US20170357750A1 - Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene - Google Patents

Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene Download PDF

Info

Publication number
US20170357750A1
US20170357750A1 US15/645,739 US201715645739A US2017357750A1 US 20170357750 A1 US20170357750 A1 US 20170357750A1 US 201715645739 A US201715645739 A US 201715645739A US 2017357750 A1 US2017357750 A1 US 2017357750A1
Authority
US
United States
Prior art keywords
tag
gene
polymorphism
haplotype
name
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/645,739
Inventor
Kazutaka Ikeda
Daisuke Nishizawa
Kenichi Fukuda
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tokyo Metropolitan Institute of Medical Science
Original Assignee
Tokyo Metropolitan Institute of Medical Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tokyo Metropolitan Institute of Medical Science filed Critical Tokyo Metropolitan Institute of Medical Science
Priority to US15/645,739 priority Critical patent/US20170357750A1/en
Publication of US20170357750A1 publication Critical patent/US20170357750A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • G06F19/18
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to a method for evaluating drug sensitivity and disease vulnerability, comprising analyzing a cyclic AMP responsive element binding protein (cAMP responsive element binding protein; CREB) gene.
  • cAMP responsive element binding protein cyclic AMP responsive element binding protein
  • the present invention relates to a method for evaluating drug sensitivity and disease vulnerability, comprising associating a gene polymorphism of a CREB gene or a haplotype constituted by the gene polymorphism with the drug sensitivity and disease vulnerability of an individual. More specifically, the present invention relates to a method for evaluating a tendency in the presence or absence of the drug sensitivity and disease vulnerability of an individual, based on the results from the analysis of the above-described gene polymorphism or haplotype.
  • the pain sensation plays an important role in terms of a biological warning system, however, excessive pain would significantly decrease QOL (quality of life) unless it is properly controlled.
  • QOL quality of life
  • narcotic analgesics including morphine act on a protein known as an “opioid receptor,” so as to cause analgesic action.
  • the opioid receptor includes three types of receptors, a ⁇ -type opioid receptor, a ⁇ -type opioid receptor, and a ⁇ -type opioid receptor, and all of these receptors are related to analgesic action. Since these receptors are Gi/o protein-coupled receptors, they activate a GIRK channel and suppression of a calcium channel through the mediation of a Gi-o protein. In addition, the receptors suppress adenylate cyclase (Non Patent Literature 1: Pierce K.
  • Non Patent Literature 2 Bokoch G M. et al., Purification and properties of the inhibitory guanine nucleotide-binding regulatory component of adenylate cyclase, J Biol Chem, (1984) 259: 3560-3567).
  • Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase, and it causes activation of a cyclic AMP responsive element binding protein (CREB) through phosphorylation of the serine residue at position 133 of the protein
  • Non Patent Literature 3 Gonzalez G A.
  • Non Patent Literature 4 Chrivia J C, et al., Phosphorylated CREB binds specifically to the nuclear protein CBP., Nature, (1993) 365: 855-859), and it binds to the cyclic AMP responsive element of genomic DNA, thereby promoting gene expression
  • Non Patent Literature 5 Montminy M R. et al., Identification of a cyclic-AMP-responsive element within the rat somatostatin gene., Proc Natl Acad Sci USA, (1986) 83: 6682-6686).
  • the objective of the present invention is to provide a method for evaluating (predicting, etc.) an individual difference (the tendency of every individual) in terms of drug sensitivity and disease vulnerability, comprising using a gene polymorphism of a cyclic AMP responsive element binding protein (CREB) gene or the like.
  • CREB cyclic AMP responsive element binding protein
  • the present inventors focused on the cyclic AMP responsive element binding protein (CREB) gene and conducted extensive examinations based on conventional findings and clinical data.
  • CREB cyclic AMP responsive element binding protein
  • the inventors identified several useful gene polymorphisms by analyzing the association of each CREB gene polymorphism with sensitivity to drugs such as analgesics, and with disease vulnerability including pain sensitivity. Thereafter, the inventors found linkage disequilibrium among the thus identified gene polymorphisms, and we also revealed a significant correlation between drug sensitivity and disease vulnerability (more specifically, a change in the required administration amount of an analgesic and a change in the threshold value of pain sensitivity due to a difference in specific CREB gene polymorphisms), thereby accomplishing the present invention.
  • the present invention relates to the following:
  • a method for evaluating drug sensitivity comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual drug sensitivity.
  • the above-described evaluation method includes a method for evaluating a tendency in the presence or absence of an individual drug sensitivity based on the results from the analysis of the gene polymorphism or the haplotype.
  • the method according to 1 above comprising the following steps: (1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block; (2) a step of analyzing the association between the genotypes of the gene polymorphisms and drug sensitivity in a test subject; and (3) a step of using the gene polymorphism that has been significantly associated with drug sensitivity in the test subject for evaluation of the drug sensitivity.
  • a method for evaluating disease vulnerability comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual disease vulnerability.
  • the above-described evaluation method includes a method for evaluating a tendency in the presence or absence of an individual disease vulnerability is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
  • the method according to 3 above comprising the following steps: (1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block; (2) a step of analyzing the association between the genotypes of the gene polymorphisms and pain sensitivity; and (3) a step of using the gene polymorphism that has been significantly associated with pain sensitivity in the test subject for evaluation of the disease vulnerability.
  • the gene polymorphism is at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a nucleotide repeat polymorphism.
  • the gene polymorphism is at least one selected from among: rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784, and rs7594560 of a CREB1 subtype gene (which is a CREB1 gene as a subtype of the CREB gene (the same shall apply hereafter); rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs8671
  • haplotypes constituted by a combination of any given number and type of various gene polymorphisms according to 7 above can also be selected as haplotypes used in the evaluation method and the like of the present invention.
  • Tag Tag Tag 32 33 H20 T A H24 G C C H28 A A H31 G T C H35 C C C G C H21 T G H25 G C T H29 G A H32 A C T H36 T C A G C H22 C G H26 A C T H30 G G H33 A T T H37 C C A G C H23 C A H27 G T T . . . H34 A T C H38 T T C A T . . . Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 25 26 27 32 Gene polymorphism name ( ⁇ ) 34 35 36 37 38 39 40 42 43 44 45 47 50 Haplotype (H) No. Tag Tag H No. Tag Tag Tag Tag Tag H No. Tag 41 H No.
  • Haplotypes which are estimated to occur at a frequency of less than 1% ( ⁇ ) 1 ⁇ 64: (in this order) rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs17758
  • Haplotypes which are estimated to occur at a frequency of less than 1% ( ⁇ ) 1 ⁇ 31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
  • a method for determining the type, amount, and/or frequency of administration of a drug to be administered to an individual comprising using the result from the evaluation by the method according to any one of 1 to 8 above as an index.
  • a method for predicting a side effect of a drug to be administered to an individual comprising using the result from the evaluation by the method according to any one of 1 to 8 above as an index.
  • the opioid receptor function modulator is at least one selected from the group consisting of methamphetamine, methylenedioxymethamphetamine, amphetamine, dextroamphetamine, dopamine, morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane
  • oligonucleotide consisting of a nucleotide sequence of at least 10 nucleotides comprising the 51 st nucleotide of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172, or a complementary nucleotide sequence thereto, which can specifically hybridize to a DNA fragment comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene.
  • oligonucleotide is selected from the group consisting of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 38 and a complementary nucleotide sequence thereto.
  • a gene polymorphism marker for evaluating a tendency in the presence or absence of an individual drug sensitivity comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism. Examples of the drug applied herein are the same as those described in 11 and 12 above.
  • a gene polymorphism marker for evaluating a tendency in the presence or absence of an individual disease vulnerability comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.
  • this evaluation method it becomes possible to readily know or predict a proper prescribed amount, a proper prescribed schedule, and the like, associated with a narcotic drug such as morphine, and hence the method is extremely useful for personalized pain therapy, drug dependence therapy and the like.
  • FIG. 1 is a schematic view showing gene polymorphisms identified regarding a CREB1 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP.
  • the calculation value of D′ between rs16839837 and rs2551640 is 0.91.
  • FIG. 2 is a schematic view showing gene polymorphisms identified regarding a CREB1 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r 2 that is an index of the linkage disequilibrium of a SNP and another SNP.
  • the calculation value of r 2 between rs16839837 and rs2551640 is 0.12.
  • FIG. 3 is a schematic view showing gene polymorphisms identified regarding a CREB3 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs1243872 and rs2025126 is 0.97.
  • FIG. 4 is a schematic view showing gene polymorphisms identified regarding a CREB3 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r 2 that is an index of the linkage disequilibrium of a SNP and another SNP.
  • the calculation value of r 2 between rs1243872 and rs2025126 is 0.67.
  • FIG. 5 is a schematic view showing gene polymorphisms identified regarding a CREB5 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs4722778 and rs177479 is 0.93.
  • FIG. 6 is a schematic view showing gene polymorphisms identified regarding a CREB5 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r 2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r 2 between rs4722778 and rs177479 is 0.85.
  • FIG. 7 is a schematic view showing gene polymorphisms identified regarding a ATF2 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs1153711 and rs1153700 is 0.86.
  • FIG. 8 is a schematic view showing gene polymorphisms identified regarding a ATF2 subtype gene and a linkage disequilibrium found among them.
  • high-color squares indicate SNPs showing strong linkage with each other.
  • the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r 2 that is an index of the linkage disequilibrium of a SNP and another SNP.
  • the calculation value of r 2 between rs1153711 and rs1153700 is 0.14.
  • FIG. 9 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the required administration amount ( ⁇ g/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 10 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the measurement results (sec) of pain sensitivity before surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 11 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the measurement results (mm) of VAS (the intensity of pain on a visual analogue scale) 24 hours after surgery, in male patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 12 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs7583431) of an ATF2 subtype gene on the measurement results (sec) of a difference in threshold of pain perception latency before surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 13 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the required administration amount ( ⁇ g/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 14 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the required administration amount ( ⁇ g/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (abdominal surgery).
  • FIG. 15 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the reward dependence (RD) score (average) of Temperament and Character Inventory (TCI) in all healthy subjects.
  • FIG. 16 is a graph showing the effect (overall average ⁇ standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the expression level of a CREB1 subtype gene in postmortem brain tissue donors at the Stanley Foundation Brain Bank.
  • Cyclic AMP responsive element binding protein is a protein, which includes a signaling system downstream of G protein-coupled receptor such as a ⁇ -type opioid receptor, is activated depending on an intracellular cyclic AMP concentration, and binds to a cyclic AMP responsive element (cAMP responsive element) of nuclear genomic DNA, so that it is associated with regulation of gene expression.
  • the cyclic AMP responsive element binding protein is present in various tissues and/or organs such as cardiac muscle, various types of smooth muscle, fat cells, skeletal muscle and brain, and it is also associated with neurogenesis, memory, dependence, etc., through the expression of various genes.
  • Narcotic analgesics including morphine as a representative example act on a protein known as an “opioid receptor,” so as to cause analgesic action.
  • the opioid receptor includes three types of receptors, a ⁇ -type opioid receptor, a ⁇ -type opioid receptor, and a ⁇ -type opioid receptor, and all of these receptors are related to analgesic action. Since these receptors are Gi/o protein-coupled receptors, they activate a GIRK channel and suppression of a calcium channel through the mediation of a Gi-o protein. In addition, the receptors suppress adenylate cyclase.
  • Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase, and it causes activation of a cyclic AMP responsive element binding protein (CREB) through phosphorylation of the serine residue at position 133 of the protein.
  • CREB cyclic AMP responsive element binding protein
  • the activated CREB binds to a CREB-binding protein acting as an activation cofactor, and it binds to the cyclic AMP responsive element of genomic DNA, thereby promoting gene expression.
  • the cyclic AMP responsive element binding protein is distributed in various tissues and/or organs including brain and heart, and plays an important role for neurogenesis, memory, the expression of dependence, etc., through the expression of various types of genes.
  • the cyclic AMP responsive element binding protein has a domain structure comprising a Q-rich domain, a kinase-inducible domain (KID), a basic region/leucine zipper (bZIP), etc.
  • KID kinase-inducible domain
  • bZIP basic region/leucine zipper
  • the cyclic AMP responsive element binding protein functions as a dimer formed from two subunits.
  • the type of a receptor subtype is broadly classified into CREB1, CREB3, CREB5, ATF2 and the like, and their homologs have also been known. These subtypes are expressed in various tissues and/or organs including brain and heart.
  • the present inventors identified gene polymorphisms (such as SNP) of the subtypes CREB1, CREB3, CREB5 and ATF2 (CREB2) capable of constituting a cyclic AMP responsive element binding protein in healthy subjects ( FIGS. 1 to 8 ). Further, a linkage disequilibrium analysis was carried out as needed, and a block exhibiting a strong linkage disequilibrium (a haplotype block) was identified.
  • the linkage equilibrium means a case where the relationship between two gene polymorphisms on the chromosome is independent
  • the linkage disequilibrium means a case where a gene polymorphism is linked to the other gene polymorphism thereby deviating from the equilibrium situation according to Mendel's law of independence
  • the haplotype means a genetic structure of such as genes or gene polymorphisms located in the vicinity of each other in one allele of a set of alleles (a gene derived from one of the parents).
  • haplotype also refers to a combination of the arrangement of the same gene in this haplotype block.
  • the present inventors analyzed the cyclic AMP responsive element binding protein CREB1 subtype gene, and as a result, they found 4 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 7 gene polymorphisms in the intron region (see Table 5).
  • the inventors found 25 and 14 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 1 gene polymorphism in the intron region (see Table 5).
  • the inventors found 9 and 5 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 241 gene polymorphisms in the intron region and 2 gene polymorphisms (rs2190305 and rs3735566) in the noncoding region of exon (see Table 6).
  • the inventors found 11 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 16 gene polymorphisms in the intron region and 1 gene polymorphism (rs10497434) in the noncoding region of exon (see Table 5).
  • an individual difference in phenotypes regarding sensitivity to drugs i.e. drug sensitivity
  • sensitivity to drugs i.e. drug sensitivity
  • an effective duration of a drug e.g. the required number of administration of analgesic, the total amount of analgesic, prolongation of stimulant-induced psychosis, etc.
  • phenotypes regarding the development of a disease including pain sensitivity, vulnerability to substance dependence (in particular, vulnerability to drug dependence), etc.
  • the present invention provides a method for evaluating drug sensitivity and disease vulnerability based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of drug sensitivity and disease vulnerability (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person).
  • the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of drug sensitivity and disease vulnerability (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms.
  • the present invention is extremely useful for personalized pain therapy or drug dependence therapy.
  • the present invention by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, an individual difference in terms of dependence-prone personality can be easily evaluated.
  • the results of evaluating dependence-prone personality can be information for determining whether reward dependence is high or low about the personality of an individual.
  • the present invention provides a method for evaluating dependence-prone personality based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of dependence-prone personality (high reward dependence or low reward dependence) (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person).
  • the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of dependence-prone personality (high reward dependence or low reward dependence) (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms.
  • a gene polymorphism and a haplotype constituted by the gene polymorphism that can be applied to the above-described evaluation of dependence-prone personality
  • the same gene polymorphisms and haplotypes as those that can be applied to the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
  • the same oligonucleotides as those used for the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
  • the present invention by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, an individual difference in terms of the expression level of a CREB1 gene can be easily evaluated.
  • the results of evaluating the expression level of a CREB1 gene can be information for predicting whether the expression level of a CREB1 gene in an individual is high or low.
  • the present invention provides a method for evaluating the high or low expression level of a CREB1 gene based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of the high or low expression level of a CREB1 gene (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person).
  • the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of the high or low expression level of a CREB1 gene (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms.
  • a gene polymorphism and a haplotype constituted by the gene polymorphism that can be applied to the above-described evaluation of the high or low expression level of a CREB1 gene
  • the same gene polymorphisms and haplotypes as those that can be applied to the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
  • the same oligonucleotides as those used for the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
  • the human cyclic AMP responsive element binding protein gene polymorphisms of the present invention mainly include single nucleotide polymorphisms (hereinafter also referred to as “SNP”), however it is not limited to this, and insertion polymorphisms, deletion polymorphisms, and nucleotide repeat polymorphisms can also be included.
  • SNP single nucleotide polymorphisms
  • the single nucleotide polymorphism means a gene polymorphism caused by substitution of a specific one nucleotide of a gene with another nucleotide.
  • the insertion/deletion polymorphism means a gene polymorphism caused by deletion/insertion of one or more nucleotides.
  • nucleotide repeat polymorphism means a gene polymorphism caused by a difference in the number of repeats of nucleotide sequence.
  • the nucleotide repeat polymorphism is divided into a microsatellite polymorphism (the number of nucleotides: about 2 to 4 nucleotides) and a VNTR (variable number of tandem repeat) polymorphism (repeated nucleotides: several to several tens of nucleotides) according to the difference in the number of repeated nucleotides, and the number of repeats varies depending on individuals.
  • the information of human cyclic AMP responsive element binding protein gene polymorphisms (SNPs in the CREB1 subtype gene, the CREB3 subtype gene, the CREB5 subtype gene and the ATF2 subtype gene observed on the genome of Japanese healthy subjects) elucidated by the present invention is shown in Table 5 and Table 6.
  • the gene polymorphisms shown in Table 5 and Table 6 include the cyclic AMP responsive element binding protein gene polymorphisms of the present invention.
  • CREB1 indicates a CREB1 subtype gene (a CREB1 gene as a subtype of the cyclic AMP responsive element binding protein (CREB) gene
  • CREB3 indicates a CREB3 subtype gene (a CREB3 gene as a subtype of the CREB gene
  • CREB5 indicates a CREB5 subtype gene (a CREB5 gene as a subtype of the CREB gene
  • ATF2 indicates an ATF2 subtype gene (an ATF2 gene that is an alias of a CREB2 gene as a subtype of the CREB gene).
  • Porition means a position on the genome of a cyclic AMP responsive element binding protein gene, and indicates a 5′ flanking region, a 3′ flanking region, intron, and exon.
  • Gene polymorphism name is the name of SNP at a position on the genome, and it has been registered in the dbSNP database (which is accessible from the NCBI website dbSNP Short Genetic Variations) (the same shall apply in the present specification). Basically, the ID “rs” is given before four or more digit numbers, so that the type of SNP can be identified.
  • Major allele indicates an allele occurring in the majority of the genomes of Japanese healthy subjects
  • minor allele indicates an allele occurring in the minority of the genomes of Japanese healthy subjects.
  • a method of obtaining gene polymorphism information is as follows, for example.
  • Genomic DNA is purified from a blood specimen collected from a human using the phenol method and the like.
  • a commercially available genomic DNA extraction kit such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Bio-Sciences KK) or a device may be used.
  • the obtained genomic DNA is dissolved in TF buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and the concentration of the obtained solution is adjusted to 100 ng/ ⁇ l.
  • Total genome genotyping is carried out by an infinium assay II method or the like, using iScan system (manufactured by Illumina, San Diego, Calif.), in accordance with the protocols provided by the manufacturer.
  • Total genome genotyping data are analyzed using BeadStudio Genotyping module v3.3.7 (Illumina) or the like, and the quality of gene polymorphism data of each sample is evaluated (quality control).
  • gene polymorphism included in the gene regions and flanking regions of a gene of interest are selected, using the annotation information of the name of the gene of interest as a key, and all information regarding such gene polymorphisms is extracted using an output function of BeadStudio Genotyping module v3.3.7 (Illumina) or the like.
  • the present invention provides an oligonucleotide, which contains any one of CREB1 subtype gene polymorphisms (rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560), CREB3 subtype gene polymorphisms (rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485,
  • the oligonucleotide of the present invention has at least 10 nucleotides, preferably 10 to 150 nucleotides, more preferably 10 to 45 nucleotides, further more preferably 14 to 25 nucleotides.
  • oligonucleotide of the present invention examples include oligonucleotides having a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172 containing the above-mentioned gene polymorphism of the cyclic AMP responsive element binding protein gene or a nucleotide sequence complementary to the nucleotide sequence (Tables 7 to 10).
