CN107540738B - Crassostrea hongkongensis galectin Chgalectin and preparation method and application thereof - Google Patents
Crassostrea hongkongensis galectin Chgalectin and preparation method and application thereof Download PDFInfo
- Publication number
- CN107540738B CN107540738B CN201710598472.5A CN201710598472A CN107540738B CN 107540738 B CN107540738 B CN 107540738B CN 201710598472 A CN201710598472 A CN 201710598472A CN 107540738 B CN107540738 B CN 107540738B
- Authority
- CN
- China
- Prior art keywords
- chgalectin
- crassostrea hongkongensis
- galectin
- acid sequence
- hongkongensis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Abstract
The invention discloses a crassostrea hongkongensis galectin and a preparation method and application thereof, wherein the amino acid sequence of the crassostrea hongkongensis galectin is shown as SEQ ID NO:1 is shown. Experimental data show that the giant crassostrea hongkongensis galectin is a brand-new 4-linked galectin protein, has biological activity of agglutinating various gram-positive bacteria and gram-negative bacteria, can effectively improve the immunity of shellfish, particularly giant crassostrea hongkongensis and the like, reduces the occurrence of diseases, and effectively improves the culture benefit.
Description
Technical Field
The invention relates to the field of biology, and in particular relates to a giant crassostrea hongkongensis galectin ChGalectin, and a preparation method and application thereof.
Background
Shellfish is one of the most important economic groups in the world, shellfish culture occupies a great position in the development of coastal economic society in China, and has great development potential.
Crassostrea hongkongensis (Crassostrea honggkongensis) belongs to the phylum mollusca, class bivalvia, order Pteriales, family Ostreidae, and is the most important economic animal of shellfish in coastal areas of south China. With the continuous expansion of the breeding industry, the problems of large-scale allopatric transplantation of natural seedlings, reduced stress resistance of the bred crassostrea hongkongensis, germplasm resource degradation and the like are highlighted. The poor immune ability of the oysters, outbreak of diseases and even large-scale death caused by the lack of improved varieties are the main bottlenecks for restricting the sustainable development of the shellfish industry.
Therefore, how to improve the antibacterial capability of the shellfish and easily accept the shellfish by the public is a problem to be solved at present.
Disclosure of Invention
The invention aims to provide giant crassostrea hongkongensis galectin and a preparation method and application thereof.
The technical scheme adopted by the invention is as follows:
a Crassostrea hongkongensis galectin ChGalectin has an amino acid sequence shown in SEQ ID NO. 1.
The nucleic acid sequence of the giant crassostrea hongkongensis galectin is coded. Further, the nucleic acid sequence is codon optimized for the expression host cell. In particular, the nucleic acid sequence is as shown in SEQ ID NO: 2, respectively.
An expression vector, wherein a nucleic acid sequence for expressing the crassostrea hongkongensis galectin is inserted into the vector.
Furthermore, the expression vector is a prokaryotic expression vector.
A culture method for improving shellfish immunity is characterized in that the crassostrea hongkongensis ChGalectin is added in the shellfish culture process or co-cultured with cells expressing the crassostrea hongkongensis ChGalectin.
The shellfish is selected from oyster, mussel, scallop, Sinonovacula constricta, arca granosa, clam, abalone, pearl oyster, Jiang Yao and other common economically cultured shellfish.
A method for preparing giant crassostren ChGalectin hong Kong, the amino acid sequence of giant crassostren ChGalectin hong Kong is shown as SEQ ID NO:1, comprising:
1) constructing an expression vector;
2) transferring the expression vector into a host cell, and inducing expression:
3) purifying to obtain the giant crassostrea hongkongensis galectin.
The invention has the beneficial effects that:
experimental data show that the giant crassostrea hongkongensis ChGalectin is a brand-new 4-linked galectin protein, has biological activity of agglutinating various gram-positive bacteria and gram-negative bacteria, can effectively improve shellfish such as oysters, mussels, scallops, sinonovacula constricta, arca granosa, clams, abalones, pearl shells, Jianyao and the like, particularly the immunity of the giant crassostrea hongkongensis, reduces the occurrence of diseases and effectively improves the culture benefit.
