxic to those who receive it at the dosages and concentrations employed. Representative examples of carriers or diluents for injectable solutions include water, isotonic physiological saline solutions (preferably buffered to physiological pH, for example phosphate buffered physiological saline or Tris buffered physiological saline). Mannitol, dextrose, glycerol, ethanol, polypeptide or protein (eg, human serum albumin). Particularly preferred compositions include those comprising the vector or recombinant virus in 10 mg / ml mannitol, 1 mg / ml HSA, 20 mM Tris (pH 7.2) and 150 mM NaCl. In this case, the recombinant vector may represent about 1 mg of the substance, the polymer may be less than 1%, and may be less than 1 / 100,000 of the total amount of the substance (including water). The composition is stable at about 20 ° C. for at least 6 months.

The pharmaceutical composition of the present invention may contain a factor that stimulates cell division, and therefore may contain a factor that stimulates insertion or insertion of a recombinant retroviral vector. For conservation of recombinant viruses, reference may be made to those described in US Pat. No. 5,792,643.

All of the therapeutic agents for carrying out the therapy provided in the present invention can be put into a suitable pharmaceutical composition containing a pharmaceutically acceptable carrier for the therapeutic drug. The pharmaceutical carrier for the therapeutic drug may be the same or may be different for each therapeutic drug. Suitable carriers may be large and slowly metabolized macromolecules (e.g. proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, inert viruses in the particles, etc.). Such carriers are well known to those skilled in the art.

Pharmaceutically acceptable salts include, for example, inorganic acid salts (eg, hydrochloride, hydrobromide, phosphate, sulfate, etc.); Organic acid salts (eg, acetate, propionate, malonate, benzoate, etc.), and these may be used in the composition. Pharmaceutically acceptable excipients may be found, for example, in Remington's Pharmaceutical Sciences (Mack Pub. Co., N. J., USA, 1991). Pharmaceutically acceptable carriers in therapeutic compositions include liquids such as water, physiological saline, glycerol, ethanol and the like. Examples of the preparation include a wetting agent, an emulsifier, and the like, and it is also possible to contain a pH buffering substance or the like in such a vehicle. Typically, a therapeutic composition is formulated to be injectable in either liquid solution or suspension; Solid vehicles suitable for being liquid or suspension may be prepared using a liquid vehicle prior to injection. Liposomes are also included within the definition of pharmaceutically acceptable carrier.

In combination with a pharmaceutically acceptable carrier or diluent, pharmaceutical compositions comprising a recombinant retrovirus or a virus having one of the above vector constructs may also be provided. The composition may be formulated as either a liquid solution or a solid form (eg, lyophilized) that is suspended in solution prior to administration. The composition may also be prepared using a carrier or diluent suitable for administration to the surface, injection, oral administration, or rectal administration.

Pharmaceutically acceptable carriers or diluents are non-toxic to those (recipients) who receive them at the dosages and concentrations employed. Representative examples of carriers or diluents for injectable solutions include water, isotonic physiological saline solutions (preferably buffered to physiological pH, such as phosphate buffered physiological saline, Tris buffered physiological saline, etc.), Mannitol, dextrose, glycerol, ethanol, polypeptides or proteins (eg, human serum albumin) and the like. The vector or recombinant virus can be delivered in a pharmaceutical composition such as containing 10 mg / ml mannitol, 1 mg / ml HSA, 20 mM Tris (pH 7.2) and 150 mM NaCl. In this case, the recombinant vector is about 1 g of substance, which is less than 1% of the polymer substance, and may be less than 1 / 100,000 of the total amount of substance (including water). The composition will be stable at 20 ° C. for at least 6 months.

Pharmaceutically acceptable carriers or diluents may be combined with the gene delivery vehicle to enable the composition of any one of a liquid solution or a solid form (eg, lyophilized) that can be suspended in solution prior to administration. Can be. Two or more gene delivery vehicles typically represent a traditional direct route (eg, buccal / sublingual, rectal, oral, nasal, topical (eg, transdermal and eye, etc.), vaginal, pulmonary, intraarterial, intramuscular, intraperitoneal, subcutaneous) , Intranasal, intranasal, or intravenous) or indirectly.

The therapeutic drug of the present invention may optionally contain a polynucleotide for expression in, for example, a mammal, and the therapeutic drug may be formulated into an enteric tablet, a capsule, or the like according to a method known in the art. These may be referred to the following patents: for example, US Pat. No. 4,853,230, EP 225,189, AU 9,224,296, AU 9,230,801 and WO 92144,52 and the like. Such capsules can be administered orally to target the intestine. 1 to 4 days after oral administration, for example, whether the expression of the polypeptide is being performed or whether the inhibition of expression by, for example, ribozyme or antisense oligonucleotide is occurring, is used. Plasma and blood can be measured and determined.

Gene delivery vehicles are described, for example, by injection, particle gun, topical administration, parenteral administration, as described, for example, in US Pat. No. 4,411,648, 5,222,936, 5,286,254, WO 94/05369, and the like. Can be introduced into the mammal by inhalation or iontophoretic delivery.

Therapeutic compositions or therapeutic agents may benefit from the therapeutic benefits obtained from the administration of tumors, including malignant tumors such as cancer, other therapeutic agents that may improve allergic disease, inflammation, immune disorders, autoimmune diseases, or the treatment of galectin 9 modified substances. Administration with other therapeutic agents that may be augmented. For example, in the case of administration for treating an allergic reaction, an aerosol of galectin 9 modified polynucleotides may be administered to express into cells present in tissues such as mucous membranes, nose, bronchus, lungs, and advantageously, for example, allergic reactions. It can also be repeated administration by several times daily, nasal spray, or aerosol spray until it stabilizes.

Gene delivery vehicles can be administered directly to a single site or multiple sites of a mammal, eg, by direct injection. The gene delivery vehicle can also be administered using target cells transfected ex vivo. The present invention also provides a pharmaceutical composition (eg comprising various excipients) suitable for administration of a gene delivery vehicle.

Galectin 9 modified polypeptide, a vector construct that directs the expression of the modified, derivative, analog, variant or chimera thereof, shows tumor sites including malignant tumors such as cancer, sites showing allergy, sites of inflammation, immune disorders Site, autoimmune areas (eg, pancreas, kidneys, liver, joints, brain, spinal fluid, skin, or other areas or organs of the body). In order to administer the vector construct directly, various methods can be used within the scope of the present invention. For example, once an artery working for a region is identified, a vector can be injected into this artery to deliver it directly to that site. Likewise, by applying a topical pharmaceutical composition comprising, for example, a vector construct, the vector construct can be administered directly to the skin surface.

In direct administration, a combination therapy comprising a galectin 9 modified agent and other anti-autoimmune agents may be administered together. Concomitant administration can be done simultaneously, eg, by placing a polynucleotide encoding an agent in the same vector, or by placing the agent in the same pharmaceutical composition, or about the same time, regardless of whether it is a polynucleotide, polypeptide, or other drug. This can be achieved by putting a medicament in a separate pharmaceutical composition that can be injected at approximately the same position and administering it. When concurrent administration is not performed simultaneously (for example, when prodrug is administered after administering a prodrug activator), a 2nd agent may be administered by direct injection suited for a therapeutic purpose. Thus, for example, when administering a prodrug, the prodrug is to be administered at the same site as the prodrug activator. Therefore, the combined administration protocol may include the combination of administration for achieving the therapeutic objective. In addition, combined administration may include administration later, if needed (for example, the thing like repeating the process which injects 9 galectin modified bodies directly in vivo, and repeats administration).

In the present invention, it should be understood that the removed cells can be returned to the same animal or to other allogeneic animals or mammals. In such cases, in general, it is desirable that histocompatibility be consistent in the animal (but not necessarily, for example, Yamamoto et al., AIDS Research and Human Retroviruses, 7: 911-922 (1991); Yamamoto et al., Journal of Virology, 67: 601-605 (1993).

Cells can be withdrawn from various parts of the patient. In another embodiment of the present invention, for example, the vector construct may be placed in cells derived from skin (skin fibroblasts, etc.) or cells derived from blood (eg, peripheral blood leukocytes, etc.). If desired, specific fractions of cells (eg, T cell subsets or stem cells, etc.) can be specifically withdrawn from the blood (see eg WO 91/16116). Any of the above described techniques can then be used to contact the extracted cells with the vector construct and subsequently return the cells to a warm-blooded animal (preferably in or near the area exhibiting autoimmunity).

Once diagnosed in a patient, such as a mammal, for example, a galectin 9-modifying agent can be given, or in appropriate techniques and dosages for the particular disease / disease (eg, tumor, allergy, autoimmune disease, etc.) being treated. The practice of the invention is made including administering it to a mammal, or monitoring the mammal to determine its need for continuous administration or modification of administration. In the present invention, the practice may consist of identifying the diseases to be treated and determining promising cell types or body regions to which target gene therapy can be applied. A galectin 9 modified polynucleotide (may contain a plasmid with a regulatory region for expression in a mammal, or a viral vector for expression) was constructed to extract several mammalian cells to extract 9 galectins Transfected with a polynucleotide encoding the variant, and placed into a mammal for expression of the galectin 9 variant. Alternatively, the polynucleotide can be administered to a mammal, for example, to express in a region where the disease is evident.

Thus, for example, in the case of malignant tumor cells, galectin 9 variants may be used to transfect such tumor cells, such as affected tissues or organs, in vivo or ex vivo. In addition, for example, in the case of chronic arthritis rheumatoid, a galectin 9 variant may be used to transfect cells obtained from joint fluids in vitro.

For example, in the treatment of multiple sclerosis, it is possible to inject gamutin 9 variants into the affected brain regions and to facilitate expression of galectin 9 variants in cells under attack by active T cells of autoimmune response. You can also do that. In addition, as an example, in the case of multiple sclerosis, the galectin 9 modified DNA can be injected locally into the mammalian brain, and cells derived from the spinal fluid are removed and transfected with the galectin 9 modified DNA. Can be returned to the spinal cord region. As another example, in order to treat mammals with Sjogren's syndrome, a target organ of this disease may be selected that is suitable for administration of the galectin 9 modified polypeptide by injection. In addition, for mammals suffering from Scheren's syndrome, diseased organs (e.g., kidneys, etc.) can be identified, and the galectin 9 modified DNA can be directly administered to the organs. It may be treated and then returned to the body to express the galectin 9 variants in these cells of the mammal.

For example, when preventing transplant rejection, the animal receiving the transplant may be administered either locally or systemically with a galectin 9 modifying agent to kill the foreign cells, foreign tissues, or activated patient cells that attack the foreign organs. It is also possible to express the galectin 9 modified polypeptide in cells on the outer surface of the organ just prior to transplantation, in order to once protect the organ in the patient's body. It will be necessary to continuously administer the galectin 9 modifying agent until the immune system of the recipient is acclimated to foreign cells, foreign tissues, or foreign organs.

Galectin 9 modified agents are expected to act similar to natural galectin 9. Therefore, it can be used to cause an apoptosis reaction. Thus, the clinician will be able to stoichiometrically determine the amount of galectin 9 variants that must be expressed or administered to a mammal in order to achieve apoptosis. In another aspect of the present invention, the vector construct disclosed in the present specification may further instruct the expression of a nonvector derived gene. For example, a prodrug system applied simultaneously with the administration of galectin 9 variants may act as a safe mechanism for gene therapy and may act as a combination therapeutic.

The prodrug activator may be expressed in the vector together with the galectin 9 modified product to secure a safe mechanism. If it is determined that this activation system should stop, a prodrug is administered to activate the prodrug activator. This treatment gives the clinician control means during gene therapy. Prodrug activator / prodrug systems are useful for inactivating transfected cells in mammals, where, for example, autoimmunity is exacerbated by expression of galectin 9 variants. The prodrug activator / prodrug system can be used in combination therapy or in combination with a therapeutic agent to perform cytotoxic action using the prodrug activation provided by the system.

The treatment comprising administering a polynucleotide encoding a galectin 9 modified polypeptide together with the prodrug activator and the prodrug may be immunomodulatory. Immunomodulatory refers to the use of a factor that results in an immune response that differs in nature or potency from the immune response occurring in the absence of the factor, even though the factor is produced by one or more cells involved in the immune response, It may be added exogenously to the cell. The nature or potency of the response can be determined by various assays known to those skilled in the art (eg, in vitro assays measuring cell proliferation (eg, obtaining ³ H thymidine) and in vitro cytotoxicity assays (eg, measuring ⁵¹ Cr release)). (See Warner et al., AIDS Res. And Human Retroviruses, 7: 645-655 (1991)). As immunomodulatory factors, they are active both in vivo and ex vivo. Representative examples of such factors include cytokines (eg, interleukins 2, 4, 6, 12, and 15), α interferon, β interferon, γ interferon, GM-CSF, G-CSF, and tumor necrosis factor (TNF). Can be. Other immunomodulatory factors include, for example, CD3, ICAM-1, ICAM-2, LFA-1, LFA-3, MHC class I molecules, MHC class II molecules, β ₂ -macroglobulin, chaperones, analogs thereof and the like. . However, when the gene delivery vehicle does not express an immunomodulatory carrier that is a cytokine, the cytokine may be included in the composition described above, and may be administered separately (simultaneously or later) from the composition. In sum, in this embodiment, the immunomodulatory carrier is preferably administered according to standard protocols and dosages known in the art. For example, α interferon can be administered at a dosage of 1-5 million units / day for 2-4 months, and IL-2 for 1-2 weeks, 1-3 times / day, 10,000-100,000 units / kg body weight. It can be administered at a dosage of. γ interferon is administered for 2 to 12 weeks, 2 to 3 times / week, 150,000 to 1,500,000 units, for example, to achieve more effective treatment with galectin 9 variants, and to upregulate the expression of problem genes in activated T cells. It can be administered at a dosage of.

In the combined therapeutic agent, the prodrug activator may be expressed from a vector therefor or may be expressed from the same vector as the galectin 9 modified polypeptide. Either vector system (single vector or two vectors) can be administered by in vivo or ex vivo means. In autoimmune therapy, for example, the addition of a prodrug activator further promotes an immunomodulatory effect that supports the effects achieved by galectin 9 variants, and further the addition of prodrugs will activate the killing of transfect cells. Can be.

The chaperone molecule may be administered before, simultaneously with, or after administration of the polynucleotide therapeutic drug, and the chaperone molecule may be, for example, a heat shock protein (eg, hsp70). In addition, polynucleotides expressed in mammals can be linked to inducible promoters (eg, tissue specific promoters), for example for the purpose of ensuring polynucleotide expression only in the desired target cells. In addition, for the purpose of effectively delivering a polynucleotide to a tissue, the polynucleotide may be adjacent to a nucleotide sequence suitable for insertion into the cell genome of the tissue.

For this aspect of the invention and for most aspects, the effectiveness of treating humans can be tested for the first time in animal models of certain autoimmune diseases. Such existing animal models include, for example, Schagren's syndrome (autoimmune lacrimitis or immune-mediated salivaitis), autoimmune myocarditis, primary biliary cirrhosis (PBC), inflammatory heart disease, mercury-induced kidney autoimmunity, insulin-dependent diabetes (1). Type diabetes mellitus or IDD), autoimmune after thymic extraction, central nervous system (CNS) dehydration disorder, CNS lupus, Narcolebsi, myasthenia gravis (mg), Graves' disease, immune-mediated PNS disorders, deformable arthrosis, chronic arthritis rheumatoid, uveitis, Animal models of autoimmune diseases, including medulla cystic seizures, autoimmune hemolytic diseases, autoimmune vasculitis, ovarian autoimmune diseases and human schleroderma.

Multiple gene delivery vehicles can be administered to an animal or plant. In a preferred embodiment, the animal is a warm blooded animal, more preferably selected from the group consisting of mice, chickens, cows, pigs, pets (eg cats and dogs), horses and humans. For polypeptide therapeutics (eg, galectin 9 variants or other cytokines), the dosage is about 5-50 μg / kg mammal body weight, also about 50 μg / kg to about 5 mg / kg, also about 100 to 500 Μg / kg mammal body weight, and in the range of about 200 to about 250 μg / kg.

For polypeptide therapeutics (e.g., polynucleotides encoding natural or variant galectin 9 modified polypeptides, etc.), in tissue-targeted administration, in response to polynucleotide expression in a patient (e.g., a mammal), A vector comprising an expressible construct of sequence or non-code sequence can be administered as follows: In a gene therapy protocol of topical administration, about 100 ng to about 200 mg DNA, or about 500 ng to about 50 mg DNA, Or between about 1 μg to about 2 mg DNA, or about 5 μg DNA to about 500 μg DNA, and topical administration in a gene therapy protocol, in the range of about 20 μg to about 100 μg, and eg, per injection or It can be administered at a dose of about 500 μg per administration. If more expression is desired, over a wider area of tissue, a greater amount of DNA or the same amount of DNA is re-administered according to a continuous dosing protocol, e.g., in several adjacent or intimate tissue portions of the tumor site. Ganga is administered, and such will be necessary to produce a positive therapeutic result.

About administration of the small molecule therapeutic drug, dosage can be changed with the effect of a small molecule. In very powerful inhibitors, the dosage is expressed in amounts per kilogram of mammal, eg, from about 1 μg / kg to about 500 mg / kg, or from about 100 μg / kg to about 5 mg / kg, or about 1 μg / It is sufficient in the range of kg to about 50 μg / kg, or for example about 10 μg / kg. In the administration of peptides and peptoids, the potency also varies with dosage, from about 1 μg / kg to about 500 mg / kg mammal body weight, and from about 100 μg / kg to about 5 mg / kg and about 1 μg /. It may be in the range of kg to about 50 µg / kg. The normal dose may be about 10 μg / kg.

Although the active ingredient of this invention can select and administer the dosage over a wide range, the dosage, frequency | count of administration, etc. are the sex, age, weight, general state of health, meal, time of administration, administration method of a patient to be treated. Depending on the rate of excretion, the combination of medications, and the extent of the condition being treated at the time of the patient, these or other factors may be considered.

In the manufacture of pharmaceuticals, the additives and the preparation method thereof are, for example, the Japanese Pharmacy Commentary Compilation Committee Edition, the 14th revised Japanese Pharmacopoeia, published on June 27, 2001, Hirokawa Shoten Co., Ltd .; Development of Ichibangase Hisashi compilation of pharmaceutical products 12 books (Senior preparation [I]), issued October 15, 1990, Hirokawa Shoten Co., Ltd .; With reference to the descriptions of the same, 12 books of pharmaceutical development (Production Material [II]), issued on October 28, 1990, and Hirokawa Shoten Co., Ltd., these may be appropriately selected and applied as necessary.

The active ingredient of the present invention is, as described herein, (a) a galectin 9 variant and a polypeptide having a biological activity substantially equivalent thereto, and (b) a galectin 9 variant and substantially equivalent thereto. (D) Galectin 9 variants and polypeptides having a substantially equivalent biological activity, such as polynucleotides encoding polypeptides having a biological activity, (c) factors found using the Galectin 9 variant technique, and the like Gene delivery vehicles, and the like, which induces apoptosis to tumor cells and the appearance that human galectin 9 does not show injury activity to normal cells and shows cytotoxic activity to tumor cells, but apoptosis to normal cells. Not to induce, to metastatic of malignant cells, to activated immune cells, especially activated CD4 It is useful in using the activity which induces apoptosis of sex T cells (on which the apoptosis induction of restoring T cells, especially CD4 positive T cells (helper T cells) does not induce it), etc. It is promising as a drug that utilizes activities such as anti-allergic agents, immunomodulators, autoimmune disease agents, anti-inflammatory agents, and corticosteroid hormones.

From the biologically active effects identified using the active ingredients of the invention, such as galectin 9 variants (particularly G9NC (null)), galectin 9 and galectin 9 variants (particularly G9NC (null)) are shown below. It is believed to exhibit useful biological activity against pathological symptoms and diseases as shown.

Inflammatory diseases include various acute and chronic inflammations, allergic and autoimmune inflammations, infectious diseases, and the like that occur in each organ.

As acute and chronic diseases, pneumonia includes, for example, bronchitis, bronchial pneumonia, interstitial pneumonia, pneumonia, bronchiolitis or acute diaphragm, and other organ inflammations, such as pericarditis, endocarditis, myocarditis and stomatitis. , Angitis, tonsillitis, pharyngitis, laryngitis, esophagitis, peritonitis, acute gastritis, chronic gastritis, acute enteritis, appendicitis, ischemic colitis, chemical colitis, proctitis, hepatitis A, hepatitis B, hepatitis C, extreme hepatitis, chronic hepatitis Various acute and chronic hepatitis, cirrhosis, cholecystitis, acute pancreatitis, chronic pancreatitis, and also acute and chronic nephritis, mesenteric nephritis, glomerulonephritis, IgA nephropathy, various cystitis, encephalitis, dermatitis, superficial keratitis And various inflammations, including dry keratoconjunctivitis, various otitis media and rhinitis, sinusitis and nasal polyps, including gingivitis, periodontitis, and periodontitis.

In addition, effects have been confirmed for neurological inflammation (for example, nervous gastritis, neuronal cystitis, etc.). For example, Example 8 confirmed a strong inhibitory effect on the inflammatory response in the galectin 9 capsaicin-induced neurodermal inflammation model. Capsaicin is a substance that causes nerve inflammation and pain by stimulating peripheral nerves. Capsaicin has a free stimulating action of substance P, a neuropeptide stored at the perceptual nerve C fibroblast. Substance P has the action of releasing histamine from mast cells, resulting in dilated blood vessels resulting in edema. In addition, an augmentation cycle is established in which the perceptual nerve is stimulated by the released histamine, and the substance P is released at the end of the C line, which acts on the surrounding mast cells and releases the histamine. Galectin has an inhibitory effect on the formation of this condition.

Capsaicin also binds to capsaicin receptors (vanilloid receptors), which are pain receptors for sensory nerve endings, causing pain. Pain is caused by activation of sensory nerve endings by chemical stimulation (acids, etc.), heat stimulation (heats, etc.) or excessive mechanical stimulation (such as bruises), and the capsaicin receptor is also involved in pain caused by these stimuli. Therefore, it is suggested that galectin 9 inhibits the activation of nerve endings by capsaicin receptors, and the possibility of analgesic action such as reduction of pain accompanying cancer and inflammation can also be expected.

Allergic inflammatory diseases include systemic anaphylaxis, bronchial asthma, irritable pneumonia, hay fever, allergic rhinitis, allergic conjunctivitis, allergic diseases caused by immune complexes, vascular neuroedema, and the like.

In addition, autoimmune inflammation (autoimmune disease) includes systemic (chronic joint rheumatism, systemic erythromatodes, nodular polyarteritis, scleroderma, multiple myositis, dermatitis, Scheren's syndrome, Behcet's disease, etc.), nervous system (multiple sclerosis). , Myasthenia gravis, HAM (HTLV-1 myelopathy), amyotrophic lateral sclerosis, etc., endocrine (such as Vasedou's disease, Hashimoto's disease, type 1 diabetes, etc.), blood (idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, aplasticity) Anemia, etc.), respiratory organs (sarcoidosis, pulmonary fibrosis, etc.), digestive tract (ulcerative colitis, Crohn's disease, etc.), liver (autoimmune hepatitis, primary biliary cirrhosis, primary sclerosing cholangitis, autoimmune cholangitis, etc.), kidneys Urinary tract (anti-neutrophil cytoplasmic antibody-related nephritis, vasculitis, Goodpasture syndrome, anti-glomerular basement membrane antibody disease, etc.).

Infectious disease is a generic term of diseases caused by pathogens injuring cells, tissues and organs of living bodies. On the other hand, regarding infectious diseases, it is possible to refer to the supervision: Rikuma Machinami, edited by Junichi Kanade, Atsuhiko Sakamoto, `` Standard Pathology (2nd Edition) '', Medical Vow, and issued March 15, 2002. Pathogens that cause infection in humans include: 1) bacteria (including spiroheters, chlamydia, and rickiatia), 2) viruses, 3) fungi, 4) plants (algae), 5) protozoa, 6) parasites (worms) , Insects, nematodes), 7) arthropods. The main diseases brought on by each pathogen include bacterial infections (cholera, plague, Escherichia coli infections, etc.), spiroheter infections (such as leptospirosis), chlamydia infections (such as scabies), rickettsia infections (rash typhus, tetanus, etc.), viral infections. (Herpes zoster, viral hemorrhagic fever, rabies, etc.), mycosis (candidiasis, Cryptococcosis, Aspergillosis, etc.), protozoa diseases (ameba dysentery, malaria, toxplasmosis, etc.), parasites (insectosis, nematode, etc.) ), Others, mycoplasma infections (mycoplasma pneumonia, etc.), mycobacterial infections (tuberculosis, atypical acidophilus, etc.).

About cancer and sarcoma, brain tumor (polymorphic glioblastoma etc.), spinal cord tumor, maxillary sinus cancer, pancreatic adenocarcinoma, dental carcinoma, tongue cancer, cleft lip cancer, upper pharyngeal cancer, middle head cancer, hypopharyngeal cancer, laryngeal cancer, thyroid cancer, parathyroid cancer, lung cancer, pleura Tumor, Cancer peritonitis, Cancer pleurisy, Esophageal cancer, Gastric cancer, Colon cancer, Cholangiocarcinoma, Gallbladder cancer, Pancreatic cancer, Liver cancer, Kidney cancer, Bladder cancer, Prostate cancer, Penis cancer, Testicular tumor, Adrenal cancer, Cervical cancer, Uterine cancer, Vaginal cancer, Vulvar cancer, ovarian cancer, ciliary epithelial tumor, malignant bone tumor, soft sarcoma, breast cancer, skin cancer, malignant melanoma, basal cell tumor, leukemia, myelodysplastic with myeloid disease, malignant lymphoma, Hodgkin's disease, plasmacytoma, glioma Etc. can be mentioned.

The present invention can also be applied to the dermatology area. For example, 1) skin diseases include inflammations including infections, allergic inflammations and autoimmune inflammations, and specific inflammations such as psoriasis, bullousness, pustules, keratinosis, keratinosis, and the like. In addition, 2) cosmetic dermatology-related, a) melanin metabolism regulation (whitening) ... galectin 9 gene introduction melanoma cells change from black to white. Galectin 9 positive cells in the basal cell layer of the skin. b) Regulation of hair growth (hair growth) .. There are expressions of galectin 9 in the hair root area and are different from time to time. Hair growth in galectin 9 transgenic mice was very good compared to mutant galectin 9 transgenic mice. c) Collagen production regulation, etc. The fibroblasts express galectin 9 by various stimuli, and there is a galectin 9-positive part in the pre-binding job.

Examples of lifestyle diseases include hyperlipidemia, arteriosclerosis, high blood pressure, diabetes, and the like. Gal9 positive cells and negative cells were found in foam cells, one of the cells involved in the pathogenesis of lifestyle-related atherosclerosis. This suggests that gal9 is involved in the condition of arteriosclerosis, and it cannot be denied that treatment and prevention can be achieved by controlling it. In hypertension, galectin 9 enhances the expression of the tubules or glomeruli during the development of animal hypertension in animal models, so it is highly possible to control the expression of galectin 9 or administer galectin 9.

It is also applicable to the maintenance of a normal bacterial flora. For example, gal9 is strongly expressed in the normal epithelium of the intestinal tract, and when administered the jade bacterial flora, galectin 9 in inflammatory cells such as intestinal epithelium and macrophages. Expression is enhanced. It is strongly suggested that galectin 9 is involved in the maintenance of the normal flora in the digestive tract.

In addition, it is applicable to amyloidosis, for example, in the macrophage in the part which confirms amyloidosis, there exists a macrophage which shows galectin 9 expression. There is a possibility that galectin 9 can control amyloid deposition.

It is also thought to be useful for Alzheimer's disease, osteoporosis, fractures, and the like. For example, degenerated neurons in the brain of Alzheimer's disease patients show galectin 9 positive findings. Therefore, there is a possibility that it can be used for treatment and diagnosis. In osteoporosis, galectin 9 may be considered to inhibit bone resorption and promote bone formation. Such action is considered to be an ideal medicine in terms of bone metabolism.

In addition, it is also useful in the brain and nerve regions. For example, the development of ischemic lesions such as cerebral infarction and myocardial infarction is accompanied by wetting of inflammatory cells, which leads to deterioration of superoxide production. It can be expected that galectin 9 and galectin 9 variants control its inflammation. Examples of demyeloid diseases caused by inflammation and changes in the immune system include, for example, multiple sclerosis. Examples of degenerative diseases include amyotrophic lateral sclerosis and Parkinson's disease. In addition, ataxia is believed to be caused by some inflammatory change. In other words, EPA (eicosapentaenoic acid) is used to control the inflammatory response and to form nerve cell membranes in the brain. There is an example of a study showing that patients with ataxia are depleted of EPA or other essential fatty acids in the cell membrane.

Galectin 9 and galectin 9 variants are also expected to be useful for gout. Even for acute, painful inflammation of uric acid crystallization, galectin 9 and galectin 9 variants can be expected to control it.

Asthma is a respiratory disease that results in reversible airway obstruction (asthma attack), which indicates a condition in which the airway's responsiveness to an allergen or nonspecific (infection, cold, etc.) stimulus is increasing. In recent years, it has been proved that asthma airways have inflammation mainly composed of mixed acidic spheres, T lymphocytes, and mast cells even in the resting phase without seizures, and the main body of asthma is currently considered to be chronic bronchitis. In addition, the majority of pediatric asthma is strongly associated with atopic predisposition (produced IgE) (atopy-type asthma), but about half of adult asthma can not prove the involvement of IgE (biatopy-type asthma). The Guidelines for the Prevention and Management of Asthma (1998 Ministry of Health and Welfare Research) were drawn up, and asthma treatment is divided into acute attacks and chronic airway inflammation. As a seizure treatment drug, a bronchodilator (beta ₂ stimulant, aminophylline) is used as a 1st selection agent, but in a moderate to severe seizure, these drugs are inadequate and large-scale systemic administration of a steroid drug is performed. Steroid drugs have great side effects, especially peptic ulcers, hypertension, hyperglycemia, and mental symptoms, and when used for a long time, infection, adrenal suppression, osteoporosis, etc. become a problem. In addition, in the case of complications, the use of steroids carries a risk. There is a need for development of a drug having fewer side effects and an effect equivalent to steroids. Anti-inflammatory drugs are mainly used for the treatment of chronic airway inflammation as a long-term management drug. Among them, the use of inhaled steroid drugs is encouraged. If the steroid drug is used in large amounts for a long time, the possibility of side effects such as adrenal suppression, osteoporosis, and airway infection cannot be denied. In addition, inhalation drugs require accurate inhalation dexterity, and are inferior in terms of compliance with internal medicine. In moderate to severe asthma, in addition to inhaled steroid drugs, the use of inhaled β ₂ stimulants, leukotrienes antagonists or sustained release theophylline drugs is encouraged. In severe cases, systemic administration of steroids is inevitable. The development of a medicament is substituted for such a medicament.

It is known that infiltration of T lymphocytes, eosinophils into lung tissue and airways plays an important role in the formation of asthma conditions. On the other hand, galectin 9 has a function of inducing apoptosis of cells and induces apoptosis of activated T cells and eosinophils. Based on this, studies using galectin 9 variants and the like in the present invention revealed that galectin 9 and galectin 9 variants have activity to improve (suppress) airway inflammation in asthma.

In addition, galectin 9 and galectin 9 variants have osteoblast proliferation and differentiation and osteoclast differentiation activity, and are one of the side effects that are problematic in the prevention and / or treatment of osteoporosis and long-term administration of steroids. It is thought that it is also effective against bone growth inhibition.

Unlike steroids, galectin 9 and galectin 9 variants exhibit activated lymphocyte-specific inhibitory effects in contrast to steroids and can be expected to have fewer side effects, such as immunosuppression, than steroids. In addition, it also has a function of inhibiting the function of the adhesion molecule which is not present in the steroid and suppressing neurological inflammation, and is promising as an asthma treatment drug such as a seizure treatment drug. It is also thought that it is possible to reduce the side effects of steroids.

Although an Example is given to the following and this invention is concretely demonstrated to it, this Example is provided for the reference of the specific aspect only for the purpose of description of this invention. These examples are intended to illustrate certain specific aspects of the invention, but are not intended to limit or limit the scope of the invention disclosed herein. In the present invention, it should be understood that various embodiments are possible based on the spirit of the present specification.

All the examples are carried out using standard techniques, or can be carried out except as described in detail elsewhere, which are well known and conventional to those skilled in the art. On the other hand, in the following examples, unless otherwise indicated, the specific operation and processing conditions are J. Sambrook, EF Fritsch & T. Maniatis, "Molecular Cloning", 2nd ed., Cold Spring Harbor Laboratory in DNA cloning. , Cold Spring Harbor, NY (1989) and DM Glover et al. ed., "DNA Cloning", 2nd ed., Vol. 1 to 4, (The Practical Approach Series), IRL Press, Oxford University Press (1995); In the case of using the PCR method, H. A. Erliched., PCR Technology, Stockton Press, 1989; D. M. Glover et al. ed., "DNA Cloning", 2nd ed., Vol. 1, (The Practical Approach Series), IRL Press, Oxford University Press (1995) and M. A. Innis et al. ed., "PCR Protocols", Academic Press, New York (1990), and in the case of using commercially available reagents or kits, the protocols and attached drugs I'm using

Example 1

(A) Construction of galectin 9 modified expression vector

In preparation of expression vector,

(1) cDM prepared from poly (A) ⁺ RNA fraction of Jurkat cells

(2) pET-11a vector (STRATAGENE)

(3) PCR primers:

G9NCRD1: CGTCCTCATATGGCCTTCAGCGGTTCCCAG SEQ ID NO: 10

G9NCRD6: CGACCGCATATGCTGGAAGCTGATGTAGGACAG SEQ ID NO: 11

G9CCRD5: CGTCCTCATATGACTCCCGCCATCCCACCTATG SEQ ID NO: 12

G9CCRD6: CGACCGGGATCCCTATGTCTGCACATGGGTCAG SEQ ID NO: 13

Was used.

Jurkat cells (T cell-derived cells) were obtained from the American Type Culture Collection (ATCC). The cell lines were maintained at 37 ° C. under conditions of 5% CO ₂ in RPMI-1640 medium (Sigma, St. Louis, USA) to which 10% FCS was added. Extraction of total RNA from Jurkat cells was performed in the following manner. That is, Jurkat cells cultured using RPMI-1640 medium containing 10% FBS are collected by centrifugation. Wash cells twice with 10 ml PBS. To precipitate of the washed cells, 15 ml of ISOGEN (trade name: Nippon Gene) per 2 × 10 ⁸ cells is added, and total RNA is extracted according to the manual (Nippon Gene). Purification of poly (A) ⁺ RNA from total RNA and cDNA synthesis were carried out in the following manner. That is, total RNA extracted from Jurkat cells is dissolved in DEPC treated water so as to have a concentration of 1 mg / ml. Purify poly (A) ⁺ RNA from the total gun according to the manual using the PolyATtract mRNA Isolation System (trade name: Promega). Purified poly (A) ⁺ RNA is dissolved in DEPC treated water to a concentration of 5 μg / 20 μl.

Using the First-Strand cDNA Synthesis Kit (trade name: Amersham Biosciences), cDNA is synthesized from 5 μg of poly (A) ⁺ RNA according to the manual (Not Id (T) ₁₈ is used for the primer).

Subsequently, the N-terminal carbohydrate recognition domain (NCRD) and C-terminal sugar chain binding domain (CCRD) of galectin 9 are added to the NdeI-BamHI site of the pET-11a vector in the order shown in FIG. 1. ) Was inserted to prepare an expression vector of modified galectin 9 (G9NC (null)) missing the linker peptide. First, cDNA corresponding to C-terminal CRD of human galectin 9 and cDNA corresponding to N-terminal CRD of human galectin 9 were obtained from galectin 9 cDNA, respectively. That is, cDNA (G9CCRD) corresponding to the C-terminal CRD of human galectin 9 was amplified from the cDNA using a primer for PCR: G9CCRD5 + G9CCRD6. G9CCRD was digested with a restriction enzyme (NdeI + BamHI), and then inserted into a pET-11a vector treated with the same restriction enzyme to obtain pET-G9CCRD. PCR was performed using a KOD DNA polymerase kit (TOYOBO Code No. KOD-101). PCR Reaction mixtures (dNTP mix, 25 mM mgCl ₂ , 10 × buffer, KOD DNA polymerase (0.05u), primers and template cDNA) were reacted under the following PCR cycle conditions: after 2 min treatment at 94 ° C. The cycle (15 seconds at 98 ° C., then 2 seconds at 65 ° C., and 30 seconds at 74 ° C.) was performed 25 times, and finally the reaction was stopped at 4 ° C. Insertion of the PCR amplified fragment into the vector was performed using a Ligation high kit (TOYOBO Code No. LGK-101). The reaction was carried out by mixing the molar ratio of the insert: vector at about 5: 1, adding 1/2 of the total volume of the DNA solution (volume), and reagent Ligation high. It inserted by making reaction for 16 hours (0 / N) at 16 degreeC.

On the other hand, from the galectin 9 cDNA, cDNA (G9NCRD) corresponding to the N-terminal CRD of human galectin 9 was amplified using a primer for PCR: G9NCRD1 + G9NCRD6. After G9NCRD was digested with restriction enzyme (NdeI), the obtained fragment was treated with the same restriction enzyme (NdeI) and inserted into dephosphorylated pET-G9CCRD to obtain pET-G9NC (null). PCR amplification and insertion into the vector were performed in the same manner as described above. pET-G9NC (nu11) codes for a polypeptide having an amino acid sequence in which 29 amino acid sequences from human 149th Pro to 177th Ser of M-type galectin 9 are replaced with His-Met sequences. That is, the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 is encoded by having the nucleotide sequence represented by SEQ ID NO: 1.

(B) Expression and Purification of Galectin 9 Modified Recombinant Protein

The expression plasmid vector pET-G9NC (null) obtained in step (A) was introduced into Escherichia coli (BL21 (DE3)). Introduction was performed by the electroporation method. That is, competent BL21 (DE3) and the plasmid vector aqueous solution were mixed, and transfection was performed by the electroporation method at the voltage of 1.8 kV.

Expression of the recombinant protein was determined by incubating E. coli in 2% YW medium containing 2% (w / v) glucose and 100 μg / ml ampicillin, and at a point where the absorbance at 600 nm reached 0.7, 0.1 M isopropyl-β. -D-thiogalactopyranoside was added (final concentration, 0.1 mM) to induce expression of the recombinant protein. After 18 hours of incubation at 20 ° C, the cells were collected by centrifugation and suspended in 10 mM Tris-HCl (pH 7.5), 0.5 M NaCl, 1 mM DTT, and 1 mM PMSF. The suspension was sonicated for 10 minutes, then 10% (w / v) Triton X-100 was added (final concentration, 1%) and stirred at 4 ° C. for 30 minutes. After centrifugation at 15,000 xg for 30 minutes, the recombinant protein in the obtained supernatant was purified by affinity chromatography using lactose-agarose.

As a result, a high purity product was obtained with a relatively high yield. The result of the electrophoresis of the obtained recombinant protein is shown in FIG. SDS-PAGE conditions were as follows: Gel, Acrylamide-BIS (12% gel), electrophoresis buffer, 25 mM Tris-192 mM glycine-0.1% SDS, run condition, 180 V, 45 min, staining, CBB, 60 ° C./30 minutes. The electrophoretic samples were adsorbed to Strata Clean ^™ Resin (Stratagene), 1 × sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% (w / v) SDS, 5% (W / V) 2-ME, Glycerol) was adjusted to 0.2 mg / ml, and electrophoresis was performed at a protein amount of about 2 μg per lane after heat treatment at 98 ° C./3 min.

Purified G9NC (null) was stably stored at 4 ° C for 90 days or more. On the other hand, wild type galectin 9 (M-type, G9 (M)) was mostly degraded within two weeks under the same preservation conditions (see Figure 3). This degradation is thought to be due to E. coli-derived protease contained in the purified galectin standard.

Example 2

The susceptibility to proteases present in human tissues was compared with wild type galectin 9 (S-type, G9 (S): isoform with the shortest linker peptide) and G9NC (null). 1/100 (weight ratio) of matrix metalloproteinase-3 (MMP-3) or elastase was added to the galectin dissolved in PBS and kept at 37 ° C. In either case, most of G9 (S) was decomposed in 1 to 2 hours, while G9NC (null) was not decomposed at all even after 2 hours (see FIGS. 4 and 5).

Example 3

To investigate the effect of mutant introduction on the biological activity of galectin 9, we examined apoptosis-inducing activity on MOLT-4 cells (human Tcell leukemia-derived cell line) and eosinophil chemoattractant activity (ECA activity) on peripheral blood eosinophils. Reviewed.

(a) cell culture

MOLT-4 (T cells) was obtained from ATCC. The cell lines were maintained at 37 ° C. under 5% CO ₂ conditions in RPMI-1640 medium (Sigma, St. Louis, USA) to which 10% FCS was added. In order to inhibit the activity of Gal-9, 30 mM lactose may be added to the culture medium. The same concentration of sucrose was used as a control.

(b) apoptosis measurements

(1) Analysis of cell cycle (apoptosis) by PI (PI method)

After centrifuging the apoptosis induced cells at 1000 rpm for 4 minutes at 4 ° C., the cell pellet was resuspended in PBS (300 μl), and vortexed while slowly adding 100% cold ethanol (700 μl) to the cell suspension. The final concentration is 70% ethanol. Cells are fixed by incubation at 4 ° C. for 30 minutes, followed by centrifugation at 1000 rpm for 4 minutes at 4 ° C. by addition of PBS (1 ml), and the cell pellet is resuspended in PBS (440 μl). Cells were incubated at 37 ° C. for 30 minutes with 2.5 mg / ml ribonuclease A (10 μl; final concentration 50 μg / ml, Sigma, St. Louis, Missouri, USA), followed by 2.5 mg / ml of iodide prop Incubation was performed in the dark at 4 ° C. for 10 minutes with sodium (4 μl; PI, 20 μg / ml final concentration, Sigma). After removing the aggregated cells by passing the nylon mesh, the cells were massed up with PBS, and the stained cells were flow cytometer (Sandstrom, K. et al., J Immunol Methods, 240: 55 (2000) and Zhang L.). et al., Cancer Lett, 142: 129 (1999)).

(2) TUNEL (TdT-mediated marker dUTP nick end labeling) method

A nucleotide (dUTP-biotin or FITC-dUTP, etc.) labeled with an enzyme (TdT; terminal deoxynucleotidyl transferase) that adds nucleotides to the DNA terminal is inserted at the terminal resulting from fragmentation of DNA. Detects fragmentation of nuclear DNA, a salient feature of apoptosis. In the experiment, MEBSTAIN Apoptosis Kit Direct (MBL, Nagoya, Japan) was used. In accordance with the instruction by the kit supplier, the experiment was performed as follows. That is, apoptosis-induced cells (about 2 × 10 ⁵ cells / sample) were washed with PBS containing 0.2% FSA, followed by adding 4% paraformaldehyde (in 0.1 M NaH ₂ PO ₄ , pH 7.4) to 4 After immobilization at 30 DEG C for 30 minutes, washing with PBS containing 0.2% FSA was performed. 70% cold ethanol was added to the cell pellet and incubated at -20 ° C for 30 minutes to enhance permeability. After washing with 0.2% FSA-containing PBS, TdT reaction solution (mixture of TdT, FITC-dUTP and TdT buffer) was added to the cell pellet, stirred and incubated for 1 hour at 37 ° C, and incubated with 0.2% FSA-containing PBS. After washing, the cells were resuspended in 0.2% FSA-containing PBS and stained cells were analyzed by flow cytometry.

(c) T cell analysis

24 well plates were incubated with TBS solution (pH 8.0) of 3 μg / ml anti-CD3 antibody (Immunotech, Marseille, France) at 4 ° C. overnight, then the anti-CD3 antibody solution was removed and the wells were washed with PBS To obtain a well plate coated with an anti-CD3 antibody.

Mononuclear leukocyte cell fractions from heparin supplemented blood were isolated using HISTOPAQUE®, SIGMA. Subsequently, using a CD4-positive isolation kit (DYNAL, Oslo, Norway) and Dynabeads M-450 CD8 (DYNAL, Oslo, Norway), as described by the kit manufacturer, CD4 positive T cells and CD8 positive T cells were isolated, respectively. In order to activate T cells, cells in which CD4 positive T cells or CD8 positive T cells were 1 × 10 ⁶ cells / ml in RPMI-1640 containing 10% FCS were coated with anti-CD3 antibody at 37 ° C. for 20 to ²⁴ hours. The plates were incubated in a 5% CO ₂ incubator followed by incubation in a 5% CO ₂ incubator at 37 ° C. with recombinant galectin 9 (wild type G9 (S) or modified G9NC (null)). Subsequently, apoptosis analysis was performed in the same manner as in the above (b). That is, the cells were incubated for 10 minutes in the dark with 50 μg / ml of PI (Sigma) at 37 ° C. Stained cells were analyzed by flow cytometer (Sandstrom, K. et al., J Immunol Methods, 240: 55 (2000) and Zhang L. et al., Cancer Lett, 142: 129 (1999)).

Even for inactivated (resting) T cells, after incubation with a recombinant galectin 9 (wild type G9 (S) or modified G9NC (null)) in a 5% CO ₂ incubator at 37 ° C, Apoptosis analysis was performed.

(d) results

Examination of DNA fragmentation following apoptosis by agarose gel electrophoresis and FACS showed that, even when either method was used, G9NC (null) maintained apoptosis-inducing activity equivalent to or higher than G9 (S). (FIG. 6, Table 1). As a result of examining the ECA activity by the chamber method, G9NC (null) showed higher activity compared to G9 (S) (FIG. 7).

% Of apoptotic MOLT-4 cells contrast 0.1 μM 0.3 μM 0.5 μM 1 [mu] M G9 (M) 4.2 5.5 13.8 28.9 58.8 G9 (S) 4.5 8.7 23.6 44.7 64.0 G9NC (null) 5.1 11.5 33.9 57.8 72.1

Table 1 shows the results of comparing the biological activity between wild type galectin 9 (G9 (S)) and galectin 9 modified (G9NC (null)), and apoptosis inducing activity (MOCS analysis) on MOLT-4 cells. ).

Example 4

[One. Expression of Galectin 9 in Rheumatoid (RA) Syndrome]

[Way]

Patient tissues used samples of RA synovial tissue that met the American Society of Rheumatology (ACR) classification criteria. The immunohistostaining of the patient's tissue sample was performed by the following method. Preparation of the sample fragment was as follows. (1) Deparaffin: 3 times of xylene (10 minutes each), 100% alcohol, 90% alcohol, 75% alcohol (2 minutes each). (2) Microwave (MW) treatment: A 10 mM citric acid buffer (pH 6.0) is prepared before use. Sections were immersed in a buffer previously boiled with MW and boiled for MW (5 minutes x 3 times for a 500 w microwave oven, for 15 minutes in total). It is left to stand at room temperature for 20 minutes, and it cools slowly. (3) Inactivation of endogenous peroxidase: 0.3% hydrogen peroxide / methanol is prepared as needed and soaked for 30 minutes. PBS wash 5 minutes x 3 times. Block 4% BSA with 4 drops of Pasteur pipette. Wet box 1 hour room temperature.

Add 6 drops of primary or control antibody into Pasteur from the top of the sample section. Wet box overnight at 4 ° C. Next day, PBS wash 5 minutes x 3 times. Add 6 drops of peroxidase labeled secondary antibody (DACO Envision ⁺ ). Wet box 1 hour room temperature. PBS wash 5 minutes x 3 times.

Color development with DAB (3,3'-diaminobenzidine-tetrahydrochloride) reagent: Prepare DAB reagent. Moisten the sections and develop for 3 minutes. Immediately stop the color reaction with tap water. Nuclear stained Meier hematoxylin 20 seconds. Immediately flush with water for 15 minutes. Dewatering, iron, encapsulation. 75% alcohol, 90% alcohol, 100% alcohol (2 minutes each), xylene 3 times (3 minutes each).

[result]

The results are shown in FIG. 53. Galectin 9 is selectively expressed in cell groups around synovial cells and lymphatic follicles or endothelial cells of dendritic blood vessels in follicles. Almost no galectin 9 positive cells are identified in OA (deformed arthrosis) (see FIG. 53). Galectin 9 is a molecule that is strongly induced in synovial cells, lymphoid cells, and neovascularization, which are essential for RA synovial tissue proliferation. On the other hand, galectin-1 is detected in synovial cells or perivascular cells, and galectin 3 is detected throughout RA synovial constituent cells.

[2. Apoptosis Inducing Activity of Synovial Cells by Galectin-9]

[Way]

We studied the action of galectin 9 on synovial cells that cause joint destruction. The synovial membrane was aseptically collected synovial tissue of a rheumatic patient, and the cells were isolated and cultured. It was used for the experiment after one or two passages. The tissue of this experiment was a 67 year old female, right knee RA. Synovial cells were seeded and then cultured overnight. After confirming the adhesion, rhGa1-9 (hG9NC (null), rhGal-9S, rhGal-9M) was added to a final concentration of 0, 0.03, 0.1, 0.3, 1.0 μM. After culturing for 72 hours, the result was observed under an optical microscope, and the cells were recovered, and the apoptosis induction activity was measured by the PI method. The apoptosis inducing activity was measured in the same manner as in Example 3.

[result]

The result of optical microscope observation is shown in FIG. The measurement result of apoptosis induction activity by PI method is shown in FIG.

The galectin 9 modified substance (Gal-9 (NC-Null)) has stronger apoptosis inducing activity than the native galectin 9 (Gal-9 (M), Gal-9 (S)). Apoptosis inducing activity was confirmed for concentration dependence in all recombination. This apoptosis inducing activity was inhibited by lactose (30 mM), but was not affected by sucrose (30 mM).

[3. Comparison of Apoptosis Inducing Activity and Proliferation Inhibitory Activity of Synovial Cells by Galectin]

[Way]

The action of human galectins (Gal-1, Gal-3, Gal-8 (M), Gal-9NC (null)) on synovial cells was examined.

The synovial membrane was aseptically collected synovial tissue of a rheumatic patient, and the cells were isolated and cultured. After 1-2 passages, after confirming the adhesion of synovial cells seeded overnight, human galectin (Gal-1, Gal-3, Gal-8 (M), Gal-9NC (nu11)) was added to a final concentration of 0, 0.01. , 0.03, 0.1, 0.3, 1.0 μM was added. Cells were harvested after culturing for 24 hours, and apoptosis induction activity was measured by PI method. The proliferation inhibitory effect of synovial cells is added to each well of a 96 well plate so that human galectin is at a final concentration of 0, 0.03, 0.1, 0.3, 1.0 μM, and cultured for 48 hours. After incubation, the plate was washed with PBS and strong fluorescence (λex = 490 nm, λem = 515 nm, using a cell counting kit-F (Dojingaku, cat. No. 343-07743)). ) Viable cell number was measured with a fluorescent plate reader.

[result]

Fig. 56 shows the results of the apoptosis inducing activity measurement, and the results of measuring the proliferation inhibitory activity of the synovial cells are shown in Fig. 57 (hGalectin 1 is recombinant human galectin 1 and hGalectin 3 is recombinant human galectin 3 in the figure). HGalectin8 (M) represents recombinant human galectin 8M, hGalectin 9 represents hGal-9NC null). Inhibiting proliferation of synovial cells is very important in the treatment of rheumatism.

The galectin 9 modified substance (hGal-9 NCnull) is useful as an antirheumatic drug because it induces apoptosis of proliferated synovial cells and suppresses proliferation of synovial cells. Other actions do not confirm this action.

The effects of the galectin 9 variant h-G9NC (null) on mouse models of various inflammatory diseases, namely acute, chronic, allergic and immune system diseases, were investigated.

As a result, it was suggested that the galectin 9-modified substance has an inhibitory or enhancing effect of various inflammations, and also has a control action of various cytokine production, and therefore can control an inflammatory response. The example is described.

In the following Examples [Examples 5 to 12], G9NC (nuLL) [gal9NC (null), h-gal9NC (null), hG9NC (null), or h-G9NC (null): human null galectin 9 (human null galectin-9)] is a thing manufactured by the laboratory of Gal Pharma Co., Ltd. (Kagawa Prefecture, Japan). Dexamethasone (dexamethasone 21-phosphate disodium salt, Sigma-Aldrich, Missouri, USA) was obtained from a supplier.

Example 5

[Zymosan-induced Pleurisy Model]

First, mice were anesthetized with diethyl ether (Wako Pure Chemical), 100 µg of G9NC (null) (or h-gal9NC (null)), 100 µg of Zymoic acid (Sigma-Aldrich), 30 mg of dexamethasone (Sigma-Aldrich) / kg was injected alone or in combination into the thoracic cavity of mice. PBS was used as a control. After 4 hours, a 10-fold dilution of neembutal injection solution (trade name: Pentbarbital, Dainippon Seiyaku Co., Ltd.) in PBS was injected into the abdominal aorta by injecting 0.2 to 0.3 ml intraperitoneally, and blood was collected from the abdominal aorta and blood was collected. As a sample. Thereafter, blood was removed and euthanized, the intrathoracic cavity was washed twice with PBS (1 ml), and recovered as a chest cavity washing solution sample.

The blood sample was centrifuged at 5000 rpm for 10 minutes after standing at room temperature, the supernatant was recovered as a serum sample, and cryopreserved. Thoracic lavage fluid samples were counted in total cell numbers with Turk's solution. After counting, part of it is suspended on the cytospin, dried in the wind, dyed and inspected with Deep Quick (Kokusai Shiyaku Co., Ltd.) or May Green World Liquid (Mutogagaku Co., Ltd.) and Kimja Liquid (Merck Japan Co., Ltd.). Neutrophils, eosinophils, macrophages, lymphocytes and other mast cells in 200 were counted. The results are shown in FIGS. 9 and 10.

Example 6

[PMA-induced Dermatitis Model]

Phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich, Missouri, USA) was obtained from the supplier. For administration to animals, the compound was suspended in PBS (-) of a vehicle (carrier, vehicle) and used for all experiments (also in the following examples).

Balb / c mice (7 weeks old) were purchased from SLC (Shizuoka Prefecture, Japan). Animals were kept under standard conditions of 12 hours day / night rhythm, allowing for free intake of food and water. All animals were cared for by humans in accordance with international guidelines and Japanese law (the same applies to the following examples).

Edema is induced in the ears of mice in the following manner. 15 mg of phorbol 12-myristate 13-acetate (PMA) was dissolved in 30 ml of acetone, and the inside and outside of the right ear of each mouse (BALB / c, female, 7-8 weeks old, SPF, SLC) Applied to the surface. Acetone was applied to the left ear as a control.

G9NC (null), dexamethasone, or vehicle was administered intraperitoneally (0.345 ml / head) 30 minutes prior to PMA application. After PMA application, ear thicknesses at 0, 3, 6, 8 and 24 hours were measured under ether anesthesia using a calibrated thickness gauge (Mitsutoyo, Tokyo, Japan).

Ear edema is represented by (RL)-(R ₀ -L ₀ ). Here, R ₀ and L ₀ represent the thickness of the right ear and the left ear at the start of the experiment (O time), respectively, and R and L represent the values of the thickness at each time point.

Statistical processing of data was performed as follows. Unless otherwise specified, data are expressed as mean ± SEM. Statistical differences in the datasets are interpreted using two-way ANOVA, and differences between groups are Bonferroni post-processed using commercial statistical software (GraphPad Software, Inc., San Diego, USA). It evaluated by the test (Bonferroni Post-Test). P values of <0.05 shall be statistically significant. Details are shown in the drawings (also in the following embodiments). The results are shown in FIG.

Example 7

[Arachidonic Acid-Induced Dermatitis Model]

Arachidonic acid (AA, Sigma-Aldrich, Missouri, USA) was obtained from a supplier. Others are the same as in Example 6.

Edema is induced in the ears of mice in the following manner. 750 mg of arachidonic acid (AA) was dissolved in 30 ml of acetone and applied to the inner and outer surfaces of the right ear of each mouse (BALB / c, female, 7-8 weeks old, SPF, SLC). Acetone was applied to the left ear as a control.

G9NC (null), dexamethasone or vehicle were administered intraperitoneally (0.345 ml / head) 30 minutes prior to AA application. After AA application, at 0, 1, 3 and 6 hours the thickness of the ears was measured under ether anesthesia using a calibrated thickness gauge (Mitsutoyo, Tokyo, Japan). Ear edema is represented by (RL)-(R ₀ -L ₀ ). Here, R ₀ and L ₀ represent the thickness of the right ear and the left ear at the start of the experiment (O time), respectively, and R and L represent the values of the thickness at each time point. Statistical processing of the data was performed in the same manner as in Example 6. The results are shown in FIG.

Example 8

[Capsaicin Induced Dermatitis Model]

Cyproheptadine (cyproheptadine, Sigma-Aldrich, Missouri, USA) and capsaicin (capsaicin, Nakarai, Tokyo, Japan) were obtained from each supplier. Others are the same as in Example 6.

Edema is induced in the ears of mice in the following manner. 500 mg of capsaicin was dissolved in 30 ml of acetone / olive oil (dose ratio = 4/1) and applied to the inner and outer surfaces of the right ear of each mouse (BALB / c, female, 7-8 weeks old, SPF, SLC). Applied. Acetone / olive oil was applied to the left ear as a control.

G9NC (null), dexamethasone, ciproheptadine or vehicle was administered intraperitoneally (0.345 ml / head) 30 minutes prior to capsaicin application. At 0, 0.5, 1 and 2 hours after capsaicin application, the thickness of the ears was measured under ether anesthesia using a calibrated thickness gauge (Mitsutoyo, Tokyo, Japan). Ear edema is represented by (RL)-(R ₀ -L ₀ ). Here, R ₀ and L ₀ represent the thickness of the right ear and the left ear at the start of the experiment (0 hour), respectively, and R and L represent the values of the thickness at each time point. Statistical processing of the data was performed in the same manner as in Example 6. The results are shown in FIG.

Example 9

[DNFB-induced contact dermatitis model]

Dinitro-fluoro-benzene (DNFB, Sigma-Aldrich, Missouri, USA) was obtained from the supplier. Others are the same as in Example 6.

Edema is induced in the ears of mice in the following manner. Each mouse was shaved with 0.5% dinitrofluorobenzene (DNFB) -containing acetone / olive oil (volume ratio = 4/1) (30 ml) 7 days before (day -7) or 6 days before (day -6). Applied to the abdomen, it was sensitized to be a edema model of delayed-type hypersensitivity (DTH) organic. On day 0 of the experiment, 0.3% DNFB-containing acetone / olive oil (dose ratio = 4/1) fluid (30 ml) was induced by topical application to the inner and outer surfaces of the right ear of each mouse. Acetone / olive oil was applied to the left ear as a control.

G9NC (null), dexamethasone, or vehicle was administered intraperitoneally (0.345 ml / head) from 7 days before DNFB induction (day −7) to the start of the experiment (day 0), and 24 hours or 48 hours after DNFB induction. . At 0, 24, 48 and 72 hours after DNFB induction, the thickness of the ears was measured under ether anesthesia using a calibrated thickness gauge (Mitsutoyo, Tokyo, Japan). Ear edema is represented by (RL)-(R ₀ -L ₀ ). Here, R ₀ and L ₀ represent the thickness of the right ear and the left ear at the start of the experiment (0 hour), respectively, and R and L represent the values of the thickness at each time point. Statistical processing of the data was performed in the same manner as in Example 6. The results are shown in FIGS. 14 and 15.

Example 10

[FITC Induced Atopic Dermatitis Model]

Fluorescein isothiocyanate (FITC), Sigma-Aldrich, Missouri, USA was obtained from a supplier. Others are the same as in Example 6.

Edema is induced in the ears of mice in the following manner. 0.5% fluorescein isothiocyanate (FITC) containing acetone / dibutylphthalate (volume ratio = 1/1) solution (400 ml) 7 days before (day -7) or 6 days before (day -6) It was applied to the shaved abdomen of a mouse, and it was sensitized and used as the edema model of FITC organic. At the start of the experiment (day O) 0.5% FITC-containing acetone / dibutylphthalate (dose ratio = 1/1) solution (30 ml) was induced by topical application to the inner and outer surfaces of the right ear of each mouse. Acetone / dibutylphthalate was applied to the left ear as a control.

G9NC (null), dexamethasone or vehicle was administered intraperitoneally (0.41 ml / head) 30 minutes before FITC challenge and 24 hours or 48 hours after FITC challenge. At 0, 24, 48 and 72 hours after FITC challenge, ear thicknesses were measured under ether anesthesia using a calibrated thickness gauge (Mitsutoyo, Tokyo, Japan). Ear edema is represented by (RL)-(R ₀ -L ₀ ). Here, R ₀ and L ₀ represent the thickness of the right ear and the left ear at the start of the experiment (0 hour), respectively, and R and L represent the values of the thickness at each time point. Statistical processing of the data was performed in the same manner as in Example 6. The results are shown in FIG.

Example 11

[Damage model]

Anti-DNP IgE (SPE7), Sigma Aldrich, Missouri, USA) and dinitrofluorobenzene (DNFB), Sigma Aldrich, Missouri, USA are available from each supplier did. Others are the same as in Example 6.

Edema is induced in the ears of mice as follows. Anti-DNP IgE (5 mg / mouse) -containing PBS (-) solution was injected intravenously one day before (day-1) to sensitize to be a biphasic skin reaction model. At the start of the experiment (day O), 0.15% of DNFB-containing acetone / olive oil (dose ratio = 4/1) solution (30 ml) was induced by topical application to the inner and outer surfaces of the right ear of each mouse. Acetone / olive oil was applied to the left ear as a control.

G9NC (null), dexamethasone or vehicle was administered intraperitoneally (0.345 ml / head) 30 minutes before DNFB induction. Ears were measured under ether anesthesia using a calibrated thickness gauge (Mitsutoyo, Tokyo, Japan) at 0, 1, 2, 4, 8 and 24 hours after DNFB challenge. Ear edema is represented by (RL)-(R ₀ -L ₀ ). Here, R ₀ and L ₀ represent the thickness of the right ear and the left ear at the start of the experiment (O time), respectively, and R and L represent the values of the thickness at each time point. Statistical processing of the data was performed in the same manner as in Example 6. The results are shown in FIGS. 17 and 18.

Example 12

[Arthritis Model]

Using DBA / 1J female mice (7 weeks old), a monoclonal antibody cocktail (Chondrex, No. 62100) for causing arthritis was administered 2 mg / 0.5 ml / body to the tail vein of the animal. Three days later, 100 µl of a sample in which 5 µg LPS (SIGMA, L6511) and h-gal9NC (null) of each concentration were mixed in advance was administered intraperitoneally to the animal. After sample administration, the swelling of the left and right anterior / hind limb joints was measured and scored once daily. The results are shown in FIG.

As an acute inflammation model, the effects of h-G9NC (null) in the representative Zymosan-induced pleurisy model (Example 5) and LPS-induced peritonitis model were investigated. In the Zymosan-induced pleurisy model, the inhibitory effect of pleurisy was confirmed by intraperitoneal administration of 100 μg of h-G9NC (null). On the other hand, h-G9NC (null) alone does not particularly affect mice. In addition, h-G9NC (null) also influences carrageenan and f mlP induced pleurisy models.

In the LPS-induced peritonitis model, changes in the production of cytokines (IFN-γ, IL-4, IL-12, IL-10, etc.) in serum induced by inflammation were confirmed by h-G9NC (null). It is becoming. For example, after simultaneous administration of LPS and h-G9NC to the mouse abdominal cavity, blood was collected from the mouse orbit after 6 hours, 12 hours, and 24 hours, and IFN-γ levels in the serum were measured. Induced transient elevation of IFN- [gamma] was confirmed, but the elevation (induction) of IFN- [gamma] was suppressed depending on the dose of h-G9NC (null) in the h-G9NC (null) coadministration group. This suggests that h-G9NC (null) regulates cytokine production, thereby controlling inflammation.

Moreover, the inhibitory effect of h-G9NC (null) was also confirmed in the steroid-sensitive (PMA-induced) and steroid-insensitive (arachidonic acid-induced) inflammation models (Examples 6 and 7) and capsaicin-induced inflammation models (Example 8). It became.

As allergic inflammation, the effects of h-G9NC (null) on the DNFB induced contact dermatitis model, the FITC induced atopic dermatitis model, and the anti-DNP monoclonal IgE antibody sensitized dam margin model were investigated. For example, in the DNFB-induced contact dermatitis model of Example 9, h-G9NC (null) was administered intraperitoneally, and the effect was examined by a skin reaction with edema as an index. As a result, the inhibitory effect was confirmed by 1, 10, and 100 micrograms of h-G9NC (null), and the remarkable weight loss resulting from dexamethasone administration was not confirmed. In the FITC-induced atopic dermatitis model of Example 10, intraperitoneal administration of h-G9NC (null) confirmed the effect of h-G9NC (null) on the induction phase. In addition, 1, 10, and 100 μg of h-G9NC (null) were intraperitoneally administered to the anti-DNP monoclonal IgE antibody sensitized murine model mouse of Example 11, respectively, and the bilayer skin reaction by antigen application (DNFB) This was suppressed.

As one autoimmune disease model, examples of h-G9NC (null) for antibody cocktail induced arthritis are described. H-G9NC (null) also has an effect on adjuvants and collagen joint models. For example, in Example 12, inhibition was also confirmed at 1 µg of h-G9NC (null).

Example 13

[Induction of Apoptosis (Cellular Disruptive Activity) in Tumor Cells of 9 Galectin Variants]

[Experimental Method]

3 × 10 ³ cells / 90 μl of each cell suspended in RPMI (SIGMA) 10% FBS (JRH) was placed in a 96 well plate (FALCON) and cultured for 24 hours (37 ° C., 5% CO ₂ ), followed by galectin. Nine modified variants (h-G9NC (null)) are added (10 µl) to a final concentration of 0.03 to 1 µM and incubated for 24 hours. After incubation, 10 μl of WST-1 reagent (Roche, 1644807) was added to each well, and reacted for 2 to 4 hours at 37 ° C. and 5% CO ₂ conditions, and then absorbance at 450 nm was measured with a plate reader. . Apoptosis (cell interference activity) induction evaluation in each tumor cell was performed as Viability (%) = [(absorbance -Blank of a sample)] / (absorbance -Blank of a negative control)] x100.

The used tumor cells are shown in Table 2.

In Table 2, "Cell name" is the cell name, "Animal" is the animal species derived from the tumor cell, "1 μM killing" is the killing (%) at the time of addition of 1 μM of the gamut of 9 modified proteins, "Tissue" represents the tissue-organ part derived from the cell.

[result]

Table 2 shows the results of the induction of apoptosis (cell interference activity) by galectin 9 variants (h-G9NC (null)) in cultured cells. As a result, nine variants of galectin are

1) Effective against hematopoietic tumors

2) Effective against non-epithelial malignancies such as malignant melanoma and adenocarcinoma

3) Effective against epithelial malignancies such as gastric cancer, pancreatic cancer and lung cancer

Was judged.

Example 14

[Anti-tumor Activity (anticancer Effect) in a Subcutaneous Transplantation Model of 9 Galectin Variants]

[Experimental Method]

LLC cells were used as target tumor cells. Cultured cells (1 × 10 ⁶ cells / 100 μl) were reacted with 9 variants of galectin (h-G9NC (null), 100 μg / 100 μl) or 100 μl of physiological saline at 37 ° C. for 1 hour, and then C57BL6 mice Injected subcutaneously in the back. Tumor diameter (long axis, short axis) was measured.

Further, 5 weeks after transplantation, the administered skin site (tumor) was cut out, the histopathological sample was immobilized with a 10% neutral buffered formaldehyde solution, and paraffin-embedded tissue was sectioned and stained with HE reagent.

[result]

In FIG. 20, the result of the tumor cell proliferation inhibitory effect, ie, an antitumor activity (anticancer effect) measurement of the galectin 9 modified body in a subcutaneous transplantation model is shown. 21 shows the results of investigating antitumor activity (anticancer effect) by histopathological analysis. In the figure, Gal9 (n) and Gal9 represent galectin 9 modifications (h-G9NC (null)), and 5W represents 5 weeks.

In LLC cultured in the presence of galectin 9 variants (h-G9NC (null)), obvious morphological changes of cancer cells were observed under a phase contrast microscope. At this time, the galectin 9 variants reduced dose of live cells of LLC (MTT assay), leading to a decrease in DNA synthesis ability ( ³ H-Thymidine yield), and to boost LDH release in culture supernatant. The antitumor effect of the galectin 9 variants was also confirmed in human lung cancer cell lines H226 (squamous carcinoma), A549 (adenocarcinoma), and H69 (small cell carcinoma). On the other hand, the amount of Annexin V expression of LLC was significantly increased in the presence of 9 galectin variants.

On the other hand, when LLC was inoculated subcutaneously of the same strain of mouse C57BL6 in the presence of the galectin 9-variant coexistence, the tumor did not engraft and there was a clear difference from the control group at 5 weeks after inoculation. Mouse survival was significantly improved in the presence of galectin 9 variants. Galectin 9 variants have been shown to induce apoptosis in cancer cells and to exert antitumor effects.

In the multi-long-term metastasis model of lung cancer by intravenous injection of human small cell lung cancer cell line H69 cells into nude mice, the metastasis inhibitory effect has also been confirmed by intraperitoneal administration of 9 galectin variants.

Example 15

[Induction of Apoptosis (Cellular Disruptive Activity) in Cultured Tumor Cells of Galectin 9 Variants]

[Experimental Method]

(1) Apoptosis of Meth A Cells

RPMI (SIGMA) into ⁴ × 10 4 gae / 90 ㎕ a Meth A was suspended in 10% FBS (JRH) in 96 well plates (FALCON), the lectin nine variants (h-G9NC (null)) at the same time, 1 to go 30 µg / ml (10 µl) is added and cultured for 24 hours (37 ° C, 5% CO ₂ ). After 24 hours, cells were washed once with 200 μl of PBS (−), suspended in Annexin V Binding Buffer (BD PharMingen), and with Annexin V-PE (BD PharMingen). Amino-actinomycin D was added, reacted for 15 minutes at room temperature in the dark, and analyzed by FACS calibur (Becton, Dickinson).

(2) Apoptosis of B16 / F10 Cells

⁴ × 90 μl of B16 / F10 suspended in RPMI (SIGMA) 10% FBS (JRH) was put into 96 well plate (FALCON), and cultured for 24 hours (37 ° C., 5% C0 ₂ ). Nine lectins (h-G9NC (null)) were added (10 µl) to a final concentration of 1 to 30 µg / ml and incubated for 24 hours. After 24 hours, the cells were washed once with 200 µl of PBS (-), treated with 0.05% trypsin EDTA (GIBCO), then washed once with culture, and further with PBS (-). Then, it was suspended in annexin V binding buffer (BD PharMingen), annexin V-PE (BD PharMingen) and 7-amino-actinomycin were added, reacted for 15 minutes at room temperature in the dark, and FACS calibur ( Becton, Dickinson).

[result]

22 and 23 show the results. Fig. 22 shows the results of apoptosis induction analysis of Meth A cells by galectin 9 variants (h-G9NC (null)). Fig. 23 shows the results of apoptosis induction analysis of B16 / F10 cells by galectin 9 variants (h-G9NC (null)).

Example 16

[Anti-tumor Activity (anticancer Effect) in the Cancerous Peritonitis Model of 9 Galectin Variants]

[Experimental Method]

(1) Meth A cells: PBS - was inoculated with the prepared cells ⁽⁵ × 10 5 gae / 100 ㎕) in the peritoneal cavity of BALB / c mice (SLC, 6-week old females, n = 3) ().

The nine gamut of galectin (h-G9NC (null), 100 µg / 300 µl) were administered daily up to 18 days after inoculation of the cells intraperitoneally. The survival rate was compared by dividing into 4 groups (n = 10) after 1) Meth A cell inoculation at the start of administration, 2) 3 days later, 3) 7 days later, and 4) 10 days later.

(2) B16 / F10 cells: was inoculated with cells ⁽⁵ × 10 5 gae / 100 ㎕) into the abdominal cavity of C57 / BL6 mice (SLC, 6-week-old female). Immediately after inoculation, nine concentrations of galectin (h-G9NC (null), 10, 30, 100 µg / 300 µl) of each concentration were intraperitoneally administered for 14 days and daily administration. Survival rates were compared. Organs were observed 14 days after inoculation.

[result]

24 to 27 and 48 show the results. Fig. 24 is a survival curve, showing that the galectin 9 variants have antitumor effects in the cancerous peritonitis model by Meth A cells. FIG. 25 shows photographs showing the state of mice in the galectin 9-modified (Gal9) non-administered group (top) and the administration group (bottom). Fig. 26 is a survival curve showing that the galectin 9 variants have antitumor effects in the cancerous peritonitis model by B16 / F10 cells. FIG. 27 shows the visceral tissue photographs in which the state of the cancerous peritonitis model mouse by B16 / F10 cells is compared with that of the galectin 9-modified (Gal-9) -administered group. 48 shows intraperitoneal administration of 9 galectin variants (h-G9NC (null), 100 μg / mouse) or a vehicle (vehicle) daily to mice inoculated with LLC cells (1 × 10 ⁶ cells) intraperitoneally. Is shown (daily administration from Day 0, 7 mice in each group). In mouse cancer peritonitis model (Meth A, B16 / F10 cells, LLC cells), the life-saving effect by G9NC (null) administration (intraperitoneal administration at the time of cancer cell inoculation and administration after cancer cell inoculation) is confirmed. .

Meth A cells, LLC cells are cells in which apoptosis is induced by galectin 9 variants. However, B16 / F10 cells do not induce apoptosis by galectin 9 variants.

For B16 / F10 cells, galectin 9 variants have been found to inhibit cancer cell binding to extracellular matrix in a concentration dependent manner. Moreover, in the cancerous peritonitis model by B16 / F10 cells, NK and NKT cells in peritoneal fluid increased in the G9NC (null) administration group compared with the control group. B16 / F10 melanoma cells are resistant to apoptosis by stabilizing galectin 9, and the improvement in viability and the inhibition of adhesion of melanoma cells to the abdominal wall have been confirmed. The antitumor effect of the galectin 9 variants in the cancerous peritonitis model also suggested the inhibition of adhesion of tumor cells to extracellular matrix, that is, the inhibition of infiltration of inflammatory cells, and the involvement of immune cells such as NK and NKT cells.

Example 17

[Interpretation of B16 / F10 Intraperitoneal Infiltrating Cells]

[Experimental Method]

⁵ µl / 200 µl of B16 / F10 suspended in PBS (-) was implanted into the abdominal cavity of C57 / BL6 mice (SCL) and 30 µg of galectin 9-modified substance (h-G9NC (null)) / 300 μl intraperitoneally administered, 24 hours later, peritoneal cells are harvested and suspended in PBS (-). After reaction with purified antimouse CD16 / CD32 (2.4G2) (BD PharMingen) at 4 ° C. for 5 minutes, each antibody [PE antimouse CD122 (TM-β-1) (BD PharMingen), FITC antimouse TCR β-chain (H57-597) (BD Phar mlngen), PE anti mouse CD11b (M1 / 70) (BD PharMingen), APC-labeled anti mouse CD11c (HL3) (BD PharMingen), APC anti mouse CD8a (BD PharMingen) , FITC anti-mouse CD4 (BD PharMingen)] was reacted at 4 ° C. for 30 minutes and analyzed by FACS calibur (Becton, Dickinson).

[result]

The results are shown in FIG. In comparison with the PBS-administered group, the recruitment of the galectin 9-modified group (30 µg) confirmed the recruitment of cells involved in immunity such as NK / NKT cells in the abdominal lavage fluid.

Example 18

[Adhesion Inhibitory Activity of B16 / F10 Cells by Galectin 9 Variants]

[Experimental Method]

Galline 9-modified (h-G9NC) (h-G9NC) in 96 well plates (CHEMICON) coated with collagen type I, collagen type I (IV), laminin, fibronectin, and vitronectin null)) and 10 μl each to a final concentration of 1-30 μg / ml, and 4 × 10 ⁴ / well (90) of B16 / F10 suspended in RPMI (SIGMA) 0.02% BSA (Wako) on the plate. 1 µl) was inoculated and incubated for 1 hour (37 ° C., 5% CO ₂ ). After 1 hour, the supernatant was removed, washed twice with 200 μl of PBS (−), and then 90 μl of RPMI 0.02% BSA and 10 μl of WST-1 (Roche) were added and incubated for 2 to 3 hours. Finally, the absorbance of 450-600 is measured using a plate reader, and it calculates by adherence (%) = ((absorbance-Blank / (absorbance of negative control-Blank) of a sample)) x100.

[result]

The results are shown in FIG. Binding of B16 / F10 cells to each extracellular matrix (type I collagen, type IV collagen, laminin, fibronectin, vitronectin) was inhibited by galectin 9 variants (described as stabilizing galectins in the figure). The inhibitory effect was confirmed in a concentration dependent manner of the galectin 9 variants.

Subsequently, biological activity against inflammation caused by galectin 9 variants was investigated. 9 variants of galectin for inflammation, arthritis, which is classified as type I, bronchial asthma, which is classified as type I, autoimmune hemolytic anemia, which is classified as type II, and Arthus response, which is classified as type III (vasculitis) The activity of the was investigated.

Example 19

[Der f-induced AHR model]

[Experimental Method]

Dexamethasone (dexamethasone 21-phosphate disodium salt, Sigma, Missouri, USA), methacholine (MCh), Sigma, Missouri, USA) and Allergenic Extract mixed Insects MITE: house dust mite ( D. Farinae, Derf)) obtained from the suppliers indicated there. For administration to animals, the compounds were suspended in it using PBS (-) as the carrier in all experiments.

Balb / c mice (7 weeks old) were purchased from SLC (Shizuoka, Japan). The animals were reared in a standard state of rhythm, day and night, every 12 hours, allowing for adequate food and water intake. All animals were managed by human hands in accordance with international guidelines and domestic law.

Induction of Asthmatic Hypersensitive Response (AHR) in mice was performed in the following manner.

In order to induce airway hypersensitivity to methacholine and eosinophil infiltration into the airway tissues of mice, male mice were sensitized and then induced treatment using the tick antigen (Der f) as an allergen. Immunized mice by intranasal administration on day 0, 7 and 20 with 0.05 ml Der f (0.5 mg / ml), followed by treatment with Der f in 1% aerosol for 30 minutes using a nebulizer Caused. Animals in the control group received administration of conventional PBS (0.05 ml) via intranasal, on days 0, 7 and 20, then treated with PBS with a nebulizer for 30 minutes.

To investigate the effects of galectin 9 variants (h-G9NC (null)) and dexamethasone, mice were treated with galectin 9 variants (h-G9NC (null) before and after Der f and after Der f. ) 100 μg / 410 μl (in PBS) / body, or dexamethasone 3 mg / 200 μl (in PBS) / kg (body weight) were administered intraperitoneally, respectively.

Bronchoalveolar lavage fluid (BAL fluid) was taken from each animal as a sample. The total lung airflow in unconsciously restrained mice was measured by an unrestrained whole body plethysmograph (PULMOS-I; M.I.P.S, Osaka, Japan). The difference in pressure between the chamber containing the mouse and the control chamber was used to determine the air flow rate, ventilation volume, frequency of breathing, and specific airway resistance (sRAW) per minute. Airway resistance is a dimensionless parameter that is a function of the total lung volume of the mouse during the breathing cycle. Mice were treated with aerosol PBS (as a baseline measurement) or MCh (6-25 mg / ml) for 2 minutes, measured and averaged 100 breaths after spray therapy treatment. The number of suspended cells (cells / ml) was stained with Turk's solution, measured by a hemocytometer to obtain cytospin preparations, and the Gimessa-May-Grunwald solution. Morphological characterization using to determine the difference between the cells. On each slide, 200-500 leukocytes were counted.

[result]

The results are shown in Figures 30, 31 and 32. In the figure, each value represents the mean ± S.E. of seven animals. Statistical differences were analyzed using one-way ANOVA. Differences between groups were assessed using Dunnett's Multiple Comparison Test (* p <0.05, ** p <0.01, *** p <0.001). From FIG. 30 it is clear that administration of h-G9NC (null) [Gal-9] improves airway hypersensitivity. It is clear from FIG. 31 that h-G9NC (null) [Gal-9] administration inhibits eosinophil infiltration in BALF. It is clear from FIG. 32 that h-G9NC (Gal-9) administration inhibits inflammatory cell infiltration around the bronchus. Thus, galectin 9 suggests that airway hypersensitivity is improved by suppressing infiltration of inflammatory cells into the airways.

Example 20

[OVA-induced AHR model]

[Experimental Method]

As animals, mice and molots were used. Egg white albumin (Ovalbumin (OVA), Sigma, Missouri, USA), metopyrone (Stopma, Missouri, USA), mepyramine (mepyramine, Sigma, Missouri, USA) were obtained from the suppliers described there. Other compounds were obtained in the same manner as in Example 19. For administration to the animals, in all experiments, PBS (-) was used as a carrier, and the compound was suspended therein. Balb / c mice (7 weeks old) were from SLC (Shizuoka, Japan), and Malmot (5 weeks old) were Kudou Co. It purchased from Ltd (Kumamoto, Japan), and was breeding in the same manner as in Example 19.

Induction of AHR in mice was performed as follows.

In order to induce airway hypersensitivity to methacholine and eosinophil infiltration into the airway tissues of mice, male mice were sensitized and then induced using the OVA as an allergen. Mice were immunized by intraperitoneal administration with 0.2 ml of OVA (0.5 mg / ml) complexed with potassium aluminum sulfate, on day 0 and day 14. On days 14, 18 and 22, mice were anesthetized with 0.2-0.3 ml of pentbarbital (5.0 mg / ml) diluted with normal saline. All animals of the OVA sensitized group received 2.0 mg / ml OVA in 0.05 ml of normal saline via intranasal on days 14, 18 and 22. Animals in the control group received conventional PBS containing potassium aluminum sulfate via intraperitoneal via intraperitoneal on days 0 and 14, followed by conventional PBS (0.05 ml) via intranasal on days 14, 18 and 22 Was administered.

To investigate the effect of the galectin 9 variant (h-G9NC (null)) and dexamethasone, OVA 7, 14, 15, 16, 17, 18, 19, On days 20, 21 and 22, mice were given 9 variants of galectin (h-G9NC (null) 100 μg / 410 μl in PBS) / body, or dexamethasone 3 mg / 200 μl in PBS / kg body weight. Was administered intraperitoneally, respectively.

BAL liquid was taken from each animal as a sample. The total waste volume of conscious mice not constrained by a barometric plethysmograph (Buxco Electronics, Inc., Sharon, Connecticut, USA) was measured. In this device, measurements are made as a change in the pattern of respiration known as Pause (Penh), which correlates with airway resistance and was used to monitor airway resistance. Mice were treated with aerosol PBS (as a baseline measurement) or MCh (3-50 mg / ml) for 2 minutes to make measurements, and averaged 100 breaths after MCh spray therapy treatment. The number of suspended cells (cells / ml) was stained with Turk's solution, measured by a hemocytometer, cytospin preparations were obtained, and morphological characterization was performed using a Jimsa-May-Grunworld solution to measure cell differences. did. On each slide, 200-500 leukocytes were counted.

Induction of AHR in the molar was performed as follows.

In order to induce immediate airway hyperresponsiveness (IAR) and delayed airway hyperresponsiveness (LAR) to antigen and eosinophil infiltration into airway tissues, male malmot was sensitized and then induced treatment using the OVA as an allergen. The OMRON ultrasonic nebulizer (Omron NE-U17 nebulizer, Tateishenki Co., Tokyo, Japan) was used for the sensitization of 1% OVA saline aerosol for 10 minutes in mole moth on the 0-7th day. All animals were administered mepyramine (10 mg / kg) 30 minutes before the sensitization treatment and 30 minutes before the induction treatment in order to avoid anaflox shock.

To investigate the effect of the galectin 9 variant (h-G9NC (null)), 1 μg of the galectin 9 variant (h-G9NC (null)) was added to the molmot before and after the induction by OVA. / 4 ml (in PBS) / body were administered intraperitoneally.

BAL liquid was taken from each animal as a sample.

Three days after the first sensitization, the animals were placed in a systemic respiratory function analysis chamber (PULM0S-I; MIPS, Osaka, Japan) equipped with a mask equipped away from the body chamber. According to the law, non-air conductance (SGaw) was measured. The relationship between the airflow amount and the change in the box capacity (which is calculated from the change in the box pressure) can be determined by making the change in the box capacity as the slope (slop) plotted on the airflow amount and x-y. The average of the slopes in five breathing cycles was used to calculate the SGaw.

 Intraperitoneally administer 10 mg / kg of metopyrone to the molmot prior to induction by OVA, followed by 2% OVA using an Omron NE-U17 nebulizer (Tateishenki Co., Tokyo, Japan). The molar was treated with a saline solution of saline at a flow rate of 31 / min for 5 minutes. Then, changes in SGaw were monitored and measured 1 minute before antigen treatment and at 2, 4, 5, 6, 7, 8 and 23 hours after antigen treatment, and the average value of 100 breaths after each time point was determined. . Each SGaw value was compared to the value obtained before the immune challenge and expressed as a percentage change in SGaw. The number of suspended cells (cells / ml) was stained with Turk's solution and measured with a hemocytometer to obtain cytospin preparations, and morphological characterization using a Zimsa-may-Granworld solution to differentiate the cells. Was measured. On each slide, 500 white blood cells were counted.

[result]

33 and 34 show the results in the mouse, and FIGS. 35 and 36 show the results in the mouse. In the figure, each value represents the mean ± S.E. of 7 animals (FIG. 33), 5-7 (FIG. 34), 7 or 8 animals (FIGS. 35 and 36). Statistical differences were analyzed using one-way batch variance analysis. Differences between groups were assessed using the Dunette multiple comparison test (* p <0.05, ** p <0.01, *** p <0.001).

FIG. 33 shows that galectin 9 variants (h-G9NC (null)) have an effect of improving airway hyperresponsiveness. Fig. 34 shows that galectin 9 modification (h-G9NC (null)) inhibits infiltration of eosinophils in BALF.

Fig. 35 shows the effect of the 9 galectin variants (h-G9NC (null)) on immediate asthma (IAR) and delayed asthma (LAR). As a result, significant differences were observed in the galectin 9-modified group compared to the control group in both IAR and LAR. That is, the inhibitory effect was confirmed.

36 depicts the effect of galectin 9 modifications (h-G9NC (null)) on inflammatory cell infiltration in the airways. As a result, in the galectin 9-modified group, a significant difference was observed in total cell numbers and eosinophils compared with the control group. There is also a tendency to inhibit infiltration in other cells.

The galectin 9 variant was suggested to be capable of inhibiting antigen-induced immediate and delayed asthmatic reactions and intracellular airway cell infiltration of active sensitized morphotes by intraperitoneal administration prior to antigen sensitization and challenge at a dose of 1 mg / body.

Example 21

Autoimmune Hemolytic Anemia (RαMRC Ab-induced AIHA model)

[Experimental Method]

Cyclophosphamide (CY), Sigma, Missouri, USA), azathioprine (AZ), Sigma, Missouri, USA), methotrexate (MTX), Sigma, Missouri, USA Erythrocyte antibodies (RαMRC Ab) were each obtained from the suppliers indicated therein. Other compounds were obtained in the same manner as in Example 19. For administration to the animals, the compounds were suspended in PBS (-) as the carrier (V) in all experiments and suspended therein. Balb / c mice (7 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19.

Induction of autoimmune hemolytic anemia (AIHA) in mice was performed as follows.

Hemolytic anemia was induced by intravenous administration of rabbit αMRBC autoantibodies to mice. Intraperitoneally (0.345 ml / head) of galectin 9 variants (h-G9NC (null)), dexamethasone, and other drugs or carriers 30 minutes prior to the αMRBC autoantibody injection of rabbits and 1 to 4 days after the autoantibody injection. ).

Blood samples were taken in heparinized microhematocrit capillary tubes and centrifuged at 12,000 rpm for 5 minutes with a centrifuge. After centrifugation, hematocrit was determined by looking at the percentage of directly packed RBCs.

Statistical analysis was performed as follows.

Unless otherwise specified, data are expressed as mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis. The differences between the groups were then assessed using the DuNet multiple comparison test using commercial statistical software (GraphPad Software, Inc., San Diego, USA). <0.05 of P value is considered to be statistically significant.

[result]

37 shows the results. In the galectin 9-modified group, the onset of inhibition was confirmed. In the figure, each value represents the mean ± SEM of 5 to 6 animals (* p <0.05, ** p <0.01).

Example 22

[Arthus reaction (vasculitis)]

[Experimental Method]

The effects of galectin 9 variants on immune complex-induced phase 2 skin reactions (Arthus responses) were investigated.

Anti-OVA IgG was obtained from the supplier. Other compounds were obtained in the same manner as in Example 20. For administration to the animals, in all experiments, PBS (-) was used as a carrier, and the compound was suspended therein. Balb / c mice (7 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19.

Induction of edema in mice was carried out in the following manner.

Anti-OVA IgG (50 μg / mouse) was subcutaneously administered (i.d.) in the right ear of the mouse of the two-phase skin response model, and immediately 200 μL intravenously administered 1% OVA PBS.

The galectin 9 variant (h-G9NC (null)), dexamethasone or carrier was administered intraperitoneally (0.345 ml / head) 30 minutes before the injection of OVA and 5 hours after the injection of OVA. Ear thicknesses were measured under ether anesthesia using a calibration thickness gauge (Mitsutoyo, Tokyo, Japan) 0, 2, 4, 8 and 24 hours after OVA injection.

The edema is represented by (RL)-(R ₀ -L ₀ ). Where R ₀ is the thickness of the right ear at the start of the experiment (O time), and L ₀ is the thickness of the left ear at the start of the experiment (O time), R is the thickness of the right ear obtained at each time point, and L is the left Indicates the thickness of the ear.

Statistical analysis was performed as follows.

Unless otherwise specified, data are expressed as mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis. And differences between the groups were evaluated with Bonferroni post-test using commercially available statistical software (GraphPad Software, Inc., San Diego, USA). <0.05 of P values are considered to be statistically significant.

[result]

38 shows the results. In the galectin 9-modified group, a tendency to suppress development is confirmed. In the figure, each value represents the mean ± SEM of 5 to 6 animals (* p <0.05, ** p <0.01).

Example 23

[LPS-induced ARDS model]

[Experimental Method]

Lipopolysaccharides (lipopolysaccharide, LPS, Sigma, Missouri, USA) were each obtained from the suppliers indicated therein. Other compounds were obtained in the same manner as in Example 19. For administration to the animals, in all experiments, PBS (-) was used as a carrier, and the compound was suspended therein. Balb / c mice (7 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19.

Induction of ARDS in mice was performed in the following manner.

In order to cause respiratory distress and neutrophil infiltration into the airway tissues of mice, male mice were treated with LPS as a lung injury model. Mice received LPS (O.6 mg / ml, 0.05-ml dose) nasal (i.n.) administration. The control group received administration of conventional PBS (0.05 ml) in the same route.

To investigate the effects of the galectin 9 variant (h-G9NC (null)) and dexamethasone, mice were given a galectin 9 variant (h-) 30 minutes before and 6 hours after induction by LPS. 100 μg / 410 μl (in PBS) / body of G9NC (null) or 1-10 mg / 200 μl (in PBS) / kg (body weight) of dexamethasone were administered intraperitoneally, respectively.

By barometric plethysmography (whole body barometric plethysmography; Buxco Electronics, Inc., Sharon, Connecticut, USA) and unrestrained whole body plethysmograph (PULM0S-I; MIPS, Osaka, Japan), Lung function (pen h value and ventilation volume) of mice was analyzed 1 hour before and 24 hours after LPS-induced induction.

After analyzing the lung function, BAL fluid was taken from each animal as a sample.

The total lung airflow of the conscious mouse which was not restrained by the unrestrained breathing function analyzer was measured. The difference in pressure between the chamber containing the mouse and the control chamber was used to determine the air flow rate, ventilation volume, breathing frequency, pen h value, and nasal airway resistance (sRAW) per minute. Airway resistance is a dimensionless parameter that is a function of the total lung volume of the mouse during the breathing cycle.

The number of suspended cells (cells / ml) was stained with Turk's solution and measured by a hemocytometer to obtain cytospin preparations and morphological characterization using a Zimsa-may-Granworld solution to measure cell differences. did. On each slide, 200-500 leukocytes were counted.

Statistical analysis was performed as follows.

Unless otherwise specified, data are expressed as mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis or two-way batch variance analysis. The differences between the groups were then assessed by the DuNet multiple comparison test or Bonferroni post-test using commercial statistical software (GraphPad Software, Inc., San Diego, USA). <0.05 of P value is considered to be statistically significant.

[result]

39 and 40 show the results. In the figure, each value represents the mean value ± SEM of 5 to 6 animals. Statistical differences were analyzed using one-way batch variance analysis. And differences between groups were assessed using the Dunette multiple comparison test (* p <0.05, ** p <O.01, *** p <0.001). Figure 39 depicts the effect of galectin 9 variants (h-G9NC (null)) on airway hypersensitivity. There, improvements were identified. Fig. 40 shows that the galectin 9 modified substance (h-G9NC (null)) inhibits the infiltration of neutrophils in BALF.

Example 24

[Capsaicin-induced Inflammation Model]

[Experimental Method]

Cypropeptadine (cyproheptadine, Sigma, Missouri, USA) and capsaicin (capsaicin, Nakarai, Tokyo, Japan) were respectively obtained from the suppliers indicated therein. Other compounds were obtained in the same manner as in Example 19. For administration to the animals, in all experiments, PBS (-) was used as a carrier, and the compound was suspended therein. Balb / c mice (7 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19.

Induction of edema in mice was carried out as follows.

500 μg of capsaicin was dissolved in acetone / olive oil (4/1, 30 μl) and applied to the inner and outer surfaces of the right ear of each mouse (BALB / c, female, 7-8 weeks old, SPF, SLC Inc.) did. Acetone / olive oil was applied to the left ear as a control. 9 galectin variants (h-G9NC (null)), dexamethasone, ciproheptadine or carrier were administered intraperitoneally (0.345 ml / head) 30 minutes prior to capsaicin and intravenously 10 minutes prior. Ear thicknesses, 0, 0.5, 1 and 2 hours after capsaicin administration, were measured under ether anesthesia using a calibration thickness gauge (Mitsutoyo, Japan, Japan).

Earl edema is represented by (RL)-(R ₀ -L ₀ ). Where R ₀ is the thickness of the right ear at the start of the experiment (O time), and L ₀ is the thickness of the left ear at the start of the experiment (O time), R is the thickness of the right ear obtained at each time point, and L is the left Indicates the thickness of the ear.

Statistical analysis was performed as follows.

Unless otherwise specified, data are expressed as mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis. And differences between the groups were evaluated with Bonferroni post test using commercial statistical software (GraphPad Software, Inc., San Diego, USA). <0.05 of P values are considered to be statistically significant.

41 shows the result. In galectin 9-modified group (intravenous injection administration), suppression of a development is confirmed. In the figure, each value represents the mean value ± SEM of 5 to 6 animals. Statistical differences were analyzed using binary batch variance analysis. Differences between groups were assessed using the Dunette multiple comparison test (* p <0.05, ** p <0.01, *** p <0.001). The galectin 9 variants are expected to suppress pain caused by neurological and inflammatory conditions.

Example 25

[Effects on the Bone Uptake and Bone Formation of Galectin 9 Variants]

[Experimental Method]

1. Bone Absorption

Osteoclast formation

Peripheral blood monocytes (1 × 10 ⁵ cells) were incubated for 9 days in the presence of RANKL (50 ng / ml) and M-CSF (50 ng / ml), and the addition of 9 gamutin (h-G9NC (null)) The number of TRAP positive multinucleated cells (osteoblasts) was compared between 0.1-10 nM) / non-added group. h-G9NC (null) inhibited the formation of TRAP positive multinucleated cells (osteoblasts) in concentration dependence. Here, h-G9NC (null) may be described simply as gal-9.

The obtained result is shown in FIG.

Cont .: 500 ± 13.2 cells / well, galectin 9 modified group (h-G9NC (null), 0.1 nM): 451 ± 7.6 cells / well, (h-G9NC (null), 1.0 nM) : 151 ± 12.5 cells / well, (h-G9NC (null), 10 nM): 29 ± 14.0 cells / well.

2. bone formation

(Osteoblast proliferation)

H-G9NC for the proliferation of human osteoblasts (sowing cells in 96-well plates in 2 × 10 ³ wells, followed by h-G9NC (null) stimulation at night, observed at 0 h, 24 h and 48 h) null) (0.1-100 nM) was examined by absorbance using a Tetra color-1 assay.

The obtained result is shown in FIG. Galectin 9 variants induced the proliferation of osteoblasts in a concentration dependent manner, which was inhibited by lactose. The galectin 9 variants induced concentrations of osteoblasts in a concentration dependent manner and could also be inhibited by lactose (30 mM). Absorbance was 0.21 ± 0.01 in the control group, 0.22 ± 0.01 in h-G9NC (null) (0.1 nM), 0.24 ± 0.01 in h-G9NC (null) (1.0 nM), 0.25 in h-G9NC (null) (10 nM) ± 0.01, 0.26 ± 0.02 for 24 hours at h-G9NC (null) (100 nM), 0.22 ± 0.01 for control group after 48 hours, 0.23 ± 0.01, h for h-G9NC (null) (0.1 nM) 0.26 ± 0.b1 for -G9NC (null) (1.0 nM), 0.27 ± 0.01 for h-G9NC (null) (10 nM) and 0.31 ± 0.04 for h-G9NC (null) (100 nM).

(Osteoblast differentiation)

Human osteoblasts (sowing at 1 × 10 ⁵ cells / well with 10% FCS / DMEM in 6-hole plates, incubated for 24 hours, followed by gal night stimulation with 1% FCS / DMEM over night, 8 The effect of galectin 9 modification (h-G9NC (null)) (100 nM) on the differentiation of) after time was examined by flow cytometry of intracellular ALP and osteocalcin.

The obtained result is shown in FIG. The galectin 9 variant induced the expression of ALP and osteocalcin, which are bone formation markers in osteoblasts. ALP increased 400 molecules / cell compared to non-stimulated, and 800 molecules / cell increased in osteocalcin compared to non-stimulated. In addition, when H-G9NC (null) was added to the osteoblasts (10 nM) and cultured for 28 days, ALP staining and von kossa staining were promoted as compared to the non-added group.

In the above test, agglutination of monocytes occurred at 6 hours after the addition of nine galectins. The galectin 9 variants inhibited the formation of TRAP positive multinucleated cells in a concentration dependent manner. Galectin 9 variants induced the proliferation of osteoblasts in a concentration dependent manner. The galectin 9 variant induces the expression of ALP, osteocalcin in osteoblasts.

From the above results, it is suggested that the modified galectin 9 and the native galectin 9 may inhibit the bone resorption and promote the bone formation, and thus the therapeutic application to postmenopausal osteoporosis as a drug having a bone formation promoting action. The possibility was thought about.

Example 26

[Effect of Galectin 9 Variants on Interstitial Pneumonia Model]

[Experimental Method]

Mice were used as interstitial pneumonia model. C57BL / 6 mice (6 females, 7 to 8 weeks of use, 20 animals) are described in Blood 2002; 99: 1289-98 and Am J Respir Crit Care Med 2003; 168: Treated according to 1075-83, induced interstitial pneumonia. rhIL-2 (PeproTech, 5 μg × 10 mice × 2 groups × 14 days = 1400 μg = 1.4 mg) and rmIL-18 (MBL, 0.2 μg × 10 mice × 2 groups × 14 days = 56 μg) were used.

As a sample group, a control group and a galectin nine-variant (Gal-9) administration group were prepared.

(1) control group (10 mice)

Per mouse, 0.2 μg of IL-2 5 μg + IL-18 is intraperitoneally administered from day 0 to day 13 every day. As a control, 200 μl of PBS was administered daily per mouse intraperitoneally every day 0 to 13 days.

(2) Gal-9 administration group (10 mice)

IL-25 μg + IL-180.2 μg daily is administered intraperitoneally daily from day 0 to day 13 per mouse. The galectin 9 variants (h-G9NC (null)) are prepared intraperitoneally every day from day 0 to day 13 by preparing 100 µg / 300 µl PBS per mouse. All anesthesia is performed by neembutal intraperitoneal administration.

The index of effect determination was the survival rate first, and lung tissues were examined for the cases that survived until day 14.

Mouse sampling was done as follows:

During the death, dissection at the time of death to collect lung tissue

For survival cases up to day 14, blood collection → cervical dislocation → thoracic → lung tissue collection from ether anesthesia → orbit.

The effect of rhGa1-9null intraperitoneal administration in this model was examined. Survival on Day 14 of each of the rhGal-9null and non-administered groups was used as a criterion of effect determination, and histological comparisons on Day 14 were also compared.

The obtained result is shown to FIG. 46 and FIG. 46 shows survival rate. Survival on Day 14 was 30% in the non-administered group (3 out of 10) and 90% in the h-G9NC (Gal-9) group (9 out of 10), galectin 9 Survival was improved by the administration of modified (h-G9NC (null): Gal-9).

FIG. 47 depicts lung tissue (HE staining, photo) of survival on Day 14. FIG. In the non-administered group, even in survival, the thickening of pulmonary epilepsy with extensive and intense cell invasion was observed. In the galectin 9-modified (h-G9NC (null): Gal-9) -administered group, both the thickening of the epilepsy and the cell infiltration were mild, and a lot of normal tissue remained. Therefore, galectin 9 (Gal-9) in this model was shown to have an effect of suppressing onset. Body weight changes were observed in this study, but no significant body weight changes were observed in the non-administered group.

Example 27

[Activity in Cancer Metastasis Model]

[Experimental Method]

B16 / F10 cells were used to investigate the action of the galectin 9 variants in the cancer metastasis model.

Cells (5 × 10 ⁵ cells / 200 μl) were inoculated into the tail vein of C57 / BL6 mice (SLC, 6 week old female). Immediately after inoculation, nine varieties of galectin (h-G9NC (null), abbreviated as “Gal-9”; 100 μg / 300 μl) or PBS (each N = 15) were administered to the tail vein for 11 days of daily administration ( 12 times the administration number). On day 12 after inoculation, the number of nodules in the lungs was counted.

The test result (appearance of the lung of a model animal) is shown in FIG. 50 shows the results of counting the nodule number of the lung. In comparison with the galectin 9-modified group (Gal-9 group) and the PBS-administered group (PBS group), the effect of inhibiting metastasis by the galectin 9-modified substance was confirmed. In the comparison of the number of nodules in the lung, the mean number of nodules in each group was 231.3 ± 20.87 in the galectin 9-modified group (Gal-9) and 122.1 ± 13.61 in the PBS-administered group (PBS). The effect of inhibiting metastasis of cancer caused by galectin 9 variants was confirmed.

Example 28

[Carrageenan-induced Inflammation Model: Carrageenan-induced Rat Paw Edema]

Carrageenan (Irazushi kagaku, Japan) was obtained from the supplier. For administration to animals, the compounds were suspended in PBS (-) as a carrier in all experiments and suspended therein. Female Lewis rats (5 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19. To investigate the effect of the galectin 9 variant, 10 minutes before the carrageenan injection, rats were given a galectin 9 variant (h-G9NC (null), abbreviated as "gal-9"; 30-300 µg / body (In PBS) was administered intravenously Dexamethasone (Dex.) 3 mg / kg, 7 mg / kg as a positive control.

[Carrageenan Foot Edema]

According to the method of Sugishita et al. (1981), a carrageenan-induced foot edema test in rats was conducted to investigate the anti-inflammatory activity of human null galectin-9 (h-G9NC (null)). . The pharmaceutical compound (30, 100 and 300 μg / body) or carrier (PBS) was administered intravenously 10 minutes before the injection of carrageenin (0.15 ml; 1% w / v in saline) behind the foot of the right hind leg. After inducing edema, using a mercury displacement plethysmography (Muromachi, Tokyo, Japan) on the carrageenan injected side at -1, 2, 4, 6, 24, 48 and 72 h The volume between the foot and the other side of the foot (saline injected into the right hind leg) was measured. The change in the volume of the foot was calculated as the difference between -1 h and each time. Edema induced by carrageenin is shown for each animal as the difference between the foot on the carrageenan injected side and the foot on the other side.

Statistical analysis was performed as follows.

Unless otherwise specified, data are expressed in mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis or two-way batch variance analysis. The differences between the groups were then assessed with commercially available statistical software (GraphPad Software, Inc., San Diego, USA) with either the Dunett multiple comparison test or Bonferroni post-test. <0.05 of P values are considered to be statistically significant.

[result]

The results are shown in Figure 51 (Galectin 9 modified) and Figure 52 (Dexamethasone). In the galectin 9 modified substance, the inhibitory effect of the onset was also confirmed at 30 µg / mouse.

Example 29

1. Analgesic Activity of Galectin 9 Modifiers in an Adjuvant Arthritis Model

[Way]

Pain due to mechanical stimulation (Randall-Selitto test = measurement of pain threshold by vertical pressurization)

Mycobacterium butyricum (Difco, Detroit, Michigan, USA) was obtained from the supplier. For administration to animals, the compounds were suspended in it using PBS (-) as the carrier in all experiments. Female Lewis rats (5 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19. In order to investigate the effect of the galectin 9 modifications, rats were selected for the galectin 9 modifications (h-G9NC (null), abbreviated as "Gal-9") at 0 to 22 days before and after injection of the adjuvant. -300 μg / body (in PBS) was administered intravenously. Indomethacin (Indo) was administered 3 mg / kg as a positive control.

[Adjuvant Arthritis]

Female rat rats (5 weeks old) were weighed, labeled with tails, and divided into groups of 9 animals. Before the injection of adjuvant (day O), the body weight and volume of the foot paws on both hind legs were recorded. Adjuvant was then injected into the right hind limb of each rat. Groups not injected with adjuvant were used as normal age-matched controls (sham). On each of the other days after the adjuvant injection, the weight and volume of the rats in each group were recorded prior to sacrifice.

Adjuvant's Protocol

Mycobacterium butyricum was crushed in a mortar to prepare an adjuvant, mixed with oil, and final concentration was 10 mg / ml. 0.2 ml of adjuvant was injected behind the paw of the right hind leg of the rat using a 27-gauge 0.5-inch needle.

[Interpretation of Pain by Mechanical Stimulation]

By modifying the technique of Randall and Randall-Selitto, human null galectin-9 (h-G9NC (null)) is used in acute inflammatory or non-inflammatory tissues for external compression. We investigated whether there was analgesic activity to reduce peripheral hypersensitivity. That is, subcutaneous injection of Freund's Complete Freund's Adjuvant into the right hind limb of female rats (5 weeks old) induced acute and chronic inflammation. Two days before the injection of adjuvant and five days after the adjuvant injection, peripheral hypersensitivity in acute inflammatory or non-inflammatory tissues to external compression was measured by the Randall and Celito test, and on day 25 (days 25 ) (Once / week). The observer controlled, with a digital force gauge (Imada, Aichi, Japan), slowly exerting external pressure on both the foot of the inflamed side and the non-inflammatory foot of the other side (0-200 g). Pain threshold was defined as the pressure when the animal first showed signs of feeling pain. The signs are indicated by the first time the finger was spread and / or the foot was pulled or the bell was beeped.

 Statistical analysis was performed in the same manner as in Example 28. That is, unless otherwise specified, data are shown by mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis or two-way batch variance analysis. The differences between the groups were then assessed with commercially available statistical software (GraphPad Software, Inc., San Diego, USA) with either the Dunett multiple comparison test or Bonferroni post-test. <0.05 of P values are considered to be statistically significant.

[result]

The results are shown in Figure 58 (Galectin 9 Modifier, Gal-9) and Figure 59 (Indometacin). In the figure, each value represents the average value ± SEM of animals (Fig. 58: 8-9 (n = 8-9), Fig. 59: 9 (n = 9)) at the indicated points. Statistical differences were analyzed using binary batch variance analysis. And differences between groups were assessed using Bonferroni post-test (* p <0.05, ** p <0.01, *** p <0.001). Administration of the galectin 9 variant raises the threshold for nociceptive stimulation not only in areas that are inflaming in a concentration-dependent manner, but also in areas that are not inflaming (see FIG. 66 left). In other words, the 9 galectin variants are systemic and raise the threshold of pain.

2. Carrageenan-induced acute inflammation model: Carraeenan-induced Paw Edema in rats

[Way]

Carrageenan (Irazushi kagaku, Japan) was obtained from the supplier. For administration to animals, the compounds were suspended in it using PBS (-) as the carrier in all experiments. Female Lewis rats (5 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19. To investigate the effect of the galectin 9 variant, 10 minutes before carrageenan injection, rats were given a galectin 9 variant (h-G9NC (null), abbreviated as "gal-9"; 30-300 µg / body ( In PBS), 3 mg / kg, 7 mg / kg of dexamethasone (Dex) as a positive control.

[Interpretation of Pain by Mechanical Stimulation]

By modifying the technique of randal and celito, human null galectin-9 (h-G9NC (null)) reduces peripheral hypersensitivity in acute inflammatory or non-inflammatory tissues to external compression We investigated whether there was analgesic activity. That is, carrageenin was injected subcutaneously into the right hind limb of female Lewis rats (5 weeks old), causing acute and chronic inflammation. Peripheral hypersensitivity in acute inflammatory or non-inflammatory tissues to external compression is measured by the Randall and Celito test, and monitored up to 75 h one day before and 6 hours after carrageenan injection (Once / day). The observer controlled, with digital force gauges (Imada, Aichi, Japan), slowly exerting pressure from outside on both the foot of the inflamed side and the non-inflammatory foot of the other side (0-200 g). Pain threshold was defined as pressure when the animal first showed signs of feeling pain. The signs are indicated by the first time the finger was spread and / or the foot was pulled or the bell was beeped.

Statistical analysis was performed in the same manner as in Example 28. That is, unless otherwise specified, data are shown by mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis or two-way batch variance analysis. The differences between the groups were then assessed with commercially available statistical software (GraphPad Software, Inc., San Diego, USA) with either the Dunett multiple comparison test or Bonferroni post-test. <0.05 of P values are considered to be statistically significant.

[result]

The results are shown in Figure 60 (Galectin 9 variant, gal-9) and Figure 61 (dexamethasone). In the figure, each value represents the mean value ± SEM of 9 animals (n = 9) at the indicated points. Statistical differences were analyzed using binary batch variance analysis. And differences between groups were assessed using Bonferroni post-test (* p <0.05, ** p <0.01, *** p <0.001). Administration of the galectin 9 variant raises the threshold for nociceptive stimulation not only in areas that are inflaming in a concentration-dependent manner, but also in areas that are not inflaming. In other words, the 9 galectin variants are systemic and raise the threshold of pain.

Example 30

[Stability of Galectin 9 Variants in Human Joint Fluid]

Reaction conditions

160 μl human rheumatoid arthritis sample

40 μl G9NC (null) or G9 (S) (5 μl in PBS)

Ie galectin-9 in 80% joint fluid incubated for 24 hours or 96 hours at 37 ° C (sampled at 6, 24, 48, 72 hours)

Western blot with SDS treatment

4.5 μl sample

40.5 μl H ₂ O

15 μl sample buffer (4 ×, + 2-ME)

SDS-PAGE was 12.5% (10 μl / lane).

The results are shown in FIG. 62. Among the joint fluids with high protease activity, galectin 9 modifications [G9NC (null)] were found to be more stable than galectin 9S [G9 (S)].

Example 31

[Arthritis Model]

Antibody Cocktail Model: Galectin 9 Modifiers (Intravenous Administration)

[Way]

Using DBA / 1J female mice (7-8 weeks old), a monoclonal antibody cocktail (Chondrex, No. 62100) for causing arthritis is administered 2 mg / 0.5 ml / body to the tail vein of the animal. After 3 days, 50 μg / 0.2 ml of LPS (SIGMA, L6511) was administered intraperitoneally. In addition, 30 µg / 200 µl of 9 galectin variants (h-Gal9NC (null), abbreviated as "Gal-9") were administered to the tail vein of the animal. The experimental group was a PBS administration group and a h-Gal9NC (null) administration group, and was made into three groups of the day O (LPS administration day) one administration group and Day 0 to the daily administration group (up to Day 10, the number of administrations 11 times). Each group measured and scored the joint swelling of the left and right front and rear limbs once a day.

[result]

The results are shown in FIG. After antibody cocktail administration, arthritis is caused by LPS. Arthritis was also inhibited by intravenous administration of the 9 galectin variants. In addition, even a single administration was confirmed to suppress the onset of development.

2-1. CIA (collagen sensitization) model: galectin 9 variant (intraperitoneal administration)

[Way]

Bovine Collagen type II (BC II: Kondex Rex cat no 2002-1) was dissolved in a complete adjuvant (CFA: Difco cat no 263810) to prepare an emulsion for mice (DBA / 1J 7-8 Weekly, female) intradermal injection of 100 μl intramuscularly (BC II 0.1 mg / 100 μl / mouse). After 21 days of sensitization, booster injections are made to score the limbs three times a week. Immediately after the booster, galectin-9 modified substance ("Gal-9" abbreviation; 30 µg / mouse) or PBS was administered intraperitoneally, followed by daily administration.

True mouse scoring (arthritis findings) observes the limbs of each mouse by plural persons, calculates the total number of limbs (up to 16 points), and calculates an average score.

① One finger swelling: 1 point

② Two or more fingers Swell: 2 points

③ Swelling to the back of the hand: 3 points

④ severe swelling, deformation: 4 points

[result]

The results are shown in FIG. The galectin 9 variant was confirmed to have a suppressive effect.

2-2. CIA (collagen sensitization) model: galectin-9 modified (intravenous administration)

[Way]

Freund's Adjuvant (IFA: Difco) of Freund's bovine collagen type II (BC II: Condrex Corporation cat no 2002-1) to which Mycobacterium Tuberculosas H37 Ra, desiccated. Dissolve and prepare an emulsion and inject 100 μl intradermally into the tail of mice (DBA / 1J 7-8 weeks old, female) (BC II 0.2 mg / H37 Ra 0.2 mg / 100 μl / mouse). After 21 days of sensitization, booster injections are made to score the limbs three times a week. Mouse scoring (arthritis findings) observes the extremities of each mouse, calculates the total number of extremities (up to 16 points), and calculates an average score.

 Immediately after the booster, galectin-9 modified (Gal-9 abbreviation; 30 μg / mouse: N = 15) or PBS (N = 10) was administered intravenously in the tail vein, followed by daily administration for 28 days.

References: Enhancement of collagen-induced arthritis in mice genetically deficient in extracellular superoxide dismutase.

Ross AD, Banda NK, Muggli M, Arend WP. Arthritis Rheum. 2004 Nov; 50 (11): 3702-11.

[result]

The results are shown in FIG. Inhibition of onset was also confirmed in the intravenous administration of galectin-9 modified product.

3. Adjuvant Arthritis (AIA) Model: Galectin-9 Modifier (Intravenous Administration)

[Way]

Mycobacterium butyricum (Difco, Detroit, Michigan, USA) was obtained from the supplier. For administration to animals, the compounds were suspended in it using PBS (-) as the carrier in all experiments. Female Lewis rats (5 weeks old) were purchased from SLC (Shizuoka, Japan) and reared in the same manner as in Example 19. To investigate the effect of the galectin 9 variant, rats were assigned to the galectin 9 variant (h-G9NC (null), Gal-9 abbreviation; 30-300 μg) from 0 to 22 days before and after the adjuvant injection. / body (in PBS) was administered intravenously.

[Adjuvant Arthritis]

Female rat rats (5 weeks old) were weighed, labeled with tails, and divided into groups of 9 animals. Before the adjuvant injection (day O), the body weight and volume of both hind limbs were recorded. Adjuvant was then injected into the right hind limb of each rat. Groups not injected with adjuvant were used as normal age-matched controls (sham). On each of the other days after the adjuvant injection, the weight and volume of the rats in each group were recorded before the rats were sacrificed.

[Volume of foot]

The volume of the foot was measured using a mercury displacement plethysmography (Muromachi, Tokyo, Japan). The change in foot volume was calculated as the difference between day 0 and each day.

[Clinical evaluation]

The degree of arthritis of each foot was evaluated by dividing it on a scale of 0 to 3 as follows: 1. the phalanx joints and fingers of the forelimbs or hind limbs, 2. the dorsal bone or the floor, 3. the astragalus joint or wrist. No erythema or swelling; 1, mild red erythema or swelling; 2, moderate erythema or swelling of the astragalus joint or wrist part; 3, severe erythema or swelling.

In other rat groups, bed score scoring was performed. The sum of the scores of graded foot arthritis was taken to obtain a total of the daily arthritis scores for each rat.

Adjuvant's Protocol

Mycobacterium butyricum was crushed in a mortar to prepare an adjuvant, mixed with oil, and final concentration was 10 mg / ml. 0.2 ml of adjuvant was injected behind the paw of the right hind leg of the rat using a 27-gauge 0.5-inch needle.

Statistical analysis was performed in the same manner as in Example 28. That is, unless otherwise specified, data are shown by mean ± SEM. Statistical differences in the data sets were analyzed using one-way batch variance analysis or two-way batch variance analysis. The differences between the groups were then assessed using commercially available statistical software (GraphPad Software, Inc., San Diego, USA) with either the Dunnett multiple comparison test or Bonferroni post test. <0.05 of P values are considered to be statistically significant.

[result]

The results are shown in Figure 66 (Galectin 9 Modifier, Gal-9) and Figure 67 (Indometacin, Indo). Adjuvant arthritis is mainly inflammation due to acquired immunity involving natural immunity and T cells. The galectin 9 variant suppresses both inflammation, but strongly suppresses inflammation mainly due to acquired immunity. In addition, body weight increase and decrease showed the same tendency in the indomethacin group and the galectin-9 modified group.

Example 32

Rat CIA (collagen sensitization) model: galectin-9 modified body (intravenous administration)]

[Way]

Sodium type II collagen (collagen technical training) was dissolved in Freund's incomplete adjuvant (IFA: Difco), and an emulsion was prepared. Intradermal injection of 500 μl intradermal skin of rat (DA / S1c 11 weeks old: SLC, Japan). (50 μg / 500 μl / mouse of collagen) to primary sensitization. One week later, the same collagen emulsion solution (50 µg / 500 µl / mouse of collagen) was administered to the tail muscles of the animals for secondary sensitization. Score limbs three times a week. Immediately after booster, galectin-9 modified (null human galectin-9 = h-G9NC (null); 3, 10, 30 μg / 1 ml / mouse), negative control PBS (1 ml / mouse) were intravenously injected Prednizolone (3 mg / 10 ml / kg: SIGMA), a positive control substance, is administered orally once a day for 32 days up to 38 days.

After the primary sensitization day (0 day) and primary sensitization, the volume of the left and right hind limbs was measured on days 7, 15, 18, 22, 26, 30, 35 and 39, and the edema rate (%) was calculated according to the following equation. do.

Swelling (%) = [foot print volume after sensitization (ml)-foot print volume before sensitization (ml)] / [foot print volume before sensitization] (ml)] × 10 O

Statistical treatment was performed in the following manner. We express with mean and standard error of edema rate (%) which assumed addition of right and left hind legs as individual value. The homogeneous variance is tested by the F test between the PBS group and the prednisolone group, and the t test of the Student in the case of isovariance and the Aspin-Wech t test in the case of unequal dispersion. . Subsequently, the isovariance is tested between the PBS group and the galectin 9-variable group by the Bartlet assay, the parametric dunet test is performed for isodispersity, and the nonparametric dunet test is performed for isodispersity. All significant levels are said to be less than 5% (p <0.05) and are divided into less than 5% and less than 1% (p <0.01). The obtained results are shown in FIG. 68 and Table 3. FIG. In Table 3, each value represents the mean value ± SEM. ##: significant difference from control (15, 18, 22 Day: t test of Student, * p <0.05, ** p <0.01: significant difference from control (18, 22 Day: parametric dunet test; 15 Day: Nonparametric Duenett Test) The suppression of onset was confirmed by the galectin 9 variants.

The present galectin 9 variants (stabilized galectin 9, such as h-G9NC (null), etc.) have the following biological activities:

Coagulation of Tumor Cells: Coagulation Effects in Many Tumor Cells

Adhesion Inhibition: Adhesion Inhibitory Effects on Extracellular Matrix

Apoptosis, Cellular Injury: Inducing Apoptosis in Many Tumor Cells

Activation of dendritic cells (DC): induction of DC differentiation

NK, NKT Activation: Mobilization

Suppression of pain: suppression of pain by capsaicin

Antitumor effect expected.

The group of the present inventors examined expression of galectin 9 in breast cancer tissue, and confirmed that the frequency of distant metastasis was low in the case of galectin 9 positive. In addition, the development of metastasis predictive diagnosis kits is currently underway (Clin Cancer Res, 2005 in press, Galectin-9 as a prognostic factor with anti-metastatic potential in breast cancer). It was also confirmed that the galectin 9 gene-introduced human breast cancer cell line showed high cohesiveness in vitro and the same cohesiveness even in nude mice. In addition, cytotoxic activity against many cell lines, including hematopoietic malignancies, has been confirmed therein, and most of them have been confirmed by induction of apoptosis (Int J Cancer. 2002 20; 99 (6): 809-). 816, Possible role of galectin-9 in cell aggregation and apoptosis of human melanoma cell lines and its clinical significance; J immunol. 2003 1; 170 (7d): 3631-3636, Galectin-9 induces apoptosis through the carcium-calpain-caspase -1 pathway). In addition, mobilization of NK / NKT cells, Mφ-based cells, and the like has been confirmed in galectin 9-administered regions, suggesting the possibility of inducing cellular cancer immune mechanisms.

In view of the above, stabilizing galectin 9 (Galectin 9 modification of the present invention, such as h-G9NC (null), etc.), hematopoietic malignancies such as leukemia, killer cell effect on post-operative free cancer cells, cancer cells By inhibiting aggregation and cancer cell adhesion to blood vessel walls and invasion into other tissues, they have effects of inhibiting metastasis, suppressing the occurrence of cancer peritonitis, and enhancing tumor immune activity by recruitment of effector cells to the periphery of tumors. Can be expected to be a desirable effect, it is expected to be a novel anti-cancer substance with fewer side effects.

Biologics currently under development (such as monoclonal antibodies) target immune cell surface molecules, intracellular functional molecules and inflammatory cytokines. In other words, it has a pharmacological action with an inhibitory effect. On the other hand, the stabilizing galectin 9 molecule preparation also expects immune regulation, anti-inflammatory action and regeneration of bone and cartilage tissue originally possessed by the living body by inducing apoptosis and inhibiting bone destruction of synovial cells and activated T cells. It is a new development approach that is completely different from anticytokine therapy. Pain is a major finding of rheumatoid arthritis. The capsaicin used in the above examples is an important mediator that causes inflammatory pain in neurological inflammation, and stabilizing galectin 9 suppresses the swelling caused by capsaicin application. That is, it is anticipated as a new drug for systemic autoimmune disease with few side effects. This stabilized galectin 9 can be an antirheumatic agent with fewer side effects due to a novel mechanism of action. This stabilizing galectin 9 has the characteristics of clinical effects such as suppressing inflammation, restoring joint tissues and suppressing pain, and (1) induction of apoptosis of activated T cells, (2) apoptosis of synovial cells, and (3) arachidone. Mechanisms such as acid cascade and (4) inhibition of bone destruction can be expected and are promising as rheumatoid therapeutics. In fact, suppression of onset in arthritis (CIA, antibody cocktail) model has been confirmed.

Since the galectin 9 variants are more resistant to enzymes than those of the wild type, it is useful for effectively utilizing the multifaceted action and function exhibited by galectin 9. Wild type galectin 9 has been shown to induce cancer metastasis inhibition and regression by direct action on tumors (activity that induces intercellular adhesion and apoptosis of tumor cells) and action through the immune system. Nine modified variants can be expected as more advantageous active substances, such as antitumor drugs, which exhibit the same activity. Since wild-type galectin 9 does not act on inactivated lymphocytes and induces apoptosis of activated T cells, particularly CD4 positive T cells, which cause a hyperimmune response, the present gamutin 9 variants have a more favorable activity with the same activity. It can be expected as a substance such as an anti-inflammatory drug, an antiallergic drug, or an osteoporosis drug. Since wild type galectin 9 has a strong apoptosis induction ability against synovial cells involved in joint deformation and the like in rheumatism, the present galectin 9 modified product can be expected as a more advantageous active substance exhibiting the same activity. Thus, it can be used for the development of therapeutic drugs for cancer drugs, refractory autoimmune diseases (including rheumatism), allergic diseases, inflammatory diseases, and diseases related to bone metabolism, and the function development and research and development of galectin 9.

It is apparent that the present invention can be carried out in addition to those specifically described in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings, and therefore these are also within the scope of the appended claims.

<Sequence table free text>

SEQ ID NO: 1, Description of Artificial Sequence: Polynucleodide for galectin-9 mutein, G9NC (null)

SEQ ID NO: 2, Description of Artificial Sequence: Polynucleodide for galectin-9 mutein

SEQ ID NO: 5, galectin-9 medium isoform

SEQ ID NO: 10, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR

SEQ ID NO: 11, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR

SEQ ID NO: 12, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR

SEQ ID NO: 13, Description of Artificial Sequence: Oligonucleotide to act as a primer for PCR

                         SEQUENCE LISTING <110> GALPHARMA Co., Ltd. <120> Novel Galectin-9 Muteins and Use Thereof <130> GL-05PCT <150> JP 2004-94401 <151> 2004-03-29 <150> JP 2004-287005 <151> 2004-09-30 <150> JP 2005-43156 <151> 2005-02-18 <160> 13 <170> PatentIn version 3.1 <210> 1 <211> 891 <212> DNA <213> Artificial Sequence <220> <223> Polynucleodide for galectin-9 mutein <220> <221> CDS (222) (1) .. (891) <223> G9NC (null) <400> 1 atg gcc ttc agc ggt tcc cag gct ccc tac ctg agt cca gct gtc ccc 48 Met Ala Phe Ser Gly Ser Gln Ala Pro Tyr Leu Ser Pro Ala Val Pro 1 5 10 15 ttt tct ggg act att caa gga ggt ctc cag gac gga ctt cag atc act 96 Phe Ser Gly Thr Ile Gln Gly Gly Leu Gln Asp Gly Leu Gln Ile Thr             20 25 30 gtc aat ggg acc gtt ctc agc tcc agt gga acc agg ttt gct gtg aac 144 Val Asn Gly Thr Val Leu Ser Ser Ser Gly Thr Arg Phe Ala Val Asn         35 40 45 ttt cag act ggc ttc agt gga aat gac att gcc ttc cac ttc aac cct 192 Phe Gln Thr Gly Phe Ser Gly Asn Asp Ile Ala Phe His Phe Asn Pro     50 55 60 cgg ttt gaa gat gga ggg tac gtg gtg tgc aac acg agg cag aac gga 240 Arg Phe Glu Asp Gly Gly Tyr Val Val Cys Asn Thr Arg Gln Asn Gly 65 70 75 80 agc tgg ggg ccc gag gag agg aag aca cac atg cct ttc cag aag ggg 288 Ser Trp Gly Pro Glu Glu Arg Lys Thr His Met Pro Phe Gln Lys Gly                 85 90 95 atg ccc ttt gac ctc tgc ttc ctg gtg cag agc tca gat ttc aag gtg 336 Met Pro Phe Asp Leu Cys Phe Leu Val Gln Ser Ser Asp Phe Lys Val             100 105 110 atg gtg aac ggg atc ctc ttc gtg cag tac ttc cac cgc gtg ccc ttc 384 Met Val Asn Gly Ile Leu Phe Val Gln Tyr Phe His Arg Val Pro Phe         115 120 125 cac cgt gtg gac acc atc tcc gtc aat ggc tct gtg cag ctg tcc tac 432 His Arg Val Asp Thr Ile Ser Val Asn Gly Ser Val Gln Leu Ser Tyr     130 135 140 atc agc ttc cag cat atg act ccc gcc atc cca cct atg atg tac ccc 480 Ile Ser Phe Gln His Met Thr Pro Ala Ile Pro Pro Met Met Tyr Pro 145 150 155 160 cac ccc gcc tat ccg atg cct ttc atc acc acc att ctg gga ggg ctg 528 His Pro Ala Tyr Pro Met Pro Phe Ile Thr Thr Ile Leu Gly Gly Leu                 165 170 175 tac cca tcc aag tcc atc ctc ctg tca ggc act gtc ctg ccc agt gct 576 Tyr Pro Ser Lys Ser Ile Leu Leu Ser Gly Thr Val Leu Pro Ser Ala             180 185 190 cag agg ttc cac atc aac ctg tgc tct ggg aac cac atc gcc ttc cac 624 Gln Arg Phe His Ile Asn Leu Cys Ser Gly Asn His Ile Ala Phe His         195 200 205 ctg aac ccc cgt ttt gat gag aat gct gtg gtc cgc aac acc cag atc 672 Leu Asn Pro Arg Phe Asp Glu Asn Ala Val Val Arg Asn Thr Gln Ile     210 215 220 gac aac tcc tgg ggg tct gag gag cga agt ctg ccc cga aaa atg ccc 720 Asp Asn Ser Trp Gly Ser Glu Glu Arg Ser Leu Pro Arg Lys Met Pro 225 230 235 240 ttc gtc cgt ggc cag agc ttc tca gtg tgg atc ttg tgt gaa gct cac 768 Phe Val Arg Gly Gln Ser Phe Ser Val Trp Ile Leu Cys Glu Ala His                 245 250 255 tgc ctc aag gtg gcc gtg gat ggt cag cac ctg ttt gaa tac tac cat 816 Cys Leu Lys Val Ala Val Asp Gly Gln His Leu Phe Glu Tyr Tyr His             260 265 270 cgc ctg agg aac ctg ccc acc atc aac aga ctg gaa gtg ggg ggc gac 864 Arg Leu Arg Asn Leu Pro Thr Ile Asn Arg Leu Glu Val Gly Gly Asp         275 280 285 atc cag ctg acc cat gtg cag aca tag 891 Ile Gln Leu Thr His Val Gln Thr     290 295 <210> 2 <211> 296 <212> PRT <213> Artificial Sequence <220> <223> Polynucleodide for galectin-9 mutein <400> 2 Met Ala Phe Ser Gly Ser Gln Ala Pro Tyr Leu Ser Pro Ala Val Pro 1 5 10 15 Phe Ser Gly Thr Ile Gln Gly Gly Leu Gln Asp Gly Leu Gln Ile Thr             20 25 30 Val Asn Gly Thr Val Leu Ser Ser Ser Gly Thr Arg Phe Ala Val Asn         35 40 45 Phe Gln Thr Gly Phe Ser Gly Asn Asp Ile Ala Phe His Phe Asn Pro     50 55 60 Arg Phe Glu Asp Gly Gly Tyr Val Val Cys Asn Thr Arg Gln Asn Gly 65 70 75 80 Ser Trp Gly Pro Glu Glu Arg Lys Thr His Met Pro Phe Gln Lys Gly                 85 90 95 Met Pro Phe Asp Leu Cys Phe Leu Val Gln Ser Ser Asp Phe Lys Val             100 105 110 Met Val Asn Gly Ile Leu Phe Val Gln Tyr Phe His Arg Val Pro Phe         115 120 125 His Arg Val Asp Thr Ile Ser Val Asn Gly Ser Val Gln Leu Ser Tyr     130 135 140 Ile Ser Phe Gln His Met Thr Pro Ala Ile Pro Pro Met Met Tyr Pro 145 150 155 160 His Pro Ala Tyr Pro Met Pro Phe Ile Thr Thr Ile Leu Gly Gly Leu                 165 170 175 Tyr Pro Ser Lys Ser Ile Leu Leu Ser Gly Thr Val Leu Pro Ser Ala             180 185 190 Gln Arg Phe His Ile Asn Leu Cys Ser Gly Asn His Ile Ala Phe His         195 200 205 Leu Asn Pro Arg Phe Asp Glu Asn Ala Val Val Arg Asn Thr Gln Ile     210 215 220 Asp Asn Ser Trp Gly Ser Glu Glu Arg Ser Leu Pro Arg Lys Met Pro 225 230 235 240 Phe Val Arg Gly Gln Ser Phe Ser Val Trp Ile Leu Cys Glu Ala His                 245 250 255 Cys Leu Lys Val Ala Val Asp Gly Gln His Leu Phe Glu Tyr Tyr His             260 265 270 Arg Leu Arg Asn Leu Pro Thr Ile Asn Arg Leu Glu Val Gly Gly Asp         275 280 285 Ile Gln Leu Thr His Val Gln Thr     290 295 <210> 3 <211> 148 <212> PRT <213> Homo sapiens <400> 3 Met Ala Phe Ser Gly Ser Gln Ala Pro Tyr Leu Ser Pro Ala Val Pro 1 5 10 15 Phe Ser Gly Thr Ile Gln Gly Gly Leu Gln Asp Gly Leu Gln Ile Thr             20 25 30 Val Asn Gly Thr Val Leu Ser Ser Ser Gly Thr Arg Phe Ala Val Asn         35 40 45 Phe Gln Thr Gly Phe Ser Gly Asn Asp Ile Ala Phe His Phe Asn Pro     50 55 60 Arg Phe Glu Asp Gly Gly Tyr Val Val Cys Asn Thr Arg Gln Asn Gly 65 70 75 80 Ser Trp Gly Pro Glu Glu Arg Lys Thr His Met Pro Phe Gln Lys Gly                 85 90 95 Met Pro Phe Asp Leu Cys Phe Leu Val Gln Ser Ser Asp Phe Lys Val             100 105 110 Met Val Asn Gly Ile Leu Phe Val Gln Tyr Phe His Arg Val Pro Phe         115 120 125 His Arg Val Asp Thr Ile Ser Val Asn Gly Ser Val Gln Leu Ser Tyr     130 135 140 Ile Ser Phe Gln 145 <210> 4 <211> 146 <212> PRT <213> Homo sapiens <400> 4 Thr Pro Ala Ile Pro Pro Met Met Tyr Pro His Pro Ala Tyr Pro Met 1 5 10 15 Pro Phe Ile Thr Thr Ile Leu Gly Gly Leu Tyr Pro Ser Lys Ser Ile             20 25 30 Leu Leu Ser Gly Thr Val Leu Pro Ser Ala Gln Arg Phe His Ile Asn         35 40 45 Leu Cys Ser Gly Asn His Ile Ala Phe His Leu Asn Pro Arg Phe Asp     50 55 60 Glu Asn Ala Val Val Arg Asn Thr Gln Ile Asp Asn Ser Trp Gly Ser 65 70 75 80 Glu Glu Arg Ser Leu Pro Arg Lys Met Pro Phe Val Arg Gly Gln Ser                 85 90 95 Phe Ser Val Trp Ile Leu Cys Glu Ala His Cys Leu Lys Val Ala Val             100 105 110 Asp Gly Gln His Leu Phe Glu Tyr Tyr His Arg Leu Arg Asn Leu Pro         115 120 125 Thr Ile Asn Arg Leu Glu Val Gly Gly Asp Ile Gln Leu Thr His Val     130 135 140 Gln thr 145 <210> 5 <211> 972 <212> DNA <213> Homo sapiens <220> <221> CDS (222) (1) .. (972) <223> galectin-9 medium isoform <400> 5 atg gcc ttc agc ggt tcc cag gct ccc tac ctg agt cca gct gtc ccc 48 Met Ala Phe Ser Gly Ser Gln Ala Pro Tyr Leu Ser Pro Ala Val Pro 1 5 10 15 ttt tct ggg act att caa gga ggt ctc cag gac gga ctt cag atc act 96 Phe Ser Gly Thr Ile Gln Gly Gly Leu Gln Asp Gly Leu Gln Ile Thr             20 25 30 gtc aat ggg acc gtt ctc agc tcc agt gga acc agg ttt gct gtg aac 144 Val Asn Gly Thr Val Leu Ser Ser Ser Gly Thr Arg Phe Ala Val Asn         35 40 45 ttt cag act ggc ttc agt gga aat gac att gcc ttc cac ttc aac cct 192 Phe Gln Thr Gly Phe Ser Gly Asn Asp Ile Ala Phe His Phe Asn Pro     50 55 60 cgg ttt gaa gat gga ggg tac gtg gtg tgc aac acg agg cag aac gga 240 Arg Phe Glu Asp Gly Gly Tyr Val Val Cys Asn Thr Arg Gln Asn Gly 65 70 75 80 agc tgg ggg ccc gag gag agg aag aca cac atg cct ttc cag aag ggg 288 Ser Trp Gly Pro Glu Glu Arg Lys Thr His Met Pro Phe Gln Lys Gly                 85 90 95 atg ccc ttt gac ctc tgc ttc ctg gtg cag agc tca gat ttc aag gtg 336 Met Pro Phe Asp Leu Cys Phe Leu Val Gln Ser Ser Asp Phe Lys Val             100 105 110 atg gtg aac ggg atc ctc ttc gtg cag tac ttc cac cgc gtg ccc ttc 384 Met Val Asn Gly Ile Leu Phe Val Gln Tyr Phe His Arg Val Pro Phe         115 120 125 cac cgt gtg gac acc atc tcc gtc aat ggc tct gtg cag ctg tcc tac 432 His Arg Val Asp Thr Ile Ser Val Asn Gly Ser Val Gln Leu Ser Tyr     130 135 140 atc agc ttc cag cct ccc ggc gtg tgg cct gcc aac ccg gct ccc att 480 Ile Ser Phe Gln Pro Pro Gly Val Trp Pro Ala Asn Pro Ala Pro Ile 145 150 155 160 acc cag aca gtc atc cac aca gtg cag agc gcc cct gga cag atg ttc 528 Thr Gln Thr Val Ile His Thr Val Gln Ser Ala Pro Gly Gln Met Phe                 165 170 175 tct act ccc gcc atc cca cct atg atg tac ccc cac ccc gcc tat ccg 576 Ser Thr Pro Ala Ile Pro Pro Met Met Tyr Pro His Pro Ala Tyr Pro             180 185 190 atg cct ttc atc acc acc att ctg gga ggg ctg tac cca tcc aag tcc 624 Met Pro Phe Ile Thr Thr Ile Leu Gly Gly Leu Tyr Pro Ser Lys Ser         195 200 205 atc ctc ctg tca ggc act gtc ctg ccc agt gct cag agg ttc cac atc 672 Ile Leu Leu Ser Gly Thr Val Leu Pro Ser Ala Gln Arg Phe His Ile     210 215 220 aac ctg tgc tct ggg aac cac atc gcc ttc cac ctg aac ccc cgt ttt 720 Asn Leu Cys Ser Gly Asn His Ile Ala Phe His Leu Asn Pro Arg Phe 225 230 235 240 gat gag aat gct gtg gtc cgc aac acc cag atc gac aac tcc tgg ggg 768 Asp Glu Asn Ala Val Val Arg Asn Thr Gln Ile Asp Asn Ser Trp Gly                 245 250 255 tct gag gag cga agt ctg ccc cga aaa atg ccc ttc gtc cgt ggc cag 816 Ser Glu Glu Arg Ser Leu Pro Arg Lys Met Pro Phe Val Arg Gly Gln             260 265 270 agc ttc tca gtg tgg atc ttg tgt gaa gct cac tgc ctc aag gtg gcc 864 Ser Phe Ser Val Trp Ile Leu Cys Glu Ala His Cys Leu Lys Val Ala         275 280 285 gtg gat ggt cag cac ctg ttt gaa tac tac cat cgc ctg agg aac ctg 912 Val Asp Gly Gln His Leu Phe Glu Tyr Tyr His Arg Leu Arg Asn Leu     290 295 300 ccc acc atc aac aga ctg gaa gtg ggg ggc gac atc cag ctg acc cat 960 Pro Thr Ile Asn Arg Leu Glu Val Gly Gly Asp Ile Gln Leu Thr His 305 310 315 320 gtg cag aca tag 972 Val Gln Thr                                                                          <210> 6 <211> 323 <212> PRT <213> Homo sapiens <400> 6 Met Ala Phe Ser Gly Ser Gln Ala Pro Tyr Leu Ser Pro Ala Val Pro 1 5 10 15 Phe Ser Gly Thr Ile Gln Gly Gly Leu Gln Asp Gly Leu Gln Ile Thr             20 25 30 Val Asn Gly Thr Val Leu Ser Ser Ser Gly Thr Arg Phe Ala Val Asn         35 40 45 Phe Gln Thr Gly Phe Ser Gly Asn Asp Ile Ala Phe His Phe Asn Pro     50 55 60 Arg Phe Glu Asp Gly Gly Tyr Val Val Cys Asn Thr Arg Gln Asn Gly 65 70 75 80 Ser Trp Gly Pro Glu Glu Arg Lys Thr His Met Pro Phe Gln Lys Gly                 85 90 95 Met Pro Phe Asp Leu Cys Phe Leu Val Gln Ser Ser Asp Phe Lys Val             100 105 110 Met Val Asn Gly Ile Leu Phe Val Gln Tyr Phe His Arg Val Pro Phe         115 120 125 His Arg Val Asp Thr Ile Ser Val Asn Gly Ser Val Gln Leu Ser Tyr     130 135 140 Ile Ser Phe Gln Pro Pro Gly Val Trp Pro Ala Asn Pro Ala Pro Ile 145 150 155 160 Thr Gln Thr Val Ile His Thr Val Gln Ser Ala Pro Gly Gln Met Phe                 165 170 175 Ser Thr Pro Ala Ile Pro Pro Met Met Tyr Pro His Pro Ala Tyr Pro             180 185 190 Met Pro Phe Ile Thr Thr Ile Leu Gly Gly Leu Tyr Pro Ser Lys Ser         195 200 205 Ile Leu Leu Ser Gly Thr Val Leu Pro Ser Ala Gln Arg Phe His Ile     210 215 220 Asn Leu Cys Ser Gly Asn His Ile Ala Phe His Leu Asn Pro Arg Phe 225 230 235 240 Asp Glu Asn Ala Val Val Arg Asn Thr Gln Ile Asp Asn Ser Trp Gly                 245 250 255 Ser Glu Glu Arg Ser Leu Pro Arg Lys Met Pro Phe Val Arg Gly Gln             260 265 270 Ser Phe Ser Val Trp Ile Leu Cys Glu Ala His Cys Leu Lys Val Ala         275 280 285 Val Asp Gly Gln His Leu Phe Glu Tyr Tyr His Arg Leu Arg Asn Leu     290 295 300 Pro Thr Ile Asn Arg Leu Glu Val Gly Gly Asp Ile Gln Leu Thr His 305 310 315 320 Val Gln Thr              <210> 7 <211> 61 <212> PRT <213> Homo sapiens <400> 7 Asn Pro Arg Thr Val Pro Val Gln Pro Ala Phe Ser Thr Val Pro Phe 1 5 10 15 Ser Gln Pro Val Cys Phe Pro Pro Arg Pro Arg Gly Arg Arg Gln Lys             20 25 30 Pro Pro Gly Val Trp Pro Ala Asn Pro Ala Pro Ile Thr Gln Thr Val         35 40 45 Ile His Thr Val Gln Ser Ala Pro Gly Gln Met Phe Ser     50 55 60 <210> 8 <211> 29 <212> PRT <213> Homo sapiens <400> 8 Pro Pro Gly Val Trp Pro Ala Asn Pro Ala Pro Ile Thr Gln Thr Val 1 5 10 15 Ile His Thr Val Gln Ser Ala Pro Gly Gln Met Phe Ser             20 25 <210> 9 <211> 17 <212> PRT <213> Homo sapiens <400> 9 Thr Gln Thr Val Ile His Thr Val Gln Ser Ala Pro Gly Gln Met Phe 1 5 10 15 Ser      <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide to act as a primer for PCR <400> 10 cgtcctcata tggccttcag cggttcccag 30 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide to act as a primer for PCR <400> 11 cgaccgcata tgctggaagc tgatgtagga cag 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide to act as a primer for PCR <400> 12 cgtcctcata tgactcccgc catcccacct atg 33 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotide to act as a primer for PCR <400> 13 cgaccgggat ccctatgtct gcacatgggt cag 33  

Claims (19)

A protein represented by the following structure, wherein the protein or salt thereof is characterized in that it retains the sugar chain recognition activity of native galectin 9 and that the link peptide is stable to protease as compared to native galectin 9 (NCRD) -Linker- (CCRD) In the above structure, NC- (N-terminal Carbohydrate Recognition Domain; N-terminal sugar chain recognition region) is (i) a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3, or (ii) 1 to 8 in the amino acid sequence represented by SEQ ID NO: A polypeptide consisting of an amino acid sequence having three amino acids deleted and retaining sugar binding ability, wherein the deletion is a polypeptide occurring at positions 141 to 148 of SEQ ID NO: 3 CCRD (C-terminal Carbohydrate Recognition Domain) refers to (i) a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 4, or (ii) a amino acid sequence represented by SEQ ID NO: 1 to 21 A polypeptide consisting of an amino acid sequence having three amino acids deleted and retaining sugar binding ability, wherein the deletion is a polypeptide occurring at positions 1 to 21 of SEQ ID NO: 4, The linker is a peptide consisting of any two natural amino acids or a peptide consisting of the sequence of Arg Ile Pro. delete A protein represented by the following structure, wherein the protein or salt thereof is characterized in that it retains the sugar chain recognition activity of native galectin 9 and that the link peptide is stable to protease as compared to native galectin 9 (NCRD) -Linker- (CCRD) In the above structure, NC- (N-terminal Carbohydrate Recognition Domain) refers to (i) a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 3, or (ii) a position 5 in the amino acid sequence represented by SEQ ID NO: 3 Consists of an amino acid sequence of at least one amino acid substitution selected from the group consisting of Gly substituted with Ser or Lys, Lys at position 88 with Arg and Ser at position 135 with Phe, and also possess sugar binding capacity Is a polypeptide, CCRD (C-terminal Carbohydrate Recognition Domain) refers to (i) a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 4, or (ii) a position 61 in the amino acid sequence represented by SEQ ID NO: 4 A polypeptide having a amino acid sequence consisting of at least one of an amino acid substitution selected from Pro substituted with Leu and Glu at 104 and Gly substituted, and also has a sugar binding ability, The linker is a peptide consisting of any two natural amino acids or a peptide consisting of the sequence of Arg Ile Pro. The protein or salt thereof according to claim 1, which is resistant to degradation according to protease as compared to galectin 9. The protein or salt thereof according to claim 1, wherein the linker is a peptide composed of the amino acid sequence of His Met or Arg Ile Pro. The protein or salt thereof according to claim 1, which is composed of an amino acid sequence represented by SEQ ID NO: 2. A nucleic acid comprising a nucleotide sequence encoding the protein of claim 1. 8. The nucleic acid according to claim 7, which is DNA or RNA. A recombinant vector comprising the nucleic acid of claim 7. The recombinant vector according to claim 9, comprising a nucleotide sequence encoding a label protein and / or peptide in addition to the nucleic acid of claim 7. A transformant comprising the nucleic acid of claim 7. 12. The transformant of claim 11, wherein the transformant host cell is a prokaryotic or eukaryotic cell. An immunomodulatory agent comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11. An anti-tumor drug comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11. An agent for autoimmune diseases comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11. An antiallergic agent comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11. An anti-inflammatory agent comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11. A pain relief agent comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11. A bone regeneration agent comprising at least one selected from the group consisting of a protein of claim 1, a nucleic acid of claim 7, a recombinant vector of claim 9, and a transformant of claim 11.

Images