  • oligonucleotides of the present invention can be used as a probe or a primer specific to a cyclic AMP responsive element binding protein gene in the detection of cyclic AMP responsive element binding protein gene polymorphism described in the below-mentioned 6.
  • a haplotype by using SNP among the above-mentioned gene polymorphisms, a haplotype can be constructed.
  • the SNP to become a target of a haplotype analysis may be any as long as its gene polymorphism frequency is 0.5% or higher, preferably, those with a gene polymorphism frequency of 1%, more preferably those with a gene polymorphism frequency of 5% or higher can be selected. Further, SNP to become a target of a haplotype analysis may be a full or partial sequence thereof.
  • haplotype analysis can be carried out using various computer programs, and for example, Haploview (available from the following website: Broad Institute) (the same shall apply hereafter); Barrett J C, Fry B, Mailer J, Daly M J. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005 Jan. 15 [PubMed ID: 15297300] Whitehead Institute for Biomedical Research Cambridge, Mass. 02142, USA.) can be used.
  • haplotype analysis among cyclic AMP responsive element binding protein gene polymorphisms in Japanese healthy subjects found as in the above-mentioned 2, with regard to the 17 sites of SNPs which are CREB1 subtype gene polymorphisms, the 40 sites of SNPs which are CREB3 subtype gene polymorphisms, the 64 sites of SNPs which are CREB5 subtype gene polymorphisms, and the 31 sites of SNPs which are ATF2 subtype gene polymorphisms, a haplotype was estimated for each linkage disequilibrium block (haplotype block), using Haploview.
  • the estimated haplotypes are shown in Tables 11 to 14. It is to be noted that the “Tag” shown in the tables indicates a Tag SNP that is a typical gene polymorphism in the linkage disequilibrium block.
  • Tag Tag Tag 32 33 H20 T A H24 G C C H28 A A H31 G T C H35 C C C G C H21 T G H25 G C T H29 G A H32 A C T H36 T C A G C H22 C G H26 A C T H30 G G H33 A T T H37 C C A G C H23 C A H27 G T T . . . H34 A T C H38 T T C A T . . . Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 25 26 27 32 Gene polymorphism name ( ⁇ ) 34 35 36 37 38 39 40 42 43 44 45 47 50 Haplotype (H) No. Tag Tag H No. Tag Tag Tag Tag Tag H No. Tag 41 H No.
  • Haplotypes which are estimated to occur at a frequency of less than 1% ( ⁇ ) 1 ⁇ 64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584,
  • Haplotypes which are estimated to occur at a frequency of less than 1% ( ⁇ ) 1 ⁇ 31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
  • a haplotype frequency in the population is calculated, and a linkage disequilibrium analysis can be carried out based on the thus obtained haplotype frequency.
  • the D′ value and r2 value, which indicate measures of linkage disequilibrium, can be calculated based on the following definition.
  • SNP A and SNP B there are SNP A and SNP B, and the respective alleles are represented by A and a, and B and b.
  • the four haplotypes formed by SNP A and SNP B are represented by AB, Ab, aB and ab, and the respective haplotype frequencies are represented by PAB, PAb, PaB and Pab.
  • D ′ ( P AB ⁇ P ab ⁇ P Ab ⁇ P aB )/Minimum((( P AB +P aB ) ⁇ ( P aB +P ab )),(( P AB +P Ab ) ⁇ ( P Ab +P ab ))) (In the case of D ⁇ 0)
  • D ′ ( P AB ⁇ P ab ⁇ P Ab ⁇ P aB )/Minimum((( P AB +P aB ) ⁇ ( P AB +P Ab )),(( P aB +P ab ) ⁇ ( P Ab +P ab )))
  • Minimum (((P AB +P aB ) ⁇ (P aB +P ab )), ((P AB +P Ab ) ⁇ (P Ab +P ab ))) means that a smaller value among (P AB +P aB ) ⁇ (P aB +P ab ) and (P AB +P Ab ) ⁇ (P Ab +P ab ) is adopted.
  • a haplotype block can be estimated from the results of the linkage disequilibrium analysis.
  • a linkage block can be estimated from the results of the haplotype analysis by using, for example, Haploview.
  • the information of SNPs indirectly linked to each other in the same block can be obtained. That is, when a gene polymorphism of the cyclic AMP responsive element binding protein gene (specifically, a CREB1 subtype gene, a CREB3 subtype gene, a CREB5 subtype gene, or an ATF2 subtype gene) is examined, it is not necessary to analyze all the SNPs, and it is only necessary to perform typing for several specific SNPs, for example, representative SNPs such as a Tag SNP.
  • a gene polymorphism of the cyclic AMP responsive element binding protein gene specifically, a CREB1 subtype gene, a CREB3 subtype gene, a CREB5 subtype gene, or an ATF2 subtype gene
  • a phenotype associated with sensitivity to drugs drug sensitivity
  • a phenotype associated with occurrence of a disease disease vulnerability
  • drug sensitivity an efficacy of drugs, a side effect of drugs, duration of efficacy of drugs and the like
  • disease vulnerability pain sensitivity, vulnerability to substance dependence (in particular, vulnerability to drug dependence) and the like can be exemplified.
  • the type of the aforementioned drug is not particularly limited, and preferred examples of the drug include opioid receptor function modulators and cyclic AMP responsive element binding protein function modulators.
  • modulators include various drugs acting directly or indirectly on the opioid receptor or the cyclic AMP responsive element binding protein.
  • Specific examples of various drugs acting directly or indirectly on the opioid receptor include a stimulant such as methamphetamine, a dopamine receptor agonist, a dopamine receptor antagonist, a m-, ⁇ -, or ⁇ -opioid receptor agonist, a m-, ⁇ -, or ⁇ -opioid receptor antagonist, and the like.
  • drugs acting directly or indirectly on the cyclic AMP responsive element binding protein include phosphorylated enzyme, a coactivator, a PDE4 inhibitor, dephosphorylated enzyme, an agonist for each subtypes of the cyclic AMP responsive element binding protein, an antagonist for each subtypes of the cyclic AMP responsive element binding protein, and the like.
  • opioid receptor function modulator examples include morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, flurbiprofen axetil, marcain, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desi
  • morphine, pentazocine, pethidine, buprenorphine, diclofenac, indomethacin, flurbiprofen axetil and marcain are preferred, and morphine, fentanyl and pentazocine are more preferred.
  • Preferred examples of the cyclic AMP responsive element binding protein function modulator include phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3 ⁇ , and CREB-regulated transcription coactivator 1 (CRTC1).
  • PDE4 phosphodiesterase 4
  • RSK1 ribosome S6 kinase 1
  • calmodulin kinase calmodulin kinase
  • glycogen synthase kinase 3 ⁇ CREB-regulated transcription coactivator 1
  • a gene polymorphism in a linkage disequilibrium block estimated as a result of a linkage disequilibrium analysis and a haplotype analysis in healthy subjects is selected.
  • a Tag SNP which is a typical gene polymorphism is selected as a cyclic AMP responsive element binding protein gene polymorphism for analyzing a correlation with a phenotype.
  • a gene polymorphism frequency of the gene polymorphism in test subjects (patients) is analyzed.
  • a comparison is made in terms of gene polymorphisms between the test subjects and the healthy subjects. It is effective to use a statistical technique such as a chi-square test in the comparison.
  • test subjects are classified into groups depending on the difference in phenotypes, and a comparison may be made in terms of gene polymorphism frequencies or genotypes between healthy subjects and test subjects in each group.
  • the phenotype associated with the occurrence of a disease is a stimulant-induced psychotic-like symptom
  • it can be classified, for example, according to a period of time from the start of the use of a stimulant to the occurrence of delusion or hallucination, a period of duration of delusion or hallucination after termination of the use thereof, the presence or absence of the relapse, and the presence or absence of multiple drug abuse.
  • the gene polymorphism can be used for evaluating the genetic predisposition to drug sensitivity. Further, if there is a gene polymorphism with a significant difference in the gene polymorphism frequency between the healthy subjects and the test subjects, the gene polymorphism can be used for evaluating the genetic predisposition to disease vulnerability.
  • the correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype analyzed can be used as an index in a method of predicting sensitivity to various drugs associated with the opioid receptor and the cyclic AMP responsive element binding protein and also to pain, a method of selecting a method of treating or preventing a disease associated with the opioid receptor and the cyclic AMP responsive element binding protein, a method of determining an appropriate administration amount of therapeutic drugs, a method of predicting side effects, or the like.
  • the gene polymorphism or the method of the present invention it is possible to evaluate drug sensitivity and disease vulnerability in different races.
  • the subjects are not particularly limited, and examples thereof include Japanese, Europeans, Americans and the like. In the present invention, however, they are preferably Japanese or those having a similar gene polymorphism tendency to that of Japanese.
  • genomic DNA is purified from a specimen such as the blood, saliva, skin or the like collected from a human using the phenol method or the like.
  • a commercially available genomic DNA extraction kit such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Bio-Sciences KK) or a device may be used.
  • mRNA or total RNA may be extracted instead of genomic DNA.
  • the above-mentioned oligonucleotide of the present invention can be used as a probe or a primer.
  • an example of the gene polymorphism detection method will be described.
  • a high fidelity DNA polymerase for example, KOD Dash polymerase (manufactured by TOYOBO) is used.
  • a primer to be used is designed such that a target SNP in the test sample can be amplified and synthesis is carried out. It is preferred that a gene polymorphism or a strand complementary thereto is contained at a given position between the forward and reverse primers. After completion of the amplification reaction, detection of the amplified products is carried out, and the presence or absence of a gene polymorphism is determined by a sequence method or the like.
  • the gene polymorphism of the present invention can also be detected by a sequencing method based on the dideoxy method.
  • a sequencer to be used for the sequencing a commercially available ABI series (Applied Biosystems (Life Technologies)) can be used.
  • a DNA microarray is a microarray in which oligonucleotide probes have been immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array and the like.
  • a polynucleotide of a test sample is isolated and amplified by PCR, and then labeled with a fluorescent reporter group. Then, a labeled DNA/mRNA, or total RNA is incubated along with an array.
  • this array is inserted in a scanner, and a hybridization pattern is detected.
  • the data of the hybridization is collected as emitted light from the fluorescent reporter group bound to the probe array (i.e., incorporated in a target sequence).
  • a probe which is completely identical with the target sequence generates a stronger signal than those having a region which is not identical with the target sequence. Because the sequence and the position of each probe on the array are known, the sequence of the target polynucleotide reacted with the probe array can be determined based on the complementarity.
  • the TaqMan PCR method is a method utilizing an allele specific oligonucleotide (also referred to as TaqMan probe) labeled with fluorescence and PCR with Taq DNA polymerase.
  • the allele specific oligonucleotide is an oligonucleotide containing a gene polymorphic site.
  • the allele specific oligonucleotide to be used in the TaqMan PCR method can be designed based on the above-mentioned gene polymorphism information.
  • the invader method is a method of detecting a gene polymorphism by subjecting an allele specific oligonucleotide and a template to hybridization.
  • a kit for carrying out the invader method is commercially available (for example, NanoInvader® Array (manufactured by BML, Inc.)), and it is possible to easily detect a gene polymorphism by this method.
  • the present invention provides a kit for evaluating drug sensitivity and disease vulnerability.
  • the kit for detecting a gene polymorphism of the present invention includes one or more components necessary for carrying out the present invention.
  • the kit of the present invention preferably includes a component for storing or supplying an enzyme and/or a reaction component necessary for detecting a gene polymorphism.
  • a component is not limited, and examples thereof include the oligonucleotide of the present invention, an enzyme buffer solution, dNTP, a reagent for control (such as a tissue sample or a target oligonucleotide for a positive or negative control), a reagent for labeling and/or detection, a solid phase support, a written instruction manual and the like.
  • the kit of the present invention may be a partial kit including only a part of the necessary components. In this case, a user can prepare the other components.
  • the kit of the present invention can be provided as a microarray in which the above-mentioned oligonucleotide has been immobilized on a support.
  • the microarray is one in which the oligonucleotide of the present invention has been immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array and the like.
  • the kit of the present invention preferably includes an oligonucleotide which contains a cyclic AMP responsive element binding protein gene polymorphism found in the present invention and is capable of being specifically hybridized to a DNA fragment containing the gene polymorphism.
  • a gene polymorphism is determined using the kit of the present invention
  • the blood is collected before drugs are applied to patients or the like (for example, before surgery, at the time of occurrence of cancer pain or the like), and DNA containing a cyclic AMP responsive element binding protein 1 gene is isolated. Then, this gene is reacted with an oligonucleotide in the kit, and thereby a genotype is determined.
  • a dosage regimen such as the type or administration amount of the drugs can be designed.
  • an effect of the drugs suitable for an individual can be obtained, which is useful in the personalized medicine.
  • morphine it becomes possible to obtain an analgesic effect suitable for an individual, and also to suppress the side effects to the minimum.
  • Genomic DNA was extracted from the blood of humans (127 Japanese healthy subjects) by a standard method, and gene polymorphisms were identified in four subtypes (CREB1, CREB3, CREB5, and ATF2) of a human cyclic AMP responsive element binding protein.
  • CREB1 subtype gene an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB1 subtype gene, 7 gene polymorphisms in an intron region were identified in the Japanese samples. Further, 4 and 6 gene polymorphisms were found in the 5′ and 3′ flanking regions, respectively (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the 3′ flanking region (see FIG. 1 and FIG. 2 ).
  • rs1243872, rs2145925, rs2025126, GA007477, rs11541908, rs3763630, rs10814274, rsGA025684, rs10814275, rs4878628 and rs10758321 were suitable as Tag SNPs representing this linkage disequilibrium block.
  • minor allele frequency means the ratio of a minor allele. It is to be noted that the number of healthy subjects used as test subjects was 127.
  • haplotype analysis with regard to the 17 sites of SNPs which are CREB1 subtype gene polymorphisms, the 40 sites of SNPs which are CREB3 subtype gene polymorphisms, the 83 sites of SNPs which are CREB5 subtype gene polymorphisms, and the 23 sites of SNPs which are ATF2 subtype gene polymorphisms, as shown in Table 15 and Table 16, among the cyclic AMP responsive element binding protein gene polymorphisms in Japanese healthy subjects, a haplotype was estimated for each linkage disequilibrium block (haplotype block), using Haploview. The estimated haplotypes are shown in Tables 17, 18, 19 and 20. It is to be noted that the “Tag” used in each table means a Tag SNP that is a representative gene polymorphism in the linkage disequilibrium block.
  • Haplotypes which are estimated to occur at a frequency of less than 1% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% Linkage disequilibrium block No. 11 12 13 15 16 Hap- Gene polymorphism name ( ⁇ ) lotype Frequen- 19 20 H Frequen- 21 22 23 H Frequen- 24 25 H Frequen- 26 27 28 H Frequen- 29 30 31 (H) No. cy (%) Tag Tag No. cy (%) Tag Tag Tag No. cy (%) Tag Tag No. cy (%) Tag Tag No. cy (%) Tag Tag No. cy (%) Tag Tag Tag No.
  • Haplotypes which are estimated to occur at a frequency of less than 1% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% Linkage disequilibrium block No. 25 26 27 32 Hap- Gene polymorphism name ( ⁇ ) lotype Frequen- 34 35 H Frequen- 36 37 38 39 H Frequen- 40 H Frequen- 42 43 44 45 47 50 (H) No. cy (%) Tag Tag No. cy (%) Tag Tag Tag Tag No. cy (%) Tag 41 No.
  • Haplotypes which are estimated to occur at a frequency of less than 1% 100.0% 100.0% 100.0% ( ⁇ ) 1 ⁇ 64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs1266
  • Haplotypes which are estimated to occur at a frequency of less than 1% 100.0% ( ⁇ ) 1 ⁇ 31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
  • haplotypes were estimated as the haplotype of CREB1 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 6 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H6). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 17.
  • haplotypes were estimated as the haplotype of CREB3 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 11 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H5, H8 to H10, and H12 to H14). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 18.
  • haplotypes were estimated as the haplotype of CREB5 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 57 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H3, H6 to H9, H11 to H22, H24 to H36, H38 to H54, H56, H58, and H60 to H65).
  • haplotype Nos. H1 to H3, H6 to H9, H11 to H22, H24 to H36, H38 to H54, H56, H58, and H60 to H65 was omitted from Table 19.
  • haplotypes were estimated as the haplotype of ATF2 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 9 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H9). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 20.
  • FIG. 1 to FIG. 8 The linkage disequilibrium among the CREB1 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 1 and FIG. 2 .
  • the linkage disequilibrium among the CREB3 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 3 and FIG. 4 .
  • the linkage disequilibrium among the CREB5 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 5 and FIG. 6 .
  • the linkage disequilibrium among the ATF2 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 7 and FIG. 8 .
  • a linkage disequilibrium block was estimated from the results of the linkage disequilibrium analysis ( FIG. 1 to FIG. 8 ) using Haploview.
  • a D′ value which is an index of a linkage disequilibrium between SNP and SNP, is calculated, and the resulting value (two places of decimals) is written in the square at the intersection of squares continued from each SNP to the lower left direction or the lower right direction.
  • an r 2 value which is a more stringent index of the linkage disequilibrium, is calculated in the same manner, and the resulting value is written in the same square as defined above in FIG. 2 . It is to be noted that the square in which no numbers are written indicates that the D′ or r 2 value is 1. Also, the same shall apply to FIGS. 3 and 4 , FIGS. 5 and 6 , and FIGS. 7 and 8 .
  • Tag SNPs representing these linkage disequilibrium blocks are rs4722778, rs177479, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs11772815, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs
  • a linkage disequilibrium block was estimated from the results of the linkage disequilibrium analysis ( FIG. 1 to FIG. 8 ) using Haploview.
  • SNP in the CREB1 subtype gene shown in FIG. 1 and FIG. 2 one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the 3′ flanking region.
  • SNP in the CREB3 subtype gene shown in FIG. 3 and FIG. 4 one linkage disequilibrium block was confirmed in the 5′ flanking region, and one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the 3′ flanking region.
  • fentanyl which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene.
  • 54% and 46% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the A/A patient group.
  • 23% and 77% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high pain sensitivity group” and a “low pain sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene.
  • 45% and 55% of patients were determined to belong to the high pain sensitivity group and the low pain sensitivity group, respectively, in the A/A patient group.
  • 55% and 45% of patients were determined to belong to the high pain sensitivity group and the low pain sensitivity group, respectively.
  • a correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the measurement of the scale of the intensity of pain (VAS: on visual analogue scale) 24 hours after the surgery was analyzed.
  • VAS on visual analogue scale
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low pain sensitivity group” and a “high pain sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene.
  • 54% and 46% of patients were determined to belong to the low pain sensitivity group and the high pain sensitivity group, respectively, in the A/A patient group.
  • 47% and 53% of patients were determined to belong to the low pain sensitivity group and the high pain sensitivity group, respectively.
  • Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs7583431) in the ATF2 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the analgesic effect of fentanyl that was evaluated based on the measurement of a difference in threshold of pain perception latency due to finger immersion in ice water after administration of an analgesic before the surgery was analyzed.
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low analgesic sensitivity group” and a “high analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs7583431 polymorphism of the ATF2 gene.
  • 40% and 60% of patients were determined to belong to the low analgesic sensitivity group and the high analgesic sensitivity group, respectively, in the A/A patient group.
  • the C/C patient group 71% and 29% of patients were determined to belong to the low analgesic sensitivity group and the high analgesic sensitivity group, respectively.
  • Genomic DNA was extracted from the blood of 355 patients undergoing surgery (orthognathic surgery), and gene polymorphisms in the CREB1, CREB3, CREB5 and ATF2 subtype genes (Tag SNPs in linkage disequilibrium blocks and individual SNPs outside of the linkage disequilibrium blocks) were determined.
  • fentanyl which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
  • the gene polymorphisms of the CREB1, CREB3, CREB5 and ATF2 subtype genes showed a statistically significant correlation with any phenotype of the required administration amount of analgesic in 24 hours after the surgery, pain sensitivity before the surgery, pain sensitivity (VAS) 24 hours after the surgery and before the surgery, and the analgesic effect of fentanyl. Accordingly, by analyzing these gene polymorphisms, the sensitivity to analgesic, pain sensitivity, and the analgesic effect of fentanyl can be predicted.
  • fentanyl which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene.
  • 53% and 47% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the T/T or T/C patient group.
  • 22% and 78% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
  • analgesics such as pentazocine and pethidine, which are mainly administered intravenously, buprenorphine, diclofenac and indomethacin, which are mainly administered as a suppository, flurbiprofen axetil, which is injected by intravenous infusion, as well as epidural morphine and marcain were used.
  • the total amount of each analgesic in terms of fentanyl means the total amount of analgesic (mg) in the case where the amount of each administered analgesic is converted to a value corresponding to the potency equivalent to fentanyl.
  • the conversion of the amount of each analgesic to a value corresponding to the potency of fentanyl was carried out by setting a potency equivalent to 0.3 mg of fentanyl at 90 mg of pentazocine, 360 mg in the case of pethidine (Opystan), 1 mg in the case of buprenorphine (Lepetan), 300 mg in the case of diclofenac (Voltaren), 300 mg in the case of flurbiprofen axetil (Ropion), and 6 mg in the case of epidural morphine.
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene.
  • 52% and 48% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the T/T or T/C patient group.
  • 33% and 67% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
  • Genomic DNA was extracted from the blood of 194 methamphetamine-dependent patients, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of the abuse of many drugs, and a comparison was made among them. The results are shown in the following Table 28.
  • the methamphetamine-dependent patients were classified into two groups, namely, a patient group involving the abuse of drugs other than stimulants (two or more types) and a patient group involving the abuse of a single drug (only one type).
  • Genomic DNA was extracted from the blood of 436 alcohol-dependent patients, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of drug abuse, and a comparison was made among them. The results are shown in the following Table 29. Here, the alcohol-dependent patients were classified into two groups, namely, a patient group with drug abuse (one or more types) and a patient group without drug abuse (only alcohol ingestion).
  • Genomic DNA was extracted from the blood of 221 patients with eating disorder, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of drug dependence, and a comparison was made among them. The results are shown in the following Table 30.
  • the eating disorder patients were classified into two groups, namely, a patient group with a complication of drug dependence and a patient group without a complication of drug dependence.
  • Genomic DNA was extracted from the blood of 221 patients with eating disorder, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of alcohol dependence, and a comparison was made among them. The results are shown in the following Table 31.
  • the eating disorder patients were classified into two groups, namely, a patient group with a complication of alcohol dependence and a patient group without a complication of alcohol dependence.
  • RD reward dependence
  • TCI Temperament and Character Inventory
  • a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low reward dependence group” and a “high reward dependence group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene.
  • 43% and 57% of healthy subjects were determined to belong to the low reward dependence group and the high reward dependence group, respectively, in the T/T patient group.
  • 58% and 42% of healthy subjects were determined to belong to the low reward dependence group and the high reward dependence group, respectively.
  • the gene expression level the value of the relative mRNA expression level of CREB1, which was standardized with the value of the mRNA expression level of a ⁇ -actin gene (ACTB), was used.
  • a subject group with a value smaller than the reference and a subject group with a value larger than the reference were defined as a “low gene expression group” and a “high gene expression group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene.
  • 52% and 48% of subjects were determined to belong to the low gene expression group and the high gene expression group, respectively, in the T/T or T/C subject group.
  • 30% and 70% of subjects were determined to belong to the low gene expression group and the high gene expression group, respectively.
  • a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism which can evaluate an individual difference in terms of drug sensitivity and disease vulnerability; a method for evaluating drug sensitivity and disease vulnerability using the gene polymorphism or the haplotype; and the like.
  • this evaluation method it becomes possible to readily know or predict a proper prescribed amount, a proper prescribed schedule associated with a narcotic drug such as morphine, and the like, and hence the method is extremely useful for personalized pain therapy, drug dependence therapy and the like.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Evolutionary Biology (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a method for evaluating (predicting, etc.) an individual difference (the tendency of every individual) in terms of drug sensitivity and disease vulnerability, comprising using a gene polymorphism of a cyclic AMP responsive element binding protein gene or the like. The method for evaluating drug sensitivity and the method for evaluating disease vulnerability according to the present invention comprise associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with the drug sensitivity and disease vulnerability of an individual.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a Continuation of copending application Ser. No. 14/347,500, filed on Mar. 26, 2014, which is the National Phase under 35 U.S.C. §371 of PCT International Application No. PCT/JP2012/076054, filed on Oct. 1, 2012, which claims priority under 35 U.S.C. §119(a) to Patent Application No. 2011-217104, filed in JAPAN on Sep. 30, 2011, all of which are hereby expressly incorporated by reference into the present application.
  • TECHNICAL FIELD
  • The present invention relates to a method for evaluating drug sensitivity and disease vulnerability, comprising analyzing a cyclic AMP responsive element binding protein (cAMP responsive element binding protein; CREB) gene. Specifically, the present invention relates to a method for evaluating drug sensitivity and disease vulnerability, comprising associating a gene polymorphism of a CREB gene or a haplotype constituted by the gene polymorphism with the drug sensitivity and disease vulnerability of an individual. More specifically, the present invention relates to a method for evaluating a tendency in the presence or absence of the drug sensitivity and disease vulnerability of an individual, based on the results from the analysis of the above-described gene polymorphism or haplotype.
  • BACKGROUND ART
  • Pain is a pathology which is most frequently observed in the medical field, and it is often the case that the pain accompanying a disease is serious for the patient rather than the disease itself. The pain sensation plays an important role in terms of a biological warning system, however, excessive pain would significantly decrease QOL (quality of life) unless it is properly controlled. Recently, the importance of pain control has been recognized, and palliative care including pain therapy has remarkably progressed, and there is a tendency of increasing the frequency and amount of use of various analgesics.
  • It has been previously known that narcotic analgesics including morphine as a representative example act on a protein known as an “opioid receptor,” so as to cause analgesic action. The opioid receptor includes three types of receptors, a μ-type opioid receptor, a δ-type opioid receptor, and a κ-type opioid receptor, and all of these receptors are related to analgesic action. Since these receptors are Gi/o protein-coupled receptors, they activate a GIRK channel and suppression of a calcium channel through the mediation of a Gi-o protein. In addition, the receptors suppress adenylate cyclase (Non Patent Literature 1: Pierce K. et al., Seven-transmembrane receptors, Nat Rev Mol Cell Biol, (2002) 3: 639-650; Non Patent Literature 2: Bokoch G M. et al., Purification and properties of the inhibitory guanine nucleotide-binding regulatory component of adenylate cyclase, J Biol Chem, (1984) 259: 3560-3567). Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase, and it causes activation of a cyclic AMP responsive element binding protein (CREB) through phosphorylation of the serine residue at position 133 of the protein (Non Patent Literature 3: Gonzalez G A. et al., Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133, Cell, (1989) 59: 675-680). The activated CREB binds to a CREB-binding protein acting as an activation cofactor (Non Patent Literature 4: Chrivia J C, et al., Phosphorylated CREB binds specifically to the nuclear protein CBP., Nature, (1993) 365: 855-859), and it binds to the cyclic AMP responsive element of genomic DNA, thereby promoting gene expression (Non Patent Literature 5: Montminy M R. et al., Identification of a cyclic-AMP-responsive element within the rat somatostatin gene., Proc Natl Acad Sci USA, (1986) 83: 6682-6686).
  • SUMMARY OF INVENTION
  • The objective of the present invention is to provide a method for evaluating (predicting, etc.) an individual difference (the tendency of every individual) in terms of drug sensitivity and disease vulnerability, comprising using a gene polymorphism of a cyclic AMP responsive element binding protein (CREB) gene or the like.
  • The present inventors focused on the cyclic AMP responsive element binding protein (CREB) gene and conducted extensive examinations based on conventional findings and clinical data. As a result, the inventors identified several useful gene polymorphisms by analyzing the association of each CREB gene polymorphism with sensitivity to drugs such as analgesics, and with disease vulnerability including pain sensitivity. Thereafter, the inventors found linkage disequilibrium among the thus identified gene polymorphisms, and we also revealed a significant correlation between drug sensitivity and disease vulnerability (more specifically, a change in the required administration amount of an analgesic and a change in the threshold value of pain sensitivity due to a difference in specific CREB gene polymorphisms), thereby accomplishing the present invention.
  • Thus, the present invention relates to the following:
  • 1. A method for evaluating drug sensitivity, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual drug sensitivity.
  • The above-described evaluation method includes a method for evaluating a tendency in the presence or absence of an individual drug sensitivity based on the results from the analysis of the gene polymorphism or the haplotype.
  • 2. The method according to 1 above, comprising the following steps: (1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block; (2) a step of analyzing the association between the genotypes of the gene polymorphisms and drug sensitivity in a test subject; and (3) a step of using the gene polymorphism that has been significantly associated with drug sensitivity in the test subject for evaluation of the drug sensitivity.
  • 3. A method for evaluating disease vulnerability, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual disease vulnerability.
  • The above-described evaluation method includes a method for evaluating a tendency in the presence or absence of an individual disease vulnerability is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
  • 4. The method according to 3 above, comprising the following steps: (1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block; (2) a step of analyzing the association between the genotypes of the gene polymorphisms and pain sensitivity; and (3) a step of using the gene polymorphism that has been significantly associated with pain sensitivity in the test subject for evaluation of the disease vulnerability.
  • 5. The method according to 3 or 4 above, wherein the disease vulnerability is pain sensitivity or vulnerability to substance dependence (in particular, vulnerability to drug dependence).
  • 6. The method according to any one of 1 to 5 above, wherein the gene polymorphism is at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a nucleotide repeat polymorphism.
  • 7. The method according to any one of 1 to 6 above, wherein the gene polymorphism is at least one selected from among: rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784, and rs7594560 of a CREB1 subtype gene (which is a CREB1 gene as a subtype of the CREB gene (the same shall apply hereafter); rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321, and rs10758322 of a CREB3 subtype gene (which is a CREB3 gene as a subtype of the CREB gene (the same shall apply hereafter); rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs2175738, rs17156579, rs17156603, rs17642145, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs7794304, rs6952227, rs42695, rs1029897, rs4722793, rs10233653, rs6955105, rs17156685, rs17156694, rs17156699, rs177572, rs177573, rs177574, rs177576, rs13437706, rs177580, rs177581, rs12666636, rs177584, rs177585, rs216715, rs10951197, rs160335, rs1008262, rs310353, rs310359, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs41348, rs886816, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs2066979, rs10486591, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955, and rs10228137 of a CREB5 subtype gene (which is a CREB5 gene as a subtype of the CREB gene (the same shall apply hereafter); and rs1153711, rs1153702, rs7583431, rs1153699, rs2302663, rs3845744, rs212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474, and rs268174 of an ATF2 subtype gene (which is an ATF2 gene as an alias of a CREB2 gene that is a subtype of the CREB gene (the same shall apply hereafter)).
  • 8. The method according to any one of 1 to 7 above, wherein the haplotype is at least one selected from the following table.
  • It is to be noted that haplotypes constituted by a combination of any given number and type of various gene polymorphisms according to 7 above can also be selected as haplotypes used in the evaluation method and the like of the present invention.
  • TABLE 1
    Gene name CREB1
    Linkage disequilibrium block No.
    1
    Gene polymorphism name ()
    1 2 3 12 13 17
    Haplotype No. Tag Tag Tag 4 5 6 7 8 9 10 11 Tag Tag 14 15 16 Tag
    H1 C C C A G G G T C C C C C C A A T
    H2 C C A G A T A C T A T C C T G G T
    H3 C T C A G G A T T C C C C C A A T
    H4 T C A G A T A C T A T C A T G G C
    H5 C C A G A T A C T A T A C C A A T
    H6 T C A G A T A C T A T C C T G G T
    H7 T C A G A T A C T A T C A T G G T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560
  • TABLE 2
    Gene name CREB3
    Linkage disequilibrium block No.
    1
    Gene polymorphism name ()
    1 2 3 9 11
    Haplotype No. Tag Tag Tag 4 5 6 7 8 Tag 10 Tag 12 13 14 15 16 17 18 19 20 21 22 23 24
    H1 G C G T A T T T C T C C G C T G T G T C A G G A
    H2 G C G T A T T T T T C C G C T G T G T C A G G A
    H3 T T A T A T C T C T T C G A G A C A C C G T G C
    H4 T T A T A T C T C T C C G A G A C A C C G T G C
    H5 T C G C C C C C C T C C A A G G C A T C A T A C
    H6 T T G T A T C T C C C T G A T G C G T C A G G C
    H7 T C A T A T C T C T T C G A G A C A C C G T G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    2
    Gene polymorphism name ()
    25 26 29 36 38 39
    Haplotype No. Tag Tag 27 28 Tag 30 31 32 33 34 35 Tag 37 Tag Tag 40
    H8 C C G G G C G G G A T A C C G C
    H9 C T A T G T A G A G A A T C A T
    H10 T C G G C T G A A G A A T C G C
    H11 C T A G G T A G A G A A T C G T
    H12 C C G G C T G A A G A A T C G C
    H13 C T A T G T A G A G A G T C A T
    H14 C C G G G C G G G A T A C T G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322
  • TABLE 3
    Gene name CREB5
    Linkage disequilibrium block No.
    1 5 6 9 10
    Gene polymorphism name ()
    1 2 5 6 7 8 9 11 13 14 15 16 17 18
    Haplotype (H) No. Tag Tag 3 4 Tag Tag H No. Tag Tag Tag 10 Tag 12 H No. Tag Tag H No. Tag Tag H No. Tag Tag
    H1 C T A A G C H6 C C G C A G H11 T G H14 T A H17 G T
    H2 G C G A G T H7 C A A C G G H12 C C H15 C A H18 G G
    H3 G C G A A T H8 C C G C G G H13 C G H16 C G H19 A G
    H4 C C G A G T H9 T A A C G A . . . . . . . . .
    H5 G C G A G C H10 C C A C G G
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    11 12 13 15 16
    Gene polymorphism name ()
    19 20 21 22 23 24 25 26 27 28 29 30 31
    Haplotype (H) No. Tag Tag H No. Tag Tag Tag H No. Tag Tag H No. Tag Tag Tag H No. Tag Tag Tag 32 33
    H20 T A H24 G C C H28 A A H31 G T C H35 C C C G C
    H21 T G H25 G C T H29 G A H32 A C T H36 T C A G C
    H22 C G H26 A C T H30 G G H33 A T T H37 C C A G C
    H23 C A H27 G T T . . . H34 A T C H38 T T C A T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    25 26 27 32
    Gene polymorphism name ()
    34 35 36 37 38 39 40 42 43 44 45 47 50
    Haplotype (H) No. Tag Tag H No. Tag Tag Tag Tag H No. Tag 41 H No. Tag Tag Tag Tag 46 Tag 48 49 Tag
    H39 T A H42 G A G G H47 A A H49 A T C G T G T T T
    H40 C G H43 G A A A H48 G G H50 A T C G T G T T C
    H41 T G H44 A G G A . . . H51 A T A C C G T C C
    . . . H45 G A G A H52 C T A C T T C T C
    H46 G G G A H53 C T A C T G C T C
    . . . H54 A C C G T G T T T
    H55 A T A G T G T T C
    Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    33 35 40
    Gene polymorphism name ()
    51 52 53 54 57 58 59
    Haplotype (H) No. Tag Tag Tag Tag 55 56 H No. Tag Tag H No. Tag 60 61 62 63 64
    H56 T G G C A A H61 C T H64 G G C T T C
    H57 T A A T G C H62 T C H65 A A T C C A
    H58 G A A C G C H63 T T . . .
    H59 T A G C A A . . .
    H60 T A A C G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~64: (in this order) rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137
  • TABLE 4
    Gene name ATF2
    Linkage disequilibrium block No.
    1 2
    Gene polymorphism name ()
    1 2 3 4 5
    Haplotype No. Tag Tag Tag Tag Tag 6 7 8 9 10 11 12 13 14 15 16
    H1 T C A A G C C A G C G T C A A A
    H2 G C A G G T T G A T A C A C C G
    H3 T T C G A T T G A T A C A C C G
    H4 T T A G A T T G A T A C A C C G
    G G T T G A T A C A C C G
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    2
    Gene polymorphism name ()
    21 28
    Haplotype No. 17 18 19 20 Tag 22 23 24 25 26 27 Tag 29 30 31
    H5 C T T C C C G A C A C T T G T
    H6 T C C T T T A G A C T G C G C
    H7 T C C T T T A G A C T T C G C
    H8 T C C T T T A G A C T G C G C
    H9 T C C T C C G A C A C T T G T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
  • 9. A method for determining the type, amount, and/or frequency of administration of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to any one of 1 to 8 above as an index.
  • 10. A method for predicting a side effect of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to any one of 1 to 8 above as an index.
  • 11. The method according to any one of 1, 2, 5, 9, and 10 above, wherein the drug is an opioid receptor function modulator and/or a cyclic AMP responsive element binding protein function modulator.
  • 12. The method according to 11 above, wherein the opioid receptor function modulator is at least one selected from the group consisting of methamphetamine, methylenedioxymethamphetamine, amphetamine, dextroamphetamine, dopamine, morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramide, isoflurane, ginsenoside, ifenprodil, bupivacaine, tertiapin, clozapine, haloperidol, SCH23390, and cocaine; and the cyclic AMP responsive element binding protein function modulator is at least one selected from the group consisting of phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β, and CREB-regulated transcription coactivator 1 (CRTC1).
  • 13. The method according to any one of 1 to 12 above, comprising using an oligonucleotide consisting of a nucleotide sequence of at least 10 nucleotides comprising the 51st nucleotide of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172, or a complementary nucleotide sequence thereto, which can specifically hybridize to a DNA fragment comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene.
  • 14. The method according to 13 above, wherein the oligonucleotide spans a length of 10 to 150 nucleotides.
  • 15. The method according to 13 or 14 above, wherein the oligonucleotide is selected from the group consisting of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 38 and a complementary nucleotide sequence thereto.
  • 16. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual drug sensitivity, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism. Examples of the drug applied herein are the same as those described in 11 and 12 above.
  • 17. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual disease vulnerability, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.
  • According to the present invention, there can be provided: a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism, which is capable of evaluating an individual difference in terms of drug sensitivity and disease vulnerability; a method for evaluating drug sensitivity and disease vulnerability, comprising using the gene polymorphism or the haplotype; etc. According to this evaluation method, it becomes possible to readily know or predict a proper prescribed amount, a proper prescribed schedule, and the like, associated with a narcotic drug such as morphine, and hence the method is extremely useful for personalized pain therapy, drug dependence therapy and the like.
  • BRIEF DESCRIPTION OF DRAWINGS
  • FIG. 1 is a schematic view showing gene polymorphisms identified regarding a CREB1 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs16839837 and rs2551640 is 0.91.
  • FIG. 2 is a schematic view showing gene polymorphisms identified regarding a CREB1 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs16839837 and rs2551640 is 0.12.
  • FIG. 3 is a schematic view showing gene polymorphisms identified regarding a CREB3 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs1243872 and rs2025126 is 0.97.
  • FIG. 4 is a schematic view showing gene polymorphisms identified regarding a CREB3 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs1243872 and rs2025126 is 0.67.
  • FIG. 5 is a schematic view showing gene polymorphisms identified regarding a CREB5 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs4722778 and rs177479 is 0.93.
  • FIG. 6 is a schematic view showing gene polymorphisms identified regarding a CREB5 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs4722778 and rs177479 is 0.85.
  • FIG. 7 is a schematic view showing gene polymorphisms identified regarding a ATF2 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of D′ that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of D′ between rs1153711 and rs1153700 is 0.86.
  • FIG. 8 is a schematic view showing gene polymorphisms identified regarding a ATF2 subtype gene and a linkage disequilibrium found among them. In the figure, high-color squares indicate SNPs showing strong linkage with each other. In addition, the square found at the intersection of squares continued from each SNP to the lower left direction or the lower right direction indicates the calculation value (percentage) of r2 that is an index of the linkage disequilibrium of a SNP and another SNP. For example, the calculation value of r2 between rs1153711 and rs1153700 is 0.14.
  • FIG. 9 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the required administration amount (μg/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 10 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the measurement results (sec) of pain sensitivity before surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 11 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs10932200) of a CREB1 subtype gene on the measurement results (mm) of VAS (the intensity of pain on a visual analogue scale) 24 hours after surgery, in male patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 12 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs7583431) of an ATF2 subtype gene on the measurement results (sec) of a difference in threshold of pain perception latency before surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 13 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the required administration amount (μg/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (orthognathic surgery).
  • FIG. 14 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the required administration amount (μg/kg) of analgesic in 24 hours after surgery, in all patients who were administered with analgesic in the surgery (abdominal surgery).
  • FIG. 15 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the reward dependence (RD) score (average) of Temperament and Character Inventory (TCI) in all healthy subjects.
  • FIG. 16 is a graph showing the effect (overall average±standard deviation) of a polymorphism (rs2952768) of a CREB1 subtype gene on the expression level of a CREB1 subtype gene in postmortem brain tissue donors at the Stanley Foundation Brain Bank.
  • DESCRIPTION OF EMBODIMENT
  • Hereinafter, the present invention will be described in detail. However, the scope of the invention is not limited to the description, and changes and modifications can be made therein without departing from the spirit of the invention other than the following examples.
  • It is to be noted that the present specification includes all of the contents as disclosed in the specification and/or drawings of Japanese Patent Application No. 2011-217104 (filed on Sep. 30, 2011), which is a priority document of the present application. Moreover, all publications cited in the present specification, including prior art documents and patent literatures such as patent laid-open applications or patent publications, are incorporated herein by reference in their entirety.
  • 1. Outline of the Present Invention (1) Cyclic AMP Responsive Element Binding Protein
  • Cyclic AMP responsive element binding protein (cAMP responsive element binding protein; CREB) is a protein, which includes a signaling system downstream of G protein-coupled receptor such as a μ-type opioid receptor, is activated depending on an intracellular cyclic AMP concentration, and binds to a cyclic AMP responsive element (cAMP responsive element) of nuclear genomic DNA, so that it is associated with regulation of gene expression. The cyclic AMP responsive element binding protein is present in various tissues and/or organs such as cardiac muscle, various types of smooth muscle, fat cells, skeletal muscle and brain, and it is also associated with neurogenesis, memory, dependence, etc., through the expression of various genes.
  • Narcotic analgesics including morphine as a representative example act on a protein known as an “opioid receptor,” so as to cause analgesic action. The opioid receptor includes three types of receptors, a μ-type opioid receptor, a δ-type opioid receptor, and a κ-type opioid receptor, and all of these receptors are related to analgesic action. Since these receptors are Gi/o protein-coupled receptors, they activate a GIRK channel and suppression of a calcium channel through the mediation of a Gi-o protein. In addition, the receptors suppress adenylate cyclase. Activation of adenylate cyclase activates cyclic AMP-dependent protein kinase, and it causes activation of a cyclic AMP responsive element binding protein (CREB) through phosphorylation of the serine residue at position 133 of the protein. The activated CREB binds to a CREB-binding protein acting as an activation cofactor, and it binds to the cyclic AMP responsive element of genomic DNA, thereby promoting gene expression.
  • Herein, the cyclic AMP responsive element binding protein will be described. The cyclic AMP responsive element binding protein is distributed in various tissues and/or organs including brain and heart, and plays an important role for neurogenesis, memory, the expression of dependence, etc., through the expression of various types of genes. The cyclic AMP responsive element binding protein has a domain structure comprising a Q-rich domain, a kinase-inducible domain (KID), a basic region/leucine zipper (bZIP), etc. The protein binds to genomic DNA.