Drawings
Fig. 1 is an expressed and purified crassostrea hongkongensis galectin recombinant protein, wherein M: a protein Marker; lane 1: recombinant expression protein GST-ChGalectin; lane 2: purified GST; arrows indicate recombinantly expressed protein of interest GST-ChGalectin;
FIG. 2 shows the results of agglutination analysis of bacteria by ChGalectin, a semilacticin of Crassostrea hongkongensis; the agglutination analysis of the ChGalectin recombinant protein on bacteria determines that the ChGalectin recombinant protein has the agglutination capacity on various bacteria. A. B: agglutination analysis of gram-negative bacteria Escherichia coli by ChGalectin; C. c, performing agglutination analysis on Vibrio algyrinyticus of gram-negative bacteria by Chgalectin; E. f: agglutination assays for ChGalectin and the gram-positive bacterium Bacillus thuringiensis.
Detailed Description
To further illustrate the technical means, novelty, and effects of the present invention, the following examples are given by way of illustration only and should not be construed to limit the present invention.
Example 1
RNA extraction
The extraction of total RNA uses Trizol (Invitrogen) and comprises the following steps:
1) taking 40mg of Hongkong giant oyster gill tissue in a mortar precooled by liquid nitrogen, grinding the tissue into powder, transferring the powder into a centrifuge tube filled with 1ml of Trizol, blowing and uniformly mixing;
2) adding 200 μ L chloroform, shaking vigorously for 40s, and standing at room temperature for 5 min;
3) centrifuging at 4 deg.C for 10min at 12,000 Xg, sucking supernatant, and transferring to new tube;
4) adding 0.5ml of isopropanol, mixing uniformly, and precipitating at-80 ℃ overnight;
5) centrifuging at 4 deg.C for 10min at 12,000 Xg, and discarding the supernatant;
6) rinsing with 75% ethanol for twice precipitation;
7) the supernatant was discarded, and 80. mu.L of DEPC was added to dissolve the RNA.
cDNA library construction
Construction of full-Length cDNA library Using the SMART cDNA library construction Kit (Clontech), the specific steps were as follows:
1) synthesizing a first strand of cDNA using MMLV;
2) amplifying the cDNA using LD PCR;
3) digesting and purifying cDNA product by proteinase K;
4) product size separation using Chroma Spin 400;
5) connecting the cDNA to a lambda TripEx2 vector, packaging the vector by lambda phage, and transforming the vector into host cells;
6) and detecting the titer of the cDNA library.
The sequencing result shows that the complete sequence of the cDNA is as follows:
ATCCCAACAATTTGAAAATTTCAAGAAAAAACATCTCTTGCCAGACCGCGTCGGTATATAGTAAGGTGATCAAACATGACTTACCAGATCAGCAGAATTCCACAACCATTCACCAGTTACATTCCTAATGGCCTCCATGTTGGCAAGCACTTGCTCCTGAGAGGACGCGTGTCTTACGGAACGGAAGCGTTTGCGATCAACCTTCAACAAAACCCCGAACCTTGCGATGGAGAGGTTGCGTTCCATTTCAACCCTCGTCCAGGCGAGCAGCAATGCGTGCGCAACTCGTTCGATGGAGGATCATGGATGGATGAAGAGAGAGACCAGCCTCATTTTCCATTTGACGAAGGTCGGTCATTTACCCTTCGTATTGAGGTGGCGGAAGAGGGGTTCCGAACGTATGTAAATGGAAAGCCTTACGTCAATTTCAGCCATCGCCTGGACCTCGGGAATGTCCACTATCTATACTTGACGGAGGGAGCAGAGTTCTATGACATAAGCTACCAAGACCGTTACTCTTTGCCATATAAGTCCGAGATACCCCAGCAGATGAACGTAGGAAAAGCCGTCAGAATCAGAGGCGCCGCCCAGGACAACGATGGATTCAGTGTGAATTTTGCCTGTGACCCAGACAATGAAAACTGTGCCTTCCACTTTAACCCCCGACCCAATGAGGGCGTGGTCGTCCGTAATGCTAACCTGGGGGGCTGGGGCGAAGAAGAGAGGGATTACGATGCAGAATTTCCTTTCAATCCAAACAACTACTTTGACGCCATGTTTATTTGCACCGACGATAAATATATGGTTCACGTGAATGACAAGTATTTCACGGAGTTCAATCACCGTGGCGGGGTCAATGACGCATCCCATTTTAACATCGTGGGAAACCTGGACATCCAAGATGTCGAGTACTTCGAGCCATTGGAAGATGATTTCGTGAAGACCTTCCCATCCGGATTGGTGAAAGGAGACGTGCTGATCTTTAGGGGGTTCATGAAACCCGGGGGTGACACGTTCTCCATCAACTTCATGAACGGCTACAGCGTGGAGGACGACATTGCTTTCCACCTGAACCCCCGAGTTGGGGAGGGACAGGTTGTCATGAACTGCTGCATGGGTGGCGGGTGGGGGGAAGAGGAAAGGGAGGATATTCCCTCCCCCATAGCCAACAGAGAACCATTTGAGGTCAAAGTTGTAGTGAAAAAGAAGAAATTCAAGGTATATGTTAACGGCAAGAAGTGCATGAAGTTTGCCGCTAGGGGGAATGTGGAAGACATTAAGGGCGTCAATATCAAGGGAGAGGCGTATGTGTACGAGGTCAAACTAGAGCGCAAATTGGAGGATTCTTGGGAATATCTTCCTGGAGGATTCCGAGTAGGTGGCTGGGTCGTCGTTCAGGCAATACCCAAGAAAGGTTCCGAAGGATTTGCCATTAACTTCCGAACTGGTTCCGATGAAGGAAGCGATATTGCTTTCCACTTCAACCCACGCCTCCAAGAGAACTGTACCATTAGGAACTCGTGCTCCGGCGACGAGTGGGGAGGGGAAGAGAGGGACCAGCCCGAGTTTCCGTTTGAGCTGAAGGACACTTGTGAGATAGCAATCCAAGCACAGCCGGACAGGTTTGTGACTTACGTAAATGGCCGACGGTACATCGACTTCAATCATCGCCTTCCATTGGAGAGCATCTGTTGTCTTGAGCTGACCGGAAGTGCTAACTTCTTCGAACCAAAGTTCTTCTAAACAGCCGTAGACTTGTCAAATGAACTGGCTGATAACGTCTCCATTTGCTTATCTGCTTACTATGACAAAACTCTTTGGCTTCTACGCATACCGAAGCTCACTATGTACAGGGCACTGCATTTAGAGGTGTAGAAATTCTCACTGTGATTTCATCACGTGGCAAGATGACGAACTGTGATTTATTATTATATTGTTAATTGTTAGCAATAATAGAAATTGTATCTTGCAGCTCATATAAGATAACTCTTATTGTTTTTGAAAATAAAAAATACTGTATTGTTAAAAAAAAAAAAAAAAAAAAA(SEQ ID No.2)。
the corresponding amino acid sequence is:
MTYQISRIPQPFTSYIPNGLHVGKHLLLRGRVSYGTEAFAINLQQNPEPCDGEVAFHFNPRPGEQQCVRNSFDGGSWMDEERDQPHFPFDEGRSFTLRIEVAEEGFRTYVNGKPYVNFSHRLDLGNVHYLYLTEGAEFYDISYQDRYSLPYKSEIPQQMNVGKAVRIRGAAQDNDGFSVNFACDPDNENCAFHFNPRPNEGVVVRNANLGGWGEEERDYDAEFPFNPNNYFDAMFICTDDKYMVHVNDKYFTEFNHRGGVNDASHFNIVGNLDIQDVEYFEPLEDDFVKTFPSGLVKGDVLIFRGFMKPGGDTFSINFMNGYSVEDDIAFHLNPRVGEGQVVMNCCMGGGWGEEEREDIPSPIANREPFEVKVVVKKKKFKVYVNGKKCMKFAARGNVEDIKGVNIKGEAYVYEVKLERKLEDSWEYLPGGFRVGGWVVVQAIPKKGSEGFAINFRTGSDEGSDIAFHFNPRLQENCTIRNSCSGDEWGGEERDQPEFPFELKDTCEIAIQAQPDRFVTYVNGRRYIDFNHRLPLESICCLELTGSANFFEPKFF(SEQ ID No.1)。
the sequence comparison shows that the crassostrea hongkongensis galectin ChGalectin is a brand-new 4-linked galectin protein.
3. Prokaryotic expression vector construction
1) A pair of primers (with the forward primer sequence of ATGCGGATCCATGACTTACCAGATCAGCAG and the reverse primer sequence of ACTG) covering the ChGalectin ORF of Crassostrea hongkongensis was designedCTCGAGTTAGAAGAACTTTGGTTCGA), adding BamH-I and Xho-I sites and protective bases at two ends of the primer respectively;
2) taking the gill tissue cDNA of the crassostrea hongkongensis as a template, and carrying out PCR amplification by using the pair of primers;
3) carrying out double enzyme digestion on the PCR product and the pGex4T-1 vector by using BamH-I and Xho-I respectively, and recovering and purifying enzyme digestion products;
4) connecting the PCR fragment after enzyme digestion with a pGex4T-1 vector;
5) and (4) transforming, selecting positive clones, sequencing to verify that the vector is correct, and performing subsequent tests.
4. Prokaryotic expression and purification of recombinant proteins
1) Transforming the constructed ChGalectin prokaryotic expression vector into BL21(DE 3);
2) selecting single clone, culturing until OD600 is 0.6, adding IPTG to final concentration of 0.3mM, and inducing expression at 22 deg.C and 180 rmp;
3) collecting bacterial liquid after 4h, centrifuging at 12,000 Xg for 10min at 4 ℃;
4) adding Lysozyme to a final concentration of 2mg/ml, and then carrying out ultrasonic disruption;
5) the recombinant protein was purified using GST Resin, and the purified product was analyzed using 12% SDS-PAGE gel.
The results of the analysis of the SDS-PAGE gel are shown in FIG. 1, in which M: a protein Marker; lane 1: recombinant expression protein GST-ChGalectin; lane 2: purified GST; arrows indicate the recombinantly expressed protein of interest GST-ChGalectin. The experimental results show that the expressed product has higher purity and the size is consistent with the predicted molecular weight.
5. Bacterial agglutination assay
1) After all test bacteria had grown to a logarithmic phase in LB medium, they were centrifuged at 6000 Xg for 5min and resuspended to 2.5X 10 in TBS (50mM NaCl,50mM Tris-HCl, pH 8.0)9pfu/ml；
2) Respectively adding 10 mu L of the bacterial resuspension into 25 mu L of recombinant protein GST-ChGaletin and 25 mu L of GST, wherein the protein concentration is 50 ng/mu L;
3) incubating at room temperature for 1 h;
4) taking 5 mu L of the incubation liquid to a glass slide containing 25 mu L of LTBS, and blowing, beating and uniformly mixing;
5) observing under a microscope, taking a picture and storing the picture.
FIG. 2 shows the results of agglutination analysis of bacteria by ChGalectin, a semilacticin of Crassostrea hongkongensis; the agglutination analysis of the ChGalectin recombinant protein on bacteria determines that the ChGalectin recombinant protein has the agglutination capacity on various bacteria. A. B: agglutination analysis of gram-negative bacteria Escherichia coli by ChGalectin; C. c, performing agglutination analysis on Vibrio algyrinyticus of gram-negative bacteria by Chgalectin; E. f: agglutination assay of the gram-positive bacterium Bacillus thuringiensis by ChGalectin. The experimental results show that the recombinant protein GST-ChGalectin has the aggregation capability to Escherichia coli, Vibrio alginolyticus and Bacillus thuringiensis, while the GST protein in the control experiment has no aggregation capability to the three bacteria. The results show that the crassostrea hongkongensis galectin of the invention has the biological activity of agglutinating various gram-positive bacteria and gram-negative bacteria.
6. Analysis for improving shellfish disease resistance
1) Recombinant proteins GST-ChGalectin and GST were prepared in large amounts according to the protocol in example 1;
2) experimental, control (using GST protein as control) and blank groups were set up, 20 shellfish per group, and 3 replicates were set up. The shellfish of the experimental group and the shellfish of the control group are both raised in a 50L water tank and aerated for oxygenation;
3) culturing pathogenic organisms Escherichia coli and Vibrio alginolyticus to OD600 of 1.0, centrifuging at 4 deg.C for 10min at 12,000 Xg, collecting thallus, washing with TBS for 2 times, and adjusting OD600 to 1.0;
4) 200. mu.L of pathogenic bacteria (OD 600. gtoreq.1.0) were added to the experimental group, the control group and the blank group, and 5g of GST-ChGalectin was added to the experimental group, 5g of GST protein was added to the control group, and none of the proteins was added to the blank group. Adding proteins with corresponding mass into the experimental group and the control group every 12 hours, keeping the experiment for 10 days, and recording the death condition of the shellfish;
5) according to the method, experimental analysis is carried out in sequence for improving the capability of the shellfish such as crassostrea hongkongensis, mussels and sinonovacula constricta to Escherichia coli and Vibrio algyrinyticus by ChGalectin, and the death condition of the shellfish is recorded.
The experimental results are collated as follows:
TABLE 1 analysis of ChGalectin for improving disease resistance of shellfish
The above experimental results show that GST-ChGalectin can improve the disease resistance of the shellfishes such as Crassostrea hongkongensis and Chlamys nobilis on Escherichia coli and Vibrio algyrinthulus, while GST can not improve the disease resistance of the shellfishes such as Crassostrea hongkongensis and Chlamys nobilis on Escherichia coli and Vibrio algyrinthulus. Therefore, the ChGalectin can effectively improve the immunity of shellfish, such as oysters, mussels, scallops, sinonovacula constricta, ark shells, clams, abalones and the like, particularly crassostrea hongkongensis and the like, reduce the occurrence of diseases and effectively improve the culture benefit.
SEQUENCE LISTING
<110> Qingyuan profession technical school
<120> giant crassostrea hongkongensis galectin and preparation method and application thereof
<130>ChGalectin
<160>2
<170>PatentIn version 3.5
<210>1
<211>555
<212>PRT
<213> Crassostera hongkongensis (Crassostra hongkongensis)
<400>1
Met Thr Tyr Gln Ile Ser Arg Ile Pro Gln Pro Phe Thr Ser Tyr Ile
1 5 10 15
Pro Asn Gly Leu His Val Gly Lys His Leu Leu Leu Arg Gly Arg Val
20 25 30
Ser Tyr Gly Thr Glu Ala Phe Ala Ile Asn Leu Gln Gln Asn Pro Glu
35 40 45
Pro Cys Asp Gly Glu Val Ala Phe His Phe Asn Pro Arg Pro Gly Glu
50 55 60
Gln Gln Cys Val Arg Asn Ser Phe Asp Gly Gly Ser Trp Met Asp Glu
65 70 75 80
Glu Arg Asp Gln Pro His Phe Pro Phe Asp Glu Gly Arg Ser Phe Thr
85 90 95
Leu Arg Ile Glu Val Ala Glu Glu Gly Phe Arg Thr Tyr Val Asn Gly
100 105 110
Lys Pro Tyr Val Asn Phe Ser His Arg Leu Asp Leu Gly Asn Val His
115 120 125
Tyr Leu Tyr Leu Thr Glu Gly Ala Glu Phe Tyr Asp Ile Ser Tyr Gln
130 135 140
Asp Arg Tyr Ser Leu Pro Tyr Lys Ser Glu Ile Pro Gln Gln Met Asn
145 150 155 160
Val Gly Lys Ala Val Arg Ile Arg Gly Ala Ala Gln Asp Asn Asp Gly
165 170 175
Phe Ser Val Asn Phe Ala Cys Asp Pro Asp Asn Glu Asn Cys Ala Phe
180 185 190
His Phe Asn Pro Arg Pro Asn Glu Gly Val Val Val Arg Asn Ala Asn
195 200 205
Leu Gly Gly Trp Gly Glu Glu Glu Arg Asp Tyr Asp Ala Glu Phe Pro
210 215 220
Phe Asn Pro Asn Asn Tyr Phe Asp Ala Met Phe Ile Cys Thr Asp Asp
225 230 235 240
Lys Tyr Met Val His Val Asn Asp Lys Tyr Phe Thr Glu Phe Asn His
245 250 255
Arg Gly Gly Val Asn Asp Ala Ser His Phe Asn Ile Val Gly Asn Leu
260 265 270
Asp Ile Gln Asp Val Glu Tyr Phe Glu Pro Leu Glu Asp Asp Phe Val
275 280 285
Lys Thr Phe Pro Ser Gly Leu Val Lys Gly Asp Val Leu Ile Phe Arg
290 295 300
Gly Phe Met Lys Pro Gly Gly Asp Thr Phe Ser Ile Asn Phe Met Asn
305 310 315 320
Gly Tyr Ser Val Glu Asp Asp Ile Ala Phe His Leu Asn Pro Arg Val
325 330 335
Gly Glu Gly Gln Val Val Met Asn Cys Cys Met Gly Gly Gly Trp Gly
340 345 350
Glu Glu Glu Arg Glu Asp Ile Pro Ser Pro Ile Ala Asn Arg Glu Pro
355 360 365
Phe Glu Val Lys Val Val Val Lys Lys Lys Lys Phe Lys Val Tyr Val
370 375 380
Asn Gly Lys Lys Cys Met Lys Phe Ala Ala Arg Gly Asn Val Glu Asp
385 390 395 400
Ile Lys Gly Val Asn Ile Lys Gly Glu Ala Tyr Val Tyr Glu Val Lys
405 410 415
Leu Glu Arg Lys Leu Glu Asp Ser Trp Glu Tyr Leu Pro Gly Gly Phe
420 425 430
Arg Val Gly Gly Trp Val Val Val Gln Ala Ile Pro Lys Lys Gly Ser
435 440 445
Glu Gly Phe Ala Ile Asn Phe Arg Thr Gly Ser Asp Glu Gly Ser Asp
450 455 460
Ile Ala Phe His Phe Asn Pro Arg Leu Gln Glu Asn Cys Thr Ile Arg
465 470 475 480
Asn Ser Cys Ser Gly Asp Glu Trp Gly Gly Glu Glu Arg Asp Gln Pro
485 490 495
Glu Phe Pro Phe Glu Leu Lys Asp Thr Cys Glu Ile Ala Ile Gln Ala
500 505 510
Gln Pro Asp Arg Phe Val Thr Tyr Val Asn Gly Arg Arg Tyr Ile Asp
515 520 525
Phe Asn His Arg Leu Pro Leu Glu Ser Ile Cys Cys Leu Glu Leu Thr
530 535 540
Gly Ser Ala Asn Phe Phe Glu Pro Lys Phe Phe
545 550 555
<210>2
<211>2045
<212>DNA
<213> Crassostera hongkongensis (Crassostra hongkongensis)
<400>2
atcccaacaa tttgaaaatt tcaagaaaaa acatctcttg ccagaccgcg tcggtatata 60
gtaaggtgat caaacatgac ttaccagatc agcagaattc cacaaccatt caccagttac 120
attcctaatg gcctccatgt tggcaagcac ttgctcctga gaggacgcgt gtcttacgga 180
acggaagcgt ttgcgatcaa ccttcaacaa aaccccgaac cttgcgatgg agaggttgcg 240
ttccatttca accctcgtcc aggcgagcag caatgcgtgc gcaactcgtt cgatggagga 300
tcatggatgg atgaagagag agaccagcct cattttccat ttgacgaagg tcggtcattt 360
acccttcgta ttgaggtggc ggaagagggg ttccgaacgt atgtaaatgg aaagccttac 420
gtcaatttca gccatcgcct ggacctcggg aatgtccact atctatactt gacggaggga 480
gcagagttct atgacataag ctaccaagac cgttactctt tgccatataa gtccgagata 540
ccccagcaga tgaacgtagg aaaagccgtc agaatcagag gcgccgccca ggacaacgat 600
ggattcagtg tgaattttgc ctgtgaccca gacaatgaaa actgtgcctt ccactttaac 660
ccccgaccca atgagggcgt ggtcgtccgt aatgctaacc tggggggctg gggcgaagaa 720
gagagggatt acgatgcaga atttcctttc aatccaaaca actactttga cgccatgttt 780
atttgcaccg acgataaata tatggttcac gtgaatgaca agtatttcac ggagttcaat 840
caccgtggcg gggtcaatga cgcatcccat tttaacatcg tgggaaacct ggacatccaa 900
gatgtcgagt acttcgagcc attggaagat gatttcgtga agaccttccc atccggattg 960
gtgaaaggag acgtgctgat ctttaggggg ttcatgaaac ccgggggtga cacgttctcc 1020
atcaacttca tgaacggcta cagcgtggag gacgacattg ctttccacct gaacccccga 1080
gttggggagg gacaggttgt catgaactgc tgcatgggtg gcgggtgggg ggaagaggaa 1140
agggaggata ttccctcccc catagccaac agagaaccat ttgaggtcaa agttgtagtg 1200
aaaaagaaga aattcaaggt atatgttaac ggcaagaagt gcatgaagtt tgccgctagg 1260
gggaatgtgg aagacattaa gggcgtcaat atcaagggag aggcgtatgt gtacgaggtc 1320
aaactagagc gcaaattgga ggattcttgg gaatatcttc ctggaggatt ccgagtaggt 1380
ggctgggtcg tcgttcaggc aatacccaag aaaggttccg aaggatttgc cattaacttc 1440
cgaactggtt ccgatgaagg aagcgatatt gctttccact tcaacccacg cctccaagag 1500
aactgtacca ttaggaactc gtgctccggc gacgagtggg gaggggaaga gagggaccag 1560
cccgagtttc cgtttgagct gaaggacact tgtgagatag caatccaagc acagccggac 1620
aggtttgtga cttacgtaaa tggccgacgg tacatcgact tcaatcatcg ccttccattg 1680
gagagcatct gttgtcttga gctgaccgga agtgctaact tcttcgaacc aaagttcttc 1740
taaacagccg tagacttgtc aaatgaactg gctgataacg tctccatttg cttatctgct 1800
tactatgaca aaactctttg gcttctacgc ataccgaagc tcactatgta cagggcactg 1860
catttagagg tgtagaaatt ctcactgtga tttcatcacg tggcaagatg acgaactgtg 1920
atttattatt atattgttaa ttgttagcaa taatagaaat tgtatcttgc agctcatata 1980
agataactct tattgttttt gaaaataaaa aatactgtat tgttaaaaaa aaaaaaaaaa 2040
aaaaa 2045
Claims (10)
1. A Crassostrea hongkongensis galectin ChGalectin has an amino acid sequence shown in SEQ ID NO. 1.
2. A nucleic acid sequence encoding the crassostrea hongkongensis ChGalectin of claim 1.
3. The nucleic acid sequence of claim 2, wherein: the nucleic acid sequence is shown as SEQ ID NO: 2, respectively.
4. The nucleic acid sequence of claim 2, wherein: the nucleic acid sequence is codon optimized for the expression host cell.
5. An expression vector, characterized in that: a vector having inserted therein a nucleic acid sequence expressing the crassostrea hongkongensis ChGalectin of claim 1.
6. The expression vector of claim 5, wherein: the expression vector is a prokaryotic expression vector.
7. The use of the crassostrea hongkongensis galectin of claim 1 in the preparation of a preparation for enhancing shellfish immunity.
8. Use according to claim 7, characterized in that: the shellfish is selected from Concha Ostreae, mussel, scallop, Sinonovacula constricta, Arca granosa, Concha Meretricis Seu Cyclinae, abalone, Margarita, and Yao.
9. A culture method for improving the immunological competence of shellfish is characterized in that: adding the crassostrea hongkongensis ChGalectin according to claim 1 to a shellfish culture process, or co-culturing with cells expressing the crassostrea hongkongensis ChGalectin according to claim 1.
10. A method for preparing giant crassostrea hongkongensis ChGalectin comprises constructing expression vector, wherein the amino acid sequence of giant crassostrea hongkongensis ChGalectin is shown in SEQ ID NO. 1; and transferring the expression vector into a host cell, performing induced expression, and purifying to obtain the Crassostrea hongkongensis galectin Chgalectin.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710229718 | 2017-04-10 | ||
| CN2017102297181 | 2017-04-10 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107540738A CN107540738A (en) | 2018-01-05 |
| CN107540738B true CN107540738B (en) | 2020-04-24 |
Family
ID=60971189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710598472.5A Active CN107540738B (en) | 2017-04-10 | 2017-07-21 | Crassostrea hongkongensis galectin Chgalectin and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107540738B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108610406B (en) * | 2018-04-04 | 2021-03-19 | 中国科学院南海海洋研究所 | Oyster cell apoptosis gene caspase3 gene and application thereof in preparation of pathological detection diagnostic reagent |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101228274A (en) * | 2005-04-12 | 2008-07-23 | 布鲁塞尔大学 | Use of a galectin-1-targeted RNAi-based approach for the treatment of cancer |
| CN101792489A (en) * | 2009-12-24 | 2010-08-04 | 中国人民解放军军事医学科学院基础医学研究所 | Preparation and application of human galectin-9 deletant for enhancement of immune response |
| CN103623393A (en) * | 2012-08-23 | 2014-03-12 | 上海博笛生物科技有限公司 | Effects of galectin-9 on systemic lupus erythematosus or similar inflammatory diseases |
| CN104109195A (en) * | 2014-07-19 | 2014-10-22 | 浙江万里学院 | Tegillarca granosa galactose lectin Tg-GAL and application thereof |
| CN104292321A (en) * | 2004-03-29 | 2015-01-21 | 株式会社嘉尔药物 | Novel modified galectin 9 protein and use thereof |
-
2017
- 2017-07-21 CN CN201710598472.5A patent/CN107540738B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104292321A (en) * | 2004-03-29 | 2015-01-21 | 株式会社嘉尔药物 | Novel modified galectin 9 protein and use thereof |
| CN101228274A (en) * | 2005-04-12 | 2008-07-23 | 布鲁塞尔大学 | Use of a galectin-1-targeted RNAi-based approach for the treatment of cancer |
| CN101792489A (en) * | 2009-12-24 | 2010-08-04 | 中国人民解放军军事医学科学院基础医学研究所 | Preparation and application of human galectin-9 deletant for enhancement of immune response |
| CN103623393A (en) * | 2012-08-23 | 2014-03-12 | 上海博笛生物科技有限公司 | Effects of galectin-9 on systemic lupus erythematosus or similar inflammatory diseases |
| CN104109195A (en) * | 2014-07-19 | 2014-10-22 | 浙江万里学院 | Tegillarca granosa galactose lectin Tg-GAL and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| NCBI序列号: XP_011448166.1;佚名;《Genebank》;20170202;1-5 * |
| 佚名.NCBI序列号: XP_011448166.1.《Genebank》.2017, * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107540738A (en) | 2018-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111499765B (en) | Coronavirus fusion protein and preparation method and application thereof | |
| CN110643612B (en) | Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof | |
| Zong et al. | A novel globular C1q domain containing protein (C1qDC-7) from Crassostrea gigas acts as pattern recognition receptor with broad recognition spectrum | |
| CN108486089A (en) | Derived from the wide range lyases and its antibacterial applications of salmonella bacteriophage | |
| CN111690054B (en) | Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN109797155A (en) | Portunus trituberculatus Miers mannose binding lectin PtMBL gene and its coding albumen and application | |
| Xiang et al. | Characteristic and functional analysis of a ficolin-like protein from the oyster Crassostrea hongkongensis | |
| CN111304181B (en) | Genetically engineered vibrio parahemolyticus phage lyase and preparation method and application thereof | |
| Huang et al. | Identification and function of a novel C1q domain-containing (C1qDC) protein in triangle-shell pearl mussel (Hyriopsis cumingii) | |
| CN108396030B (en) | Lifobinopenaeus antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof | |
| CN107540738B (en) | Crassostrea hongkongensis galectin Chgalectin and preparation method and application thereof | |
| CN108191964B (en) | Apostichopus japonicus F-type lectin AjFL-1, and preparation method and application thereof | |
| CN107267519A (en) | Hang razor clam C1q genes, encoding proteins and its cloning process and restructuring is hung razor clam C1q construction of genetic engineering methods | |
| CN110256570A (en) | A kind of recombination fusion antibacterial peptide and application | |
| CN108314718A (en) | A kind of house fly antibiotic peptide MAF-1A peptides aggressiveness, its encoding gene and its expression and application | |
| CN108794613B (en) | Ostrea hongkongensis LysM protein with bacteriostatic activity and coding gene and application thereof | |
| CN110452895B (en) | Lysozyme from bacteriophage and gene and application thereof | |
| CN110407920A (en) | A kind of prokaryotic expression, the method for purifying proteins of carp herpesvirusⅡtype capsid protein ORF66 | |
| CN116270973A (en) | Application of procambarus clarkia mannose binding protein in inhibiting bacteria | |
| CN111529686A (en) | Application of galectin-9 from mandarin fish in preparing bacteriostatic agent | |
| CN111019952B (en) | Antifungal gene, polypeptide, recombinant protein, preparation method and application thereof | |
| CN101757618B (en) | Recombined subunit vaccine of haemaphysalis concinna and preparation method thereof | |
| CN108048475B (en) | Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria | |
| CN108467426B (en) | Taihu lake whitefish host defense peptide and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |