KR101208170B1 - SLC6A12 gene polymorphism associated with asthma - Google Patents

Abstract

The present invention reveals that the SLC6A12 gene polymorphism is associated with aspirin-sensitive asthma, and to use it for predicting or diagnosing the possibility of developing aspirin-sensitive asthma.

Description

SLC6A12 gene polymorphism associated with asthma

The present invention relates to SLC6A12 gene polymorphism associated with aspirin hypersensitivity asthma.

Asthma caused by inflammation of the lungs is triggered by interactions between genetic factors and environmental factors such as antigens. Asthma, also known as aspirin-intolerant asthma, is caused by aspirin and is chronically hyperplastic rhinosinusitis and nasal polyps after administration of aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs). Or clinical symptoms such as asthma. There have been several studies of this aspirin-sensitive asthma, but the pathological mechanism of its specific phenotypic development is not yet fully understood.

The inventors found a relationship between aspirin-sensitive asthma and SLC6A12 (Solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12) gene polymorphism, and based on the polymorphic marker for predicting or diagnosing aspirin-sensitive asthma, the polymorphic marker Aspirin hypersensitivity asthma prediction kit or diagnostic kit, including aspirin hypersensitivity asthma to provide a number of applications, such as how to provide information for the prediction or diagnosis.

One aspect of the invention is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene, set forth in SEQ ID NO: 25, is -1,768th from the translation start point (4,341 base of SEQ ID NO: 25), and is A or T Provided is a polymorphic marker for predicting or diagnosing Aspirin Intolerant Asthma (AIA) comprising a polynucleotide consisting of 20-100 consecutive nucleotides comprising a base (rs499368A> T).

Another aspect of the invention is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene, set forth in SEQ ID NO: 25, is +28 th from the translation start point (4,341 base in SEQ ID NO: 25), and T or C Provided is a polymorphic marker for predicting or diagnosing aspirin hypersensitivity asthma comprising a polynucleotide consisting of 20-100 consecutive nucleotides comprising a phosphorus base (rs557881T> C).

Another aspect of the invention is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene, set forth in SEQ ID NO: 25, wherein the -2,981 base is selected from the translation start point (4,341 base in SEQ ID NO: 25) rs3759373), aspirin-sensitive asthma prediction or diagnostic haplotype markers having a -1,768th base A (rs499368) or a + 28th base T (rs557881).

Another aspect of the present invention provides a kit for predicting or diagnosing aspirin-sensitive asthma including a primer capable of amplifying the aspirin-sensitive asthma predictive or diagnostic polymorphic marker.

Another aspect of the present invention comprises the steps of extracting genomic DNA from a blood sample isolated from the subject; Detecting the polymorphic marker present on the genomic DNA extracted in the step; The present invention provides a method for providing information for predicting or diagnosing aspirin-sensitive asthma, including comparing the polymorphic marker detection result obtained in the step with the polymorphic site detection result of the normal group.

The inventors have confirmed that the SLC6A12 gene polymorphism is closely associated with aspirin-sensitive asthma, and this association can be usefully used for predicting or diagnosing the possibility of developing aspirin-sensitive asthma. For example, the polynucleotide containing the SLC6A12 gene polymorphism site may be used for aspirin hypersensitivity asthma prediction or diagnostic polymorphism marker, and may be applied as an aspirin hypersensitivity asthma prediction or diagnostic kit including a primer capable of amplifying the polymorphism marker. Do. It can also be used to provide information for predicting or diagnosing aspirin-sensitive asthma.

1-3 show maps, haplotypes, and LDs of the SLC6A12 gene.
1 is a schematic genetic map and SNP (single base polymorphism) of the SLC6A12 gene on chromosome 12p13 (23 kb). Black blocks represent coding exons and white blocks represent 5'UTR and 3'UTR. The first nucleotide of the translation site is referred to as +1.
2 is a haplotype of the SLC6A12 gene.
3 is the LD coefficient ((| D '|) of the SLC6A12 SNP, where UTR refers to an untranslated region.

Asthma is caused by pulmonary inflammation and has characteristics such as coughing, wheezing and difficulty breathing due to airway disorders. It is caused by genetic and environmental factors, and exposure to antigens or aspirin can accelerate asthma. Specifically, negative regulation of leukotriene C4 synthase (LTC4S) by thromboxane A2 receptor (TBXA2) is known to modulate TBXA2R + 795T> C, which causes bronchial disorders in response to aspirin. Prostaglandin inhibition by cyc-leukotrien hyperplasia and cyclooxygenase (COX) inhibition in bronchial epithelium is also known to affect aspirin-sensitive asthma. However, recent studies have shown that LTC4S and cysteinyl leukotriene receptor 1 (CYSLTR1) polymorphisms are not associated with the development of aspirin-sensitive asthma. These different results are believed to be due to the test method overlooking irrelevant factors. It is also evidence of a lack of understanding of the mechanisms of asthma and aspirin-sensitive asthma.

The SLC6A12 (solute carrier family 6 (neurotransmitter transporter, betaine / GABA) member 12) gene is also referred to as Na, Cl-dependent betaine / GABA transporter-1 (BGT-1), and is mainly used in cells of the proximal tubule of the kidney and the central nervous system. Expressed. The results of different in vivo and in vitro experiments on the expression and function of SLC6A12 are not known precisely why the genes play an important physiological role in the nervous system.

Recently, an excitatory GABA system in airway epithelium has been discussed. The γ-aminobutyl acid (GABA) signaling process in the airway epithelium is known to play an important role in the development of asthma through promoting mucus production. During antigen-induced airway responses, the activity of PI3K / Akt leads to an increase in IL-13, followed by airway epithelial cells that cause airway disorders in autocrine and paracrine fashion. Activate the GABA system. Aspirin is also known to be involved in the translation of GABA-lytic picrotoxin (PT), an antagonist of GABA _A receptor chloride channels. Inhibition of picrotoxin by aspirin restores GABA activity. Given that SLC6A12 plays an important role in GABA delivery in the brain, it is thought that SLC6A12 could be a gene involved in aspirin-sensitive asthma.

The present invention reveals that SLC6A12 gene polymorphism is associated with aspirin-sensitive asthma, and thus provides a polymorphic marker for predicting or diagnosing aspirin-sensitive asthma including SLC6A12 gene polymorphism marker. Another aspect of the invention provides a polymorphic marker for predicting or diagnosing aspirin hypersensitivity, comprising a polynucleotide comprising a SLC6A12 gene polymorphism marker.

We obtained the SLC6A12 genomic sequence (Accession No. NM_003044) from the National Center for Biotechnology Information (build 36) and HapMap (http://hapmap.ncbi.nlm.nih.gov/). It was.

In one aspect of the invention, the SLC6A12 gene polymorphism marker is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene as set forth in SEQ ID NO: 25, and -1,768 from the translation start point (4,341 base of SEQ ID NO: 25) Second and A or T base (rs499368A> T).

In another aspect of the invention, the SLC6A12 gene polymorphism marker is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene as set forth in SEQ ID NO: 25, from the translation start point (4,341 base of SEQ ID NO: 25) + 28th, and may include a base (rs557881T> C) that is T or C.

In one aspect of the invention, the polynucleotide comprising the SLC6A12 gene polymorphism marker is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene described in SEQ ID NO: 25, the translation start point (4,341 th of SEQ ID NO: 25) Base containing -1,768th, A or T base (rs499368A> T), or + 28th from translation start point (4,341 base in SEQ ID NO: 25) and T or C base (rs557881T> C) It may comprise -100 consecutive nucleotides. In another aspect of the invention the polynucleotide is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene set forth in SEQ ID NO: 25, and is -1,768th from the translation start point (4,341 base in SEQ ID NO: 25) , 20-30 contiguous nucleotides comprising a base (rs499368A> T) that is A or T or a + 28th from the translation start point (4,341 base in SEQ ID NO: 25) and a base that is T or C (rs557881T> C) It may include.

One aspect of the invention provides a composition for predicting or diagnosing aspirin hypersensitivity asthma comprising the polymorphic marker. Another aspect of the invention provides a medical or pharmaceutical composition for predicting or diagnosing aspirin-sensitive asthma comprising the polymorphic marker.

One aspect of the invention is selected within the SLC6A12 (Solute carrier family 6, member 12) genomic gene described by SEQ ID NO: 25, the -2,981 base is C (rs3759373) from the translation start point (4,341 base of SEQ ID NO: 25) , A -1,768th base A (rs499368) or + 28th base T (rs557881) provides an aspirin hypersensitivity asthma predictive or diagnostic haplotype marker.

One aspect of the invention provides a composition for predicting or diagnosing aspirin hypersensitivity asthma comprising the haplotype marker. Another aspect of the invention provides a medical or pharmaceutical composition for predicting or diagnosing aspirin-sensitive asthma comprising the haplotype marker.

The present invention provides a kit for predicting or diagnosing aspirin-sensitive asthma comprising a primer capable of amplifying the SLC6A12 gene polymorphism marker. Another aspect of the present invention may provide a kit for predicting or diagnosing aspirin asthma including a primer capable of amplifying the haplotype marker.

In one aspect of the invention, the primers in the kit used to amplify the SLC6A12 gene polymorphism may include any that can amplify the SLC6A12 gene polymorphism. In another aspect of the present invention, the primer in the kit used to amplify the SLC6A12 gene polymorphism may be one or more of the nucleotide sequences set forth in SEQ ID NOs: 1 to 24, but is not limited thereto.

In another aspect of the invention, the aspirin-sensitive asthma prediction or diagnostic kit may further comprise a primer used to amplify another single base polymorphism (SNP). In another aspect of the invention, the kit may further comprise instructions describing how to use the polymorphic marker.

In one aspect of the invention, the aspirin-sensitive asthma prediction or diagnostic kit may comprise a probe (probe) that can detect the polymorphic marker. In another aspect of the present invention, the aspirin-sensitive asthma prediction or diagnostic kit may include a probe capable of detecting the haplotype marker.

One aspect of the present invention comprises the steps of extracting genomic DNA from a blood sample isolated from the subject; Detecting the polymorphic marker present on the genomic DNA extracted in the step; The present invention provides a method for providing information for predicting or diagnosing aspirin-sensitive asthma, including comparing the polymorphic marker detection result obtained in the step with the polymorphic site detection result of the normal group.

In one aspect of the present invention, a method for providing information for predicting or diagnosing aspirin-sensitive asthma may obtain DNA of a subject from all possible sources such as blood, saliva, hair, and skin of the subject.

In one aspect of the present invention, the method for providing information for predicting or diagnosing aspirin-sensitive asthma may include extracting genomic DNA from a blood sample.

In one aspect of the present invention, in the method for providing information for predicting or diagnosing aspirin-sensitive asthma, detecting the polymorphic marker may include sequencing analysis, hybridization by microarray, and allele specific PCR. ), Dynamic allele-specific hybridization (DASH), PCR extension analysis, and TaqMan technique, but are not limited thereto. The methods can use conventional methods for sequencing and can be performed using an automated genetic analyzer.

In a method of providing information for predicting or diagnosing aspirin-sensitive asthma in one aspect of the present invention, comparing the polymorphic marker detection result with the detection of the polymorphic site of the normal group in a conventional comparison method, for example, a statistical method. It may be, but is not limited to.

Another aspect of the present invention provides a composition for inhibiting or treating aspirin-sensitive asthma including the SLC6A12 gene polymorphism expression promoter or inhibitor as an active ingredient. In a composition for inhibiting or treating aspirin-sensitized asthma comprising the SLC6A12 gene polymorphism expression promoter as an active ingredient, the promoter generally includes all substances capable of promoting the expression of the SLC6A12 gene polymorphism. In a composition for inhibiting or treating aspirin-sensitized asthma containing the SLC6A12 gene polymorphism expression inhibitor as an active ingredient, the inhibitor generally includes all substances capable of inhibiting the expression of the SLC6A12 gene polymorphism. The materials can be extracted from natural products or artificially synthesized, for example.

In another aspect of the present invention, the composition for inhibiting or treating aspirin-sensitized asthma may be added to pharmaceutical supplements such as preservatives, stabilizers, hydrates or emulsifiers, salts and / or buffers for controlling osmotic pressure, and other therapeutically useful substances. And may be formulated in various oral or parenteral dosage forms according to conventional methods. In addition, the pharmaceutically acceptable dose of the active ingredient, that is, the dosage, depends on the age, sex, and weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. Will be different. Dosage determination based on these factors is within the level of skill in the art.

Another aspect of the present invention provides a method for screening a composition for inhibiting or treating aspirin-sensitive asthma, including confirming whether a test substance promotes or inhibits expression of the SLC6A12 gene polymorphism. In the screening method for inhibiting or treating aspirin-sensitive asthma, the test substance includes all substances that are likely to be used as compositions for inhibiting or treating aspirin-sensitive asthma. In another aspect of the present invention, the screening method may further comprise the step of treating, binding or reacting the test substance to the SLC6A12 gene polymorphism in a conventional manner in the art. In another aspect of the screening method of the present invention, when the test substance promotes or inhibits the expression of the SLC6A12 gene polymorphism, the method may further include determining that it can be used as a composition for inhibiting or treating aspirin-sensitive asthma. In another aspect of the screening method of the present invention, when the test substance inhibits or promotes expression of the SLC6A12 gene polymorphism, the data may be used as an auxiliary judgment data on the availability of aspirin-sensitive asthma inhibitors or as a therapeutic composition. have.

In one aspect of the present invention, since the SLC6A12 gene polymorphism is closely related to the development of aspirin-sensitive asthma, in addition to the above-described disclosure, it may be applied to various inventions for predicting, diagnosing, regulating, and controlling aspirin-sensitive asthma. .

In one aspect of the invention, aspirin-sensitive asthma predictive or diagnostic polymorphism markers, aspirin-sensitive asthma prediction or diagnostic kit comprising a primer capable of amplifying the polymorphic markers, aspirin-sensitive asthma predictive or diagnostic method for providing information for The composition for inhibiting or treating aspirin-sensitive asthma and the composition for inhibiting or treating aspirin-sensitive asthma is applicable to humans as well as animals. That is, the object of application of the present invention may be an animal or a human.

Hereinafter, the configuration and effects of the present invention will be described in more detail with reference to test examples. However, these test examples are provided only for the purpose of illustration to help the understanding of the present invention is not limited to the scope and scope of the present invention.

[Test Example]

1. Selection and analysis of test target

A total of 592 subjects were selected for this test. All subjects were diagnosed with asthma according to GINA criteria and had asthma symptoms such as coughing, wheezing or dyspnea. Inhalation of bronchodilator also increased FEV ₁ by 5% for 1 second and / or showed less than 10 mg / mL of methacholine overreactivity. First, the test group (163 patients) were diagnosed as aspirin-sensitive asthma patients among asthma patients, and had aspirin-sensitive or urticaria, nasal polyps, and sinusitis after aspirin administration. The control group (429) was an asthma patient with an FEV ₁ reduction of more than 15%, and consisted of those who did not have extrabronchial nose or skin symptoms. Their characteristics are summarized in Table 1 below.

all Test group Control group Number (persons) 592 163 429 Age (average) 46.15 43.13 * 47.30 Gender (male / female) 206/386 59/104 147/282 % Of smokers 27.70 21.47 * 30.07 FEV ₁ Decrease After Aspirin Dosing 9.27 ± 13.24 24.63 ± 16.11 ** 3.54 ± 4.85 Blood Eosinophil (%) 6.01 ± 5.73 5.96 ± 5.21 6.03 ± 5.92 FEV ₁ (% predicted) 90.54 ± 6.97 90.35 ± 14.04 * 91.66 ± 16.87 PC20 Methacholine (mg / ml) 6.43 ± 8.67 5.02 ± 7.83 * 6.91 ± 8.90 Total IgE (IU / ml) 357.65 ± 604.09 348.60 ± 596.44 361.00 ± 607.56 Skin test positive rate (%) 56.42 52.76 57.81

* P <0.05; ** P <0.0001 (vs. control)

As can be seen in Table 1 above, the percent decrease in FEV ₁ after administration of aspirin in the test group was higher than that in the control group (P <0.0001).

2. Identification of single nucleotide polymorphism (SNP) and genotyping

(1) Distribution of SLC6A12 mutations

Select single base polymorphism (SNP), which represents polymorphism, based on dbSNPs from the National Center for Biotechnology Information (build 36) and HapMap (http://hapmap.ncbi.nlm.nih.gov/) It was. Genotypes of 96-384 SNPs were determined by Illumina goldengate assay using BeadXpress® (Illumina, San Diego, Calif., USA). The genotypes of 96 polymorphisms including 8 SNPs of SLC6A12 were determined to assess their association with aspirin-sensitive asthma. The primer / probe sequences used for eight of these SNPs are shown in Table 2 below.

location rs number Primer / Probe Sequence Intron 1 rs3759373 oligo1 ACTTCGTCAGTAACGGACGCTCTGGGCAGCACCAAGCCT Intron 2 rs499368 ACTTCGTCAGTAACGGACGGAGCGAGCTTGAAAACACGCAA Exon 4 rs557881 ACTTCGTCAGTAACGGACGAGACCGCAGGAGGCCCACA Intron 7 rs216244 ACTTCGTCAGTAACGGACATGGGGTGCTGGAACTGCATT Intron 7 rs216242 ACTTCGTCAGTAACGGACGTCTCTCCATCTTTCTGTACGAGAAAAAA Intron14 rs2284330 ACTTCGTCAGTAACGGACGTGCCTTTCCAACAACGAGGT Intron14 rs2284329 ACTTCGTCAGTAACGGACGCAACATGCTTCACTCACCTGGCA Exon17 rs2075228 ACTTCGTCAGTAACGGACGTCTCCCCGTGTACAAATGCAGTAT Intron 1 rs3759373 oligo2 GAGTCGAGGTCATATCGTGCTCTGGGCAGCACCAAGCCC Intron 2 rs499368 GAGTCGAGGTCATATCGTGGAGCGAGCTTGAAAACACGCAT Exon 4 rs557881 GAGTCGAGGTCATATCGTGAGACCGCAGGAGGCCCACG Intron 7 rs216244 GAGTCGAGGTCATATCGTATGGGGTGCTGGAACTGCATG Intron 7 rs216242 GAGTCGAGGTCATATCGTGTCTCTCCATCTTTCTGTACGAGAAAAAT Intron14 rs2284330 GAGTCGAGGTCATATCGTGTGCCTTTCCAACAACGAGGC Intron14 rs2284329 GAGTCGAGGTCATATCGTGCAACATGCTTCACTCACCTGGCC Exon17 rs2075228 GAGTCGAGGTCATATCGTGTCTCCCCGTGTACAAATGCAGTAC Intron 1 rs3759373 oligo3 GTGTGGAAATTGGTGTGTTTACGTCAATCTAGTGAGCGTCAGGGTCTGCCTATAGTGAGTC Intron 2 rs499368 AAAATGCACCAGATAGGAAACGGAATCCCGAGAAGGTCCTGCTGTCTGCCTATAGTGAGTC Exon 4 rs557881 TCTTGCACTGCCACCTTCCGCTGAGAACCCGTTGAGAGTAGTCTGCCTATAGTGAGTC Intron 7 rs216244 ATGGGTGTGAGGGTCCAGTAGAACGGTTGTAGTCCCTGGAGTGTCTGCCTATAGTGAGTC Intron 7 rs216242 ATCTGGATGAGTTAGAAAGATAAAGTCGGCTATTGAGTCCGCGCAATGTCTGCCTATAGTGAGTC Intron14 rs2284330 ATCACCCAGACTCTGAGTACTTCCGTCCTGCGGTTGTAAGCACTAGTCTGCCTATAGTGAGTC Intron14 rs2284329 TATCTGGCTTTTAACTTTGGCTTTAAGTGGGTACGGGCGTCACAGTCTGCCTATAGTGAGTC Exon17 rs2075228 CTCTAACAAGAGGCATCCCGCCGCTAGATTAGGCCACCTTCGTCTGCCTATAGTGAGTC

Data quality assessment of double DNA was performed. The genotyping quality of the retention data was set at 0.25. A total of eight SNP genotypes in the SLC6A12 gene were successfully determined. The results are shown in Table 3 below and FIG. 1.

HWE: Hardy-Weinberg Equilibrium; MAF: minor allele frequency

Eight polymorphisms included two SNPs in the coding region (rs557881 and rs2075228) and six SNPs in the non-coding region (rs3759373, rs499368, rs216244, rs216242, rs2284330, and rs2284329). The distribution of each locus was in the Hardy-Weinberg equilibrium (P> 0.05). Two LD blocks and haplotypes were inferred by pair-wise comparison of eight SNPs (see FIGS. 2 and 3).

(2) Relationship between polymorphism and aspirin-sensitive asthma

A co-dominant model was used to perform logistic related analysis on 8 SNPs in SLC6A12 between the test and control groups. At this time, age, sex, smoking status, atopy, body mass index, and the like were used as variables. As a result, two single nucleotide polymorphisms (rs499368 and rs557881) showed a correlation of P <0.05. This is shown in Table 4 below.

OR: odds ratio; CI: confidence interval

As can be seen from Table 4, two polymorphisms of rs499368 and rs557881 were found to be related to aspirin-sensitive asthma. In particular, SNP rs557881T> C was a nonsynonymous variation that translates amino acids from cysteine to arginine. Cysteine is an amino acid with a non-polar side chain that is non-charged at biological pH and contains functional groups that cannot participate in hydrogen bonding. Arginine, on the other hand, is an amino acid having a polar side chain comprising a group that can be charged at a biological pH or participate in hydrogen bonding. These changes can affect aspirin-sensitive asthma.

(3) Relationship between polymorphism and decline in FEV ₁ after aspirin dosing

Since a decrease in FEV ₁ after aspirin dosing is an important diagnostic marker for aspirin-sensitive asthma, a regression analysis of the relationship between SNP and FEV ₁ drop after aspirin dosing was performed. The results are shown in Table 5 below.

As can be seen in Table 5, two SNPs (rs499368 and rs557881) and haplotype (SLC6A12_BL1_ht1) showed a significant difference between the test and control groups in terms of FEV ₁ drop after aspirin administration (P <0.05). This indicates that the SLC6A12 gene may be a major cause of lung dysfunction in patients with aspirin-sensitive asthma.

3. Statistical Method

To determine the relationship between the distribution of genotypes in the test and control groups, age (continuous value), gender (male = 0, female = 1), smoking status (non-smoker = 0, former smoker) to remove or reduce other influencing factors. Logistic analysis was performed using = 1, smoker = 2), atopy (none = 0, yes = 1) and body mass index (BMI) as covariates. Lewontin's D '(| D' |) and LD coefficient r ² were calculated to determine linkage disequilibrium between all heterologous locus pairs. Haplotypes were inferred with PHASE algorithm version 2.0 using 8 SNPs, and their relevance analysis was performed using SAS version 9.1 (SAS Inc., Cary, NC).

The difference in FEV ₁ drop after aspirin dosing between genotype and haplotype was calculated using a linear regression model. Significant numbers of independent marker loci detected in SLC6A12 polymorphisms were calculated by multi-testing calibration using SNPSpD (http://genepi.qimr.edu.au/ general / daleN / SNPSpD /) software, which indicates pairs between SNPs ( Pair-wise) is based on the spectral decomposition (SpD) of the matrix of association imbalance (LD).

Attach an electronic file to a sequence list

Claims (5)

delete A base selected from the SLC6A12 (Solute carrier family 6, member 12) genomic gene, set forth in SEQ ID NO: 25, which is + 28th from the translation start point (4,341 base of SEQ ID NO: 25) and is T or C (rs557881T> C) Polymorphic marker composition for predicting or diagnosing Aspirin Intolerant Asthma (AIA) comprising a polynucleotide consisting of 20-100 consecutive nucleotides.
delete Aspirin hypersensitivity asthma prediction or diagnostic kit comprising a primer capable of amplifying the aspirin hypersensitivity asthma prediction or diagnostic polymorphism marker of claim 2.
Extracting genomic DNA from blood samples isolated from the subject;
Detecting the polymorphic marker of claim 2 present on the genomic DNA extracted in the step;
A method for providing information for predicting or diagnosing aspirin-sensitive asthma, comprising comparing a polymorphic marker detection result obtained in the step with a polymorphic site detection result of a normal group.

Images