  • The cyclic AMP responsive element binding protein functions as a dimer formed from two subunits. The type of a receptor subtype is broadly classified into CREB1, CREB3, CREB5, ATF2 and the like, and their homologs have also been known. These subtypes are expressed in various tissues and/or organs including brain and heart.
  • (2) Gene Polymorphism
  • The present inventors identified gene polymorphisms (such as SNP) of the subtypes CREB1, CREB3, CREB5 and ATF2 (CREB2) capable of constituting a cyclic AMP responsive element binding protein in healthy subjects (FIGS. 1 to 8). Further, a linkage disequilibrium analysis was carried out as needed, and a block exhibiting a strong linkage disequilibrium (a haplotype block) was identified.
  • Here, the linkage equilibrium means a case where the relationship between two gene polymorphisms on the chromosome is independent, and the linkage disequilibrium means a case where a gene polymorphism is linked to the other gene polymorphism thereby deviating from the equilibrium situation according to Mendel's law of independence. Further, the haplotype means a genetic structure of such as genes or gene polymorphisms located in the vicinity of each other in one allele of a set of alleles (a gene derived from one of the parents).
  • Gene polymorphisms or the like located in the vicinity on a genome are inherited in a haplotype block. In other words, a haplotype also refers to a combination of the arrangement of the same gene in this haplotype block.
  • In the case where several gene polymorphisms appear in association with a certain phenotype in the cyclic AMP responsive element binding protein genes, even if not all the respective gene polymorphisms are typed, by analyzing several gene polymorphisms constituting a haplotype, a relationship between the genotype and the phenotype of a patient can be elucidated.
  • The present inventors analyzed the cyclic AMP responsive element binding protein CREB1 subtype gene, and as a result, they found 4 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 7 gene polymorphisms in the intron region (see Table 5).
  • In addition, with regard to the CREB3 subtype gene, the inventors found 25 and 14 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 1 gene polymorphism in the intron region (see Table 5).
  • Moreover, with regard to the CREB5 subtype gene, the inventors found 9 and 5 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 241 gene polymorphisms in the intron region and 2 gene polymorphisms (rs2190305 and rs3735566) in the noncoding region of exon (see Table 6).
  • Furthermore, with regard to the ATF2 subtype gene, the inventors found 11 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, and also found 16 gene polymorphisms in the intron region and 1 gene polymorphism (rs10497434) in the noncoding region of exon (see Table 5).
  • According to the present invention, by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein gene or haplotypes constituted by the gene polymorphisms, an individual difference in phenotypes regarding sensitivity to drugs (i.e. drug sensitivity), such as the effectiveness of a drug, the side effects of a drug, and an effective duration of a drug (e.g. the required number of administration of analgesic, the total amount of analgesic, prolongation of stimulant-induced psychosis, etc.), and in phenotypes regarding the development of a disease including pain sensitivity, vulnerability to substance dependence (in particular, vulnerability to drug dependence), etc., can be easily evaluated. The results of evaluating drug sensitivity and disease vulnerability can be important information for determining the administration number, amount, type or the like of drugs to be administered to an individual, and predicting side effects. Therefore, the present invention provides a method for evaluating drug sensitivity and disease vulnerability based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of drug sensitivity and disease vulnerability (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person). In addition, the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of drug sensitivity and disease vulnerability (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms.
  • In particular, because morphine, a stimulant or the like may cause a big social problem depending on the usage, it is important to know in advance an appropriate amount of drugs to be administered to an individual before administering the drugs. Therefore, the present invention is extremely useful for personalized pain therapy or drug dependence therapy.
  • Moreover, according to the present invention, by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, an individual difference in terms of dependence-prone personality can be easily evaluated. The results of evaluating dependence-prone personality can be information for determining whether reward dependence is high or low about the personality of an individual. Therefore, the present invention provides a method for evaluating dependence-prone personality based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of dependence-prone personality (high reward dependence or low reward dependence) (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person). In addition, the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of dependence-prone personality (high reward dependence or low reward dependence) (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms. Herein, with regard to the types of a gene polymorphism and a haplotype constituted by the gene polymorphism that can be applied to the above-described evaluation of dependence-prone personality, the same gene polymorphisms and haplotypes as those that can be applied to the above-described method for evaluating drug sensitivity and disease vulnerability can be used. Moreover, with regard to oligonucleotides used for the above described evaluation of dependence-prone personality as well, the same oligonucleotides as those used for the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
  • Furthermore, according to the present invention, by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, an individual difference in terms of the expression level of a CREB1 gene can be easily evaluated. The results of evaluating the expression level of a CREB1 gene can be information for predicting whether the expression level of a CREB1 gene in an individual is high or low. Therefore, the present invention provides a method for evaluating the high or low expression level of a CREB1 gene based on the results obtained by analyzing gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms, and specifically, a method for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of the high or low expression level of a CREB1 gene (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person). In addition, the present invention also provides a gene polymorphism marker used for evaluating (specifically, knowing in advance or predicting) a tendency in the presence or absence of the high or low expression level of a CREB1 gene (more specifically, the presence or absence of the genetic factor thereof) in an individual (an individual person), wherein the gene polymorphism marker comprises gene polymorphisms of the cyclic AMP responsive element binding protein or haplotypes constituted by the gene polymorphisms. Herein, with regard to the types of a gene polymorphism and a haplotype constituted by the gene polymorphism that can be applied to the above-described evaluation of the high or low expression level of a CREB1 gene, the same gene polymorphisms and haplotypes as those that can be applied to the above-described method for evaluating drug sensitivity and disease vulnerability can be used. Moreover, with regard to oligonucleotides used for the above described evaluation of the high or low expression level of a CREB1 gene as well, the same oligonucleotides as those used for the above-described method for evaluating drug sensitivity and disease vulnerability can be used.
  • 2. Gene Polymorphism of Cyclic AMP Responsive Element Binding Protein Gene
  • The human cyclic AMP responsive element binding protein gene polymorphisms of the present invention mainly include single nucleotide polymorphisms (hereinafter also referred to as “SNP”), however it is not limited to this, and insertion polymorphisms, deletion polymorphisms, and nucleotide repeat polymorphisms can also be included.
  • The single nucleotide polymorphism [SNP (SNPs)] means a gene polymorphism caused by substitution of a specific one nucleotide of a gene with another nucleotide. The insertion/deletion polymorphism means a gene polymorphism caused by deletion/insertion of one or more nucleotides.
  • Further, the nucleotide repeat polymorphism means a gene polymorphism caused by a difference in the number of repeats of nucleotide sequence. The nucleotide repeat polymorphism is divided into a microsatellite polymorphism (the number of nucleotides: about 2 to 4 nucleotides) and a VNTR (variable number of tandem repeat) polymorphism (repeated nucleotides: several to several tens of nucleotides) according to the difference in the number of repeated nucleotides, and the number of repeats varies depending on individuals.
  • The information of human cyclic AMP responsive element binding protein gene polymorphisms (SNPs in the CREB1 subtype gene, the CREB3 subtype gene, the CREB5 subtype gene and the ATF2 subtype gene observed on the genome of Japanese healthy subjects) elucidated by the present invention is shown in Table 5 and Table 6. The gene polymorphisms shown in Table 5 and Table 6 include the cyclic AMP responsive element binding protein gene polymorphisms of the present invention.
  • TABLE 5
    CREB1 gene polymorphism CREB3 gene polymorphism ATF2 gene polymorphism
    Gene Major Gene Major Gene Major
    polymorphism allele:minor polymorphism allele:minor polymorphism allele:minor
    Position name allele Position name allele Position name allele
    5′ Flanking rs16839837 C:T 5′ Flanking rs1243872 G:T 5′ Flanking rs268174 C:T
    region rs2360969 C:T region rs2145925 C:T region rs13030474 G:T
    rs10932200 A:C rs2025126 G:A rs268237 C:T
    rs2253206 G:A rs1885373 T:C rs1982235 T:G
    Intron rs2551640 A:G rs1885374 A:C rs10497435 T:C
    rs11904814 T:G GA007473 T:C rs268231 C:A
    rs16839883 A:G rs2295794 T:C rs268230 A:C
    rs6740584 C:T rs4879926 T:C rs268229 G:A
    rs3770704 T:C GA007477 C:T rs268228 A:G
    rs2254137 A:C rs867194 T:C rs166531 T:C
    rs2551645 T:C rs11541908 C:T rs268214 T:C
    3′ Flanking rs2551946 C:A rs741917 C:T Exon rs10497434 T:C
    region rs4234080 C:A rs7862485 G:A Intron rs11888507 C:T
    rs2952768 T:C rs2756894 C:A rs13388308 C:T
    rs2709386 G:A rs2249250 T:G rs3755490 T:C
    rs7591784 G:A rs2295795 G:A rs7578569 G:A
    rs7594560 T:C rs877365 T:C rs7566401 C:A
    rs2737273 G:A rs1153676 C:A
    rs2295797 T:C rs1205399 A:C
    rs2295798 C:T rs2072538 C:T
    rs1534847 A:G rs212361 A:G
    rs7873822 G:T rs212360 T:C
    rs2737274 G:A rs1153685 A:G
    rs10972567 A:C rs12693057 G:A
    rs3763630 C:T rs212347 T:C
    Intron rs10814274 C:T rs212349 T:C
    3′ Flanking rs3750434 G:A rs3845744 A:G
    region rs1570246 G:T rs2302663 G:A
    GA025684 G:C 3′ Flanking rs35507277 T:G
    rs1570248 T:C region rs1153699 G:T
    rs1570249 G:A rs1153700 C:G
    rs34478611 G:A rs7583431 A:C
    rs1322045 A:G rs1153702 T:C
    rs1951432 G:A rs1153711 T:G
    GA025687 A:T
    rs10814275 A:G
    rs10758320 T:C
    rs4878628 C:T
    rs10758321 G:A
    rs10758322 C:T
  • TABLE 6
    CREB5 gene polymorphism
    Gene Major
    polymorphism allele:minor
    Position name allele
    5′ Flanking rs4722778 C:G
    region rs177479 T:C
    rs177480 A:G
    rs11981754 A:G
    rs177486 G:A
    rs177498 C:T
    rs849322 A:G
    rs177505 T:G
    rs2175738 G:A
    Intron rs4719932 A:C
    rs10258745 C:T
    rs1013900 G:T
    rs6955393 G:A
    rs6953880 A:G
    rs17156573 T:C
    rs6960209 C:T
    rs17156577 T:C
    rs7811922 A:C
    rs6973453 T:C
    rs17156579 C:T
    rs1073298 T:C
    rs6961801 C:T
    rs6977728 C:A
    rs6978238 C:T
    rs13230543 C:A
    rs12673465 A:G
    rs10251129 T:C
    rs2391656 T:C
    rs6971345 A:G
    rs17156603 A:G
    rs7806362 C:A
    rs17642145 T:C
    rs10229500 C:T
    rs10243659 C:A
    rs4722785 G:A
    rs16874503 C:T
    rs11772815 G:A
    rs6958133 G:A
    rs16874525 C:T
    rs17715174 G:C
    rs10242868 T:G
    rs12700884 G:A
    rs17156635 G:A
    rs10239606 C:T
    rs16874528 G:A
    rs7799687 C:A
    rs714218 G:A
    rs1860759 A:G
    rs997908 G:A
    rs12112050 C:T
    rs2191827 A:G
    rs4498447 T:C
    rs10254657 G:A
    rs6953524 C:T
    rs10239810 A:G
    rs17156649 G:A
    rs1811248 T:G
    rs887623 T:C
    rs740988 A:G
    rs7794304 T:C
    rs42694 A:G
    rs6952227 G:A
    rs42695 C:T
    rs1029897 T:C
    rs42699 A:C
    rs4722793 C:A
    rs735101 T:C
    rs10233653 G:A
    rs6955105 G:A
    rs2286841 C:A
    rs979915 C:T
    rs7794347 C:T
    rs16874562 G:T
    rs17156685 A:G
    rs174024 C:T
    rs6949786 G:A
    rs7793437 A:G
    rs3757677 T:C
    rs6462085 T:G
    rs17717216 T:C
    rs17156694 G:A
    rs17156699 A:G
    rs177572 T:C
    rs177573 T:C
    rs6977204 A:G
    rs177574 A:G
    rs177576 T:C
    rs177578 G:A
    rs13437706 C:T
    rs177580 C:T
    rs177581 C:T
    rs12666636 C:A
    rs177584 G:A
    rs177585 C:T
    rs177588 G:A
    rs6462088 G:A
    rs7796539 C:T
    rs1859020 A:G
    rs1011384 A:G
    rs6462090 G:T
    rs12671247 T:C
    rs217508 T:C
    rs4719936 G:T
    rs217509 G:T
    rs217510 T:C
    rs17718257 G:A
    rs149591 C:A
    rs1910553 C:A
    rs217517 G:A
    rs217519 G:A
    rs2391668 T:G
    rs4722804 G:T
    rs618776 A:G
    rs217503 C:T
    rs217513 C:T
    rs65264 C:T
    rs441355 G:T
    rs2391670 C:T
    rs2391671 A:G
    rs216708 A:G
    rs11980665 C:T
    rs11980669 C:T
    rs11984308 T:C
    rs160346 G:A
    rs150607 A:G
    rs177594 G:A
    rs6969064 A:G
    rs150610 A:G
    rs216715 T:C
    rs10951197 T:C
    rs12539927 A:G
    rs216720 A:G
    rs17156823 G:A
    rs2078980 G:A
    rs216730 T:G
    rs13228899 G:T
    rs160335 G:A
    rs10951200 G:A
    rs10486588 G:A
    rs216735 G:A
    rs216737 C:T
    rs216743 G:A
    rs216744 A:G
    rs216747 C:T
    rs1976489 A:G
    rs150613 C:T
    rs17156878 G:A
    rs767834 C:G
    rs4722820 G:A
    rs160337 C:A
    rs160338 G:A
    rs1008262 T:C
    rs310353 G:A
    rs310359 T:C
    rs310361 C:T
    rs13233942 A:G
    rs310338 T:C
    rs41273 G:A
    rs1637457 A:G
    rs17156919 G:A
    rs41276 A:G
    rs160375 A:G
    rs917275 A:G
    rs160342 A:G
    rs160343 T:C
    rs41295 C:T
    rs160357 A:G
    rs41298 G:A
    rs41305 G:A
    rs41307 C:T
    rs10228740 A:G
    rs3888613 G:A
    rs41320 C:T
    rs41321 A:G
    rs41322 A:G
    rs7780656 G:T
    rs41327 A:G
    rs42322 T:C
    rs41333 A:G
    rs9655280 A:G
    rs9655281 G:A
    rs4719945 A:G
    rs6945988 A:G
    rs10258405 T:G
    rs10243376 G:A
    rs41334 T:C
    rs10245004 C:T
    rs41339 G:T
    rs982947 C:T
    rs982950 A:G
    rs16874653 A:G
    rs41346 G:T
    rs41348 A:G
    rs9969149 C:T
    rs6968464 G:A
    rs886816 G:A
    rs757980 A:G
    rs41351 G:A
    rs9691873 A:C
    rs17157048 A:C
    rs6462098 T:C
    rs10951201 C:A
    rs13311248 G:C
    rs12540480 T:C
    rs10265166 G:T
    rs7798774 T:C
    rs7799246 T:C
    rs6972081 T:C
    rs7777929 T:C
    rs12533079 T:G
    rs7806547 G:A
    rs6462100 G:A
    rs6979352 C:T
    rs6950574 A:G
    rs4722835 A:C
    rs9648352 A:G
    rs879593 A:C
    rs879591 G:T
    rs2299110 C:T
    rs2237349 C:T
    rs2066979 T:C
    rs10486589 A:G
    rs10486591 G:A
    rs6462103 C:T
    rs721993 C:T
    rs2237351 T:C
    rs740315 G:A
    rs2237353 A:C
    rs2073537 T:C
    rs4722844 G:T
    rs17730621 C:T
    rs2282907 G:A
    rs10238623 G:A
    rs2299116 C:A
    rs2299117 T:C
    rs2237355 A:G
    rs2237360 T:G
    rs2237361 T:C
    rs2237362 T:C
    rs7791555 G:T
    rs2237364 A:G
    rs2282909 T:G
    rs2282910 C:T
    rs2282911 T:C
    rs1544470 A:G
    rs1964240 A:C
    rs17669844 T:C
    rs886750 A:G
    rs12531253 G:A
    rs10951205 A:G
    Exon rs2190305 A:G
    rs3735566 G:A
    3′ Flanking rs11975539 G:A
    region rs6462107 C:T
    rs2190306 T:C
    rs4719955 T:C
    rs10228137 C:A
  • In Table 5 and Table 6, “CREB1” (italic form) indicates a CREB1 subtype gene (a CREB1 gene as a subtype of the cyclic AMP responsive element binding protein (CREB) gene), “CREB3” (italic form) indicates a CREB3 subtype gene (a CREB3 gene as a subtype of the CREB gene), “CREB5” (italic form) indicates a CREB5 subtype gene (a CREB5 gene as a subtype of the CREB gene), and “ATF2” (italic form) indicates an ATF2 subtype gene (an ATF2 gene that is an alias of a CREB2 gene as a subtype of the CREB gene).
  • “Position” means a position on the genome of a cyclic AMP responsive element binding protein gene, and indicates a 5′ flanking region, a 3′ flanking region, intron, and exon.
  • “Gene polymorphism name” is the name of SNP at a position on the genome, and it has been registered in the dbSNP database (which is accessible from the NCBI website dbSNP Short Genetic Variations) (the same shall apply in the present specification). Basically, the ID “rs” is given before four or more digit numbers, so that the type of SNP can be identified.
  • “Major allele” indicates an allele occurring in the majority of the genomes of Japanese healthy subjects, and “minor allele” indicates an allele occurring in the minority of the genomes of Japanese healthy subjects.
  • In the present invention, a method of obtaining gene polymorphism information is as follows, for example.
  • (1) Genomic DNA is purified from a blood specimen collected from a human using the phenol method and the like. At this time, a commercially available genomic DNA extraction kit such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Bio-Sciences KK) or a device may be used.
    (2) Then, the obtained genomic DNA is dissolved in TF buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and the concentration of the obtained solution is adjusted to 100 ng/μl.
    (3) Total genome genotyping is carried out by an infinium assay II method or the like, using iScan system (manufactured by Illumina, San Diego, Calif.), in accordance with the protocols provided by the manufacturer.
    (4) Total genome genotyping data are analyzed using BeadStudio Genotyping module v3.3.7 (Illumina) or the like, and the quality of gene polymorphism data of each sample is evaluated (quality control).
    (5) Based on these total genome genotyping data, gene polymorphism included in the gene regions and flanking regions of a gene of interest are selected, using the annotation information of the name of the gene of interest as a key, and all information regarding such gene polymorphisms is extracted using an output function of BeadStudio Genotyping module v3.3.7 (Illumina) or the like.
  • The present invention provides an oligonucleotide, which contains any one of CREB1 subtype gene polymorphisms (rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560), CREB3 subtype gene polymorphisms (rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322), CREB5 subtype gene polymorphisms (rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs2175738, rs17156579, rs17156603, rs17642145, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs7794304, rs6952227, rs42695, rs1029897, rs4722793, rs10233653, rs6955105, rs17156685, rs17156694, rs17156699, rs177572, rs177573, rs177574, rs177576, rs13437706, rs177580, rs177581, rs12666636, rs177584, rs177585, rs216715, rs10951197, rs160335, rs1008262, rs310353, rs310359, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs41348, rs886816, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs2066979, rs10486591, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137), and ATF2 subtype gene polymorphisms (rs1153711, rs1153702, rs7583431, rs1153699, rs2302663, rs3845744, rs212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174), and which is capable of being specifically hybridized to a DNA fragment containing a gene polymorphism of the cyclic AMP responsive element binding protein gene. The gene polymorphic site is the 51st nucleotide in the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172.
  • It is preferred that the oligonucleotide of the present invention has at least 10 nucleotides, preferably 10 to 150 nucleotides, more preferably 10 to 45 nucleotides, further more preferably 14 to 25 nucleotides.
  • Examples of the oligonucleotide of the present invention include oligonucleotides having a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172 containing the above-mentioned gene polymorphism of the cyclic AMP responsive element binding protein gene or a nucleotide sequence complementary to the nucleotide sequence (Tables 7 to 10).
  • The oligonucleotides of the present invention can be used as a probe or a primer specific to a cyclic AMP responsive element binding protein gene in the detection of cyclic AMP responsive element binding protein gene polymorphism described in the below-mentioned 6.
  • TABLE 7
    Gene
    Gene polymorphism SEQ
    name Position name Sequence ID NO:
    CREB1 5′ Flanking region rs16839837 ATTTAAAGAAGACCAGCAGAAAAATATTTATGAACTTATTTTCAACTTGT  1
    [T/C]CCCATTTTTGAACTTTTTTATCAGTGAAGAAATGGAAACATTTTT
    TCAAT
    rs2360969 ATGAAAAACTGGGGATGAGGGCCAGTCATCTGTATTTCAACAAGTCTTGC  2
    [T/C]GGTGATTCCGATGCACGCCATAGCGTGAGAACCAGTATAGCAATA
    AAACC
    rs10932200 AATAGGGAGAGCAAAAGAGCAAAGAGGTGGTTGTTCGGTGATCAATTTCC  3
    [A/C]CCAGAGTAGTAAGGAAAGGCCTCACAGAAACAGGAGCATTTGAGC
    AAAGA
    rs2253206 ACAAATAATGAGAAGTAGGAATTGGAAAAGAAAGTGATAAGTTACAGTTA  4
    [A/G]GTAGGAGGAATGGGTGACAGAAAAAAATTCCAGGGGAAGGGAAGG
    GCATG
    Intron rs2551640 TTATAATACCTTATACAGTGCCTGCCCATCACTTGACTCTTATGGGTTCA  5
    [A/G]CATAGGAGTCAGCATGCAGCAAATTCAAGCTTTACTTCTGGGACT
    TGGGG
    rs11904814 AAGATAGTGTTGTGCATGTAAAGATCTAAGAACTTGATATTTCTATGAAA  6
    [T/G]CACAATGACTGAGCAATAGTCCTTTGCCTTAGTTTTTATTCCATT
    GAGTG
    rs16839883 CGAGGGATAGTACTTAAGTTTCCAAAGGACCATATATAGGTTTAGGAAAC  7
    [A/G]TCGAATATTACCATTGTTTTGATTGGTTCTAGTTACTTTATAGTT
    TATTT
    rs6740584 GTACTTAAGTTTCCAAAGGACCATATATAGGTTTAGGAAACATCGAATAT  8
    [T/C]ACCATTGTTTTGATTGGTTCTAGTTACTTTATAGTTTATTTTAAA
    ATTTC
    rs3770704 AAAATTTAATTTAAAAATTAGATGATTTATTTGGAAGAAGCATTTTTAGA  9
    [T/C]AGGTGGCAATATCCTCTCTAGACAATTCTCCCTGTAGGGGTCAAG
    CTTTT
    rs2254137 AAACCTTTAACTTAAAATTAGAAGCAAGTCTGATCAAGAAGTCTCAAGCA 10
    [A/C]AGGCTGAGTAGTAATATTTAAGACAACACTGCTTACTAAAGAAAA
    GAGTT
    rs2551645 AGGTCATATGTACTAAAACAGTTTATCCAAAAAGGCCTTTCTAAGACACA 11
    [T/C]TATTTTCAAACTCAAAAGTCAAAAACAAAGAAAAAATTCTTATGG
    AACCA
    3′ Flanking region rs2551946 GTGTTTATGTAATACATATATAATCACTGAAAAATTACTGAATTGTATGA 12
    [A/C]AGTAATGTAAGTGAAAATACTTGTTCTTTAAGTGGTAAGTTAAAG
    TTGTT
    rs4234080 ATTTCTGCAACCCAAATTCCGTGGTCTCCTCATAGGGCACGAGGGCCATT 13
    [A/C]CGCCTGCACCCCGCCCTCTGCTCAGACCTGCCGTGCAAAAGAATC
    CTGGG
    rs2952768 CTCTGTCTCAAAAAAAAAAAAAATAGTGCTTTTTACTTTTATCTGAATGA 14
    [T/C]TGAAATGTCCTTTTCCCAATCCTATGATGCCTGACTGCAAAATAA
    TGGTA
    rs2709386 AACACTGACTTCCTATCACTGACTGTAAATATACAACTGATACATTATCA 15
    [A/G]TTTTCTTGTTATCTTTAACGTGAAAGCAGTATAGAGAGAGTGTGT
    TCAAA
    rs7591784 CTGGCTGTCCAGTCCCCACTCCACACCACAGAGCAACACCTAGCCAAAGA 16
    [A/G]GGTAGGTAAGAAAAGCTAAACACCCAGGGATATGAAACCAGCCTT
    CACAG
    rs7594560 TGGCAATTTTTGAATAAAAAGATTAACTACTAATTCTGAGGCAGTGGAGA 17
    [T/C]TGAGGAGAATAAGAAAGATGGCCAGCACTGCTTGCTTCTCTGGCT
    GTCCA
  • TABLE 8
    Gene
    polymorphism SEQ
    Gene name Position name Sequence ID NO:
    Gene name 5′ rs1243872 AGTCCTCCTGTTCCCTGTGAGAGCACTTCAAGTGCTGGGGCCAG 18
    Flanking GTCTGA[T/G]GCAGCTCTGATTCCTACACAGCAAAGCCTGGCC
    region CAGGTAAGGGGATGGGA
    Gene name rs2145925 GGAGACGCGGTGTGTGTAGGGGCGCTACTAAGATTTGGAGGCTA 19
    CTGGGA[T/C]GGAAGCGGAATAACATAAAAGGGACAGTACAGT
    CAAGGGTACTGGTGGGA
    Gene name rs2025126 GTTGCCAACCTAAGACGACTGTCAGAGAGTCCATGCATTATGGA 20
    CAGAGT[A/G]GCTGGATGGGGACGTGGAAGCACACAGCATCCA
    CCTCTCTGACTGCCTCT
    Gene name rs1885373 CCCCCTCTAACAATAAATTCTCACACCTGGGTCAAGCTCTTCAC 21
    TTTTAG[T/C]GCTACCCTAGGCAGGAGTGTCCCAACCCAATCA
    AGAGCGGTGCCTACCCG
    Gene name rs1885374 AATGTCCTGGTAGCCACAAGGAACTGTGGTAGCTGCTGTCCCAG 22
    CAGCAG[A/C]AGAACGACACTTTGTGAGGCTTAGGTGCTGGCC
    AGGGAGGTGAGGATAAC
    Gene name GA007473 GATAGTATCAAAAAACGGTGAAGAGAGCTGATGAGGCTGTGGGG 23
    ACTGGC[T/C]GGAAGCTGCTGGCAGGGTGGAGTGGGCTGGGGC
    CCCGGCAGATTCAGATC
    Gene name rs2295794 AGCTTTAGGCCCCGCAGATCCCTACAGTTTCTCTCCCACTATGT 24
    TCTGGC[T/C]CAAAGCTGCCTCACGGAAATGCCTCAAGGATTT
    CTACCTTGCAAGCCCGA
    Gene name rs4879926 GAACTTGGACTTTTACATAATATGTGAAAGTCATAAAATATTTT 25
    GATGTA[T/C]GGGTTCAATCTGCAAACATTTATTAAAGATCAG
    CTAGGTGGCAGATTCTA
    Gene name GA007477 CTCCCAGCTGCGTTTTGCACCAGGACCTTGGTGTCCTCCACCAG 26
    CACCTT[T/C]GCAGTCTTCAGGATGCCCTCCCTGAGGGAGGGC
    CCAGCTTAGTCAGATCT
    Gene name rs867194 CATAACCCCATACAGGCCACATGGTAATCCACGGCCCTCTGATT 27
    CCCACA[T/C]TCAAGCATAAAGTGCTCCTCCCCTTCTCCCCAC
    TGTGCTTAACACAATCC
    Gene name rs11541908 GTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGC 28
    AGTGAC[T/C]GTTCAGGAGATGGTGAGTTTGGGCGAGTCCCAG
    AGGACTGCCCTCGGAGA
    Gene name rs741917 TGCCCATCCTCCATTCTGCCACAATGTATGCCCCCCAGCCACAC 29
    TGGTTC[T/C]CCATCCCTCAATACCTCATGCTTGTAATTAGCT
    TCTTGATGGAGTCTGAG
    Gene name rs7862485 CAGAGATACCCAAAGATGAACTGGGCATGGGAGAGGAAAGACAT 30
    ACTAAT[A/G]GAGAAACCATAAGAGGGCATGTGGGAGAGTAAG
    CTCGAACATCTACAGAG
    Gene name rs2756894 ATGTTGGGTCTTAGAGTGAAAAGTATGGCTTACTGTAAGTAGCA 31
    GTAAAA[A/C]GTTTGAGAGCCATATATAAATACACACCTTTGT
    GCACACAAGCAAAGCCT
    Gene name rs2249250 GAGCTTCTTGAAATGTCCCAGTGCTAGGAGGAAGCTGCAAGGTG 32
    AGAGGG[T/G]AAGTCAGACAGAAGAGTGGGGAATGATGCAGGG
    AGAAGTCTGGTAAAGGA
    Gene name rs2295795 CTGGCATTCTTTGACTCCTACGTTCCCCCACCCCCTACCGTCCT 33
    CCTACC[A/G]AGTCACTCAGGAGTCGCTTGCTGGCATCTCCAA
    CTGCCCTCAGGGCATTA
    Gene name rs877365 CCAGCTCCCATTTTCCTACCTCCCTCACAATATGCCCCATGCCT 34
    GGCTCT[T/C]TGCCCACATACCTGCATAATTCTCATTGCCCTG
    GGCAACCTCTCCCAGTA
    Gene name rs2737273 CCTCCCGAAGTGTTAGGATTGCAGGCATGAGCCACCACACCTGG 35
    CCTAAA[A/G]TTATTTTTTAATTGACATAATTTTACATATTCA
    TGAGGTACATAGTGACA
    Gene name rs2295797 ATGGGGAAGAATTTAGCAAAGAGTTTCATATCACAGCTAAGGAA 36
    TTAAGG[T/C]TGGATGCTAACTCTAACGAGAGAGAATTATGGG
    GACACTGGAAAGGTTGA
    Gene name rs2295798 TCAGATTATGCTACCTCATTTGATCCTATCAGTCCTACACGGGG 37
    CAAGTA[T/C]TGTTATCCCAAATCAGAGGTAAATAAAAGATTA
    CAAGAATATTGAACTGA
    Gene name rs1534847 ATGTAGTTCAGTATCTCTGCCCCTACCCCCATCTCTGAAGCAAG 38
    CATGTC[A/G]CTCTTTTTTGAGATTATCTGAAGAATTTTGCTG
    CAGTAGCCAGAGGGAAA
    Gene name rs7873822 TTATCTGGTCAACTCTTGTGTTTTGGAGAAGGGGAAATAGACTC 39
    TGGGAG[T/G]CCAGGAAACATTTTCAAGACAGGCCAGAGAAAG
    GACCCAGTCCCTGTAAC
    Gene name rs2737274 TCTCACCAGAGGCTTCCGTGCTTGAGGAGGAAGGGGGTGTCTAA 40
    GTGTCC[A/G]GAGGAAATGGGGGGAGACATGCAGTTTCAGCTT
    AGTGTGAAGGGTCCTTT
    Gene name rs10972567 ACAAGTATGAGTAGAAGCTAGCTCATTCCTCCTTTGGCCTGAGA 41
    ACTTTG[A/C]TCCCTTTTCCATTGTGTTTGATGGAACAGCAAC
    TCCCCACTGCCGTGTCC
    Gene name rs3763630 GGTCCCTATTTCCCACCTATGTTGTCTGTAAACAACACAGTCCA 42
    GAATCT[T/C]TGTCCCCTAACTGTGGTGGCCACAGCAAGGGCC
    TTGGGCTTAGAGAATGG
    Gene name Intron rs10814274 TTTTTTTAATAGTTTAAAATGGTCTGGCTTGTTAGGGTTAACAC 43
    CTGGTC[T/C]GTGGAGGCATTCAGAAAGAATCTGAATGCCTGT
    TGGTCAGGGAAGCTGTA
    Gene name 3′ rs3750434 AAGGAACATGTACCTCCCAAGATGGAAAGGATTTGGGGGTTCAG 44
    Flanking CAGAGT[A/G]GGATCATCAAATGAATCCCAGTGCAAGTCTACT
    region GACTTTGGTGGGTGGAG
    Gene name rs1570246 ATTCCAGATGCGGGCGCCGGTCGTTGTTAGGTATCGTCCCGGAG 45
    GGCCGG[T/G]CGTTGGGGAAAGCTTAAATGAGCTGGTGTTTCA
    GTGGAGCCGGGGAGCTC
    Gene name GA025684 TTGGCTGGGGAGGCGCTGGAGTGTGTAGTGACCGTCACCAACCC 46
    CCTTCC[C/G]CCCACGGCCACTTCTGCATCCAGGTGGGGATGC
    TGGCACTGAAGGTGGTG
    Gene name rs1570248 TTTAGCCATCTCATGTTAGAATCTAAAACCCTAACCTCTACTCT 47
    CATCTC[T/C]GTTCCCTCTCAGCATTACCTCTCCACTCATTCT
    TTCTCTAGGCCTTCAGG
    Gene name rs1570249 GAGGGTGTAATGGATCCTGATTCCTTATACACACTCCCAGACAT 48
    ACCCAC[A/G]TCTAGCCTCTGACCCGGAACAGTTTCTCAGACC
    TTCAACCTCTTCCTGTT
    Gene name rs34478611 AGTACGCACTATCCCCGTATTTAGTTTGTCTTTCCTGTTTCACA 49
    GCTGGA[A/G]GAAGCCTGGGTATTTTGACACGGGATCATCTGT
    AAGGCCCCATCCTCCCT
    Gene name rs1322045 TGGAGGGGGCACTGGACTGGGCACTTCCCCAGCAAGGAGGCAGG 50
    AGGGGC[A/G]AGGGCCCCCAGGTGGTCCCCAGATCTCTTCCCT
    GACCTGGAGAGAAGGAA
    Gene name rs1951432 CTGGCGCGCAGGTCCCGGAGGGGGCGGCTGGCGCGCACTACACG 51
    CTTGGG[A/G]ACAAGGAAAACATCCGCCGGAGGCCCGGCCGGG
    CGGCGCTCCAGCCTCGG
    Gene name GA025687 GTCGTGGTGTCGCTACGGGCGCGAAACGGACACTGAACACAGTC 52
    TGACTG[A/T]ATGGAGGCAGGTGGGGAGGGATCCCCTGGGAGA
    ACTTGGCGGGCCGAGAG
    Gene name rs10814275 TGCATTGCCTTTGGTCCCAAACAAGCAAATCTGGGTCAATTAAT 53
    GAAAAA[A/G]AAAAGAAAAGAAAAGAAAATGTCTTACTTTGGG
    CCCTGTTGCACTCTCCC
    Gene name rs10758320 TTGGATAACAAATTAACCTCCATTTCCACTGGACAGAGAACTCA 54
    TTCTTC[T/C]GGTATGTTTCAGAAGGCTAATGGAGCAAGGATA
    ACCTTATATTACTAATG
    Gene name rs4878628 TGGCTAGTGTTTTTTGTATCCTGCATAAGAAATCTTCCCTTACA 55
    CCAGGT[T/C]ACAAAGATTTTTTTCCTACATTTTCTCCTATAT
    CTAAAAGTTTTATGATT
    Gene name rs10758321 AGACATCATTAAATTCATCATGGCATTCTTTCTTGCTGAGCCTG 56
    GACATA[A/G]CCTGGTAAGACTAGAACTAGATAATAGGAAAAG
    AAATGTAGACATTAAGT
    Gene name rs10758322 TGGGAGAGGCTGGCATCAAATTACTCCTCTGTTTTTCTCTCTTG 57
    GTGACC[T/C]AGCAGGTGTTTAGGACAATGACGACTACTCATG
    TGGAACCTTTGCAGTCA
  • TABLE 9
    Gene SEQ Gene SEQ
    Gene polymorphism ID polymorphism ID
    name Position name Sequence NO: Position name Sequence NO:
    CRE 5′ rs4722778 AATCACCATTTTATGTGAAC 58 Intron rs177584 GGGTGACGTAAGGGGGTGCA 100
    B5 Flanking AAATTGAAGTCTTTATAGCA GAGATTCCCACTTGGGTTTA
    region TTCTTAATTT[C/G]GTTTC TGCTGGCCTC[A/G]TCTTT
    TGAAAGACATTTAGATAATT GACTGGCTCTGTCATGTTGC
    GGGCAATTTAACAAAAGAGT CCTTGTGGGGTCCTGTTTTC
    ATGTTC ATTAA
    rs177479 CAAGTTTCATCCACGTTGTA 59 rs177585 TTTTGCACGGTAAATGCTTC 101
    GCGTGTATCAAAACTTCAAT GTAAACGTCAGCTATTCATT
    TAATATTCTT[T/C]TATAT AGTGAGGTGT[T/C]GGGGA
    GGGTATGTTACATTTTGTTT GTTGTCGGGGGAAGAGAGAG
    ATCCATTCATCAGTTGGTAG GAGAAAGAAGGAAGTGAGAG
    ACATG GGGAG
    rs177480 GCTGCTGTGGACATTTGCAT 60 rs216715 AAAAAGAAAGAGCCAGCCTT 102
    ACAAGTTTTTTTGTGTGGAA TAAGGAAACGGGAAGTCAAA
    ATATGTTTTC[A/G]ATTCT GCTTGTGTAA[T/C]GAAGC
    CTTGGGAATATACCTAGGAC AAGACCAGACTTTTTAAATC
    TGGAATGGGTCATTTGGAAA TACCTCCCTTAACCTTTATA
    CTACG AACAT
    rs11981754 ATTCAAAAATAACAGGATTG 61 rs10951197 ATGGTGCTACATAGGCTGGC 103
    TGAAATATCCAACTAAAATC TTAACATCTTTTTTTGAAAT
    ATATTTGAAA[A/G]TGGTC AAAAACCAAG[T/C]GTAAA
    CAGGAATCCCCAAATAACTT CATGAGTCAGAATGACAGGG
    TTATGCATGTTATATGAAGA CATATGCAGGACTCCAACAT
    TAAAT TTACT
    rs177486 CCTTCCTTTCAGCATGCAGA 62 rs160335 TGAATTTGATGCTGTTCTCT 104
    ATTGAACTTGGCTCTGAAGT TGGTCTTTTTCACAACTGAA
    AAAACAATAC[A/G]GGTTT ACATTGGGCC[A/G]TTGGT
    TTGAGTGATCCAGCAGCTGT GGGACGTTCTGTGCCTTGAA
    TCTACTTTGGTGAGAGTTTT ACTTTTAATACGTGCAGCTC
    CTTCT CATCT
    rs177498 GTCCTCAATTACATCTTTGT 63 rs1008262 GTCTTCTCCCCAAGAGGCCA 105
    GAGAATCAAATGTGATAAGG CCTTTTTGACCAGGTGACTC
    CATAACACTC[T/C]TGGCA TCCTCAGTGA[T/C]GATAT
    TGGTGGCTTTAGATATTAAC GGTGCAATTTTTATGAGATT
    AACTCTTGCTATGTTGGTTG TTGGGATGTGAAGCAGCTCT
    TGCTT GTAGA
    rs2175738 ATTAGTTTCTGGCTATTGCA 64 rs310353 TGCTAACAGTGCCCTTGGGG 106
    GCTAATTCTCGGGTAAAGAA AATGTTTGGAGGGACTTGAT
    TTTGAATGGC[A/G]TTCTA TCCAGATCAG[A/G]AAAGA
    GTATTGCATTTTACCTAGAC TAAACAGTGATCTGGAGGGT
    TACACTGTTACAGAATTGTG CTGGTTTAGATGCAAGTCAT
    TGTAG ATTTC
    Intron rs17156579 TATCACAGGGTTCTTTGTTG 65 rs310359 CACCCTTTACATACCTGTGT 107
    GCTATTTATTGACCCATCTT CCCTGGATCTTCCTTTCTCC
    CTCTCAGGCA[T/C]GTATA ATGGTCCTCA[T/C]AGCCT
    TTCTCTGGGCAAGTATAGAC CTCTTCTTTTACACTTACCT
    TCACAAGTGCCTGGAGTCCC CTCCTTGAGCTCCCTGATGT
    TCCTC GCCTT
    rs17156603 ATCAGTACATCAAACAACTC 66 rs41273 TGGTTCTGACAAGAAAAAGA 108
    AATTAACAAATGCTTGCATC AAGTATTCATATTTGGTGGA
    TGCAATGTTC[A/G]TTATA CGTGGTGGTA[A/G]GTAAA
    ATACAGCATCATAGTTGCAG CTACTAATTTGTAAACATTG
    AATTAAAATGGCAAGATTAT GAAATTTTTACTTTAAGTGA
    AAAAC GAGCA
    rs17642145 GGAAGTAGGACCACCATCGG 67 rs1637457 AGCTGTTGAGCACACTCGCC 109
    CCCATACAACTTAAGTCCAA TGTGGTTGACAGGACTCTGG
    TATATAGACT[T/C]TTAAC CACAAGTGCC[A/G]TGGAG
    CTATGTCAGTGTGAATAGTT GATGATGTTAGAGAGGTGGA
    GCCTGCTTGACCAGGGACTT CACATGGGGTCAGAAGAGGA
    TAATT AGGAG
    rs10029500 TCCAGTCAGATGACTATTTG 68 rs17156919 ATTCACCGCATACATTCACG 110
    TTCAAATATTTATTCTACTA CAAAGGGGAAAATTTACTGC
    CATGACACAC[T/C]GTGCT CTAAACAGAG[A/G]GACCT
    GGACACTTCAGAGATAGCTG AAATCCCCCAGGCTAAATAA
    TGAGTTTTGCTTCCTGTGTG ACCCAATGGAAACACAAGAA
    GTAGC CTGCA
    rs10243659 GTGGGATGCAGGACAAAGTG 69 rs41276 TAAAAAGGTTTCTTCAAATG 111
    TTTACTTTTGTCTTTCAGAG AAAAATGGATGGCTGAGCTG
    TCAAAATGGG[A/C]AAGGT CTAATGGCCC[A/G]GTAAC
    TAACACAAGGAGTAAACTAA CTAAAAATTTAACTCTTCCC
    GAAAATATATCCATATCCAT TAATGCTCAGGGACCTCAGG
    ATTCA TAAGG
    rs4722785 AACTGGCTTCAGCCAATTAC 70 rs160375 TTTTTGTCCTTTATTATTTT 112
    TATACCTGTTTCCTCTGGCT TTGAATTACTTTGCTTTATT
    ATAGTGATTG[A/G]TTCAG TTTCATGTGT[A/G]AAAAC
    GGAGAGGCCCTTAATCTAGT ACCATATGGTGGCCACAGTG
    AGCTGTTGAGATGGAAAAAA GGAAGCCAGGTCCTCTGCAC
    AAACA TAAGA
    rs16874503 GAGATAGTTCCTATTCAGGA 71 rs917275 ATAGGAGGTTAGGTATGGTT 113
    CACACACCCAGTGCTTGCAG CTGACATTGCAATATTCTCT
    ATCCATACTG[T/C]TAGAC TCAAGTTAAC[A/G]GCAGG
    TACGTGAAGGAGGAAGAAAG CATTTGTTACATGCTCAGAG
    ATGTTTGCAAAGGAGCCAAG AATTTTATGATTTATAAAGA
    GGGGA ACTTT
    rs11772815 ATCCATACTGCTAGACTACG 72 rs41348 TTCATTTACGTTATCAACTT 114
    TGAAGGAGGAAGAAAGATGT AATTAATTTATTTATAAAAT
    TTGCAAAGGA[A/G]CCAAG TTCCATGACC[A/G]TAGGA
    GGGGAAAGCAGGTTGCCTGC TGACCACGTAGAAGTGTGGA
    ACCAAGATCAGACTGTCTCT CTATGGATCACTAGCATCAA
    TGTGT AATCT
    rs6958133 GATGTTTGCAAAGGAGCCAA 73 rs886816 CAGGAAAGCCATCTTTACAT 115
    GGGGGAAAGCAGGTTGCCTG CACCTCTATTTAAAGCACAG
    CACCAAGATC[A/G]GACTG GGTCCCTTTT[A/G]CCTAT
    TCTCTTGTGTTCTTTGATAA GTCACTGAAAAACAGCAGAA
    CTCTGAGATTTTCCTTTCCT GCCTGGTATCTAGTGGATTC
    ATTCC ACCCC
    rs16874525 CTTTCTTCCCATCTATTAAT 74 rs17157048 ATGCAATCTGATTTATTTCC 116
    GAGCATGAACTACATCCTGG ATGGATTCTGAGCTAGGAAT
    CCTTTAATCA[T/C]TGATA CGCAATTGGG[A/C]ATCTC
    TCATTTCATATATACTTTTT CAGAACCAATGGGGATTTTT
    CATTATCCTCATCTCTCCTT GCTGTAGGACCATCGTTCTT
    TGCTT TTCTG
    rs17715174 CATTTTTCATAGAGTCTTTG 75 rs6462098 TTTTCCAAAGCAGCTTAATG 117
    GCATTGGGTTGGACAATGAT TAGAACAATAGGGCCAAGAA
    GGAAATTAGT[C/G]AGTTT GGGGTTTTTT[T/C]GCTCT
    TACTCAGACAAGGTCCCTTC GAAAAATACCGAGTCCCCTG
    CTTTGAGGAATTTATCCTCC CCCAAGAGCTCCAGTGCCTC
    ATAAT CCTCC
    rs6953524 TGGTATTTCCAGGGAAGAAT 76 rs10951201 CCCCAAATACCACATTTGTT 118
    ACATTAGTAATGCAGGCTTG TGCAAGTAGGAATAGGACTG
    GGTAACCACT[T/C]GCAGC TCTGAGGAAT[A/C]ATTTG
    TCACCTCACTACTGAGCAAT AGAAACTGAGCCAGTCACTC
    GACGTGGAATTGGAGCTGGT TCTTTGGCAACATGCAGGGC
    ATCAC CACCA
    rs10239810 ATCAGAGCCTGAGCCAATAA 77 rs13311248 TTGTGTGCCAAGCTCAGTGC 119
    TATGAGCTGTCTTCTTGGAT TCTCAAATATTCTCCCTTCA
    AGCTTGGGCT[A/G]GGCTC GCCTAGAAGA[C/G]AGACT
    CACAACAGAAGAAGCTGGGG GGTACCTGCTGTAAGGGGTC
    CAAATTGGCTCTGTTGCTGA TGGCATGGAGAGAAAGCCGG
    GACCT CTTCC
    rs17156649 TTCTGGCAGTGTGAACTTCA 78 rs12540480 TATTTTCTACAGCAGATCAC 120
    ATGGCCCACATAATTTTTTT TCATCTCTTAAATAGATTAT
    GACCTAATGT[A/G]TAAAC GCATTGATCG[T/C]CTTCA
    ATTTTACCTCATGTGTAGAA AAGGGCTAAGCACACTCAAA
    ATAGGGACAATGGTACTACC ATATTCTCTAAAGTCATTCT
    TCGTG CATGC
    rs1811248 ATCCTCATTTTAAAGGGAAG 79 rs10265166 TCCCTAGAAAGCAAGTCAGA 121
    GAAACCAATGAGAGTGAAAT CAGGGACAAGTCTATTTTTT
    TTAAGAAACA[T/G]ATCAG AAGAGCCCAA[T/G]AAGAG
    ATTATTGGGAAATGGAGTAT GAAATTTCAAAATCTCTATT
    TCTTCCCAGAGCTCCTCAAA AGCCATTTAATTGTTTTACA
    ATATC CTATT
    rs887623 GAGTACCCCTTAACTCAGTG 80 rs7798774 CATCATTATCTGCCAGCCTT 122
    AGGTAGACACCCAAAAGCAA CTCTAATGTCTCCCCCATGG
    CCATCCTGCA[T/C]TTTTT GCTAAAGAAG[T/C]CTTAT
    TCCGTGAGCATTAATAAAGT TTCCTTTACTTTTCCCATTA
    CTATTGTTCATTGTAGAATG AGTCTTCCCTTCCGGCTTTT
    TTCTG TAGTA
    rs740988 TCCCATCTTTCTCACCATTA 81 rs7799246 TCAGCCTTGTTAGGCAATGC 123
    ACATGTACACATTATGCCTA CCCTTTCCTTGTTCATGTTT
    ACACGAATCC[A/G]CCAAT CCTTGGAGAA[T/C]AAGTG
    CCCTTGCAGCCACTGGCATG ATCCTCTCAGCACGCTATCA
    CTCATTGGTCTCTGCCTCCA CTTTATCATTAAGAATAGAA
    GACCC CTTGA
    rs7794304 TCCTTGCTTACTTCTTTCTC 82 rs6972081 TTGGTTAATAAATGAATCAA 124
    AATCACGCATAATGCCTCAA GCTGACTGCATGACTAATTC
    CTCTTAGAGC[T/C]GGCAT AGATTAATGG[T/C]GCAGA
    TTGTTGTATCAGTCCTAATA AATCAGTCACTAAAGAAGCC
    ACTCTTGAGGTATCTCTGAA AAAAAAAGTTTGCTTTAATA
    ATCAG GTCTT
    rs6952227 TAAAGACTTGGAAAGTGTCA 83 rs12533079 GCTTGACAGTAAGATTTGGT 125
    CATTGTAGTACAGTGGGGTT TCGGAACATGAGCTCATTCA
    TTCTCCTGAT[A/G]GCTAC CAAAAAGATA[T/G]GGGTA
    AATTTACATGCCAGGAGCCC ATAAGACGTCTTTTAAAAAT
    TGTAAGCCCTCTAGCATTTT ATGGGTCAGGCAGCTTTCTC
    CTTGA GTGTT
    rs42695 CATAATTTTATCAAAATTTT 84 rs7806547 CTTCAAGAGTCTTTGAGATG 126
    TTTCACATACGTTGGCATGG CCTATAGGCTCATCTGTTCA
    TCTTCAGACC[T/C]GTGGT TTACAAGATG[A/G]TGAAA
    AATAATCACACCTCTCTTAA TGGAGAGCCTGAAAGTTAAG
    CGGGTGGCGTGCTGATCAAA AGTCTTTTCCCCCAGTCAAT
    TAAGT AACTT
    rs1029897 CTGTTGAGTGTTCAAGTCTG 85 rs6462100 CAGATCTTCTGAAGACCTGA 127
    ATTTGGCTTCACCAAGAATA GAAAGGACAGCAGGGTGGAG
    GAACAATGTT[T/C]CTAAA AGACCCCTTC[A/G]CACCT
    AAGTTTGTCATGAAGAGAAG TCCAGACGAAAGCACTGGCC
    CCCATTTAGAAATTCATCCT TGAGGATAGGCTTGCCCAAG
    CTAAC GGCAA
    rs4722793 GGGAGGTGTATTAACTTTTG 86 rs6979352 ACCCCTAGACAGGAAAACAT 128
    CCTATGGAGCTAGTAACAGG CCTTCGGGGGGAAAAATGAG
    TAGAACCGGG[A/C]TTCTT GACATGAAAT[T/C]GCTTG
    TTTTTTCATCATTTTTTATT CTGCGGTGCCTATCATTCTG
    ATGTAAAATATATATAACAA TTAAGGACAGTGAAAACACA
    AATTT GTCTG
    rs10233653 AAGTTCAGAGTAACTTCCCA 87 rs6950574 TATTCAGAATCCAAACATAT 129
    GATTTTAAATATTCTGTGTC AGGGATCTCAAATAATCCTT
    ATGTAAGAAC[A/G]AGGAG TCCCTTCTAT[A/G]CACTA
    GAATCGCTGATCAATTAGGT CTAATTAGCTTGATCGATAT
    TTAAAAGCTACTGAAATTCT CATTAGGAAATTATTATTAT
    CAAGA AATCC
    rs6955105 CGGCTGTCAAATCTCTTGCT 88 rs4722835 ACATTAAGACCGGAGGATAT 130
    GTCTGCTGCCTTTCCTCTCA CAACAAATTTGGTTGACTGA
    GCATGTGAGC[A/G]TGGAG GCCACATCCT[A/C]TACCT
    CTGGGGGTCTGGTGGATCCT ATCTGACTCAGTCTATCCAC
    GTCAATCATATGTCTGTGGG CTGTGAAGGAGACTTTAAGA
    CAGCA CCTAG
    rs17156685 TTTATCATATGTATCTCCAG 89 rs2066979 TGGTGAATGAAAGGCAGTGC 131
    CTTGCACCTCTCTCCTTGGC AGAGACTGCCTCTCTTTTTG
    AATGGCCTTC[A/G]CTGCA AGGATGTTTG[T/C]TACAG
    CCTTTGACATTTTCCAACTG AGCCTTGGTGTCAGATAATC
    CGCCTTTGACATTTTCCTCT ATGTAACAAGCACTGGATTG
    AGATG GCAAG
    rs17156694 CTCAGACTTTCTTTGATGGA 90 rs10486591 GGATTCATTTTCTGAAGAAT 132
    GCCAGCCTCCTTGAAAGCAG TAAGTCAACAGACATGGCTT
    TTATTTTTAG[A/G]TGTTC CACAATGCAC[A/G]TATTG
    CAACAGCCATCTATCTTACA GATTCCTTTTGGGGGTCAGA
    AAAGGATTTTCTCTTCAGAT GCAGACTCAGAGCTCTGAGA
    AGGCT GGCTT
    rs17156699 AGAGGAGCTCAGTCAATGGT 91 rs721993 GAGAGCCTCAGCTTCCCAGT 133
    GAGATCGAATCTTTGGACCT TGCTTGCTGGACCCTAAAGC
    CCTTTGGACC[A/G]CCGGA TGTAAGAACT[T/C]TGTGA
    ATGAAATCACACGTTCCCTA AACTTGAATGTTTCTTTTTT
    CAATAACAAGAGAAGCTGTT TAACCAAGGTAAGGAATTTA
    ATTTT ATGCC
    rs177572 CTCACCTTATTTCCATGATG 92 rs2237351 GGAGGTACCTTCATCCTTGA 134
    CTTGGTTGTCAGTGAACGCA GAAGAGAGACTTCAGTATCT
    GATATTGGAG[T/C]TAAGG GTGGAACAAG[T/C]GAAGC
    CCAGTGTTTGTCCCAGGGCC TAGAACTTGGCATCGGAGCA
    CCAGATCCAACTGGAGTGAA TAGTGCTGAGCAAAGAAGCC
    TATTA TCTAC
    rs177573 TTTCTATGGGTGCTATTAAG 93 rs3735566 TCTCTTAAACTCCCTCCACT 135
    CATATAAAATTTTTTTTCAA CAACACAACTGATACCTTTC
    AAGGACTGAG[T/C]TGAGT ATTATCTCCT[A/G]TAGTG
    TGGTATGCCACTGTGAACAG TCTGTGGCATTGGTATTCTA
    TAACTTCATCACTTGGAAGA AAGGAGAAAACTAGAATCTA
    TCCGA ATGAG
    rs177574 ATTTCCTCATGGTAGCATTT 94 rs11975539 TTGTTGTTTTTGTTGCCACC 136
    GAACCAAGCCTTTAAGTAGA ACAAGAGCAAAGGTATTTCC
    ACAAGATTTT[A/G]CTAAA TATTTTGTTT[A/G]AATTT
    CATAGAAGGCAGAAAGGGCA GTCACTAAGATCTAAAACAG
    CTGCTGACTAGCTATTTGAA TGGACACACAATGGGCACAC
    GAAAA AACAA
    rs177576 TCATTGGTGGATCTGGAGAG 95 rs6462107 ATGCCTCCAGGCTTATGTTC 137
    TAGCTGACCTGAAAACAGTC TTAGTCTAATACTCAGCCCT
    TTCATCTTTC[T/C]GCCAA TAGCTCACAA[T/C]GGAAT
    AATAATTTTAACACTTAAAA CATCAATCCCAGCAACTAGA
    AAAATTTTTTTGAGAAGGTA TATTGGGACAGGGAACCTAG
    CTAGA AGAGT
    rs13437706 CTGAGACACAGTGGGCCTTG 96 rs2190306 TTGATAACCTAGTTTAGTAT 138
    GAAATGGCAGTTCCCATAGG CCTATGAGTGCCTTAAATAC
    GAGTCCTGCA[T/C]GAGCC AGAGGATGCT[T/C]AATGA
    ATGAAGGCGAGAAGCCAAGG AAATTTATAGACTGCCCGCT
    CTTTGCATGCTATGCTTTGG CAGCAGCTCACTGGGATTG
    GTGTG AATAT
    rs177580 TGCAGATCTGATGACAGTAC 97 rs4719955 ATCTGCACATGCCAGTGGTC 139
    ATCCACACCCTGTCGCTTTC TGAATAACAGAAGGAGTCCT
    CCTGCCAAGA[T/C]GAACT TCCAAGGCCA[T/C]CCTGA
    GTAGCCGTCAGAGCCTCCAT CCTGCAGCCATGTTGGTGTA
    TCTGCTCCCCACACCCATCC GGAACTGTCTCCAGGGAGCC
    AGTGA AAAGT
    rs177581 TGACAGTACATCCACACCCT 98 rs10228137 CTAGAAAATATCCGTCTCTT 140
    GTCGCTTTCCCTGCCAAGAC GTTCTAGCAGCCATAGGTAA
    GAACTGTAGC[T/C]GTCAG ATGACAATGG[A/C]GACGC
    AGCCTCCATTCTGCTCCCCA TACTGAAAAATCACAACTCG
    CACCCATCCAGTGACCATCC TGTGTTCTAAAATGACCACA
    ACTAA AAGGG
    rs1266 TCTTCTGCACTCCAGCCTCT
    CCCTCTACTTCCCTCCTTTT
    TGCTTCAGCC[A/C]GAGGC
    AGATGGCAGACATGGATACA
    CATTTATGGATTGGCTGATG
    TGTCT
  • TABLE 10
    Gene
    polymorphism SEQ
    Gene name Position name Sequence ID NO:
    ATF2 5′ rs268174 ACGCGTGTATGTTTTACAATATACATCTCTCATAATATCAACTGAAGCAA[T/C] 141
    Flanking ATTTAATGTTTCAGTCTACCACAGATCATTTATTTTCTAGCAAATGTCTT
    region rs13030474 ACATGTGAGTTGAAGTTACTCCATGAAGCCCCTAAGAATGTGCAGAAAAG[T/G] 142
    GATTGATTCAAATGGATCATTCTTTCTTTTCCATTACCTTTTTTTTTTCC
    rs268237 TGGACTGACTTATATAAAAAATTAGAGAAAAATACAAATTAGTACACATT[T/C] 143
    CAGGACAAAGTTGTGTGATGCACTAAGGGAAATCGCATTAGAAAAGAGAT
    rs1982235 TGAGGAGGAAGCAAGAAAGAAGCCAAGATCCACAGTGGCTGCTTCCAAGT[T/G] 144
    GCATATGGACTAGTTGCTTGTGGCAGGGAGAGACATGGGTTCCGAATCCC
    rs10497435 AAATAGAGATAATTCACGTGTACTGTTCAACAAGCAATTATTCATATAGT[T/C] 145
    TCTCAAGTACTCAATTCTAACCAAGAACATGGTGTCCTGTGGTGTCTACA
    rs268231 GTAATTCTAACAAATGGCTAATGGAAGTGATATCAACACGTCAACATAAA[A/C] 146
    GATTAAACATCTAGAATGCCCTGCTAAGAAGATGGCTGGGGACTGAACTC
    rs268230 GAAAGAAGGGTCATTCACTACTTAACAGGAAACTAGGGTCCCCAGCAAAG[A/C] 147
    GAAGATATTTATTTCAAGGAACCTGGAAAATGGTTCCAGAAGTATGGCTA
    rs268229 ACAAAAAGAAAAACTGTAGATTCACCCCGGCAGAGAGGACTAAACAGATT[A/G] 148
    ACTTTTGATATGAGTTGGCTGCAGGATAGTGGGCCTTTTTCTTCACGTTG
    rs268228 CCCTGTGCCCTCCACTTACCTTCCCAGGAGGCGGCGGCGGCACGGGCTGC[A/G] 149
    GCAGAGGTCGAAGGAGTGGGACTCAATGCGCAAGCGCGGTCCGGCTCTTA
    rs166531 GGTGAGCTCCGGAAAGGCTGCTAGAGGGAAAGCAGGATGGGTCCTCCGAG[T/C] 150
    CCAGCCCCAGGAGCCGGGTGTCTCCGTTTCCGTCACTTCCCAGCACTAGG
    rs268214 TTCTGGAGGGGGCGGGACCAGAGGGCCCAAGGAGCGTTACTTCTGTAAAC[T/C] 151
    CGGAGCTGTGGAAGACTGTGATTGGCTGTCGGCTGGAGGAGGGCGCGGGT
    Exon rs10497434 TTCTAGCTGGTGGGCCATGAGCTTTATTTACTCTGCTTCCAGGAATACCT[T/C] 152
    AGCTGTTATCAATAAGCAGTCCTTTCTCAAGTTTCCATCTAGTACCCTTA
    Intron rs11888507 CCCCTCTTAAAGAGCTTGATCTGCCAACATTGGAGAAAAGGGCAATCCTA[T/C] 153
    ATATCCATGATCCTGACATACCTGCCTCAGGTAAACTAGGGGAGATACTG
    rs13388308 TTTCCCTCCTCCTATCCCACCATGGGCTGGATTCTTCATTTCACATCCTA[T/C] 154
    AAAAACTCAGCATAATTTCCAGGTTTGAAATGGCAACTTTCTCTCTGTCT
    rs3755490 AAATTGCATTTTTCATAATTTTGTTCATAAATGAAGTTTCAAGAATGTCA[T/C] 155
    GCTCAGAAAAATTTGGTAATTCTTGTGGGGAAATGTGTAACTAGCCAAAG
    rs7578569 ATAAATTTGGGAAATGTTGAATGTGTAGGCTTCATTTCACAGGACTTTTC[A/G] 156
    TGACCTTAATGTTATGTCAATTAAGGATTCATAACTTTAAAAAATGCCCC
    rs7566401 ATACTTTCTAAAGCTCAGTTGCACTATTGAAGAAAAAGCAGAATTTCTTG[A/C] 157
    CAAAAGTTTCCTGGGTTTTTTTTCATCCTAACTCTAAAATTTTACAGAAT
    rs1153676 GAAGGTAACTGTTAATAATCCAAACAAAAGATGATGATGGTTTGGGCTTA[A/C] 158
    GTGGTGTCACTGAACACAGACATAGAGGATGAGATTCAGGTCTGATAAAA
    rs1205399 GCACTCCAGCCTGAGTGACAAAGAGAAAGACTGTCCAAAAACAACAACAA[A/C] 159
    AAAAAAAGAATTACAGTCAGGTGCAGTGACTCACGCCTGTAATCCCAACA
    rs2072538 TTAGGTTTTCCCTGTCCCCAGTAAGCAGATCTAGTTCTCTTTTGCTGTTG[T/C] 160
    AGGTTTGCCAGTTAATTATTGGATTGTACTGGACTCACATTCAGAGCATG
    rs212361 ACAAGATACAGTTATGTAAATACCTATGCTTAGGTGGCAATCTAAAACTT[A/G] 161
    TTTATATGTGTTTCTTTGATTGAAAACTTTTGCTTTTTAATGCCAATGCT
    rs212360 GAAGCTTAATTTCTGCTACTCAGAGTTACATTTGTATATTTTTATGCCTA[T/C] 162
    CAAGGATTGGAGGCTTCTTAGAAGTGTATACTGCTCCTTCTCTCCCCATG
    rs1153685 CTTATTTCAGTTGCTTTTCATAATAGTACTTATTCTATCAGTTTGACGGA[A/G] 163
    AAACAAAGGCTTAGGAAGATTCTTAGTAAAAGCTTCAAATGTAAGTATTA
    rs12693057 ATTAGAAGCACAGTCTCCATTTTTAAAGTAGCAGCTCAGTTCACTCTGAC[A/G] 164
    GTATTTCACTGACGTAGCCTAAGGCTATAGGTAATGGAACATTACTCACT
    rs212347 TCTTATCAAAAAAGAAGGACATTACAAAAAGGAAAAGGCACAATTAACCT[T/C] 165
    TAAAATGCTGAAAACAAAAGAATCTCATTCTTTGGGAAAACATTTAGCAG
    rs212349 ACGGAATCTTTTAAATTAAAAAATATTGCCCATTCTGATGAAACTGCTTA[T/C] 166
    AATGACTACAAGTAAAGATGGTGGCCATTAAGTTTTATCGTGAGCACCTG
    rs3845744 CCAGTTTTAGCACTGAAAGTCCTGCTTCCTAAGAAGACCCCTCAGTCGTG[A/G] 167
    GAAAACCATGACAGTTAGTCACCCCAACAGTTAAGTAATATAAAACCTGA
    rs2302663 TTATCAGCAGCTGGGTGGAAAAAAGAAAAATTATTCATTTTCCTAAAATC[A/G] 168
    GTAAGAATGCACCAGTATGCTGAGGCAATACACAGAGTAAAAAGTTAGAA
    3′ rs1153699 GTGGGTTTGATTCTTGTCCTAGTCTAGCCTCAGTTTTGGGCAGGCACTGC[T/G] 169
    Flanking TTGGGGTGGGGCTTTCTCAAATATCCTGCCCCTTTTCCAGTAGCAGGAAA
    region rs7583431 ATCCTTTCTGTGTGTCTCCTCTTGTGGCTACACTTGACGGGCCATATTAT[A/C] 170
    AAAGAATACAAAACAATAGTACAGACAGGTAAATGTTTATGCCTAGAAAT
    rs1153702 TGTTGTTCATATTTTAAAAAAATTCTTAGCCATTATCTCTTCAAATAACA[T/C] 171
    GTTTGCCAAGTTCTCAATATGATATTGTTCCATAGATCTTGGATGCTGTG
    rs1153711 TGTGTGTCTTGCAGCAGCTGGATGAAGGTTCTGTAAATGTATGCTACGTC[T/G] 172
    GTTGAGTCCATGGTGTAGTTTAAGTCTGATAATTTTTGTTGATTTTTTTT
  • In Table 7 to Table 10 (SEQ ID NOS: 1 to 172), 101 nucleotides are shown, and a gene polymorphic site is shown at the 51st nucleotide. For example, one represented by “A/G” means a gene polymorphism associated with transitions between “A” and “G”, and “C/T” means a gene polymorphism associated with transitions between “C” and “T”.
  • 3. Haplotype Analysis
  • In the present invention, by using SNP among the above-mentioned gene polymorphisms, a haplotype can be constructed. The SNP to become a target of a haplotype analysis may be any as long as its gene polymorphism frequency is 0.5% or higher, preferably, those with a gene polymorphism frequency of 1%, more preferably those with a gene polymorphism frequency of 5% or higher can be selected. Further, SNP to become a target of a haplotype analysis may be a full or partial sequence thereof.
  • The haplotype analysis can be carried out using various computer programs, and for example, Haploview (available from the following website: Broad Institute) (the same shall apply hereafter); Barrett J C, Fry B, Mailer J, Daly M J. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005 Jan. 15 [PubMed ID: 15297300] Whitehead Institute for Biomedical Research Cambridge, Mass. 02142, USA.) can be used.
  • As an example of the haplotype analysis, among cyclic AMP responsive element binding protein gene polymorphisms in Japanese healthy subjects found as in the above-mentioned 2, with regard to the 17 sites of SNPs which are CREB1 subtype gene polymorphisms, the 40 sites of SNPs which are CREB3 subtype gene polymorphisms, the 64 sites of SNPs which are CREB5 subtype gene polymorphisms, and the 31 sites of SNPs which are ATF2 subtype gene polymorphisms, a haplotype was estimated for each linkage disequilibrium block (haplotype block), using Haploview. The estimated haplotypes are shown in Tables 11 to 14. It is to be noted that the “Tag” shown in the tables indicates a Tag SNP that is a typical gene polymorphism in the linkage disequilibrium block.
  • TABLE 11
    Gene name CREB1
    Linkage disequilibrium block No.
    1
    Gene polymorphism name ()
    1 2 3 12 13 17
    Haplotype No. Tag Tag Tag 4 5 6 8 9 10 11 Tag Tag 14 15 16 Tag
    H1 C C C A G G G T C C C C C C A A T
    H2 C C A G A T A C T A T C C T G G T
    H3 C T C A G G A T T C C C C C A A T
    H4 T C A G A T A C T A T C A T G G C
    H5 C C A G A T A C T A T A C C A A T
    H6 T C A G A T A C T A T C C T G G T
    H7 T C A G A T A C T A T C A T G G T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560
  • TABLE 12
    Gene name CREB3
    Linkage disequilibrium block No.
    1
    Gene polymorphism name ()
    1 2 3 9 11
    Haplotype No. Tag Tag Tag 4 5 6 7 8 Tag 10 Tag 12 13 14 15 16 17 18 19 20 21 22 23 24
    H1 G C G T A T T T C T C C G C T G T G T C A G G A
    H2 G C G T A T T T T T C C G C T G T G T C A G G A
    H3 T T A T A T C T C T T C G A G A C A C C G T G C
    H4 T T A T A T C T C T C C G A G A C A C C G T G C
    H5 T C G C C C C C C T C C A A G G C A T C A T A C
    H6 T T G T A T C T C C C T G A T G C G T C A G G C
    H7 T C A T A T C T C T T C G A G A C A C C G T G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    2
    Gene polymorphism name ()
    25 26 29 36 38 39
    Haplotype No. Tag Tag 27 28 Tag 30 31 32 33 34 35 Tag 37 Tag Tag 40
    H8 C C G G G C G G G A T A C C G C
    H9 C T A T G T A G A G A A T C A T
    H10 T C G G C T G A A G A A T C G C
    H11 C T A G G T A G A G A A T C G T
    H12 C C G G C T G A A G A A T C G C
    H13 C T A T G T A G A G A G T C A T
    H14 C C G G G C G G G A T A C T G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322
  • TABLE 13
    Gene name CREB5
    Linkage disequilibrium block No.
    1 5 6 9 10
    Gene polymorphism name ()
    1 2 5 6 7 8 9 11 13 14 15 16 17 18
    Haplotype (H) No. Tag Tag 3 4 Tag Tag H No. Tag Tag Tag 10 Tag 12 H No. Tag Tag H No. Tag Tag H No. Tag Tag
    H1 C T A A G C H6 C C G C A G H11 T G H14 T A H17 G T
    H2 G C G A G T H7 C A A C G G H12 C C H15 C A H18 G G
    H3 G C G A A T H8 C C G C G G H13 C G H16 C G H19 A G
    H4 C C G A G T H9 T A A C G A . . . . . . . . .
    H5 G C G A G C H10 C C A C G G
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    11 12 13 15 16
    Gene polymorphism name ()
    19 20 21 22 23 24 25 26 27 28 29 30 31
    Haplotype (H) No. Tag Tag H No. Tag Tag Tag H No. Tag Tag H No. Tag Tag Tag H No. Tag Tag Tag 32 33
    H20 T A H24 G C C H28 A A H31 G T C H35 C C C G C
    H21 T G H25 G C T H29 G A H32 A C T H36 T C A G C
    H22 C G H26 A C T H30 G G H33 A T T H37 C C A G C
    H23 C A H27 G T T . . . H34 A T C H38 T T C A T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    25 26 27 32
    Gene polymorphism name ()
    34 35 36 37 38 39 40 42 43 44 45 47 50
    Haplotype (H) No. Tag Tag H No. Tag Tag Tag Tag H No. Tag 41 H No. Tag Tag Tag Tag 46 Tag 48 49 Tag
    H39 T A H42 G A G G H47 A A H49 A T C G T G T T T
    H40 C G H43 G A A A H48 G G H50 A T C G T G T T C
    H41 T G H44 A G G A . . . H51 A T A C C G T C C
    . . . H45 G A G A H52 C T A C T T C T C
    H46 G G G A H53 C T A C T G C T C
    . . . H54 A C C G T G T T T
    H55 A T A G T G T T C
    Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    33 35 40
    Gene polymorphism name ()
    51 52 53 54 57 58 59
    Haplotype (H) No. Tag Tag Tag Tag 55 56 H No Tag Tag H No. Tag 60 61 62 63 64
    H56 T G G C A A H61 C T H64 G G C T T C
    H57 T A A T G C H62 T C H65 A A T C C A
    H58 G A A C G C H63 T T . . .
    H59 T A G C A A . . .
    H60 T A A C G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137
  • TABLE 14
    Gene name ATF2
    Linkage disequilibrium block No.
    1 2
    Gene polymorphism name ()
    1 2 3 4 5
    Haplotype No. Tag Tag Tag Tag Tag 6 7 8 9 10 11 12 13 14 15 16
    H1 T C A A G C C A G C G T C A A A
    H2 G C A G G T T G A T A C A C C G
    H3 T T C G A T T G A T A C A C C G
    H4 T T A G A T T G A T A C A C C G
    G G T T G A T A C A C C G
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Linkage disequilibrium block No.
    2
    Gene polymorphism name ()
    21 28
    Haplotype No. 17 18 19 20 Tag 22 23 24 25 26 27 Tag 29 30 31
    H5 C T T C C C G A C A C T T G T
    H6 T C C T T T A G A C T G C G C
    H7 T C C T T T A G A C T T C G C
    H8 T C C T T T A G A C T G C G C
    H9 T C C T C C G A C A C T T G T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
  • Further, from the genotype information of cyclic AMP responsive element binding protein (CREB) genes of the respective individuals in a population, a haplotype frequency in the population is calculated, and a linkage disequilibrium analysis can be carried out based on the thus obtained haplotype frequency. The D′ value and r2 value, which indicate measures of linkage disequilibrium, can be calculated based on the following definition.
  • Definition
  • It is assumed that there are SNP A and SNP B, and the respective alleles are represented by A and a, and B and b. The four haplotypes formed by SNP A and SNP B are represented by AB, Ab, aB and ab, and the respective haplotype frequencies are represented by PAB, PAb, PaB and Pab.

  • D=P AB ×P ab −P Ab ×P aB (In the case of D>0)

  • D′=(P AB ×P ab −P Ab ×P aB)/Minimum(((P AB +P aB)×(P aB +P ab)),((P AB +P Ab)×(P Ab +P ab))) (In the case of D<0)

  • D′=(P AB ×P ab −P Ab ×P aB)/Minimum(((P AB +P aB)×(P AB +P Ab)),((P aB +P ab)×(P Ab +P ab)))

  • r 2=(P AB ×P ab −P Ab ×P aB)2/[(P AB +P Ab)(P AB +P aB)(P aB +P ab)(P Ab +P ab)]
  • [However, Minimum (((PAB+PaB)×(PaB+Pab)), ((PAB+PAb)×(PAb+Pab))) means that a smaller value among (PAB+PaB)×(PaB+Pab) and (PAB+PAb)×(PAb+Pab) is adopted.]
  • Further, a haplotype block can be estimated from the results of the linkage disequilibrium analysis. As for the haplotype block, a linkage block can be estimated from the results of the haplotype analysis by using, for example, Haploview.
  • When a specific SNP in the estimated haplotype blocks is examined, the information of SNPs indirectly linked to each other in the same block can be obtained. That is, when a gene polymorphism of the cyclic AMP responsive element binding protein gene (specifically, a CREB1 subtype gene, a CREB3 subtype gene, a CREB5 subtype gene, or an ATF2 subtype gene) is examined, it is not necessary to analyze all the SNPs, and it is only necessary to perform typing for several specific SNPs, for example, representative SNPs such as a Tag SNP.
  • 4. Correlation of Cyclic AMP Responsive Element Binding Protein Gene Polymorphism with Drug Sensitivity and Disease Vulnerability
  • It is considered that when a gene polymorphism occurs in the cyclic AMP responsive element binding protein gene, the function or expression level of the cyclic AMP responsive element binding protein might change. Therefore, there is a correlation between a cyclic AMP responsive element binding protein gene polymorphism and various phenotypes associated with the cyclic AMP responsive element binding protein in some cases.
  • Here, as the phenotype, a phenotype associated with sensitivity to drugs (drug sensitivity) and a phenotype associated with occurrence of a disease (disease vulnerability) can be exemplified. As the drug sensitivity, an efficacy of drugs, a side effect of drugs, duration of efficacy of drugs and the like can be exemplified. As the disease vulnerability, pain sensitivity, vulnerability to substance dependence (in particular, vulnerability to drug dependence) and the like can be exemplified.
  • In the present invention, the type of the aforementioned drug is not particularly limited, and preferred examples of the drug include opioid receptor function modulators and cyclic AMP responsive element binding protein function modulators. Examples of such modulators include various drugs acting directly or indirectly on the opioid receptor or the cyclic AMP responsive element binding protein. Specific examples of various drugs acting directly or indirectly on the opioid receptor include a stimulant such as methamphetamine, a dopamine receptor agonist, a dopamine receptor antagonist, a m-, κ-, or δ-opioid receptor agonist, a m-, κ-, or δ-opioid receptor antagonist, and the like. Specific examples of various drugs acting directly or indirectly on the cyclic AMP responsive element binding protein include phosphorylated enzyme, a coactivator, a PDE4 inhibitor, dephosphorylated enzyme, an agonist for each subtypes of the cyclic AMP responsive element binding protein, an antagonist for each subtypes of the cyclic AMP responsive element binding protein, and the like.
  • Examples of the opioid receptor function modulator include morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, flurbiprofen axetil, marcain, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramide, isoflurane, ginsenoside, ifenprodil, bupivacaine, tertiapine, clozapine, haloperidol, SCH23390, cocaine, and the like. In particular, morphine, pentazocine, pethidine, buprenorphine, diclofenac, indomethacin, flurbiprofen axetil and marcain are preferred, and morphine, fentanyl and pentazocine are more preferred.
  • Preferred examples of the cyclic AMP responsive element binding protein function modulator include phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β, and CREB-regulated transcription coactivator 1 (CRTC1).
  • The correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype can be examined as described in the following (1) to (4), for example.
  • (1) A gene polymorphism in a linkage disequilibrium block estimated as a result of a linkage disequilibrium analysis and a haplotype analysis in healthy subjects is selected. For example, a Tag SNP which is a typical gene polymorphism is selected as a cyclic AMP responsive element binding protein gene polymorphism for analyzing a correlation with a phenotype.
    (2) Then, a gene polymorphism frequency of the gene polymorphism in test subjects (patients) is analyzed. In the case where a correlation between a gene polymorphism and disease vulnerability is examined, a comparison is made in terms of gene polymorphisms between the test subjects and the healthy subjects. It is effective to use a statistical technique such as a chi-square test in the comparison.
  • Here, the test subjects are classified into groups depending on the difference in phenotypes, and a comparison may be made in terms of gene polymorphism frequencies or genotypes between healthy subjects and test subjects in each group. In the case where the phenotype associated with the occurrence of a disease is a stimulant-induced psychotic-like symptom, it can be classified, for example, according to a period of time from the start of the use of a stimulant to the occurrence of delusion or hallucination, a period of duration of delusion or hallucination after termination of the use thereof, the presence or absence of the relapse, and the presence or absence of multiple drug abuse.
  • (3) If there is a gene polymorphism significantly linked to drug sensitivity in the test subjects, the gene polymorphism can be used for evaluating the genetic predisposition to drug sensitivity. Further, if there is a gene polymorphism with a significant difference in the gene polymorphism frequency between the healthy subjects and the test subjects, the gene polymorphism can be used for evaluating the genetic predisposition to disease vulnerability.
  • However, it is suggested that a tendency to gene polymorphism would be affected by the race, birthplace or the like, therefore, it is preferred that in a group showing a similar gene polymorphism to that of a population used for finding an associated gene polymorphism (such as SNP), the above-mentioned evaluation using the gene polymorphism is carried out.
  • Specific examples of the correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype will be shown in the following (1) to (4).
  • (1) In the correlation with the measurement results of the required total administration amount of analgesic in 24 hours after surgery, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly high in correlation with the number of alleles which they had. Thus, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to analgesic can be more easily predicted.
    (2) In the correlation with the measurement results of pain perception latency due to finger immersion in ice water before surgery, the presence or absence of a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and pain perception latency (logarithmic transformation) showed a significant correlation. Thus, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain can be more easily predicted.
    (3) In the correlation with the measurement results of the scale of the intensity of pain (VAS: on visual analogue scale) 24 hours after surgery, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the value of VAS (logarithmic transformation) was statistically significantly high in correlation with the number of alleles which they had. Thus, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain or analgesic after the surgery can be more easily predicted.
    (4) In the correlation with the measurement results of a difference in threshold of pain perception latency due to finger immersion in ice water before surgery, in the case of patients who had a minor allele (C) of the ATF2 subtype gene polymorphism (rs7583431) and underwent the surgery, a difference in threshold of pain perception latency (logarithmic transformation) due to finger immersion in ice water was statistically significantly short in correlation with the number of alleles which they had. Thus, by analyzing the ATF2 subtype gene polymorphism (rs7583431), the sensitivity to analgesic before the surgery can be more easily predicted.
  • 5. Use of Analysis Results
  • As in the above-mentioned 4, the correlation between a cyclic AMP responsive element binding protein gene polymorphism and a phenotype analyzed can be used as an index in a method of predicting sensitivity to various drugs associated with the opioid receptor and the cyclic AMP responsive element binding protein and also to pain, a method of selecting a method of treating or preventing a disease associated with the opioid receptor and the cyclic AMP responsive element binding protein, a method of determining an appropriate administration amount of therapeutic drugs, a method of predicting side effects, or the like.
  • Further, by using the gene polymorphism or the method of the present invention, it is possible to evaluate drug sensitivity and disease vulnerability in different races. The subjects are not particularly limited, and examples thereof include Japanese, Europeans, Americans and the like. In the present invention, however, they are preferably Japanese or those having a similar gene polymorphism tendency to that of Japanese.
  • 6. Detection of Gene Polymorphism
  • A genome sample of a test subject can be extracted from the blood, saliva, skin or the like, however, the origin is not limited to these as long as a genome sample can be collected therefrom. The extraction and purification methods of genomic DNA are publicly well known. For example, genomic DNA is purified from a specimen such as the blood, saliva, skin or the like collected from a human using the phenol method or the like. At this time, a commercially available genomic DNA extraction kit such as GFX Genomic Blood DNA Purification Kit (manufactured by GE Healthcare Bio-Sciences KK) or a device may be used. In the case where SNP to be detected is present in an exon, mRNA or total RNA may be extracted instead of genomic DNA.
  • In the detection of a cyclic AMP responsive element binding protein gene polymorphism in a genome sample, the above-mentioned oligonucleotide of the present invention can be used as a probe or a primer. Hereinafter, an example of the gene polymorphism detection method will be described.
  • (1) Detection of Gene Polymorphism by PCR Method
  • In order to amplify a test sample by PCR, it is preferred that a high fidelity DNA polymerase, for example, KOD Dash polymerase (manufactured by TOYOBO) is used. A primer to be used is designed such that a target SNP in the test sample can be amplified and synthesis is carried out. It is preferred that a gene polymorphism or a strand complementary thereto is contained at a given position between the forward and reverse primers. After completion of the amplification reaction, detection of the amplified products is carried out, and the presence or absence of a gene polymorphism is determined by a sequence method or the like.
  • (2) Detection of Gene Polymorphism by Sequencing Method
  • The gene polymorphism of the present invention can also be detected by a sequencing method based on the dideoxy method. As a sequencer to be used for the sequencing, a commercially available ABI series (Applied Biosystems (Life Technologies)) can be used.
  • (3) Detection of Gene Polymorphism Using DNA Microarray
  • A DNA microarray is a microarray in which oligonucleotide probes have been immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array and the like. First, a polynucleotide of a test sample is isolated and amplified by PCR, and then labeled with a fluorescent reporter group. Then, a labeled DNA/mRNA, or total RNA is incubated along with an array.
  • Then, this array is inserted in a scanner, and a hybridization pattern is detected. The data of the hybridization is collected as emitted light from the fluorescent reporter group bound to the probe array (i.e., incorporated in a target sequence). A probe which is completely identical with the target sequence generates a stronger signal than those having a region which is not identical with the target sequence. Because the sequence and the position of each probe on the array are known, the sequence of the target polynucleotide reacted with the probe array can be determined based on the complementarity.
  • (4) Detection of Gene Polymorphism by TaqMan PCR Method
  • The TaqMan PCR method is a method utilizing an allele specific oligonucleotide (also referred to as TaqMan probe) labeled with fluorescence and PCR with Taq DNA polymerase. The allele specific oligonucleotide is an oligonucleotide containing a gene polymorphic site. The allele specific oligonucleotide to be used in the TaqMan PCR method can be designed based on the above-mentioned gene polymorphism information.
  • (5) Detection of Gene Polymorphism by Invader Method
  • The invader method is a method of detecting a gene polymorphism by subjecting an allele specific oligonucleotide and a template to hybridization. A kit for carrying out the invader method is commercially available (for example, NanoInvader® Array (manufactured by BML, Inc.)), and it is possible to easily detect a gene polymorphism by this method.
  • 7. Kit
  • The present invention provides a kit for evaluating drug sensitivity and disease vulnerability. The kit for detecting a gene polymorphism of the present invention includes one or more components necessary for carrying out the present invention.
  • For example, the kit of the present invention preferably includes a component for storing or supplying an enzyme and/or a reaction component necessary for detecting a gene polymorphism. Such a component is not limited, and examples thereof include the oligonucleotide of the present invention, an enzyme buffer solution, dNTP, a reagent for control (such as a tissue sample or a target oligonucleotide for a positive or negative control), a reagent for labeling and/or detection, a solid phase support, a written instruction manual and the like. Further, the kit of the present invention may be a partial kit including only a part of the necessary components. In this case, a user can prepare the other components.
  • The kit of the present invention can be provided as a microarray in which the above-mentioned oligonucleotide has been immobilized on a support. The microarray is one in which the oligonucleotide of the present invention has been immobilized on a support, and includes a DNA chip, a Gene chip, a microchip, a bead array and the like.
  • The kit of the present invention preferably includes an oligonucleotide which contains a cyclic AMP responsive element binding protein gene polymorphism found in the present invention and is capable of being specifically hybridized to a DNA fragment containing the gene polymorphism.
  • In the case where a gene polymorphism is determined using the kit of the present invention, for example, the blood is collected before drugs are applied to patients or the like (for example, before surgery, at the time of occurrence of cancer pain or the like), and DNA containing a cyclic AMP responsive element binding protein 1 gene is isolated. Then, this gene is reacted with an oligonucleotide in the kit, and thereby a genotype is determined.
  • From the determined genotype and gene polymorphism, a dosage regimen such as the type or administration amount of the drugs can be designed. As a result, an effect of the drugs suitable for an individual can be obtained, which is useful in the personalized medicine. For example, in the case of using morphine, it becomes possible to obtain an analgesic effect suitable for an individual, and also to suppress the side effects to the minimum.
  • Hereinafter, the present invention will be described in more detail with reference to Examples. However, the present invention is not limited to these.
  • Example 1 <SNP Analysis and Haplotype Construction> (SNP Analysis)
  • Genomic DNA was extracted from the blood of humans (127 Japanese healthy subjects) by a standard method, and gene polymorphisms were identified in four subtypes (CREB1, CREB3, CREB5, and ATF2) of a human cyclic AMP responsive element binding protein.
  • With regard to the CREB1 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB1 subtype gene, 7 gene polymorphisms in an intron region were identified in the Japanese samples. Further, 4 and 6 gene polymorphisms were found in the 5′ and 3′ flanking regions, respectively (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the 3′ flanking region (see FIG. 1 and FIG. 2). It was found that rs16839837, rs2360969, rs10932200, rs2551946, rs4234080 and rs7594560 were suitable as Tag SNPs representing this linkage disequilibrium block.
  • Further, in the same manner as above, with regard to the CREB3 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB3 subtype gene, 1 gene polymorphism in an intron region, and 25 and 14 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, were identified in the Japanese samples (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in the 5′ flanking region, and 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the 3′ flanking region (see FIG. 3 and FIG. 4). It was found that rs1243872, rs2145925, rs2025126, GA007477, rs11541908, rs3763630, rs10814274, rsGA025684, rs10814275, rs4878628 and rs10758321 were suitable as Tag SNPs representing this linkage disequilibrium block.
  • Further, in the same manner as above, with regard to the CREB5 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the CREB5 subtype gene, 2 gene polymorphisms in a noncoding region of exon, 241 gene polymorphisms in an intron region, and 9 and 5 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, were identified in the Japanese samples (see Table 16). As a result of linkage disequilibrium analysis performed on some of the aforementioned gene polymorphisms, 1 linkage disequilibrium block was found in the 5′ flanking region, 15 linkage disequilibrium blocks were found in the intron region, and 1 linkage disequilibrium block was found in a region ranging from the noncoding region of exon to the 3′ flanking region (see FIG. 5 and FIG. 6). It was found that rs4722778, rs177479, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs11772815, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs17157048, rs6462098, rs10951201, rs13311248, rs10265166, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs721993, rs2237351 and rs3735566 were suitable as Tag SNPs representing this linkage disequilibrium block.
  • Further, in the same manner as above, with regard to the ATF2 subtype gene, an entire exon region, 5′ and 3′ flanking regions, and an intron region were analyzed. In the case of the ATF2 subtype gene, 1 gene polymorphism in a noncoding region of exon 1, 16 gene polymorphisms in an intron region, and 11 and 6 gene polymorphisms in the 5′ and 3′ flanking regions, respectively, were identified in the Japanese samples (see Table 15). As a result of linkage disequilibrium analysis, 1 linkage disequilibrium block was found in a region ranging from the 5′ flanking region to the intron region, and 1 linkage disequilibrium block was found in the 3′ flanking region (see FIG. 7 and FIG. 8). It was found that rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, rs268214 and rs1982235 were suitable as Tag SNPs representing this linkage disequilibrium block.
  • TABLE 15
    CREB1 gene polymorphism CREB3 gene polymorphism ATF2 gene polymorphism
    Gene Major Minor Gene Major Minor Gene Major Minor
    polymorphism allele:minor allele polymorphism allele:minor allele polymorphism allele:minor allele
    Position name allele frequency Position name allele frequency Position name allele frequency
    5′ rs16839837 C:T 0.232 5′ rs1243872 G:T 0.449 5′ rs268174 C:T 0.201
    Flanking rs2360969 C:T 0.126 Flanking rs2145925 C:T 0.39 Flanking rs13030474 G:T 0.008
    region rs10932200 A:C 0.315 region rs2025126 G:A 0.366 region rs268237 C:T 0.189
    rs2253206 G:A 0.315 rs1885373 T:C 0.055 rs1982235 T:G 0.398
    Intron rs2551640 A:G 0.323 rs1885374 A:C 0.051 rs10497435 T:C 0.189
    rs11904814 T:G 0.319 GA007473 T:C 0.051 rs268231 C:A 0.197
    rs16839883 A:G 0.181 rs2295794 T:C 0.453 rs268230 A:C 0.197
    rs6740584 C:T 0.307 rs4879926 T:C 0.051 rs268229 G:A 0.197
    rs3770704 T:C 0.181 GA007477 C:T 0.358 rs268228 A:G 0.205
    rs2254137 A:C 0.323 rs867194 T:C 0.028 rs166531 T:C 0.189
    rs2551645 T:C 0.319 rs11541908 C:T 0.283 rs268214 T:C 0.189
    3′ rs2551946 C:A 0.02 rs741917 C:T 0.028 Exon rs10497434 T:C 0.154
    Flanking rs4234080 C:A 0.193 rs7862485 G:A 0.051 Intron rs11888507 C:T 0.154
    region rs2952768 T:C 0.331 rs2756894 C:A 0.445 rs13388308 C:T 0.154
    rs2709386 G:A 0.331 rs2249250 T:G 0.425 rs3755490 T:C 0.146
    rs7591784 G:A 0.331 rs2295795 G:A 0.374 rs7578569 G:A 0.154
    rs7594560 T:C 0.181 rs877365 T:C 0.445 rs7566401 C:A 0.154
    rs2737273 G:A 0.413 rs1153676 C:A 0.154
    rs2295797 T:C 0.374 rs1205399 A:C 0.169
    rs2295798 C:T 0.008 rs2072538 C:T 0.146
    rs1534847 A:G 0.37 rs212361 A:G 0.154
    rs7873822 G:T 0.417 rs212360 T:C 0.154
    rs2737274 G:A 0.051 rs1153685 A:G 0.154
    rs10972567 A:C 0.445 rs12693057 G:A 0.154
    rs3763630 C:T 0.276 rs212347 T:C 0.154
    Intron rs10814274 C:T 0.409 rs212349 T:C 0.154
    3′ rs3750434 G:A 0.402 rs3845744 A:G 0.291
    Flanking rs1570246 G:T 0.385 rs2302663 G:A 0.146
    region GA025684 G:C 0.323 3′ rs35507277 T:G 0.008
    rs1570248 T:C 0.268 Flanking rs1153699 G:T 0.472
    rs1570249 G:A 0.409 region rs1153700 C:G 0.425
    rs34478611 G:A 0.323 rs7583431 A:C 0.366
    rs1322045 A:G 0.268 rs1153702 T:C 0.476
    rs1951432 G:A 0.26 rs1153711 T:G 0.209
    GA025687 A:T 0.264
    rs10814275 A:G 0.067
    rs10758320 T:C 0.264
    rs4878628 C:T 0.134
    rs10758321 G:A 0.394
    rs10758322 C:T 0.402
  • TABLE 16
    CREB5 gene polymorphism
    Gene Major
    polymorphism allele:minor Minor allele
    Position name allele frequency
    5′ Flanking rs4722778 C:G 0.256
    region rs177479 T:C 0.252
    rs177480 A:G 0.242
    rs11981754 A:G 0.008
    rs177486 G:A 0.161
    rs177498 C:T 0.248
    rs849322 A:G 0.437
    rs177505 T:G 0.201
    rs2175738 G:A 0.161
    Intron rs4719932 A:C 0.016
    rs10258745 C:T 0.031
    rs1013900 G:T 0.021
    rs6955393 G:A 0.035
    rs6953880 A:G 0.02
    rs17156573 T:C 0.035
    rs6960209 C:T 0.02
    rs17156577 T:C 0.039
    rs7811922 A:C 0.035
    rs6973453 T:C 0.201
    rs17156579 C:T 0.055
    rs1073298 T:C 0.201
    rs6961801 C:T 0.319
    rs6977728 C:A 0.106
    rs6978238 C:T 0.102
    rs13230543 C:A 0.248
    rs12673465 A:G 0.343
    rs10251129 T:C 0.327
    rs2391656 T:C 0.333
    rs6971345 A:G 0.327
    rs17156603 A:G 0.398
    rs7806362 C:A 0.173
    rs17642145 T:C 0.008
    rs10229500 C:T 0.138
    rs10243659 C:A 0.476
    rs4722785 G:A 0.488
    rs16874503 C:T 0.004
    rs11772815 G:A 0.331
    rs6958133 G:A 0.13
    rs16874525 C:T 0.461
    rs17715174 G:C 0.354
    rs10242868 T:G 0.205
    rs12700884 G:A 0.476
    rs17156635 G:A 0.189
    rs10239606 C:T 0.374
    rs16874528 G:A 0.008
    rs7799687 C:A 0.189
    rs714218 G:A 0.327
    rs1860759 A:G 0.327
    rs997908 G:A 0.476
    rs12112050 C:T 0.484
    rs2191827 A:G 0.484
    rs4498447 T:C 0.327
    rs10254657 G:A 0.449
    rs6953524 C:T 0.492
    rs10239810 A:G 0.307
    rs17156649 G:A 0.079
    rs1811248 T:G 0.13
    rs887623 T:C 0.252
    rs740988 A:G 0.276
    rs7794304 T:C 0.457
    rs42694 A:G 0.035
    rs6952227 G:A 0.291
    rs42695 C:T 0.244
    rs1029897 T:C 0.409
    rs42699 A:C 0.024
    rs4722793 C:A 0.405
    rs735101 T:C 0.409
    rs10233653 G:A 0.421
    rs6955105 G:A 0.465
    rs2286841 C:A 0.228
    rs979915 C:T 0.012
    rs7794347 C:T 0.248
    rs16874562 G:T 0.283
    rs17156685 A:G 0.087
    rs174024 C:T 0.268
    rs6949786 G:A 0.26
    rs7793437 A:G 0.016
    rs3757677 T:C 0.016
    rs6462085 T:G 0.016
    rs17717216 T:C 0.016
    rs17156694 G:A 0.441
    rs17156699 A:G 0.268
    rs177572 T:C 0.331
    rs177573 T:C 0.417
    rs6977204 A:G 0.48
    rs177574 A:G 0.047
    rs177576 T:C 0.327
    rs177578 G:A 0.012
    rs13437706 C:T 0.374
    rs177580 C:T 0.382
    rs177581 C:T 0.169
    rs12666636 C:A 0.224
    rs177584 G:A 0.169
    rs177585 C:T 0.169
    rs177588 G:A 0.098
    rs6462088 G:A 0.437
    rs7796539 C:T 0.004
    rs1859020 A:G 0.378
    rs1011384 A:G 0.236
    rs6462090 G:T 0.004
    rs12671247 T:C 0.154
    rs217508 T:C 0.398
    rs4719936 G:T 0.004
    rs217509 G:T 0.197
    rs217510 T:C 0.193
    rs17718257 G:A 0.004
    rs149591 C:A 0.051
    rs1910553 C:A 0.22
    rs217517 G:A 0.193
    rs217519 G:A 0.173
    rs2391668 T:G 0.382
    rs4722804 G:T 0.189
    rs618776 A:G 0.378
    rs217503 C:T 0.382
    rs217513 C:T 0.236
    rs65264 C:T 0.394
    rs441355 G:T 0.189
    rs2391670 C:T 0.362
    rs2391671 A:G 0.362
    rs216708 A:G 0.425
    rs11980665 C:T 0.173
    rs11980669 C:T 0.173
    rs11984308 T:C 0.173
    rs160346 G:A 0.37
    rs150607 A:G 0.276
    rs177594 G:A 0.106
    rs6969064 A:G 0.169
    rs150610 A:G 0.094
    rs216715 T:C 0.287
    rs10951197 T:C 0.39
    rs12539927 A:G 0.185
    rs216720 A:G 0.051
    rs17156823 G:A 0.252
    rs2078980 G:A 0.492
    rs216730 T:G 0.236
    rs13228899 G:T 0.201
    rs160335 G:A 0.496
    rs10951200 G:A 0.047
    rs10486588 G:A 0.461
    rs216735 G:A 0.287
    rs216737 C:T 0.031
    rs216743 G:A 0.055
    rs216744 A:G 0.055
    rs216747 C:T 0.031
    rs1976489 A:G 0.496
    rs150613 C:T 0.169
    rs17156878 G:A 0.232
    rs767834 C:G 0.437
    rs4722820 G:A 0.177
    rs160337 C:A 0.047
    rs160338 G:A 0.075
    rs1008262 T:C 0.323
    rs310353 G:A 0.299
    rs310359 T:C 0.217
    rs310361 C:T 0.169
    rs13233942 A:G 0.339
    rs310338 T:C 0.323
    rs41273 G:A 0.169
    rs1637457 A:G 0.22
    rs17156919 G:A 0.299
    rs41276 A:G 0.417
    rs160375 A:G 0.067
    rs917275 A:G 0.067
    rs160342 A:G 0.264
    rs160343 T:C 0.083
    rs41295 C:T 0.094
    rs160357 A:G 0.492
    rs41298 G:A 0.236
    rs41305 G:A 0.402
    rs41307 C:T 0.425
    rs10228740 A:G 0.126
    rs3888613 G:A 0.205
    rs41320 C:T 0.323
    rs41321 A:G 0.402
    rs41322 A:G 0.335
    rs7780656 G:T 0.063
    rs41327 A:G 0.343
    rs42322 T:C 0.331
    rs41333 A:G 0.331
    rs9655280 A:G 0.063
    rs9655281 G:A 0.063
    rs4719945 A:G 0.307
    rs6945988 A:G 0.413
    rs10258405 T:G 0.185
    rs10243376 G:A 0.185
    rs41334 T:C 0.429
    rs10245004 C:T 0.189
    rs41339 G:T 0.317
    rs982947 C:T 0.181
    rs982950 A:G 0.181
    rs16874653 A:G 0.28
    rs41346 G:T 0.02
    rs41348 A:G 0.386
    rs9969149 C:T 0.339
    rs6968464 G:A 0.02
    rs886816 G:A 0.181
    rs757980 A:G 0.035
    rs41351 G:A 0.083
    rs9691873 A:C 0.098
    rs17157048 A:C 0.087
    rs6462098 T:C 0.122
    rs10951201 C:A 0.154
    rs13311248 G:C 0.146
    rs12540480 T:C 0.063
    rs10265166 G:T 0.043
    rs7798774 T:C 0.087
    rs7799246 T:C 0.059
    rs6972081 T:C 0.287
    rs7777929 T:C 0.037
    rs12533079 T:G 0.079
    rs7806547 G:A 0.157
    rs6462100 G:A 0.134
    rs6979352 C:T 0.012
    rs6950574 A:G 0.13
    rs4722835 A:C 0.13
    rs9648352 A:G 0.028
    rs879593 A:C 0.138
    rs879591 G:T 0.15
    rs2299110 C:T 0.228
    rs2237349 C:T 0.272
    rs2066979 T:C 0.276
    rs10486589 A:G 0.039
    rs10486591 G:A 0.272
    rs6462103 C:T 0.118
    rs721993 C:T 0.154
    rs2237351 T:C 0.091
    rs740315 G:A 0.004
    rs2237353 A:C 0.238
    rs2073537 T:C 0.217
    rs4722844 G:T 0.181
    rs17730621 C:T 0.327
    rs2282907 G:A 0.24
    rs10238623 G:A 0.193
    rs2299116 C:A 0.091
    rs2299117 T:C 0.154
    rs2237355 A:G 0.366
    rs2237360 T:G 0.268
    rs2237361 T:C 0.217
    rs2237362 T:C 0.106
    rs7791555 G:T 0.272
    rs2237364 A:G 0.26
    rs2282909 T:G 0.366
    rs2282910 C:T 0.366
    rs2282911 T:C 0.366
    rs1544470 A:G 0.362
    rs1964240 A:C 0.293
    rs17669844 T:C 0.008
    rs886750 A:G 0.354
    rs12531253 G:A 0.272
    rs10951205 A:G 0.374
    Exon rs2190305 A:G 0.374
    rs3735566 G:A 0.039
    3′ Flanking rs11975539 G:A 0.039
    region rs6462107 C:T 0.039
    rs2190306 T:C 0.043
    rs4719955 T:C 0.047
    rs10228137 C:A 0.051
  • In Table 15 and Table 16, there is not found any polymorphism causing amino acid substitution, namely, a polymorphism in which the type of amino acid after translation is changed depending on the gene polymorphism allele.
  • Moreover, in Table 15 and Table 16, “minor allele frequency” means the ratio of a minor allele. It is to be noted that the number of healthy subjects used as test subjects was 127.
  • (Haplotype Construction)
  • As some examples of haplotype analysis, with regard to the 17 sites of SNPs which are CREB1 subtype gene polymorphisms, the 40 sites of SNPs which are CREB3 subtype gene polymorphisms, the 83 sites of SNPs which are CREB5 subtype gene polymorphisms, and the 23 sites of SNPs which are ATF2 subtype gene polymorphisms, as shown in Table 15 and Table 16, among the cyclic AMP responsive element binding protein gene polymorphisms in Japanese healthy subjects, a haplotype was estimated for each linkage disequilibrium block (haplotype block), using Haploview. The estimated haplotypes are shown in Tables 17, 18, 19 and 20. It is to be noted that the “Tag” used in each table means a Tag SNP that is a representative gene polymorphism in the linkage disequilibrium block.
  • TABLE 17
    Gene name CREB1
    Linkage disequilibrium block No.
    1
    Gene polymorphism name ()
    1 2 3 12 13 17
    Haplotype No. Frequency (%) Tag Tag Tag 4 5 6 7 8 9 10 11 Tag Tag 14 15 16 Tag
    H1 16.9 C C C A G G G T C C C C C C A A T
    H2 42.5 C C A G A T A C T A T C C T G G T
    H3 12.2 C T C A G G A T T C C C C C A A T
    H4 17.7 T C A G A T A C T A T C A T G G C
    H5 1.6 C C A G A T A C T A T A C C A A T
    H6 3.5 T C A G A T A C T A T C C T G G T
    H7 1.2 T C A G A T A C T A T C A T G G T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0%
    () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560
  • TABLE 18
    Gene name CREB3
    Linkage disequilibrium block No.
    1
    Hap- Gene polymorphism name ()
    lotype Frequen- 1 2 3 9 11
    No. cy (%) Tag Tag Tag 4 5 6 7 8 Tag 10 Tag 12 13 14 15 16 17 18 19 20 21 22 23 24
    H1 18.9 G C G T A T T T C T C C G C T G T G T C A G G A
    H2 35.4 G C G T A T T T T T C C G C T G T G T C A G G A
    H3 25.6 T T A T A T C T C T T C G A G A C A C C G T G C
    H4 8.3 T T A T A T C T C T C C G A G A C A C C G T G C
    H5 4.3 T C G C C C C C C T C C A A G G C A T C A T A C
    H6 2.8 T T G T A T C T C C C T G A T G C G T C A G G C
    H7 1.2 T C A T A T C T C T T C G A G A C A C C G T G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0%
    Linkage disequilibrium block No.
    2
    Hap- Gene polymorphism name ()
    lotype Frequen- 25 26 29 36 38 39
    No. cy (%) Tag Tag 27 28 Tag 30 31 32 33 34 35 Tag 37 Tag Tag 40
    H8 12.6 C C G G G C G G G A T A C C G C
    H9 29.8 C T A T G T A G A G A A T C A T
    H10 25.9 T C G G C T G A A G A A T C G C
    H11 2.0 C T A G G T A G A G A A T C G T
    H12 6.4 C C G G C T G A A G A A T C G C
    H13 6.7 C T A T G T A G A G A G T C A T
    H14 12.2 C C G G G C G G G A T A C T G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0%
    () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322
  • TABLE 19
    Gene name CREB5
    Linkage disequilibrium block No.
    1 5 6 9 10
    Hap- Gene polymorphism name ()
    lotype Frequen- 1 2 5 6 H Frequen- 7 8 9 11 H Frequen- 13 14 H Frequen- 15 16 H Frequen- 17 18
    (H) No. cy (%) Tag Tag 3 4 Tag Tag No. cy (%) Tag Tag Tag 10 Tag 12 No. cy (%) Tag Tag No. cy (%) Tag Tag No. cy (%) Tag Tag
    H1 73.2 C T A A G C H6 33.1 C C G C A G H11 46.1 T G H14 49.2 T A H17 87.0 G T
    H2 6.7 G C G A G T H7 33.8 C A A C G G H12 35.4 C C H15 20.1 C A H18 5.1 G G
    H3 16.1 G C G A A T H8 16.5 C C G C G G H13 18.5 C G H16 30.7 C G H19 7.9 A G
    H4 1.2 C C G A G T H9 12.6 T A A C G A . . . . . . . . .
    H5 1.2 G C G A G C H10 2.0 C C A C G G
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0% 100.0% 100.0% 100.0% 100.0%
    Linkage disequilibrium block No.
    11 12 13 15 16
    Hap- Gene polymorphism name ()
    lotype Frequen- 19 20 H Frequen- 21 22 23 H Frequen- 24 25 H Frequen- 26 27 28 H Frequen- 29 30 31
    (H) No. cy (%) Tag Tag No. cy (%) Tag Tag Tag No. cy (%) Tag Tag No. cy (%) Tag Tag Tag No. cy (%) Tag Tag Tag 32 33
    H20 71.2 T A H24 40.1 G C C H28 42.1 A A H31 26.8 G T C H35 60.6 C C C G C
    H21 3.6 T G H25 6.4 G C T H29 4.3 G A H32 33.1 A C T H36 21.3 T C A G C
    H22 24.0 C G H26 28.7 A C T H30 53.5 G G H33 25.2 A T T H37 1.2 C C A G C
    H23 1.2 C A H27 24.0 G T T . . . H34 15.0 A T C H38 16.9 T T C A T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0% 100.0% 100.0% 100.0% 100.0%
    Linkage disequilibrium block No.
    25 26 27 32
    Hap- Gene polymorphism name ()
    lotype Frequen- 34 35 H Frequen- 36 37 38 39 H Frequen- 40 H Frequen- 42 43 44 45 47 50
    (H) No. cy (%) Tag Tag No. cy (%) Tag Tag Tag Tag No. cy (%) Tag 41 No. cy (%) Tag Tag Tag Tag 46 Tag 48 49 Tag
    H39 29.9 T A H42 41.7 G A G G H47 93.3 A A H49 58.7 A T C G T G T T T
    H40 32.3 C G H43 29.9 G A A A H48 6.7 G G H50 13.0 A T C G T G T T C
    H41 37.8 T G H44 16.9 A G G A . . . H51 5.4 A T A C C G T C C
    . . . H45 6.3 G A G A H52 4.3 C T A C T T C T C
    H46 5.1 G G G A H53 4.3 C T A C T G C T C
    . . . H54 12.2 A C C G T G T T T
    H55 1.2 A T A G T G T T C
    Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0% 100.0% 100.0% 100.0%
    Linkage disequilibrium block No.
    33 35 40
    Hap- Gene polymorphism name ()
    lotype Frequen- 51 52 53 54 H Frequen- 57 58 H Frequen- 59
    (H) No. cy (%) Tag Tag Tag Tag 55 56 No. cy (%) Tag Tag No. cy (%) Tag 60 61 62 63 64
    H56 83.4 T G G C A A H61 84.6 C T H64 94.5 G G C T T C
    H57 1.2 T A A T G C H62 9.1 T C H65 3.9 A A T C C A
    H58 7.5 G A A C G C H63 6.3 T T . . .
    H59 2.8 T A G C A A . . .
    H60 4.3 T A A C G C
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0% 100.0% 100.0%
    () 1~64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137
  • TABLE 20
    Gene name ATF2
    Linkage disequilibrium block No.
    1 2
    Gene polymorphism name ()
    1 2 3 4 5
    Haplotype No. Frequency (%) Tag Tag Tag Tag Tag 6 7 8 9 10 11 12 13 14 15 16
    H1 26.3 T C A A G C C A G C G T C A A A
    H2 20.9 G C A G G T T G A T A C A C C G
    H3 36.2 T T C G A T T G A T A C A C C G
    H4 16.2 T T A G A T T G A T A C A C C G
    G G T T G A T A C A C C G
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0%
    Linkage disequilibrium block No.
    2
    Gene polymorphism name ()
    21 28
    Haplotype No. Frequency (%) 17 18 19 20 Tag 22 23 24 25 26 27 Tag 29 30 31
    H5 14.6 C T T C C C G A C A C T T G T
    H6 8.8 T C C T T T A G A C T G C G C
    H7 40.3 T C C T T T A G A C T T C G C
    H8 28.3 T C C T T T A G A C T G C G C
    H9 4.3 T C C T C C G A C A C T T G T
    . . . Haplotypes which are estimated to occur at a frequency of less than 1%
    Figure US20170357750A1-20171214-P00001
    100.0%
    () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
  • As shown in Table 17, at least 7 haplotypes were estimated as the haplotype of CREB1 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 6 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H6). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 17.
  • In addition, as shown in Table 18, at least 14 haplotypes were estimated as the haplotype of CREB3 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 11 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H5, H8 to H10, and H12 to H14). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 18.
  • Moreover, as shown in Table 19, at least 65 haplotypes were estimated as the haplotype of CREB5 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 57 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H3, H6 to H9, H11 to H22, H24 to H36, H38 to H54, H56, H58, and H60 to H65). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 19.
  • Furthermore, as shown in Table 20, at least 9 haplotypes were estimated as the haplotype of ATF2 subtype gene polymorphism in the Japanese healthy subjects, and among these, there were 9 haplotypes observed at a high frequency of 3% or higher (haplotype Nos. H1 to H9). Incidentally, specific description regarding haplotypes which are estimated to occur at a frequency of less than 1% was omitted from Table 20.
  • As well as an analysis of the haplotype frequencies in the haplotype analysis shown in Tables 17, 18, 19 and 20, a linkage disequilibrium analysis was carried out. The results are shown in FIG. 1 to FIG. 8. The linkage disequilibrium among the CREB1 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 1 and FIG. 2. In addition, the linkage disequilibrium among the CREB3 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 3 and FIG. 4. Moreover, the linkage disequilibrium among the CREB5 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 5 and FIG. 6. Furthermore, the linkage disequilibrium among the ATF2 subtype gene polymorphisms in the Japanese healthy subjects is shown in FIG. 7 and FIG. 8.
  • A linkage disequilibrium block was estimated from the results of the linkage disequilibrium analysis (FIG. 1 to FIG. 8) using Haploview.
  • In FIG. 1, a D′ value, which is an index of a linkage disequilibrium between SNP and SNP, is calculated, and the resulting value (two places of decimals) is written in the square at the intersection of squares continued from each SNP to the lower left direction or the lower right direction. Further, an r2 value, which is a more stringent index of the linkage disequilibrium, is calculated in the same manner, and the resulting value is written in the same square as defined above in FIG. 2. It is to be noted that the square in which no numbers are written indicates that the D′ or r2 value is 1. Also, the same shall apply to FIGS. 3 and 4, FIGS. 5 and 6, and FIGS. 7 and 8.
  • When focusing attention on the D′ values in FIG. 1, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 2, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs16839837, rs2360969, rs10932200, rs2551946, rs4234080 and rs7594560.
  • In addition, when focusing attention on the D′ values in FIG. 3, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 4, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs1243872, rs2145925, rs2025126, GA007477, rs11541908, rs3763630, rs10814274, rsGA025684, rs10814275, rs4878628 and rs10758321.
  • When focusing attention on the D′ values in FIG. 5, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 6, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs4722778, rs177479, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs11772815, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs17157048, rs6462098, rs10951201, rs13311248, rs10265166, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs721993, rs2237351 and rs3735566.
  • In addition, when focusing attention on the D′ values in FIG. 7, a complete linkage disequilibrium (D′=1) was observed in many combinations of gene polymorphisms. Further, when focusing attention on the r2 values in FIG. 8, it was found that several gene polymorphisms showed a strong linkage disequilibrium (r2=1). It was found that suitable Tag SNPs representing these linkage disequilibrium blocks are rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, rs268214 and rs1982235.
  • Further, a linkage disequilibrium block was estimated from the results of the linkage disequilibrium analysis (FIG. 1 to FIG. 8) using Haploview. As a result, with regard to SNP in the CREB1 subtype gene shown in FIG. 1 and FIG. 2, one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the 3′ flanking region. In a similar manner, with regard to SNP in the CREB3 subtype gene shown in FIG. 3 and FIG. 4, one linkage disequilibrium block was confirmed in the 5′ flanking region, and one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the 3′ flanking region. In a similar manner, with regard to SNP in the CREB5 subtype gene shown in FIG. 5 and FIG. 6, one linkage disequilibrium block was confirmed in the 5′ flanking region, 15 linkage disequilibrium blocks were confirmed in the intron region, and one linkage disequilibrium block was confirmed in a region ranging from the noncoding region of exon to the 3′ flanking region. In a similar manner, with regard to SNP in the ATF2 subtype gene shown in FIG. 7 and FIG. 8, one linkage disequilibrium block was confirmed in a region ranging from the 5′ flanking region to the intron region, and one linkage disequilibrium block was confirmed in the 3′ flanking region.
  • Example 2
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs10932200) and Required Administration Amount of Analgesic>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and the required administration amount of analgesic was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the required administration amount of analgesic after the surgery was analyzed.
  • Incidentally, as the analgesic, fentanyl, which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
  • As a result, as shown in the following Table 21 and FIG. 9, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly high in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to analgesic can be predicted.
  • Using the median (2.222 (μg/kg)) of the required administration amounts of fentanyl in 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 54% and 46% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the A/A patient group. In contrast, in the C/C patient group, 23% and 77% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
  • TABLE 21
    Effect of CREB1 rs10932200 polymorphism on required amount
    of analgesic administered in 24 hours after surgery in
    patients treated with analgesic in surgery (orthognathic surgery)
    (descriptive statistics by gender)
    Number of test
    CREB1 Average subjects
    rs10932200 Gender Standard deviation (subjects)
    A/A F 2.47 2.06 77
    M 2.42 2.57 36
    Total 2.46 2.23 113
    A/C F 3.23 2.65 75
    M 2.05 1.97 33
    Total 2.87 2.51 108
    C/C F 4.37 3.32 13
    M 4.94 2.70 13
    Total 4.65 2.98 26
    Total F 2.96 2.50 165
    M 2.67 2.54 82
    Total 2.87 2.51 247
     Required administration amount (μg/kg) of analgesic in 24 hours after surgery
  • Example 3
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs10932200) and Pain Sensitivity>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the measurement of pain perception latency due to finger immersion in ice water before the surgery was analyzed.
  • As a result, as shown in the following Table 22 and FIG. 10, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery, the measurement result (logarithmic transformation) of pain perception latency was statistically significantly low in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain can be predicted.
  • Using the median (15 sec) of the measurement results of pain perception latency due to finger immersion in ice water before the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high pain sensitivity group” and a “low pain sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 45% and 55% of patients were determined to belong to the high pain sensitivity group and the low pain sensitivity group, respectively, in the A/A patient group. In contrast, in the A/C or C/C patient group, 55% and 45% of patients were determined to belong to the high pain sensitivity group and the low pain sensitivity group, respectively.
  • TABLE 22
    Effect of CREB1 rs10932200 polymorphism on
    measurement results of pain sensitivity before surgery in
    patients treated with analgesic in surgery (orthognathic surgery)
    (descriptive statistics by gender)
    Number of test
    CREB1 Average subjects
    rs10932200 Gender Standard deviation (subjects)
    A/A F 20.95 18.21 76
    M 27.96 32.07 36
    Total 23.20 23.65 112
    A/C F 17.83 15.13 75
    M 21.91 17.12 33
    Total 19.07 15.80 108
    C/C F 12.07 8.03 14
    M 17.73 9.86 13
    Total 14.80 9.24 27
    Total F 18.78 16.33 165
    M 23.90 24.28 82
    Total 20.48 19.43 247
     Measurement (sec) of pain perception latency due to finger immersion in ice water before surgery
  • Example 4
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs10932200) and Pain Sensitivity>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs10932200) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the measurement of the scale of the intensity of pain (VAS: on visual analogue scale) 24 hours after the surgery was analyzed.
  • As a result, as shown in the following Table 23 and FIG. 11, in correlation with the measurement result (logarithmic transformation) of the scale of the intensity of pain (VAS) 24 hours after the surgery, patients who had a minor allele (T) of the CREB1 subtype gene polymorphism (rs10932200) and underwent the surgery had a value of VAS (logarithmic transformation) that was statistically significantly high in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs10932200), the sensitivity to pain or analgesic after the surgery can be more easily predicted.
  • Using the median (24 mm) of the VAS values 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low pain sensitivity group” and a “high pain sensitivity group,” respectively, and the groups were then stratified in terms of the rs10932200 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 54% and 46% of patients were determined to belong to the low pain sensitivity group and the high pain sensitivity group, respectively, in the A/A patient group. In contrast, in the A/C or C/C patient group, 47% and 53% of patients were determined to belong to the low pain sensitivity group and the high pain sensitivity group, respectively.
  • TABLE 23
    Effect of CREB1 rs10932200 polymorphism on measurement results
    of VAS (intensity of pain on visual analogue scale) after surgery
    in patients administered with analgesic in surgery (orthognathic surgery)
    (descriptive statistics by gender)
    Number of test
    Standard subjects
    CREB1 rs10932200 Gender Average  deviation (subjects)
    A/A F 24.17 19.35 77
    M 21.94 18.59 36
    Total 23.46 19.06 113
    A/C F 28.51 24.49 75
    M 26.33 20.06 33
    Total 27.84 23.15 108
    C/C F 37.31 17.78 13
    M 34.31 21.78 13
    Total 35.81 19.54 26
    Total F 27.18 21.92 165
    M 25.67 19.92 82
    Total 26.68 21.25 247
     Measurement (mm) of scale of intensity of pain by VAS after surgery
  • Example 5
  • <Correlation Between ATF2 Subtype Gene Polymorphism (rs7583431) and Analgesic Effect of Fentanyl>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and pain sensitivity was examined. Genomic DNA was extracted from the blood of 247 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs7583431) in the ATF2 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the analgesic effect of fentanyl that was evaluated based on the measurement of a difference in threshold of pain perception latency due to finger immersion in ice water after administration of an analgesic before the surgery was analyzed.
  • As a result, as shown in the following Table 24 and FIG. 12, in correlation with the measurement result (logarithmic transformation) of a difference in threshold of pain perception latency due to finger immersion in ice water before the surgery, patients who had a minor allele (C) of the ATF2 subtype gene polymorphism (rs7583431) and underwent the surgery had a difference in threshold of pain perception latency (logarithmic transformation) due to finger immersion in ice water before the surgery that was statistically significantly low in correlation with the number of alleles which they had. Accordingly, by analyzing the ATF2 subtype gene polymorphism (rs7583431), the sensitivity to analgesic before surgery can be more easily predicted.
  • Using the median (13 sec) of the measurement results of a difference in threshold of pain perception due to finger immersion in ice water before the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low analgesic sensitivity group” and a “high analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs7583431 polymorphism of the ATF2 gene. As a result, in terms of this polymorphism, 40% and 60% of patients were determined to belong to the low analgesic sensitivity group and the high analgesic sensitivity group, respectively, in the A/A patient group. In contrast, in the C/C patient group, 71% and 29% of patients were determined to belong to the low analgesic sensitivity group and the high analgesic sensitivity group, respectively.
  • TABLE 24
    Effect of ATF2 rs7583431 polymorphism on measurement results of
    difference in threshold of pain sensitivity before surgery in patients
    treated with analgesic in surgery (orthognathic surgery)
    (descriptive statistics by gender)
    Number of test
    ATF2 subjects
    rs7583431 Gender Average  Standard deviation (subjects)
    A/A F 26.69 32.69 64
    M 34.78 36.28 32
    Total 29.39 33.96 96
    A/C F 26.97 36.11 76
    M 28.73 42.97 44
    Total 27.62 38.60 120
    C/C F 14.24 25.36 25
    M 12.00 19.07 6
    Total 13.81 24.00 31
    Total F 24.93 33.49 165
    M 29.87 39.24 82
    Total 26.57 35.50 247
     Measurement (sec) of difference in threshold of pain perception latency due to finger immersion in ice water before surgery
  • Example 6 <Correlation Between Each of CREB1, CREB3, CREB5 and ATF2 Subtype Gene Polymorphisms, and Each of Required Administration Amount of Analgesic, Pain Sensitivity, and Analgesic Effect of Fentanyl>
  • In the same manner as Examples 2 to 5 above, a correlation between each gene polymorphism of the cyclic AMP responsive element binding protein gene, and each of the required administration amount of analgesic, pain sensitivity, and the analgesic effect of fentanyl was examined. Genomic DNA was extracted from the blood of 355 patients undergoing surgery (orthognathic surgery), and gene polymorphisms in the CREB1, CREB3, CREB5 and ATF2 subtype genes (Tag SNPs in linkage disequilibrium blocks and individual SNPs outside of the linkage disequilibrium blocks) were determined. Then, a correlation between these results of determination of the gene polymorphisms, and each of the required administration amount of analgesic in 24 hours after the surgery, pain sensitivity before the surgery, pain sensitivity (VAS) 24 hours after the surgery and before the surgery, and the analgesic effect of fentanyl, was analyzed.
  • Incidentally, as the analgesic, fentanyl, which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
  • As a result, the gene polymorphisms of the CREB1, CREB3, CREB5 and ATF2 subtype genes showed a statistically significant correlation with any phenotype of the required administration amount of analgesic in 24 hours after the surgery, pain sensitivity before the surgery, pain sensitivity (VAS) 24 hours after the surgery and before the surgery, and the analgesic effect of fentanyl. Accordingly, by analyzing these gene polymorphisms, the sensitivity to analgesic, pain sensitivity, and the analgesic effect of fentanyl can be predicted.
  • The results of the present example, as well as the results of Examples 2 to 5, are collectively shown in the following Table 25.
  • TABLE 25
    Tag SNPs in linkage disequilibrium (LD) blocks and SNPs outside of LD blocks found to have significant association with phenotypes
    Gene Chromosome Minor allele Statistics
    region No. LD block No. Tag SNP Position frequency Phenotype N BETA SE R2 P
    CREB1 2 1 rs16839837 208079256 0.232 Required amount of fentanyl 247 −0.1347 0.06718 0.01613 0.04613
    administered in 24 hours after
    surgery
    CREB1 2 1 rs2360969 208081241 0.126 Required amount of fentanyl 353 0.1453 0.07182 0.01153 0.04377
    administered in 24 hours after
    surgery
    CREB1 2 1 rs10932200 208095930 0.315 Required amount of fentanyl 247 0.2211 0.0597 0.05301 0.000263
    administered in 24 hours after
    surgery
    CREB1 2 1 rs10932200 208095930 0.315 VAS 24 hours after surgery 247 0.3084 0.1305 0.02228 0.01891
    CREB1 2 1 rs10932200 208095930 0.315 pain perception latency before 247 −0.14 0.06043 0.02145 0.02129
    surgery
    CREB1 2 1 rs4234080 208197346 0.193 Required amount of fentanyl 247 −0.2078 0.07133 0.03348 0.003906
    administered in 24 hours after
    surgery
    CREB3 9 1 rs2145925 35679373 0.39 Required amount of fentanyl 246 −0.1258 0.05884 0.01838 0.03358
    administered in 24 hours after
    surgery
    CREB3 9 1 rs2025126 35686625 0.366 Required amount of fentanyl 247 −0.1281 0.06011 0.01821 0.03402
    administered in 24 hours after
    surgery
    CREB3 9 2 rs4878628 35756561 0.134 VAS 24 hours after surgery 253 −0.4888 0.1739 0.0305 0.005343
    CREB5 7 1 rs4722778 28278588 0.256 Required amount of fentanyl 126 −0.2062 0.09913 0.03371 0.03961
    administered in 24 hours after
    surgery
    CREB5 7 rs2175738 28304605 0.161 Required amount of fentanyl 126 −0.3309 0.1141 0.06356 0.0044
    administered in 24 hours after
    surgery
    CREB5 7 rs2175738 28304605 0.161 VAS 24 hours after surgery 126 −0.5459 0.2322 0.04267 0.0203
    CREB5 7 rs17156579 28327642 0.055 Required amount of fentanyl 253 −0.306 0.1293 0.02184 0.01868
    administered in 24 hours after
    surgery
    CREB5 7 rs17156603 28348671 0.398 pain perception latency before 253 −0.1105 0.05533 0.01564 0.04692
    surgery
    CREB5 7 rs17642145 28355789 0.008 pain perception latency before 247 −0.7505 0.319 0.02209 0.01943
    surgery
    CREB5 7 5 rs4722785 28356666 0.488 Required amount of fentanyl 253 −0.1142 0.05564 0.01651 0.04114
    administered in 24 hours after
    surgery
    CREB5 7 6 rs16874525 28357707 0.461 VAS 24 hours after surgery 252 0.2455 0.121 0.01621 0.04345
    CREB5 7 10 rs17156649 28386945 0.079 Analgesic effect of fentanyl 247 −0.6983 0.2917 0.02285 0.01743
    before surgery
    CREB5 7 rs7794304 28394916 0.457 pain perception latency before 354 −0.1154 0.05005 0.01487 0.02175
    surgery
    CREB5 7 12 rs1029897 28400928 0.409 pain perception latency before 353 −0.09985 0.04979 0.01133 0.04568
    surgery
    CREB5 7 rs4722793 28404054 0.405 pain perception latency before 252 −0.1225 0.05698 0.01817 0.03246
    surgery
    CREB5 7 13 rs10233653 28406845 0.421 pain perception latency before 354 −0.119 0.05004 0.0158 0.01796
    surgery
    CREB5 7 13 rs6955105 28409814 0.465 pain perception latency before 354 −0.1222 0.0481 0.01802 0.01147
    surgery
    CREB5 7 rs17156685 28431959 0.087 pain perception latency before 247 −0.2359 0.1053 0.02007 0.02598
    surgery
    CREB5 7 rs17156694 28451480 0.441 pain perception latency before 253 −0.1379 0.05492 0.02449 0.0127
    surgery
    CREB5 7 15 rs177572 28460820 0.331 pain perception latency before 253 0.1454 0.06446 0.01988 0.02492
    surgery
    CREB5 7 rs177574 28461566 0.047 Analgesic effect of fentanyl 247 0.7803 0.3685 0.01798 0.03521
    before surgery
    CREB5 7 rs177576 28463632 0.327 Analgesic effect of fentanyl 247 0.4179 0.1582 0.02771 0.008764
    before surgery
    CREB5 7 rs13437706 28465016 0.374 Analgesic effect of fentanyl 253 0.3854 0.1501 0.02559 0.01083
    before surgery
    CREB5 7 16 rs177580 28465195 0.382 Analgesic effect of fentanyl 253 −0.3177 0.1503 0.01749 0.03554
    before surgery
    CREB5 7 16 rs12666636 28465748 0.224 VAS 24 hours after surgery 354 −0.2569 0.1182 0.01325 0.03036
    CREB5 7 rs216715 28539407 0.287 VAS 24 hours after surgery 354 −0.2213 0.1069 0.01202 0.03923
    CREB5 7 rs10951197 28540048 0.39 VAS 24 hours after surgery 253 −0.248 0.1181 0.01726 0.03676
    CREB5 7 rs160335 28554342 0.496 VAS 24 hours after surgery 247 0.2437 0.122 0.01602 0.04693
    CREB5 7 25 rs310353 28603649 0.299 VAS 24 hours after surgery 247 −0.2846 0.1258 0.02047 0.02451
    CREB5 7 rs310359 28606311 0.217 Required amount of fentanyl 126 0.2233 0.1071 0.0339 0.03904
    administered in 24 hours after
    surgery
    CREB5 7 26 rs1637457 28615963 0.22 pain perception latency before 253 −0.1327 0.06564 0.01603 0.04422
    surgery
    CREB5 7 rs41348 28683373 0.386 pain perception latency before 354 −0.1254 0.04985 0.01765 0.01235
    surgery
    CREB5 7 rs886816 28689932 0.181 Required amount of fentanyl 354 0.1596 0.06074 0.01924 0.008961
    administered in 24 hours after
    surgery
    CREB5 7 32 rs17157048 28703823 0.087 Required amount of fentanyl 354 −0.2175 0.09867 0.01361 0.02816
    administered in 24 hours after
    surgery
    CREB5 7 32 rs10951201 28711867 0.154 Required amount of fentanyl 354 −0.2078 0.07776 0.01988 0.007896
    administered in 24 hours after
    surgery
    CREB5 7 32 rs10265166 28713821 0.043 Analgesic effect of fentanyl 253 0.9373 0.4605 0.01624 0.04285
    before surgery
    CREB5 7 32 rs6972081 28715571 0.287 pain perception latency before 354 −0.1289 0.05762 0.01402 0.02588
    surgery
    CREB5 7 33 rs6462100 28720620 0.134 Required amount of fentanyl 354 −0.2022 0.08 0.01782 0.01194
    administered in 24 hours after
    surgery
    CREB5 7 rs2066979 28730634 0.276 pain perception latency before 250 −0.1395 0.06557 0.01792 0.0344
    surgery
    CREB5 7 rs10486591 28733403 0.272 pain perception latency before 354 −0.1231 0.05973 0.01192 0.04007
    surgery
    CREB5 7 35 rs721993 28745985 0.154 Required amount of fentanyl 354 −0.1698 0.07741 0.01348 0.02898
    administered in 24 hours after
    surgery
    CREB5 7 40 rs3735566 28831314 0.039 Required amount of fentanyl 247 −0.2901 0.1445 0.01618 0.04582
    administered in 24 hours after
    surgery
    ATF2 2 1 rs1153702 175629003 0.476 Analgesic effect of fentanyl 354 0.2496 0.1214 0.01188 0.04044
    before surgery
    ATF2 2 1 rs7583431 175630628 0.366 Analgesic effect of fentanyl 247 −0.5442 0.1582 0.04606 0.000685
    before surgery
    ATF2 2 rs1153699 175631032 0.472 Analgesic effect of fentanyl 247 0.3865 0.1524 0.02558 0.01184
    before surgery
    ATF2 2 rs1153699 175631032 0.472 pain perception latency before 247 0.1173 0.0577 0.01659 0.04312
    surgery
    ATF2 2 2 rs268214 175741461 0.189 Analgesic effect of fentanyl 247 0.4065 0.1863 0.01907 0.03004
    before surgery
  • Example 7
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Required Administration Amount of Analgesic>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and the required administration amount of analgesic was examined. Genomic DNA was extracted from the blood of 354 patients undergoing surgery (orthognathic surgery), and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the required administration amount of analgesic after the surgery was analyzed.
  • Incidentally, as the analgesic, fentanyl, which is mainly administered intravenously through a PCA (patient-controlled analgesia) pump, was used.
  • As a result, as shown in the following Table 26 and FIG. 13, in the case of patients who had a minor allele (C) of the CREB1 subtype gene polymorphism (rs2952768) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly high in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), the sensitivity to analgesic can be predicted.
  • Using the median (2.268 (μg/kg)) of the required administration amount of fentanyl in 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 53% and 47% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the T/T or T/C patient group. In contrast, in the C/C patient group, 22% and 78% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
  • TABLE 26
    Effect of CREB1 rs2952768 polymorphism on required amount
    of analgesic administered in 24 hours after surgery in patients
    treated with analgesic in surgery (orthognathic surgery)
    (descriptive statistics by gender)
    Number of test
    CREB1 subjects
    rs2952768 Gender Average  Standard deviation (subjects)
    T/T F 2.78 2.43 101
    M 2.38 2.46 58
    Total 2.64 2.44 159
    T/C F 2.99 2.42 108
    M 2.38 2.50 52
    Total 2.79 2.46 160
    C/C F 4.80 3.05 20
    M 5.08 2.55 15
    Total 4.92 2.81 35
    Total F 3.05 2.53 229
    M 2.71 2.62 125
    Total 2.93 2.57 354
     Required amount (μg/kg) of analgesic administered in 24 hours after surgery
  • Example 8
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Required Administration Amount of Analgesic>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and the required administration amount of analgesic was examined. Genomic DNA was extracted from the blood or the oral mucosa of 112 patients undergoing surgery (abdominal surgery), and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and the required administration amount of analgesic after the surgery was analyzed.
  • Incidentally, as the analgesic, analgesics such as pentazocine and pethidine, which are mainly administered intravenously, buprenorphine, diclofenac and indomethacin, which are mainly administered as a suppository, flurbiprofen axetil, which is injected by intravenous infusion, as well as epidural morphine and marcain were used.
  • Incidentally, the total amount of each analgesic in terms of fentanyl means the total amount of analgesic (mg) in the case where the amount of each administered analgesic is converted to a value corresponding to the potency equivalent to fentanyl. The conversion of the amount of each analgesic to a value corresponding to the potency of fentanyl was carried out by setting a potency equivalent to 0.3 mg of fentanyl at 90 mg of pentazocine, 360 mg in the case of pethidine (Opystan), 1 mg in the case of buprenorphine (Lepetan), 300 mg in the case of diclofenac (Voltaren), 300 mg in the case of flurbiprofen axetil (Ropion), and 6 mg in the case of epidural morphine.
  • As a result, as shown in the following Table 27 and FIG. 14, in the case of patients who did not have a major allele (T) of the CREB1 subtype gene polymorphism (rs2952768) and underwent the surgery, the required administration amount (logarithmic transformation) of analgesic after the surgery was statistically significantly higher compared with patients having the aforementioned allele (T). Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), the sensitivity to each analgesic can be predicted.
  • Using the median (2.453 (μg/kg)) of the required total administration amount of each analgesic in terms of fentanyl in 24 hours after the surgery as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “high analgesic sensitivity group” and a “low analgesic sensitivity group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 52% and 48% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively, in the T/T or T/C patient group. In contrast, in the C/C patient group, 33% and 67% of patients were determined to belong to the high analgesic sensitivity group and the low analgesic sensitivity group, respectively.
  • TABLE 27
    Effect of CREB1 rs2952768 polymorphism on required amount
    of analgesic administered in 24 hours after surgery in patients
    treated with analgesic in surgery (abdominal surgery)
    (descriptive statistics by gender)
    Number of test
    CREB1 subjects
    rs2952768 Gender Average  Standard deviation (subjects)
    T/T F 0.93 1.35 18
    M 0.43 0.63 26
    Total 0.63 1.01 44
    T/C F 0.67 1.32 28
    M 0.78 1.01 28
    Total 0.72 1.17 56
    C/C F 1.12 1.34 6
    M 1.78 1.61 6
    Total 1.45 1.45 12
    Total F 0.81 1.32 52
    M 0.73 1.00 60
    Total 0.77 1.15 112
     Required total amount (μg/kg) of analgesic administered in terms of fentanyl in 24 hours after surgery
  • Example 9
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Drug Dependence in Methamphetamine-Dependent Patients>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to drug dependence associated with the severity of drug dependence was examined. Genomic DNA was extracted from the blood of 194 methamphetamine-dependent patients, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of the abuse of many drugs, and a comparison was made among them. The results are shown in the following Table 28. Here, the methamphetamine-dependent patients were classified into two groups, namely, a patient group involving the abuse of drugs other than stimulants (two or more types) and a patient group involving the abuse of a single drug (only one type).
  • As a result, as is clear from the following Table 28, a significant difference in genotype frequency was observed in terms of the gene polymorphism (rs2952768), and in methamphetamine-dependent patients having a major allele (T), the number of patients who abused many drugs was statistically significantly higher compared with patient who did not have the aforementioned allele T.
  • From the above results, it was demonstrated that drug sensitivity associated with the severity of stimulant dependence can be easily predicted by determining genotype frequency in the cyclic AMP responsive element binding protein gene polymorphism.
  • TABLE 28
    Comparison of genotype and allele frequencies in rs2952768 polymorphism in methamphetamine-dependent patients
    classified based on presence or absence of abuse of many drugs
    Gene polymorphism name: CREB1 rs2952768
    (Number of samples) Genotype frequency (%) Allele frequency
    Sample name Abuse of many drugs   T/T   T/C   C/C  T   C
    Methamphetamine- dependent patients No (53)   Yes (141) 19 22 12 ( 35.8 % ) ( 41.5 % ) ( 22.6 % ) 58 67 16 )     ( P = 0.137 ; genotype )     ( P = 0.503 ; dominant model ) * ( P = 0.046 ; recessive model )   ( 41.1 % ) ( 47.5 % ) ( 11.3 % ) 0.556 0.444 0.644 0.356 ) ( P = 0.133 ; allele )
    Each model indicates hereditary mode regarding minor allele (C);
    *. P < 0.05.
  • Example 10
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Drug Dependence in Alcohol-Dependent Patients>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to drug dependence associated with the severity of drug dependence was examined. Genomic DNA was extracted from the blood of 436 alcohol-dependent patients, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of drug abuse, and a comparison was made among them. The results are shown in the following Table 29. Here, the alcohol-dependent patients were classified into two groups, namely, a patient group with drug abuse (one or more types) and a patient group without drug abuse (only alcohol ingestion).
  • As a result, as is clear from the following Table 29, a significant difference in genotype and allele frequencies was observed in terms of the gene polymorphism (rs2952768), and it was demonstrated that the frequency of major allele (T) was statistically significantly higher in the patient group with drug abuse than in the patient group without drug abuse.
  • From the above results, it was demonstrated that vulnerability to drug dependence associated with the severity of drug dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
  • TABLE 29
    Comparison of genotype and allele frequencies in rs2952768 polymorphism in alcohol-dependent patients
    classified based on presence or absence of drug abuse
    Gene polymorphism name: CREB1 rs2952768
    (Number of samples) Genotype frequency (%) Allele frequency
    Sample name Drug abuse   T/T   T/C   C/C  T   C
    Alcohol- dependent patients No (391)   Yes (45) 172 166 53 ( 44.0 % ) ( 42.5 % ) ( 13.6 % ) 25 18 2 )    ( P = 0.142 ; genotype )    ( P = 0.140 ; dominant model ) ( P = 0.097 ; recessive model )   ( 55.6 % ) ( 40.0 % ) ( 4.4 % ) 0.652 0.348 0.756 0.244 ) * ( P = 0.049 ; allele )
    Each model indicates hereditary mode regarding minor allele (C);
    *. P < 0.05.
    †. 0.05 ≦ P < 0.1.
  • Example 11
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Drug Dependence in Eating Disorder Patients>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to drug dependence associated with the severity of drug dependence was examined. Genomic DNA was extracted from the blood of 221 patients with eating disorder, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of drug dependence, and a comparison was made among them. The results are shown in the following Table 30. Here, the eating disorder patients were classified into two groups, namely, a patient group with a complication of drug dependence and a patient group without a complication of drug dependence.
  • As a result, as is clear from the following Table 30, a significant difference in genotype and allele frequencies was observed in terms of the gene polymorphism (rs2952768), and it was demonstrated that the frequency of major allele (T) was statistically significantly higher in the patient group with a complication of drug dependence than in the patient group without a complication of drug dependence.
  • From the above results, it was demonstrated that vulnerability to drug dependence associated with the severity of drug dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
  • TABLE 30
    Comparison of genotype and allele frequencies in rs2952768 polymorphism in patients with eating disorder
    classified based on presence or absence of complication of drug dependence
    Gene polymorphism name: CREB1 rs2952768
    (Number of samples) Genotype frequency (%) Allele frequency
    Sample name Complication of drug   T/T   T/C   C/C  T   C
    Eating disorder patients No (200)   Yes (21) 85 93 22 ( 42.5 % ) ( 46.5 % ) ( 11.0 % ) 14 6 1 )     ( P = 0.103 ; genotype ) * ( P = 0.034 ; dominant model )     ( P = 0.705 ; recessive model )   ( 66.7 % ) ( 28.6 % ) ( 4.8 % ) 0.658 0.343 0.810 0.190 ) * ( P = 0.046 ; allele )
    Each model indicates hereditary mode regarding minor allele (C);
    *. P < 0.05.
  • Example 12
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Severity of Substance Dependence in Eating Disorder Patients>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and vulnerability to substance (alcohol) dependence associated with the severity of substance (alcohol) dependence was examined. Genomic DNA was extracted from the blood of 221 patients with eating disorder, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. The patients were classified based on the presence or absence of alcohol dependence, and a comparison was made among them. The results are shown in the following Table 31. Here, the eating disorder patients were classified into two groups, namely, a patient group with a complication of alcohol dependence and a patient group without a complication of alcohol dependence.
  • As a result, as is clear from the following Table 31, a significant difference in genotype and allele frequencies was observed in terms of the gene polymorphism (rs2952768), and it was demonstrated that the frequency of major allele (T) was statistically significantly higher in the patient group with a complication of alcohol dependence than in the patient group without a complication of alcohol dependence.
  • From the above results, it was demonstrated that vulnerability to substance (alcohol) dependence associated with the severity of substance (alcohol) dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
  • TABLE 31
    Comparison of genotype and allele frequencies in rs2952768 polymorphism in patients with eating disorder
    classified based on presence or absence of complication of alcohol dependence
    Gene polymorphism name: CREB1 rs2952768
    (Number of samples) Genotype frequency (%) Allele frequency
    Sample name Complication of alcohol   T/T   T/C   C/C  T   C
    Eating disorder patients No (151)   Yes (70) 61 72 18 ( 40.4 % ) ( 47.7 % ) ( 11.9 % ) 38 27 5 )    ( P = 0.136 ; genotype ) ( P = 0.053 ; dominant model )    ( P = 0.279 ; recessive model )   ( 54.3 % ) ( 38.6 % ) ( 7.1 % ) 0.642 0.358 0.736 0.264 ) ( P = 0.052 ; allele )
    Each model indicates hereditary mode regarding minor allele (C);
    †. 0.05 ≦ P < 0.1.
  • Example 13
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Reward Dependence>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and dependence-prone personality associated with reward dependence was examined. Genomic DNA was extracted from the oral mucosa of 495 healthy subjects, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and dependence-prone personality was analyzed.
  • It is to be noted that, as a test of dependence-prone personality, a reward dependence (RD) score (average) in the Temperament and Character Inventory (TCI) was used.
  • As a result, as is shown in the following Table 32 and FIG. 15, healthy subjects having a minor allele (C) in the CREB1 subtype gene polymorphism (rs2952768) had an RD score (logarithmic transformation) that was statistically significantly low in correlation with the number of alleles which they had. Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), dependence-prone personality can be predicted.
  • Using the median (0.667) of the RD score as a reference, a patient group with a value smaller than the reference and a patient group with a value larger than the reference were defined as a “low reward dependence group” and a “high reward dependence group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 43% and 57% of healthy subjects were determined to belong to the low reward dependence group and the high reward dependence group, respectively, in the T/T patient group. In contrast, in the C/C patient group, 58% and 42% of healthy subjects were determined to belong to the low reward dependence group and the high reward dependence group, respectively.
  • From the above results, it was demonstrated that dependence-prone personality associated with reward dependence can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
  • TABLE 32
    Effect of CREB1 rs2952768 polymorphism on
    reward dependence (RD) score (average)
    (descriptive statistics by gender)
    Number of test
    CREB1 Average subjects
    rs2952768 Gender Standard deviation (subjects)
    T/T F 0.72 0.18 98
    M 0.66 0.18 122
    Unknown 0.60 0.09 2
    Total 0.68 0.18 222
    T/C F 0.70 0.18 103
    M 0.62 0.20 98
    Unknown 0.78 0.08 3
    Total 0.66 0.19 204
    C/C F 0.68 0.22 37
    M 0.58 0.18 32
    Total 0.63 0.21 69
    Figure US20170357750A1-20171214-P00002
    F 0.70 0.19 238
    M 0.63 0.19 252
    Unknown 0.71 0.12 5
    Total 0.67 0.19 495
     Average in dimension of average score in each subscale
  • Example 14
  • <Correlation Between CREB1 Subtype Gene Polymorphism (rs2952768) and Expression Level of CREB1 Gene>
  • A correlation between a cyclic AMP responsive element binding protein gene polymorphism and a gene expression level was examined. Genomic DNA was extracted from the blood of 100 postmortem brain tissue donors at the Stanley Foundation Brain Bank, and one gene polymorphism (rs2952768) in the CREB1 subtype gene was determined. Then, a correlation between these results of determination of the gene polymorphism and a gene expression level was analyzed.
  • Incidentally, as the gene expression level, the value of the relative mRNA expression level of CREB1, which was standardized with the value of the mRNA expression level of a β-actin gene (ACTB), was used.
  • As a result, as shown in the following Table 33 and FIG. 16, in the case of subjects who did not have a major allele (T) of the CREB1 subtype gene polymorphism (rs2952768), the mRNA expression level (logarithmic transformation) of CREB1 was statistically significantly higher compared with subjects having the aforementioned allele (T). Accordingly, by analyzing the CREB1 subtype gene polymorphism (rs2952768), the gene expression level can be predicted.
  • Using the median (0.0145) of the relative mRNA expression level as a reference, a subject group with a value smaller than the reference and a subject group with a value larger than the reference were defined as a “low gene expression group” and a “high gene expression group,” respectively, and the groups were then stratified in terms of the rs2952768 polymorphism of the CREB1 gene. As a result, in terms of this polymorphism, 52% and 48% of subjects were determined to belong to the low gene expression group and the high gene expression group, respectively, in the T/T or T/C subject group. In contrast, in the C/C subject group, 30% and 70% of subjects were determined to belong to the low gene expression group and the high gene expression group, respectively.
  • From the above results, it was demonstrated that the tendency of the expression level of a CREB1 gene (whether the gene tends to be expressed at a high level or at a low level) can be easily predicted by determining genotype and allele frequencies in the cyclic AMP responsive element binding protein gene polymorphism.
  • TABLE 33
    Effect of CREB1 rs2952768 polymorphism on gene expression level
    in postmortem brain tissue donors at Stanley Foundation Brain Bank
    (descriptive statistics)
    Number of test
    subjects
    CREB1 rs2952768 Average  Standard deviation (subjects)
    T/T 0.015345 0.006618 48
    T/C 0.015667 0.005267 42
    C/C 0.023360 0.023537 10
    Total 0.016282 0.009396 100
     Relative mRNA expression level value of CREB1 standardized with mRNA expression level value of β-actin gene (ACTB)
  • INDUSTRIAL APPLICABILITY
  • According to the present invention, it becomes possible to provide: a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism, which can evaluate an individual difference in terms of drug sensitivity and disease vulnerability; a method for evaluating drug sensitivity and disease vulnerability using the gene polymorphism or the haplotype; and the like. According to this evaluation method, it becomes possible to readily know or predict a proper prescribed amount, a proper prescribed schedule associated with a narcotic drug such as morphine, and the like, and hence the method is extremely useful for personalized pain therapy, drug dependence therapy and the like.

Claims (19)

1. A method for evaluating drug sensitivity, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual drug sensitivity.
2. The method according to claim 1, wherein a tendency in the presence or absence of an individual drug sensitivity is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
3. The method according to claim 1, comprising the following steps:
(1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block;
(2) a step of analyzing the association between the genotypes of the gene polymorphisms and drug sensitivity in a test subject; and
(3) a step of using the gene polymorphism that has been significantly associated with drug sensitivity in the test subject for evaluation of the drug sensitivity.
4. A method for evaluating disease vulnerability, comprising associating a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism with an individual disease vulnerability.
5. The method according to claim 4, wherein a tendency in the presence or absence of an individual disease vulnerability is evaluated based on the results from the analysis of the gene polymorphism or the haplotype.
6. The method according to claim 4, comprising the following steps:
(1) a step of performing linkage disequilibrium analysis and haplotype analysis on a healthy subject and selecting gene polymorphisms in a linkage disequilibrium block;
(2) a step of comparing the frequency of gene polymorphisms in a test subject with the frequency of gene polymorphisms in the healthy subject; and
(3) a step of using the gene polymorphism that has a significant difference in the gene polymorphism frequency between the test subject and the healthy subject for evaluation of the disease vulnerability.
7. The method according to claim 4, wherein the disease vulnerability is pain sensitivity or vulnerability to substance dependence.
8. The method according to claim 1 or 4, wherein the gene polymorphism is at least one selected from the group consisting of a single nucleotide polymorphism, an insertion polymorphism, a deletion polymorphism, and a nucleotide repeat polymorphism.
9. The method according to claim 1 or 4, wherein the gene polymorphism is at least one selected from among: rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784, and rs7594560 of a CREB1 subtype gene; rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321, and rs10758322 of a CREB3 subtype gene; rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs2175738, rs17156579, rs17156603, rs17642145, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs7794304, rs6952227, rs42695, rs1029897, rs4722793, rs10233653, rs6955105, rs17156685, rs17156694, rs17156699, rs177572, rs177573, rs177574, rs177576, rs13437706, rs177580, rs177581, rs12666636, rs177584, rs177585, rs216715, rs10951197, rs160335, rs1008262, rs310353, rs310359, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs41348, rs886816, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs2066979, rs10486591, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955, and rs10228137 of a CREB5 subtype gene; and rs1153711, rs1153702, rs7583431, rs1153699, rs2302663, rs3845744, rs212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474, and rs268174 of an ATF2 subtype gene.
10. The method according to claim 1 or 4, wherein the haplotype is at least one selected from the following table.
TABLE 1 Gene name CREB1 Linkage disequilibrium block No. 1 Gene polymorphism name () 1 2 3 12 13 17 Haplotype No. Tag Tag Tag 4 5 6 7 8 9 10 11 Tag Tag 14 15 16 Tag H1 C C C A G G G T C C C C C C A A T H2 C C A G A T A C T A T C C T G G T H3 C T C A G G A T T C C C C C A A T H4 T C A G A T A C T A T C A T G G C H5 C C A G A T A C T A T A C C A A T H6 T C A G A T A C T A T C C T G G T H7 T C A G A T A C T A T C A T G G T . . . Haplotypes which are estimated to occur at a frequency of less than 1% () 1~17: (in this order)rs16839837, rs2360969, rs10932200, rs2253206, rs2551640, rs11904814, rs16839883, rs6740584, rs3770704, rs2254137, rs2551645, rs2551946, rs4234080, rs2952768, rs2709386, rs7591784 and rs7594560
TABLE 2 Gene name CREB3 Linkage disequilibrium block No. 1 Gene polymorphism name () 1 2 3 9 11 Haplotype No. Tag Tag Tag 4 5 6 7 8 Tag 10 Tag 12 13 14 15 16 17 18 19 20 21 22 23 24 H1 G C G T A T T T C T C C G C T G T G T C A G G A H2 G C G T A T T T T T C C G C T G T G T C A G G A H3 T T A T A T C T C T T C G A G A C A C C G T G C H4 T T A T A T C T C T C C G A G A C A C C G T G C H5 T C G C C C C C C T C C A A G G C A T C A T A C H6 T T G T A T C T C C C T G A T G C G T C A G G C H7 T C A T A T C T C T T C G A G A C A G C G T G C . . . Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 2 Gene polymorphism name () 25 26 29 36 38 39 Haplotype No. Tag Tag 27 28 Tag 30 31 32 33 34 35 Tag 37 Tag Tag 40 H8 C C G G G C G G G A T A C C G C H9 C T A T G T A G A G A A T C A T H10 T C G G C T G A A G A A T C G C H11 C T A G G T A G A G A A T C G T H12 C C G G C T G A A G A A T C G C H13 C T A T G T A G A G A G T C A T H14 C C G G G C G G G A T A C T G C . . . Haplotypes which are estimated to occur at a frequency of less than 1% () 1~40: (in this order)rs1243872, rs2145925, rs2025126, rs1885373, rs1885374, GA007473, rs2295794, rs4879926, GA007477, rs867194, rs11541908, rs741917, rs7862485, rs2756894, rs2249250, rs2295795, rs877365, rs2737273, rs2295797, rs2295798, rs1534847, rs7873822, rs2737274, rs10972567, rs3763630, rs10814274, rs3750434, rs1570246, GA025684, rs1570248, rs1570249, rs34478611, rs1322045, rs1951432, GA025687, rs10814275, rs10758320, rs4878628, rs10758321 and rs10758322
TABLE 3 Gene name crEB5 Linkage disequilibrium block No. 1 5 6 9 10 Gene polymorphism name () 1 2 5 6 7 8 9 11 13 14 15 16 17 18 Haplotype (H) No. Tag Tag 3 4 Tag Tag H No. Tag Tag Tag 10 Tag 12 H No. Tag Tag H No. Tag Tag H No. Tag Tag H1 C T A A G C H6 C C G C A G H11 T G H14 T A H17 G T H2 G C G A G T H7 C A A C G G H12 C C H15 C A H18 G G H3 G C G A A T H8 C C G C G G H13 C G H16 C G H19 A G H4 C C G A G T H9 T A A C G A . . . . . . . . . H5 G C G A G C H10 C C A C G G . . . Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 11 12 13 15 16 Gene polymorphism name () 19 20 21 22 23 24 25 26 27 28 29 30 31 Haplotype (H) No. Tag Tag H No. Tag Tag Tag H No. Tag Tag H No. Tag Tag Tag H No. Tag Tag Tag 32 33 H20 T A H24 G C C H28 A A H31 G T C H35 C C C G C H21 T G H25 G C T H29 G A H32 A C T H36 T C A G C H22 C G H26 A C T H30 G G H33 A T T H37 C C A G C H23 C A H27 G T T . . . H34 A T C H38 T T C A T . . . Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 25 26 27 32 Gene polymorphism name () 34 35 36 37 38 39 40 42 43 44 45 47 50 Haplotype (H) No. Tag Tag H No. Tag Tag Tag Tag H No. Tag 41 H No. Tag Tag Tag Tag 46 Tag 48 49 Tag H39 T A H42 G A G G H47 A A H49 A T C G T G T T T H40 C G H43 G A A A H48 G G H50 A T C G T G T T C H41 T G H44 A G G A . . . H51 A T A C C G T C C . . . H45 G A G A H52 C T A C T T C T C H46 G G G A H53 C T A C T G C T C . . . H54 A C C G T G T T T H55 A T A G T G T T C Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 33 35 40 Gene polymorphism name () 51 52 53 54 57 58 59 Haplotype (H) No. Tag Tag Tag Tag 55 56 H No. Tag Tag H No. Tag 60 61 62 63 64 H56 T G G C A A H61 C T H64 G G C T T C H57 T A A T G C H62 T C H65 A A T C C A H58 G A A C G C H63 T T . . . H59 T A G C A A . . . H60 T A A C G C . . . Haplotypes which are estimated to occur at a frequency of less than 1% () 1~64: (in this order)rs4722778, rs177479, rs177480, rs11981754, rs177486, rs177498, rs10229500, rs10243659, rs4722785, rs16874503, rs11772815, rs6958133, rs16874525, rs17715174, rs6953524, rs10239810, rs17156649, rs1811248, rs887623, rs740988, rs6952227, rs42695, rs1029897, rs10233653, rs6955105, rs17156699, rs177572, rs177573, rs177580, rs177581, rs12666636, rs177584, rs177585, rs1008262, rs310353, rs41273, rs1637457, rs17156919, rs41276, rs160375, rs917275, rs17157048, rs6462098, rs10951201, rs13311248, rs12540480, rs10265166, rs7798774, rs7799246, rs6972081, rs12533079, rs7806547, rs6462100, rs6979352, rs6950574, rs4722835, rs721993, rs2237351, rs3735566, rs11975539, rs6462107, rs2190306, rs4719955 and rs10228137
TABLE 4 Gene name ATF2 Linkage disequilibrium block No. 1 2 Gene polymorphism name () 1 2 3 4 5 Haplotype No. Tag Tag Tag Tag Tag 6 7 8 9 10 11 12 13 14 15 16 H1 T C A A G C C A G C G T C A A A H2 G C A G G T T G A T A C A C C G H3 T T C G A T T G A T A C A C C G H4 T T A G A T T G A T A C A C C G G G T T G A T A C A C C G . . . Haplotypes which are estimated to occur at a frequency of less than 1% Linkage disequilibrium block No. 2 Gene polymorphism name () 21 28 Haplotype No. 17 18 19 20 Tag 22 23 24 25 26 27 Tag 29 30 31 H5 C T T C C C G A C A C T T G T H6 T C C T T T A G A C T G C G C H7 T C C T T T A G A C T T C G C H8 T C C T T T A G A C T G C G C H9 T C C T C C G A C A C T T G T . . . Haplotypes which are estimated to occur at a frequency of less than 1% () 1~31: (in this order)rs1153711, rs1153702, rs7583431, rs2302663, rs3845744, s212349, rs212347, rs12693057, rs1153685, rs212360, rs212361, rs2072538, rs1205399, rs1153676, rs7566401, rs7578569, rs3755490, rs13388308, rs11888507, rs10497434, rs268214, rs166531, rs268228, rs268229, rs268230, rs268231, rs10497435, rs1982235, rs268237, rs13030474 and rs268174
11. A method for determining the type, amount, and/or frequency of administration of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to claim 1 or 4 as an index.
12. A method for predicting a side effect of a drug to be administered to an individual, comprising using the result from the evaluation by the method according to claim 1 or 4 as an index.
13. The method according to claim 1 or 7, wherein the drug is an opioid receptor function modulator and/or a cyclic AMP responsive element binding protein function modulator.
14. The method according to claim 13, wherein the opioid receptor function modulator is at least one selected from the group consisting of methamphetamine, methylenedioxymethamphetamine, amphetamine, dextroamphetamine, dopamine, morphine, DAMGO, codeine, methadone, carfentanil, fentanyl, heroin, cocaine, naloxone, naltrexone, nalorphine, levallorphan, pentazocine, pethidine, buprenorphine, oxycodone, hydrocodone, levorphanol, etorphine, dihydroetorphine, hydromorphone, oxymorphone, tramadol, diclofenac, indomethacin, flurbiprofen axetil, marcaine, ethanol, methanol, diethyl ether, propanol, butanol, flupirtine, laughing gas, F3 (1-chloro-1,2,2-trifluorocyclobutane), halothane, estradiol, dithiothreitol, thioridazine, pimozide, fluoxetine, paroxetine, desipramine, imipramine, clomipramine, tetramide, isoflurane, ginsenoside, ifenprodil, bupivacaine, tertiapin, clozapine, haloperidol, SCH23390, and cocaine; and the cyclic AMP responsive element binding protein function modulator is at least one selected from the group consisting of phosphodiesterase 4 (PDE4), calcineurin, protein kinase A, protein kinase C, p90 ribosome S6 kinase 1 (RSK1), calmodulin kinase, glycogen synthase kinase 3β, and CREB-regulated transcription coactivator 1 (CRTC1).
15. The method according to claim 1 or 4, comprising using an oligonucleotide consisting of a nucleotide sequence of at least 10 nucleotides comprising the 51st nucleotide of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172, or a complementary nucleotide sequence thereto, which can specifically hybridize to a DNA fragment comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene.
16. The method according to claim 15, wherein the oligonucleotide spans a length of 10 to 150 nucleotides.
17. The method according to claim 15, wherein the oligonucleotide is selected from the group consisting of the nucleotide sequence represented by any one of SEQ ID NOS: 1 to 172 and a complementary nucleotide sequence thereto.
18. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual drug sensitivity, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.
19. A gene polymorphism marker for evaluating a tendency in the presence or absence of an individual disease vulnerability, comprising a gene polymorphism of a cyclic AMP responsive element binding protein gene or a haplotype constituted by the gene polymorphism.
US15/645,739 2011-09-30 2017-07-10 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene Abandoned US20170357750A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/645,739 US20170357750A1 (en) 2011-09-30 2017-07-10 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
JP2011-217104 2011-09-30
JP2011217104 2011-09-30
PCT/JP2012/076054 WO2013047912A1 (en) 2011-09-30 2012-10-01 Method for evaluating drug sensitivity and susceptibility to diseases by analyzing gene for protein capable of binding to cyclic-amp-responsive sequence
US201414347500A 2014-03-26 2014-03-26
US15/645,739 US20170357750A1 (en) 2011-09-30 2017-07-10 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/JP2012/076054 Continuation WO2013047912A1 (en) 2011-09-30 2012-10-01 Method for evaluating drug sensitivity and susceptibility to diseases by analyzing gene for protein capable of binding to cyclic-amp-responsive sequence
US14/347,500 Continuation US9727691B2 (en) 2011-09-30 2012-10-01 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic AMP responsive element binding protein gene

Publications (1)

Publication Number Publication Date
US20170357750A1 true US20170357750A1 (en) 2017-12-14

Family

ID=47995923

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/347,500 Expired - Fee Related US9727691B2 (en) 2011-09-30 2012-10-01 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic AMP responsive element binding protein gene
US15/645,739 Abandoned US20170357750A1 (en) 2011-09-30 2017-07-10 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US14/347,500 Expired - Fee Related US9727691B2 (en) 2011-09-30 2012-10-01 Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic AMP responsive element binding protein gene

Country Status (4)

Country Link
US (2) US9727691B2 (en)
EP (1) EP2787076B1 (en)
JP (1) JP6325254B2 (en)
WO (1) WO2013047912A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110734969A (en) * 2017-04-21 2020-01-31 武汉科技大学 PCR-RFLP method for detecting single nucleotide polymorphism of gene CREB1

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1261801A (en) 1997-04-29 2000-08-02 肯尼思·布卢姆公司 Allelic polygene diagnosis of reward deficiency syndrome and treatment
US8153646B2 (en) 2000-08-10 2012-04-10 Dart Neuroscience (Cayman) Ltd. Phosphodiesterase 4 inhibitors for cognitive and motor rehabilitation
US9931318B2 (en) 2003-04-08 2018-04-03 Dart Neuroscience (Cayman) Ltd. Phosphodiesterase 4 inhibitors for cognitive and motor rehabilitation
US20080020476A1 (en) 2004-03-31 2008-01-24 Kazutaka Ikeda Method Of Evaluating Drug Sensitivity By Analyzing The Mu-Opioid Receptor Gene
AU2005336514A1 (en) * 2004-09-25 2007-05-17 Novartis Ag TORC polynucleotides and polypeptides, and methods of use
EP1799865B1 (en) 2004-09-30 2012-06-06 Vanda Pharmaceuticals Inc. Methods for the administration of iloperidone
EP2377533A3 (en) 2006-05-19 2012-02-22 Helicon Therapeutics, Inc. Phosphodiesterase 4 inhibitors for cognitive and motor rehabilitation
US20080248470A1 (en) * 2007-04-04 2008-10-09 Sungkyunkwan University Foundation For Corporate Collaboration Genetic screening for predicting antidepressant drug response based on the monoamine transporter gene polymorphism combination
US20120022610A1 (en) 2010-04-22 2012-01-26 Kenneth Blum Devices for Delivering Neuro Electro Adaptive Therapy NEAT

Also Published As

Publication number Publication date
WO2013047912A1 (en) 2013-04-04
EP2787076B1 (en) 2019-08-28
US20140243237A1 (en) 2014-08-28
JPWO2013047912A1 (en) 2015-03-30
JP6325254B2 (en) 2018-05-16
EP2787076A4 (en) 2015-07-01
EP2787076A1 (en) 2014-10-08
US9727691B2 (en) 2017-08-08

Similar Documents

Publication Publication Date Title
EP2376655B1 (en) Genetic variants underlying human cognition and methods of use thereof as diagnostic and therapeutic targets
US20220056529A1 (en) Identification of pediatric onset inflammatory bowel disease loci and methods for use thereof for the diagnosis and treatment of the same
JP2012507297A (en) Method for treating psychosis and schizophrenia based on ERBB4 gene polymorphism
EP2880179B1 (en) Genetic markers for predicting responsiveness to fgf-18 compound
EP2940137B1 (en) Identification of group of hypertension-susceptibility genes
US20180137235A1 (en) System and method for processing genotype information relating to opioid risk
JP5308644B2 (en) Drug sensitivity evaluation method by GIRK channel gene analysis
JP4580924B2 (en) Evaluation method of drug sensitivity by analysis of mu opioid receptor gene
US20170357750A1 (en) Method for evaluating drug sensitivity and disease vulnerability by analyzing cyclic amp responsive element binding protein gene
US20090281090A1 (en) Biomarkers for the prediction of responsiveness to clozapine treatment
US9670545B2 (en) Methods and kits for treating and classifying individuals at risk of or suffering from TRAP1 change-of-function
KR101840843B1 (en) Single nucleotide polymorphism marker in gene for predicting risk of drug induced leukopenia and method for predicting risk of drug induced leukopenia using the same
WO2010111080A2 (en) Optimized treatment of schizophrenia
JP5904501B2 (en) Method for detecting type 2 diabetes
JP6073682B2 (en) Drug sensitivity evaluation method by voltage-dependent calcium channel gene analysis
US20190018923A1 (en) System and method for processing genotype information relating to medically-assisted treatment regarding withdrawal or pain
CN104946738B (en) Method for determining visceral fat accumulation susceptibility
US20190080048A1 (en) System and method for processing genotype information relating to opioid response
US20180247013A1 (en) System and method for processing genotype information relating to non-opioid response
US20190249232A1 (en) Compositions and methods for diagnosing and treating arrhythmias
Carstens Renin-angiotensin-aldosterone system genes and the complex hypertrophic phenotype of hypertrophic cardiomyopathy
WO2016057810A1 (en) Markers for assessing risk of developing or having obsessive compulsive disorder
WO2010022235A2 (en) Genome-wide association study of autism reveals a comnon novel risk locus at 5p14.1
JP2011239697A (en) Risk marker for development of parkinson&#39;s disease

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION