KR101191994B1 - RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use - Google Patents

RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use Download PDF

Info

Publication number
KR101191994B1
KR101191994B1 KR1020100078695A KR20100078695A KR101191994B1 KR 101191994 B1 KR101191994 B1 KR 101191994B1 KR 1020100078695 A KR1020100078695 A KR 1020100078695A KR 20100078695 A KR20100078695 A KR 20100078695A KR 101191994 B1 KR101191994 B1 KR 101191994B1
Authority
KR
South Korea
Prior art keywords
protein
rna
binding
sequence
rna oligonucleotide
Prior art date
Application number
KR1020100078695A
Other languages
Korean (ko)
Other versions
KR20120057697A (en
Inventor
김양훈
엄현주
이상희
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020100078695A priority Critical patent/KR101191994B1/en
Publication of KR20120057697A publication Critical patent/KR20120057697A/en
Application granted granted Critical
Publication of KR101191994B1 publication Critical patent/KR101191994B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/205—Aptamer

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 HT1 (Human cyclin T1) 단백질에 특이적으로 결합하는 RNA 앱타머(aptamer) 및 이의 용도에 관한 것이다. 본 발명의 RNA 앱타머는 HT1 단백질에 특이적으로 결합함으로써 HT1 단백질과 이의 결합 파트너인 Cdk9 (cyclin-dependent kinase 9) 단백질과의 상호작용을 억제하여, 이들 단백질들이 서브유닛으로 구성되는 전사연장 인자 p-TEFb (Positive Transcription Elongation Factor b)의 활성을 저해하고, 이로써 숙주세포에 감염한 HIV (Human Immunodeficiency Virus)의 복제가 억제된다. 따라서, 본 발명의 RNA 앱타머는 HIV의 증식을 억제하는 AIDS 치료용 약물로 개발될 수 있다. The present invention relates to an RNA aptamer and its use specifically binding to HT1 (Human cyclin T1) protein. The RNA aptamer of the present invention specifically inhibits the interaction between the HT1 protein and its binding partner Cdk9 (cyclin-dependent kinase 9) protein by specifically binding to the HT1 protein, and thus the transcriptional extension factor p in which these proteins are composed of subunits. It inhibits the activity of -TEFb (Positive Transcription Elongation Factor b), which inhibits the replication of Human Immunodeficiency Virus (HIV) infected with host cells. Therefore, the RNA aptamer of the present invention can be developed as a drug for treating AIDS that inhibits the proliferation of HIV.

Description

ＨＴ1 단백질에 결합하는 ＲＮＡ 앱타머 및 이의 용도{RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use} RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use}

본 발명은 HT1 (Human cyclin T1) 단백질에 결합하는 RNA 앱타머 및 이의 용도에 관한 것이다.
The present invention relates to RNA aptamers that bind to HT1 (Human cyclin T1) protein and uses thereof.

HIV(Human Immunodeficiency Virus) 감염에 의한 질환은 수년간 잠복하여 겉으로 증상을 보이지 않을 수도 있고, 급격히 급성 바이러스 감염과 기회감염 증상을 나타낼 수도 있는 변화무쌍 한 질환이다. HIV는 감염 후 AIDS (Acquired Immunodeficiency Syndrome) 발병까지 기간은 CD4 양성임파구수, 환자 상태, 치료 시기 및 방법에 따라 다양하게 나타나며, 치료를 받지 않을 경우 평균 8 - 10년 사이 AIDS로 발전하는 것으로 조사되고 있다. 세계보건기구(WHO)는 HIV 감염추세가 세계적인 유행 현상인 판데믹(pandemic) 중 하나라고 정의하고 있으며, 실제 1981년부터 2006년까지 AIDS로 인하여 2천 5백만 명 이상의 사람이 사망하였을 뿐만 아니라, 전 세계인구의 0.6％는 HIV에 감염되어 있다고 발표했다. HIV는 주로 T 세포의 CD4 세포 (항원 임파구), 대식세포 (macrophage), 수지상 세포 (dendritic cell) 등의 살아있는 면역세포들에 감염되며, HIV에 감염은 CD4 분자를 가지는 T 세포의 수를 급격히 감소시킨다. CD4를 갖는 T 세포의 수가 치명적인 수준 이하로 내려가면 세포의 면역 기능을 더욱 상실되며, 이는 기회감염을 더욱 쉽게 일어나게 한다. 즉, HIV는 CD4를 가지는 T 세포에 침입하여 T 세포 수를 감소시켜, 신체 세포 면역 기능을 떨어뜨리며, 세포내 감염과 종양을 일으키며 신경계에 침입하여 치매, 마비, 신경이상을 유발한다. Diseases caused by HIV (Human Immunodeficiency Virus) infections are a variable disease that may linger for years and show no symptoms, or may show signs of acute viral infections and opportunistic infections. The duration of HIV post-infection AIDS (Acquired Immunodeficiency Syndrome) varies according to the number of CD4 positive lymphocytes, the patient's condition, the time and method of treatment, and if not treated, AIDS develops in an average of 8 to 10 years. have. The World Health Organization (WHO) defines the trend of HIV infection as one of the world's most prevalent pandemics, and in fact, more than 25 million people died of AIDS from 1981 to 2006. 0.6% of the world's population is infected with HIV. HIV mainly infects living immune cells such as T4 CD4 cells (antigen lymphocytes), macrophages, dendritic cells, etc., and HIV infection dramatically reduces the number of T cells with CD4 molecules. Let's do it. When the number of T cells with CD4 falls below the lethal level, the immune function of the cells is further lost, which makes opportunistic infections easier to occur. In other words, HIV invades T cells with CD4, reduces the number of T cells, reduces body cell immune function, causes intracellular infections and tumors, and invades the nervous system, causing dementia, paralysis, and neuropathy.

상기한 바와 같이 치명적인 질환을 유발하는 HIV의 감염률 및 이로 인한 질환 발생률이 부각되고 있는 바, 이들을 효과적으로 치료할 수 있는 새로운 치료제가 절실히 요구되고 있다. HIV는 세포내 감염 후 복제를 위한 전사(transcription)을 위해 다양한 세포내 단백질이 요구되며, 특히, 세포내 복제를 위한 전사 시에는 RNA 폴리머라아제 II이 HIV-LTR (long-terminal repeat) 프로모터 지역에 결합한 후 전사를 진행하기 위해서 P-TEFb라는 핵심적인 전사기구가 요구된다. P-TEFb는 촉매서브유닛인 Cdk9 (cyclin-dependent kinase 9)와 조절서브유닛인 HT1(Human cycT1)으로 구성되어 있으며, 이들은 모두는 HIV가 세포내에서 증식하기 위한 RNA 전사에 필수적인 요소이다. 구체적으로 HIV가 세포내에서 전사를 하기 위해서는 먼저 RNA polymerase Ⅱ가 LTR 프로모터 지역에 결합한 후 바이러스 RNA의 TAR (trans-activation response region)에 Tat 단백질이 결합하고, TAR RNA에 HT1 단백질과 Cdk9 단백질이 차례로 결합하여 전사의 연장 (transcriptional elongation)을 주도하는 RNA polymerase Ⅱ의 C-말단 부위의 인산화를 유도하며, HIV 바이러스의 단백질인 Tat의 발현을 유도하여 HIV 전사 연장을 일으킨다고 알려져 있다 (Biglion, S. et al., Retrovirology, 2007, 4, 47).As described above, the infection rate of HIV causing fatal diseases and the incidence of diseases caused by these are highlighted, and new therapeutic agents that can effectively treat them are urgently needed. HIV requires a variety of intracellular proteins for transcription for intracellular infection and, in particular, for transcription for intracellular replication, RNA polymerase II is a long-terminal repeat (HTR-LTR) promoter region. In order to proceed with transcription after binding to the core, a key transcriptional mechanism called P-TEFb is required. P-TEFb consists of the catalytic subunit Cdk9 (cyclin-dependent kinase 9) and the regulatory subunit HT1 (Human cycT1), all of which are essential for RNA transcription for HIV to proliferate intracellularly. Specifically, in order for HIV to transduce intracellularly, RNA polymerase II binds to the LTR promoter region, and then Tat protein binds to the trans-activation response region (TAR) of viral RNA, and HT1 protein and Cdk9 protein to TAR RNA in turn. Induction of phosphorylation of the C-terminal region of RNA polymerase II, which leads to transcriptional elongation by binding, is known to induce expression of HIV transcription by inducing the expression of Tat, a protein of the HIV virus (Biglion, S. et al., Retrovirology, 2007, 4, 47).

이에 최근 P-TEFb을 표적으로 하여 HIV-전사(transcription)을 억제하고자하는 몇몇의 연구가 보고되었다 (Richter, S.N. and Palㆉ, G., Curr. Med. Chem., 2006, 13, 1305-1315). 이 중에는 Cdk9 키나아제(kinase) 활성을 저해하는 돌연변이 단백질 또는 작은 화합물을 활용하는 기법 (Chao, S.H., et al., J. Biol. Chem., 2000, 275, 28345-28348); Tat, TAR과 HT1 단백질간의 상호작용을 제어하는 기법 (Hwang, S., et al., J. Biol. Chem., 2003, 278, 39092-39103); HT1 억제제를 이용하는 기법 (Bai, J., et al., J. Biol. Chem., 2003, 278, 1433-1442); Cdk9 불활성을 위한 연쇄반응의 oligomerization (Napolitano, G. et al., Oncogene., 2003, 31, 4882.4888)를 이용하는 방법들이 포함된다. 기존 연구 결과를 통하여 HIV가 세포내 감염을 일으키는데 세포내 많은 단백질들이 동시 다발적으로 활용됨을 확인할 수 있었다. 따라서, 효율적이고 안전한 항-HIV 치료제의 개발을 위하여 HIV-특이적인 대사경로를 정확하게 억제하는 것이 반드시 필요하다.Recently, several studies have attempted to inhibit HIV-transcription by targeting P-TEFb (Richter, SN and Pal ', G., Curr. Med. Chem., 2006, 13, 1305-1315). ). Among them, techniques utilizing mutant proteins or small compounds that inhibit Cdk9 kinase activity (Chao, S.H., et al., J. Biol. Chem., 2000, 275, 28345-28348); Techniques for controlling the interaction between Tat, TAR and HT1 proteins (Hwang, S., et al., J. Biol. Chem., 2003, 278, 39092-39103); Techniques using HT1 inhibitors (Bai, J., et al., J. Biol. Chem., 2003, 278, 1433-1442); Methods using oligomerization of the chain reaction for Cdk9 inactivation (Napolitano, G. et al., Oncogene., 2003, 31, 4882.4888) are included. Existing studies have confirmed that many proteins in cells are used simultaneously to cause intracellular infections of HIV. Therefore, it is essential to accurately inhibit HIV-specific metabolic pathways for the development of efficient and safe anti-HIV therapeutics.

RNA 앱타머(aptamer)는 RNA 올리고머(oligomer)로 표적하는 물질과 특이적이고 강력하게 결합하는 특징을 가지고 있다. 이에 최근 RNA 앱타머는 다양한 바이러스성 질환 치료제로 개발되고 있음이 보고되고 있다. 실제 최근 논문에서는 HIV-1 역전사효소(reverse transcriptase, RT)를 특이적으로 탐지하여 이의 활성을 억제함으로써 HIV-1 복제를 제어할 수 있는 RNA 앱타머가 보고된바 있다. 2003년 khati et al 연구팀은 HIV-1Ba-L인 R5 strain의 표면의 당단백질(glycoprotein, gp120)에 특이적으로 결합하는 RNA 앱타머를 분리하는데 성공하였으며, 이를 사람 말초 혈액 단핵 세포에 전염되는 HIV-1Ba-L 전염 중화에 활용하고자 하였다.RNA aptamers are characterized by specific and strong binding to a target material as an RNA oligomer. Recently, it has been reported that RNA aptamer has been developed as a therapeutic agent for various viral diseases. Indeed, recent studies have reported RNA aptamers that can control HIV-1 replication by specifically detecting HIV-1 reverse transcriptase (RT) and inhibiting its activity. In 2003, khati et al's team succeeded in isolating RNA aptamers that specifically bind to glycoproteins (gp120) on the surface of the HIV-1Ba-L R5 strain, which is transmitted to human peripheral blood mononuclear cells. -1Ba-L was intended to neutralize the transmission.

그러나, 종래 연구에서의 대부분은 항-레트로바이러스(retroviral) 물질로 HIV 자체 요소를 표적으로 하고 있어 환경에 따른 바이러스의 변형에 따라 저항성이 생겨난다. 이에 HIV 세포내 감염 및 질환 발생에 관한 새로운 메카니즘을 표적으로 하는 치료제 개발이 절실하다. 뿐만 아니라, 효율적이고 안전한 항-HIV 치료제의 개발을 위한 HIV-특이적인 대사경로를 정확하게 억제하는 것이 반드시 필요하다. 이러한 관점에서 2006년 Klebl과 Choidas은 상기와 같은 문제를 해결하기 위하여 바이러스 부분이 아닌 세포내 물질을 표적으로 하는 간접적인 방법으로 HIV 바이러스 억제제를 개발하는 방법을 제시하였다.
However, most of the previous studies are anti-retroviral substances that target HIV's own elements, resulting in resistance to viral modifications in the environment. The development of therapeutics that target new mechanisms for HIV intracellular infection and disease development is urgently needed. In addition, it is essential to accurately inhibit HIV-specific metabolic pathways for the development of efficient and safe anti-HIV therapeutics. In this regard, in 2006, Klebl and Choidas proposed a method for developing HIV virus inhibitors by indirectly targeting intracellular substances rather than viral portions to solve the above problems.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

본 발명자들은 HIV (Human Immunodeficiency Virus)의 복제 및 증식을 억제하기 위한 RNA 앱타머를 개발하기 위해 연구 노력하였다. 그 결과, 숙주세포에 감염시 HIV 유전자 전사에 필수적인 전사연장 인자 P-TEFb (Positive Transcription Elongation Factor b)의 주요 서브유닛인 HT1 (Human cyclin T1) 단백질을 표적으로 하여, 이 단백질에 특이적으로 결합할 수 있는 RNA 앱타머를 선별하였고, 이 선별된 RNA 앱타머가 HT1 단백질과 이의 결합 파트너인 Cdk9 (cyclin-dependent kinase 9) 단백질과의 상호결합을 매우 효과적으로 저해한다는 것을 실험적으로 확인함으로써 본 발명을 완성하였다. The present inventors have tried to develop RNA aptamers for inhibiting the replication and proliferation of HIV (Human Immunodeficiency Virus). As a result, it specifically targets HT1 (Human cyclin T1) protein, a major subunit of the transcriptional transcription factor P-TEFb (P-TEFb), which is essential for HIV gene transcription when infected with host cells. The present invention was completed by experimentally confirming that RNA aptamers can be selected and that the selected RNA aptamers effectively inhibit the interaction of HT1 protein with its binding partner Cdk9 (cyclin-dependent kinase 9) protein. It was.

따라서, 본 발명의 목적은 HT1 (Human cyclin T1) 단백질에 특이적으로 결합하는 RNA 올리고뉴클레오타이드를 제공하는 것에 있다. Accordingly, an object of the present invention is to provide an RNA oligonucleotide that specifically binds to HT1 (Human cyclin T1) protein.

본 발명의 다른 목적은 상기 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질과 Cdk9 (cyclin-dependent kinase 9) 단백질과의 결합 저해제를 제공하는 것에 있다. Another object of the present invention is to provide a binding inhibitor of the HT1 protein and the Cdk9 (cyclin-dependent kinase 9) protein including the RNA oligonucleotide.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드를 포함하는 HIV 증식 억제제를 제공하는 것에 있다. Still another object of the present invention is to provide an HIV growth inhibitor comprising the RNA oligonucleotide.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드를 포함하는 AIDS의 예방 또는 치료용 약제학적 조성물을 제공하는 것에 있다. Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating AIDS including the RNA oligonucleotide.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질 검출용 조성물을 제공하는 것에 있다. Another object of the present invention to provide a composition for detecting HT1 protein comprising the RNA oligonucleotide.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드가 고정화된 기판을 포함하는 HT1 단백질 검출용 마이크로어레이를 제공하는 것에 있다. Still another object of the present invention is to provide a microarray for detecting HT1 protein including a substrate on which the RNA oligonucleotide is immobilized.

본 발명의 또 다른 목적은 HIV의 감염 진단에 필요한 정보를 제공하기 위해 상기 RNA 올리고뉴클레오타이드를 이용하여 HT1 단백질의 발현 수준을 측정 방법을 제공하는 것에 있다. Another object of the present invention to provide a method for measuring the expression level of HT1 protein using the RNA oligonucleotide to provide information necessary for the diagnosis of infection of HIV.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질 분리용 조성물을 제공하는 것에 있다. Another object of the present invention is to provide a composition for separating HT1 protein comprising the RNA oligonucleotide.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드를 이용하여 HT1 단백질을 분리하는 방법을 제공하는 것에 있다. Still another object of the present invention is to provide a method for separating HT1 protein using the RNA oligonucleotide.

본 발명의 또 다른 목적은 상기 RNA 올리고뉴클레오타이드를 이용하여 HT1 단백질과 Cdk9 단백질과의 결합을 저해하는 물질을 스크리닝하는 방법을 제공하는 것에 있다.
Still another object of the present invention is to provide a method for screening a substance that inhibits binding of HT1 protein and Cdk9 protein by using the RNA oligonucleotide.

본 발명의 목적 및 장점은 하기의 발명의 상세한 설명, 청구의 범위 및 도면에 의해 보다 명확하게 된다.
The objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 HT1 (Human cyclin T1) 단백질에 특이적으로 결합하는 RNA 올리고뉴클레오타이드에 관한 것이다. According to one aspect of the invention, the invention relates to an RNA oligonucleotide that specifically binds to HT1 (Human cyclin T1) protein.

본 발명의 바람직한 일 구현예에 의하면, 상기 RNA 올리고뉴클레오타이드는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는다. According to one preferred embodiment of the present invention, the RNA oligonucleotide has a sequence of any one of the first to ninth sequence of the sequence listing.

본 발명의 다른 바람직한 일 구현예에 의하면, 상기 RNA 올리고뉴클레오타이드는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열과 90％ 이상의 서열 동일성을 갖는 서열을 포함한다. According to another preferred embodiment of the present invention, the RNA oligonucleotide comprises a sequence having at least 90% sequence identity with any one of SEQ ID NO: 1 to 9 sequences.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질과 Cdk9 (cyclin-dependent kinase 9) 단백질과의 결합 저해제에 관한 것이다. According to another aspect of the present invention, the present invention is a binding inhibitor of the HT1 protein and the Cdk9 (cyclin-dependent kinase 9) protein comprising an RNA oligonucleotide having any one of SEQ ID NO: 1 to 9 It is about.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 유효성분으로 포함하는 HIV (Human Immunodeficiency Virus)의 증식 억제제에 관한 것이다. According to another aspect of the present invention, the present invention relates to a proliferation inhibitor of HIV (Human Immunodeficiency Virus) comprising an RNA oligonucleotide having any one sequence of SEQ ID NO: 1 to 9 as an active ingredient.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 유효성분으로 포함하는 AIDS (Acquired Immunodeficiency Syndrome) 예방 또는 치료용 약제학적 조성물에 관한 것이다. According to another aspect of the invention, the present invention is a pharmaceutical composition for preventing or treating AIDS (Acquired Immunodeficiency Syndrome) comprising an RNA oligonucleotide having any one sequence of SEQ ID NO: 1 to 9 sequence as an active ingredient It is about.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질 검출용 조성물에 관한 것이다. According to another aspect of the invention, the invention relates to a composition for detecting HT1 protein comprising an RNA oligonucleotide having any one of SEQ ID NO: 1 to 9 sequences.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드가 고정화된 기판을 갖는 HT1 단백질 검출용 마이크로어레이에 관한 것이다. According to another aspect of the present invention, the present invention relates to a microarray for detecting a HT1 protein having a substrate to which an RNA oligonucleotide having a sequence of any one of SEQ ID NOs: 1 to 9 is immobilized.

본 발명의 다른 일 양태에 따르면, 본 발명은 HIV의 감염 진단에 필요한 정보를 제공하기 위해 HT1 단백질의 발현 수준을 측정하는 방법으로서 다음의 단계를 포함하는 방법에 관한 것이다: (a) 생물학적 시료와 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 접촉시키는 단계; 및 (b) 상기 RNA 올리고뉴클레오타이드에 결합된 HT1 단백질을 검출하는 단계. According to another aspect of the present invention, the present invention relates to a method for measuring the expression level of HT1 protein to provide information necessary for diagnosing infection of HIV, comprising the following steps: (a) a biological sample; Contacting an RNA oligonucleotide having a sequence of any one of SEQ ID NOs: 1-9; And (b) detecting the HT1 protein bound to the RNA oligonucleotide.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질 분리용 조성물에 관한 것이다. According to another aspect of the present invention, the present invention relates to a composition for separating HT1 protein comprising an RNA oligonucleotide having any one of SEQ ID NO: 1 to 9 sequences.

본 발명의 다른 일 양태에 따르면, 본 발명은 다음의 단계를 포함하는 HT1 단백질을 분리하는 방법에 관한 것이다: (a) 시료와 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 접촉시켜 RNA 올리고뉴클레오타이드와 HT1 단백질의 복합체를 형성시키는 단계; 및 (b) 상기 복합체를 회수하여 RNA 올리고뉴클레오타이드로부터 HT1 단백질을 분리하는 단계. According to another aspect of the present invention, the present invention relates to a method for separating an HT1 protein comprising the following steps: (a) RNA having a sequence of any one of the first to ninth sequences Contacting the oligonucleotide to form a complex of the RNA oligonucleotide and the HT1 protein; And (b) recovering the complex to separate HT1 protein from RNA oligonucleotides.

본 발명의 다른 일 양태에 따르면, 본 발명은 다음의 단계를 포함하는 HT1 단백질과 Cdk9 단백질과의 결합을 억제하는 물질을 스크리닝 하는 방법에 관한 것이다: (a) 후보물질의 존재하에 HT1 단백질과 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 인큐베이션(incubation)하는 단계; 및 (b) 상기 RNA 올리고뉴클레오타이드에 결합된 HT1 단백질의 양을 측정하는 단계로서, 후보물질의 존재하에서 상기 RNA 올리고뉴클레오타이드에 결합되는 HT1 단백질의 양이 후보물질의 부존재하에서 보다 감소되는 경우 상기 후보물질이 HT1 단백질과 Cdk9 단백질과의 결합을 억제할 수 있는 물질임을 암시하는 단계.
According to another aspect of the present invention, the present invention relates to a method for screening a substance that inhibits binding of HT1 protein and Cdk9 protein, comprising the following steps: (a) HT1 protein and sequence in the presence of a candidate Incubating an RNA oligonucleotide having a sequence of any of the first through ninth sequences; And (b) measuring the amount of HT1 protein bound to the RNA oligonucleotide, wherein the amount of HT1 protein bound to the RNA oligonucleotide in the presence of the candidate is further reduced in the absence of the candidate. Implying that the substance can inhibit the binding of the HT1 protein to the Cdk9 protein.

이하에서 본 발명의 내용을 보다 상세히 설명한다. Hereinafter, the content of the present invention will be described in more detail.

RNA 앱타머RNA aptamer

본 발명은 HT1 (Human cyclin T1) 단백질에 특이적으로 결합하는 RNA 올리고뉴클레오타이드에 관한 것이다. The present invention relates to RNA oligonucleotides that specifically bind to HT1 (Human cyclin T1) protein.

본 명세서에서 용어 "RNA 앱타머(aptamer)"는 특정 분자에 고친화성 및 특이성으로 결합할 수 있는 RNA 핵산 분자를 의미한다(Ellington et al., Nature 346, 818-22, 1990; 및 Tuerk et al., Science 249, 505-10, 1990). As used herein, the term “RNA aptamer” refers to an RNA nucleic acid molecule capable of binding to a particular molecule with high affinity and specificity (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al. , Science 249, 505-10, 1990).

본 명세서에서 "RNA 앱타머"는 "RNA 올리고뉴클레오타이드"와 혼용하여 사용한다. 본 명세서에서 용어 "올리고뉴클레오타이드"는 일반적으로 길이가 약 200개 미만을 갖는 뉴클레오타이드 중합체를 지칭하며, 이에는 DNA 및 RNA가 포함될 수 있으며, 바람직하게는 RNA 핵산 분자이다. 뉴클레오타이드는 데옥시리보뉴클레오타이드, 리보뉴클레오타이드, 변형된 뉴클레오타이드 또는 염기, 및/또는 그들의 유사체, 또는 DNA 또는 RNA 폴리머라제에 의해 또는 합성 반응에 의해 중합체 내로 도입될 수 있는 모든 기질일 수 있다. 뉴클레오타이드 구조에 대한 변형이 존재하는 경우, 이러한 변형은 올리고뉴클레오타이드 중합체의 합성 전에 또는 후에 추가될 수 있다. 뉴클레오타이드 서열은 비-뉴클레오타이드 성분에 의해 중단될 수 있다. 올리고뉴클레오타이드는 합성 후에, 예를 들어 표지와의 결합에 의해 추가로 변형시킬 수 있다. As used herein, "RNA aptamer" is used interchangeably with "RNA oligonucleotide." The term “oligonucleotide” herein generally refers to a nucleotide polymer having less than about 200 lengths, which may include DNA and RNA, and is preferably an RNA nucleic acid molecule. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be introduced into the polymer by DNA or RNA polymerase or by a synthetic reaction. If modifications to the nucleotide structure are present, such modifications may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be terminated by a non-nucleotide component. Oligonucleotides can be further modified after synthesis, for example by binding to a label.

앱타머는 전형적으로는 타겟 분자의 결합에 대한 시험관내 선택법에 의해 얻을 수 있다. 관심의 타겟 분자에 특이적으로 결합하는 앱타머를 선택하는 방법은 당분야에서 공지되어 있다. 예를 들어, 유기 분자, 뉴클레오타이드, 아미노산, 폴리펩타이드, 세포 표면상의 마커분자, 이온, 금속, 염, 다당류가 각 리간드에 특이적으로 결합할 수 있는 앱타머를 분리해내는데 적절한 타겟 분자가 될 수 있다. 앱타머의 선별은 SELEX 방법으로 알려진 공지된 생체내 또는 시험관내 선택 기술을 이용할 수 있다(Ellington et al., Nature 346, 818-22, 1990; 및 Tuerk et al., Science 249, 505-10, 1990). 앱타머의 선별 및 제조에 대한 구체적인 방법은 미국특허 5,582,981, WO 00/20040, 미국특허 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al.,Biochemistry 36:9726 (1997), Blind, Proc. Natl. Acad. Sci. USA 96:3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34:656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 및 미국특허 5,756,291에 기재되어 있으며, 상기 문헌들은 본 명세서에 참조로써 삽입된다. Aptamers are typically obtainable by in vitro selection methods for binding of target molecules. Methods of selecting aptamers that specifically bind to a target molecule of interest are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, and polysaccharides can be suitable target molecules to isolate aptamers that can specifically bind to each ligand. have. The selection of aptamers can use known in vivo or in vitro selection techniques known as SELEX methods (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al., Science 249, 505-10, 1990). Specific methods for the selection and preparation of aptamers are described in US Pat. No. 5,582,981, WO 00/20040, US Pat. No. 5,270,163, Lorsch and Szostak, Biochemistry, 33: 973 (1994), Mannironi et al., Biochemistry 36: 9726 (1997), Blind, Proc. Natl. Acad. Sci. USA 96: 3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34: 656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 and US Pat. No. 5,756,291, supra. Are incorporated herein by reference.

본 발명의 RNA 앱타는 바람직하게는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 포함한다. 본 발명의 서열목록 제 1 서열 내지 제 9 서열의 RNA 앱타머는 본 명세서 도 4a 내지 도 4d에 도시된 2차 구조를 형성할 것으로 추정된다. The RNA aptamer of the present invention preferably comprises a sequence of any one of the first to ninth sequences of the sequence listing. RNA aptamers of SEQ ID NOS 1 to 9 of the present invention are assumed to form secondary structures shown in FIGS. 4A-4D herein.

또한, 본 발명의 RNA 앱타머는 HT1 단백질에 결합하는 특성을 유지하면서, 상기 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열에 대하여 실질적인 동일성을 나타내는 뉴클레오타이드 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 뉴클레오타이드 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘 (Smith and Waterman, Adv. Appl. Math. 2:482(1981) Needleman and Wunsch, J. Mol. Bio. 48:443(1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31(1988); Higgins and Sharp, Gene 73:237-44(1988); Higgins and Sharp, CABIOS 5:151-3(1989); Corpet et al., Nuc. Acids Res. 16:10881-90(1988); Huang et al., Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al., Meth. Mol. Biol. 24:307-31(1994))을 이용하여 얼라인된 서열을 분석한 경우에, 최소 90％의 상동성, 보다 바람직하게는 최소 95％의 상동성, 가장 바람직하게는 최소 98％의 상동성을 나타내는 뉴클레오타이드 서열을 의미한다.
In addition, the RNA aptamer of the present invention is interpreted to include a nucleotide sequence that exhibits substantial identity to any one of the sequences of the first to ninth sequences, while maintaining the property of binding to the HT1 protein. The substantial identity above aligns the nucleotide sequence of the present invention with any other sequence to the maximum correspondence, and the algorithm commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2: 482 (1981) ) Needleman and Wunsch, J. Mol. Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988) Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc.Acids Res. 16: 10881-90 (1988); Huang et al., Comp.Appl. BioSci. 8: 155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 (1994)), at least 90% homology, more preferably at least 95 By nucleotide sequence exhibiting% homology, most preferably at least 98% homology.

HT1 (Human cyclin T1) 단백질 특이적 결합HT1 (Human cyclin T1) protein specific binding

본 발명에서 "HT1 (Human cyclin T1) 단백질"은 고도로 보존된 사이클린 패밀리(cyclin family)에 속하는 CCNT1 유전자에 의해 코딩되는 인간 단백질이다. 일반적으로 사이클린은 CDK (cyclin dependent kinase) 키나아제의 조절자로서 작용하며, 이 패밀리에 속하는 각각의 상이한 사이클린들은 상이한 발현 및 분해 패턴을 나타내어 세포 유사분열의 각 단계를 시기적으로 조절하는 것으로 알려져 있다. In the present invention, "HT1 (Human cyclin T1) protein" is a human protein encoded by the CCNT1 gene belonging to the highly conserved cyclin family. Cyclin generally acts as a modulator of cyclin dependent kinase (CDK) kinase, and each of the different cyclins belonging to this family is known to exhibit different expression and degradation patterns, thereby regulating each stage of cell mitosis.

본 발명의 HT1 사이클린 단백질은 Cdk9 (cyclin-dependent kinase 9)과 강하게 결합하여 전사 연장 인자 p-TEFb (Positive Transcription Elongation Factor b)의 주요 서브유닛을 구성한다(Young, Tara M et al., Mol. Cell. Biol. 23 (18): 6373??84). HT1 단백질 및 Cdk9 단백질을 포함하는 pTEFb 전사 연장 인자는 HIV 바이러스의 Tat 단백질과 상호작용하는 이의 보조인자(cofactor)로서 기능하고, 이 전사연장인자의 정상적인 활성은 HIV의 바이러스 완전한 전사 활성에 필수적으로 요구된다. The HT1 cyclin protein of the present invention binds strongly to cyclin-dependent kinase 9 (Cdk9) and constitutes a major subunit of the transcriptional transcription factor p-TEFb (Young, Tara M et al., Mol. Cell. Biol. 23 (18): 6373 ?? 84). The pTEFb transcription prolongation factor, including the HT1 protein and Cdk9 protein, functions as a cofactor of its interaction with the Tat protein of the HIV virus, and the normal activity of this transcription extension factor is essential for the viral complete transcriptional activity of HIV. do.

하기 본 발명의 구체적인 일 실시예에서 입증되는 바와 같이, 본 발명의 RNA 앱타머는 HT1 단백질과 특이적으로 결합하며, HT1 단백질과 Cdk9 단백질과의 결합을 효과적으로 저해한다. As demonstrated in one specific embodiment of the present invention, the RNA aptamer of the present invention specifically binds to HT1 protein and effectively inhibits the binding of HT1 protein to Cdk9 protein.

HIV 증식 억제HIV proliferation suppression

본 발명의 HT1 단백질에 특이적으로 결합하는 RNA 앱타머는 HT1 단백질과 Cdk9 단백질과의 결합을 효과적으로 저해함으로써 숙주세포에 감염한 HIV의 바이러스 전사(viral transcription)을 억제하여 이의 증식 및 복제를 저해할 수 있다. 이와 같은 HIV 저해 기작은 상기에서 설명된 바와 같이, HT1 및 Cdk9 단백질이 주요 서브유닛으로 하여 구성되는 p-TEFb 전사연장 인자가 HIV 바이러스의 유전자 전사에 필수적으로 요구된다는 공지된 사실에 기초한다. 본 발명의 HIV 증식 저해제는 본 발명의 RNA 앱타머를 유효성분으로 포함한다. 본 발명에서의 HIV 바이러스는 HIV 타입 1 (HIV-1) 또는 HIV 타입 2 (HIV-2)를 모두 포함하며, 바람직하게는 HIV-1이다. 본 발명의 HIV 증식 저해제의 유효성분인 RNA 앱타머는 RNA 앱타머로 전사될 수 있는 DNA 형태로 세포내로 도입될 수 있고, RNA 앱타머 자체가 세포 내로 도입될 수 있다. 본 발명의 RNA 앱타머는 HIV 바이러스 유전자의 전사를 억제함으로써 HIV에 의해 유도되는 질환인 AIDS (Acquired Immunodeficiency Syndrome)의 치료 및 예방 용도로도 사용될 수 있다. The RNA aptamer specifically binding to the HT1 protein of the present invention can inhibit the viral transcription of HIV infected with host cells by effectively inhibiting the binding of the HT1 protein to the Cdk9 protein, thereby inhibiting its proliferation and replication. have. This mechanism of HIV inhibition is based on the known fact that the p-TEFb transcription-extension factor, consisting of HT1 and Cdk9 proteins as major subunits, is essentially required for gene transcription of HIV viruses, as described above. The HIV growth inhibitor of the present invention includes the RNA aptamer of the present invention as an active ingredient. The HIV virus in the present invention includes both HIV type 1 (HIV-1) or HIV type 2 (HIV-2), preferably HIV-1. The RNA aptamer, which is an active ingredient of the HIV growth inhibitor of the present invention, may be introduced into a cell in the form of DNA capable of being transcribed into an RNA aptamer, and the RNA aptamer itself may be introduced into the cell. The RNA aptamer of the present invention can also be used for the treatment and prevention of AIDS (Acquired Immunodeficiency Syndrome), a disease induced by HIV by inhibiting the transcription of HIV viral genes.

약제학적 조성물Pharmaceutical composition

본 발명의 RNA 앱타머는 약제학적으로 허용되는 담체와 함께 제형화된다. 예를 들어, RNA 앱타머 자체 또는 이를 코딩하는 DNA 핵산 분자는 단독으로 또는 약제학적 제형의 성분으로서 투여될 수 있다. RNA aptamers of the invention are formulated with a pharmaceutically acceptable carrier. For example, the RNA aptamer itself or DNA nucleic acid molecules encoding it can be administered alone or as a component of a pharmaceutical formulation.

본 발명의 RNA 앱타머가 약제학적 유효성분으로 사용되는 경우 생체내에서의 안정성을 높이기 위해 다양한 화학적 변형이 가해질 수 있다. 예를 들어, RNase에 대한 내성을 높이기 위해 RNA 핵산의 리보오스(ribose)의 2'-OH 그룹 대신에 2'-F, 2'-NH2, 2'-O-메틸 그룹으로 치환될 수 있다. 이러한 화학적 변형은 혈청내 반감기를 증가시킬 수 있다. 또한, 혈액내에서의 RNA 앱타머의 신속한 클리어런스(rapid clearance) 가능성을 줄이기 위해 PEG 또는 콜레스테롤과 같은 고분자 물질을 RNA 앱타머에 부착(conjugate)시킬 수 있다. When the RNA aptamer of the present invention is used as a pharmaceutical active ingredient, various chemical modifications may be made to increase stability in vivo. For example, in order to increase resistance to RNase, it may be substituted with 2'-F, 2'-NH 2 , 2'-O-methyl group instead of 2'-OH group of ribose of RNA nucleic acid. Such chemical modifications can increase serum half-life. In addition, polymeric substances such as PEG or cholesterol can be conjugated to RNA aptamers to reduce the likelihood of rapid clearance of RNA aptamers in the blood.

본 발명의 약제학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함할 수 있으며, 이러한 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다. The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier in addition to the active ingredient. Such a carrier is conventionally used in the present invention and includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, , Calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and Mineral oil, and the like, but are not limited thereto. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 한편, 본 발명의 약제학적 조성물의 경구 투여량은 바람직하게는 1일 당 0.0001-100 mg/kg(체중)이다. The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . On the other hand, the oral dosage of the pharmaceutical composition of the present invention is preferably 0.0001-100 mg / kg (body weight) per day.

본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구로 투여되는 경우, 피부에 국소적으로 도포, 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있다. The pharmaceutical composition of the present invention can be administered orally or parenterally, and when administered parenterally, it can be administered by local application to the skin, intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, transdermal administration, .

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

HT1 단백질의 검출Detection of HT1 Protein

본 발명의 RNA 앱타머의 HT1 단백질과의 특이적 결합 특성을 이용하여 HT1 단백질을 검출할 수 있다. HT1 protein can be detected using the specific binding properties of the RNA aptamer of the invention with HT1 protein.

본 발명의 검출방법은 RNA 앱타머와 HT1 단백질의 복합체를 검출하는 방법에 기초한다. 복합체의 검출을 용이하게 하기 위해 본 발명의 RNA 앱타머가 형광물질, 예를 들어 플루오레세인(fulorescein), Cy3 또는 Cy5; 방사성물질, 또는 화학물질, 예를 들어 바이오틴(biotin)으로 표지되거나 1차 아민(primary amine)으로 변형된 뉴클레오타이드를 포함할 수 있다. The detection method of the present invention is based on a method for detecting a complex of RNA aptamer and HT1 protein. To facilitate the detection of complexes, the RNA aptamers of the present invention may be selected from fluorescent materials, such as fluorescein, Cy3 or Cy5; Radioactive materials, or chemicals, such as nucleotides labeled with biotin or modified with primary amines.

본 발명에서 본 발명의 RNA 앱타머가 고정화된 기판(substrate)을 포함하는 마이크로어레이(microarray) 형태를 사용하여 HT1 단백질을 검출할 수 있다. 본 명세서에서 "마이크로 어레이"는 기판의 특정의 영역에 유전 물질이 고밀도로 부착된 어레이(배열)를 의미한다. 본 명세서에서 용어 상기 마이크로어레이의 "기판"은 적합한 견고성 또는 반-견고성을 갖는 지지체를 의미하며, 예컨대, 유리(glass), 막(membrane), 슬라이드, 필터, 칩, 웨이퍼, 파이버, 자기성 비드 또는 비자기성 비드, 겔, 튜빙, 플레이트, 고분자, 미소입자 및 모세관을 포함하나 이에 한정되지 않는다. 본 발명의 RNA 앱타머는 상기 기판상에 배열되고 고정화된다. 이와 같은 고정화는 화학적 결합 방법 또는 UV와 같은 공유 결합적 방법에 의해 실시된다. In the present invention, the HT1 protein may be detected using a microarray form including a substrate to which the RNA aptamer of the present invention is immobilized. By "microarray" is meant herein an array (array) in which dielectric material is densely attached to a particular area of a substrate. As used herein, the term "substrate" of the microarray means a support having suitable firmness or semi-rigidity, for example glass, membrane, slide, filter, chip, wafer, fiber, magnetic beads Or nonmagnetic beads, gels, tubing, plates, polymers, microparticles, and capillaries. RNA aptamers of the invention are arranged and immobilized on the substrate. This immobilization is carried out by chemical bonding methods or by covalent binding methods such as UV.

본 발명의 RNA 앱타머는 예를 들어, 바이오티닐화(biotinylated)화될 수 있고, 이는 스트랩타비딘(streptavidin)을 코팅된 기판상에 성공적으로 결합될 수 있다. 기판상에 고정화된 본 발명의 RNA 앱타머는 HT1 단백질을 포획할 수 있다. RNA 앱타머의 타겟 분자의 검출용도로서의 응용에 대한 내용은 문헌 "Bunka DH and Stockley PG. (2006) Nat Rev Microbiol. 4, 588-596"에 기재되어 있으며, 이는 본 명세서에 참조로써 삽입된다. The RNA aptamers of the present invention can be biotinylated, for example, which can successfully bind streptavidin onto a coated substrate. RNA aptamers of the invention immobilized on a substrate can capture HT1 protein. The application of RNA aptamers as detectable target molecules is described in Bunka DH and Stockley PG. (2006) Nat Rev Microbiol. 4, 588-596, which is incorporated herein by reference.

본 발명에서 HT1 단백질의 검출은 HIV 감염 진단에 유용한 정보로 사용될 수 있다. 구체적으로, HIV 감염 및 증식에 따라서 감염된 숙주 세포내에서는 HT1 단백질의 발현 수준이 증가하게 되고, 발현되어 증가된 HT1 단백질의 수준을 측정함으로써 HIV 감염 여부를 판단할 수 있다. In the present invention, the detection of HT1 protein can be used as useful information for diagnosing HIV infection. Specifically, according to HIV infection and proliferation, the expression level of the HT1 protein is increased in the infected host cells, and the HIV infection may be determined by measuring the level of the expressed and increased HT1 protein.

본 발명에서 HIV의 감염 진단에 필요한 정보를 제공하기 위해 HT1 단백질의 발현 수준을 측정하는 것은 다음의 단계를 포함하여 이루어진다: (a) 생물학적 시료와 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 접촉시키는 단계; 및 (b) 상기 RNA 올리고뉴클레오타이드에 결합된 HT1 단백질을 검출하는 단계. In the present invention, measuring the expression level of the HT1 protein to provide information necessary for diagnosing infection of HIV includes the following steps: (a) the biological sample and the sequence list of any one of the first to ninth sequences. Contacting the RNA oligonucleotide having the sequence; And (b) detecting the HT1 protein bound to the RNA oligonucleotide.

상기 용어"생물학적 시료"는 혈액, 타액, 누액, 요액, 활액, 점액, 세포, 조직, 및 기타 다른 조직 및 체액을 포함할 수 있으며, 세포 배양 상등액, 파열된 진핵세포 및 세균 발현계 등도 포함하지만, 이에 제한되지는 않는다. The term "biological sample" may include blood, saliva, tear fluid, urine, synovial fluid, mucus, cells, tissues, and other tissues and body fluids, including cell culture supernatants, ruptured eukaryotic cells and bacterial expression systems, etc. However, it is not limited thereto.

본 발명에서 HT1 단백질 검출용 조성물은 키트의 형태로 제공될 수 있다. 본 발명에서 키트는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 앱타머를 유효성분으로 포함한다. 본 발명에서의 키트는 시료 중의 HT1 단백질 검출에 키트를 사용하기 위한 설명서 또는 라벨을 추가로 포함할 수 있다.
In the present invention, the composition for detecting HT1 protein may be provided in the form of a kit. In the present invention, the kit includes an RNA aptamer having any one of SEQ ID NOs: 1 to 9 as the active ingredient. Kits in the present invention may further comprise instructions or labels for using the kit to detect HT1 protein in a sample.

HT1 단백질의 분리Isolation of HT1 Protein

본 발명의 RNA 앱타머의 HT1 단백질의 특이적 결합 특성을 이용하면, HT1 단백질을 분리 및 정제에 응용할 수 있다. 본 발명에서 HT1 단백질의 분리는 RNA 앱타머와 HT1 단백질의 결합 복합체를 형성시킨 후, 이 복합체로부터 HT1 단백질을 분리시켜 회수하는 결합 분석(binding assay) 방법에 기초하여 이루어진다. 이러한 결합 분석 방법의 예는 당업계에 잘 공지되어 있다. By utilizing the specific binding properties of the HT1 protein of the RNA aptamer of the present invention, the HT1 protein can be applied to isolation and purification. In the present invention, the separation of the HT1 protein is based on a binding assay method of forming a binding complex of RNA aptamer and HT1 protein and then separating and recovering the HT1 protein from the complex. Examples of such binding assay methods are well known in the art.

본 발명의 RNA 앱타머 분자는 비드(bead) 또는 레진(resin)과 같은 지지체에 결합될 수 있으며, 결합된 RNA 앱타머는 리간드인 HT1 단백질을 포획(capture)할 수 있다. RNA 앱타머의 지지체로의 결합은 예를 들어, RNA 앱타머를 바이오티닐화시키고, 지지체의 표면을 스트랩타비딘으로 코팅하여, RNA 앱타머를 지지체상에 용이하게 결합시킬 수 있다. 상기 HT1 단백질이 결합되어 포획된 RNA 앱타머 비드를 용이하게 회수하기 위해서 지지체로서 자성 비드(magnetic bead)를 사용할 수 있다. The RNA aptamer molecule of the present invention may be bound to a support such as beads or resins, and the bound RNA aptamer may capture the ligand HT1 protein. Binding of the RNA aptamer to the support can, for example, biotinylate the RNA aptamer and coat the surface of the support with straptavidin to facilitate binding of the RNA aptamer onto the support. Magnetic beads may be used as a support to easily recover the RNA aptamer beads captured by the binding of the HT1 protein.

스크리닝 방법Screening method

본 발명의 RNA 앱타머는 HT1 단백질과 CDK9 단백질과의 결합을 억제 또는 저해하는 물질을 스크리닝 하는데 응용될 수 있다. 스크리닝 방법은 구체적으로 다음의 단계를 포함한다: (a) 후보물질의 존재하에 HT1 단백질과 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 인큐베이션(incubation)하는 단계; 및 (b) 상기 RNA 올리고뉴클레오타이드에 결합된 HT1 단백질의 양을 측정하는 단계로서, 후보물질의 존재하에서 상기 RNA 올리고뉴클레오타이드에 결합되는 HT1 단백질의 양이 후보물질의 부존재하에서 보다 감소되는 경우 상기 후보물질이 HT1 단백질과 Cdk9 단백질과의 결합을 억제할 수 있는 물질임을 지시하는 단계. The RNA aptamer of the present invention can be applied to screen for substances that inhibit or inhibit the binding of HT1 protein and CDK9 protein. The screening method specifically includes the following steps: (a) incubating an RNA oligonucleotide having a HT1 protein and any one of SEQ ID NOs: 1-9 in the presence of a candidate; And (b) measuring the amount of HT1 protein bound to the RNA oligonucleotide, wherein the amount of HT1 protein bound to the RNA oligonucleotide in the presence of the candidate is further reduced in the absence of the candidate. Indicating that the substance is capable of inhibiting the binding between the HT1 protein and the Cdk9 protein.

본 발명의 스크리닝 방법은 기본적으로 HT1 단백질과 본 발명의 RNA 앱타머, 바람직하게는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드와의 결합을 경쟁적으로 저해(competitive inhibition) 하는 후보물질을 검색하는 방법에 기초한다. HT1 단백질과 본 발명의 RNA 앱타머의 특이적 결합을 저해하는 후보물질은 HT1 단백질과 Cdk9 단백질과의 결합도 저해할 것으로 기대된다. 본 발명의 방법은 다양한 스크리닝 방법을 적용하여 행할 수 있으며, 특히 HTS (high-throughput screening)에 적합하다. 본 발명에서 후보물질은 천연물 또는 화학적 합성 방법 및 조합에 의해 생산한 화합물의 라이브러리를 포함할 수 있다. 예를 들어, 비-펩타이드성 유기분자, 펩타이드, 폴리펩타이드, 당, 호르몬, 핵산분자, 소분자(small molecule) 라이브러리가 포함된다. RNA 앱타머와 HT1 단백질이 결합된 복합체의 양은 상기 설명된 HT1 단백질의분리방법에서 설명된 방법을 이용하여 결정할 수 있다.
The screening method of the present invention basically competitively inhibits the binding of the HT1 protein to the RNA oligomer of the present invention, preferably an RNA oligonucleotide having any one of SEQ ID NOS: 1-9. Is based on the method of searching for candidate substances. Candidates that inhibit the specific binding of the HT1 protein with the RNA aptamer of the present invention are expected to inhibit the binding of the HT1 protein with the Cdk9 protein. The method of the present invention can be carried out by applying various screening methods, and is particularly suitable for high-throughput screening (HTS). Candidates in the present invention may include a library of compounds produced by natural products or chemical synthesis methods and combinations. For example, non-peptidic organic molecules, peptides, polypeptides, sugars, hormones, nucleic acid molecules, small molecule libraries are included. The amount of the conjugated RNA aptamer and HT1 protein can be determined using the method described in the above-described method for separating HT1 protein.

상기 설명된 본 발명 방법의 실시는 달리 지적되지 않는 한, 당해 분야에 속하는 세포 생물학, 세포 배양학, 분자 생물학, 유전자 도입 생물학, 미생물학, 재조합 DNA, 및 면역학에 관한 통상의 기술을 사용할 것이다. 상기 기술은 문헌에 충분히 설명되어 있다. 예를 들어, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (2001); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, In Enzymology (Academic Press, Inc., N. Y.); Gne Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); 방법 In Enzymology, VoIs. 154 and 155 (Wu et al. eds.), Immunochemmical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-rV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1986) 참조할 수 있다.
The practice of the methods of the invention described above will use conventional techniques relating to cell biology, cell culture, molecular biology, transduction biology, microbiology, recombinant DNA, and immunology, unless otherwise indicated. Such techniques are explained fully in the literature. See, eg, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (2001); DNA Cloning, Volumes I and II (DN Glover ed., 1985); Oligonucleotide Synthesis (MJ Gait ed., 1984); Mullis et al. US Patent No: 4,683,195; Nucleic Acid Hybridization (BD Hames & SJ Higgins eds. 1984); Transcription And Translation (BD Hames & SJ Higgins eds. 1984); Culture Of Animal Cells (RI Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, In Enzymology (Academic Press, Inc., NY); Gne Transfer Vectors For Mammalian Cells (JH Miller and MP Calos eds., 1987, Cold Spring Harbor Laboratory); Method In Enzymology, VoIs. 154 and 155 (Wu et al. Eds.), Immunochemmical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-rV (DM Weir and CC Blackwell, eds., 1986); See Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986).

본 발명은 HT1 (Human cyclin T1) 단백질에 특이적으로 결합하는 RNA 앱타머(aptamer) 및 이의 용도에 관한 것이다. 본 발명의 RNA 앱타머는 HT1 단백질에 특이적으로 결합함으로써 HT1 단백질과 이의 결합 파트너인 Cdk9 (cyclin-dependent kinase 9) 단백질과의 상호작용을 억제하여, 이들 단백질들이 서브유닛으로 구성되는 전사연장 인자 p-TEFb (Positive Transcription Elongation Factor b)의 활성을 저해하고, 이로써 숙주세포에 감염한 HIV (Human Immunodeficiency Virus)의 복제가 억제된다. 따라서, 본 발명의 RNA 앱타머는 HIV의 증식을 억제하는 AIDS 치료용 약물로 개발될 수 있다.
The present invention relates to an RNA aptamer and its use specifically binding to HT1 (Human cyclin T1) protein. The RNA aptamer of the present invention specifically inhibits the interaction between the HT1 protein and its binding partner Cdk9 (cyclin-dependent kinase 9) protein by specifically binding to the HT1 protein, and thus the transcriptional extension factor p in which these proteins are composed of subunits. It inhibits the activity of -TEFb (Positive Transcription Elongation Factor b), which inhibits the replication of Human Immunodeficiency Virus (HIV) infected with host cells. Therefore, the RNA aptamer of the present invention can be developed as a drug for treating AIDS that inhibits the proliferation of HIV.

도 1은 재조합 HT1을 발현하는 벡터를 대장균에 형질도입한 후 이들로부터 생산된 HT1 단백질을 SDS-PAGE로 분석한 결과를 나타내는 사진이다. 레인 1: pET21a 발현 벡터를 BL21(DE3) 균주에 형질도입하여 제조한 형질전환체의 배양액의 상층액을 SDS-PAGE 분석결과이고; 레인 2: HT1 유전자를 포함하는 pET21a 발현 벡터를 BL21(DE3) 균주에 형질도입하여 제조한 형질전환체의 배양액의 상층액을 SDS-PAGE 분석결과이며; 레인 3: HT1 유전자를 포함하는 pET21a 발현 벡터를 BL21(DE3) 균주에 형질도입하여 제조한 형질 전환체의 배양액의 상층액을 Ni-NTA 아가로스 레진(agarose resin)을 이용하여 HT1 단백질 분리 정제를 수행하여 수득한 정제 HT1 재조합 단백질의 SDS-PAGE 분석결과이다.
도 2는 랜덤 DNA 앱타머 풀을 PCR 및 시험관내 전사 기법을 이용하여 RNA 앱타머 풀로 제작한 후, 니트로셀룰로오스 여과(nitrocellulose filtration) 기반의 SELEX 방법을 이용하여 회수된 HT1과 특이적으로 결합하는 RNA 앱타머를 아가로스 전기영동을 통하여 확인한 결과를 나타내는 사진이다. 레인 M: 100 bp DNA 마커 및 이를 아가로스 전기영동을 통하여 확인한 결과이며; 레인 1: PCR 기법을 이용하여 증폭한 랜덤 DNA 앱타머 풀 산물 및 이를 아가로스 전기영동을 통하여 확인한 결과이며; 레인 2: 시험관내 전사 기법을 이용하여 랜덤 DNA 앱타머 풀을 RNA 앱타머 풀로 전환한 산물 및 이를 아가로스 전기영동을 통하여 확인한 결과이며; 레인 3: 니트로셀룰로오스 여과(nitrocellulose filtration) 기반의 SELEX 방법을 이용하여 회수된 HT1과 특이적으로 결합하는 RNA 앱타머 산물 및 이를 아가로스 전기영동을 통하여 확인한 결과이다.
도 3은 각 라운드에서 회수되는 HT1 단백질과 특이적으로 결합하는 RNA 앱타머 풀의 양을 나노드랍으로 측정하여 나타낸 결과이다.
도 4a 내지 도 4d는 HT1과 특이적으로 결합하는 RNA 앱타머 후보군들, HT1-1, HT1-2, HT1-3, HT1-4, HT1-5, HT1-6, HT1-7, HT1-8, HT1-9의 2차 구조를 나타낸 것이다.
도 5은 젤 이동분석법을 이용하여 본 발명의 HT1 단백질 결합 RNA 앱타머와 HT1 단백질간의 결합친화도를 분석한 결과를 나타낸다.
도 6은 도트 블롯팅(dot blotting) 기법을 기반으로 본 발명의 HT1 단백질 결합 RNA 앱타머가 HT1 단백질과 Cdk9 단백질간의 결합을 방해하는 것을 확인한 결과로 Cdk9 단백질, Cdk9 단백질에 특이적으로 결합하는 Cdk9 항체, 그리고 이에 특이적으로 결합하는 퍼옥시다아제 (peroxidase)가 결합되어 있는 토끼 IgG 항체를 이용하여 분석한 결과를 나타낸다.
점 1은 Cdk9 단백질 25 ng을 PVDF 막(membrane)에 스폿팅(spotting)한 후 Cdk9 단백질에 특이적으로 결합하는 항체와 이에 특이적으로 결합하는 퍼옥시다아제(peroxidase)가 결합되어 있는 토끼 IgG 항체를 이용하여 분석한 결과이다.
점 2-4은 HT1 단백질을 12.5, 25, 50 ng으로 PVDF 막에 순차적으로 스폿팅한 후 Cdk9 단백질, Cdk9 단백질에 특이적으로 결합하는 항체, 그리고 이에 특이적으로 결합하는 퍼옥시다아제가 결합되어 있는 토끼 IgG 항체를 이용하여 분석한 결과이다.
점 5는 1/2000으로 희석된 Cdk9 단백질에 특이적으로 결합하는 항체를 PVDF 막에 스폿팅한 후, 이에 특이적으로 결합하는 퍼옥시다아제가 결합되어 있는 토끼 IgG 항체를 이용하여 분석한 결과이다.
점 6-14는 HT1 결합 RNA 앱타머 HT1-1부터 HT1-9 160 pmol을 HT1 단백질 5 ng을 결합하고 PVDF 막에 스폿팅한 후, 이를 Cdk9 단백질, Cdk9 단백질에 특이적으로 결합하는 항체, 그리고 이에 특이적으로 결합하는 퍼옥시다아제가 결합되어 있는 토끼 IgG 항체를 이용하여 분석한 결과이다. Figure 1 is a photograph showing the results of analyzing the HT1 protein produced from them after transducing a vector expressing recombinant HT1 to E. coli. Lane 1: the supernatant of the culture medium of the transformant prepared by transducing the pET21a expression vector to the BL21 (DE3) strain; Lane 2: the supernatant of the culture medium of the transformant prepared by transducing the pET21a expression vector containing the HT1 gene into the BL21 (DE3) strain; Lane 3: HT1 protein isolation and purification was performed using Ni-NTA agarose resin on the supernatant of the culture medium of the transformant prepared by transducing pET21a expression vector containing HT1 gene into BL21 (DE3) strain. SDS-PAGE analysis of the purified HT1 recombinant protein obtained.
Figure 2 is a RNA aptamer pool using a random DNA aptamer pool using PCR and in vitro transcription techniques, and then specifically binds to HT1 RNA recovered using a nitrocellulose filtration-based SELEX method The photograph shows the result of aptamer confirmed through agarose electrophoresis. Lane M: 100 bp DNA marker and its results were confirmed by agarose electrophoresis; Lane 1: random DNA aptamer pool product amplified by PCR and the result confirmed by agarose electrophoresis; Lane 2: the product obtained by converting the random DNA aptamer pool to the RNA aptamer pool using an in vitro transcription technique and confirmed by agarose electrophoresis; Lane 3: RNA aptamer product specifically binding to the recovered HT1 using nitrocellulose filtration-based SELEX method and agarose electrophoresis.
Figure 3 is a result of measuring the amount of RNA aptamer pools specifically binding to the HT1 protein recovered in each round measured by nanodrops.
4A to 4D show RNA aptamer candidate groups specifically binding to HT1, HT1-1, HT1-2, HT1-3, HT1-4, HT1-5, HT1-6, HT1-7, HT1-8 , HT1-9 shows the secondary structure.
Figure 5 shows the results of analyzing the binding affinity between the HT1 protein binding RNA aptamer and HT1 protein of the present invention using a gel transfer assay.
6 is a Cdk9 antibody that specifically binds to Cdk9 and Cdk9 proteins as a result of confirming that the HT1 protein binding RNA aptamer of the present invention interferes with the binding between the HT1 protein and the Cdk9 protein based on a dot blotting technique. And it shows the results of analysis using a rabbit IgG antibody is bound to a peroxidase (peroxidase) that specifically binds to it.
Point 1 shows a rabbit IgG antibody that binds 25 ng of Cdk9 protein to PVDF membrane and then binds specifically to Cdk9 protein and peroxidase that binds specifically to it. This is the result of analysis.
Points 2-4 show HT1 protein at 12.5, 25 and 50 ng sequentially spotted on PVDF membrane, followed by Cdk9 protein, antibodies that specifically bind to Cdk9 protein, and peroxidase that binds specifically to it. Analysis results using rabbit IgG antibody.
Point 5 is a result of spotting the antibody specifically binding to the Cdk9 protein diluted to 1/2000 on the PVDF membrane, followed by analysis using a rabbit IgG antibody bound to the peroxidase specifically binding thereto.
Points 6-14 show that HT1 binding RNA aptamers HT1-1 through 160 pmol of HT1-9 bind 5 ng of HT1 protein and are spotted on PVDF membrane, which then binds to Cdk9 protein, Cdk9 protein, and This is a result of analysis using a rabbit IgG antibody that specifically binds to the peroxidase.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

실시예 Example

실시예Example 1: One: HT1HT1 ( ( humanhuman cyclinT1cyclinT1 ) 유전자 및 ) Genes and Cdk9Cdk9 유전자 확보  Gene acquisition

Cdk9 단백질과 특이적으로 결합하는 HT1 활성 도메인을 확보하기 위하여 RT-PCR을 수행하였다. HT1 활성 도메인 증폭을 위한 프라이머 한 쌍은 GenBank accession number AF048730의 cDNA 서열의 30 번째부터 789번까지의 서열을 증폭할 수 있도록 디자인하였으며, 바이오니아(bioneer, 한국)에서 주문 제작하였다. 프라이머 서열은 다음과 같다 [정방향 프라이머: 5'-ataGGATCCatggagggagagagga-3' (서열목록 제 10 서열), 역방향 프라이머: 5'-ctgAAGCTTggagttttctccaaaa-3' (서열목록 제 11 서열)]. RT-PCR was performed to secure the HT1 active domain specifically binding to Cdk9 protein. A pair of primers for amplifying the HT1 active domain was designed to amplify the sequences 30 th to 789 of the cDNA sequence of GenBank accession number AF048730, and was custom-made in Bioneer (Korea). The primer sequence is as follows (forward primer: 5'-ata GGATCC atggagggagagagga-3 '(SEQ ID NO: 10), reverse primer: 5'-ctg AAGCTT ggagttttctccaaaa-3' (SEQ ID NO: 11)).

또한, HT1 단백질 결합 앱타머가 HT1 단백질과 Cdk9 단백질의 결합을 방해할 수 있는 지에 대한 확인을 위하여 Cdk9 단백질을 확보하고자 하였다. Cdk9 유전자의 cDNA 서열은 GenBank에서 확인 할 수 있었으며, GenBank accession number AF366306의 서열을 기준으로 Cdk9 전체 유전자를 증폭할 수 있도록 프라이머를 디자인하여 바이오니아(bioneer, 한국)에 주문 제작하였다. 프라이머 서열은 다음과 같다 [정방향 프라이머: 5'-acaGGATCCatggcaaagcagtacg-3' (서열목록 제 12 서열), 역방향 프라이머: 5'-ataCTCGAGgaagacgcgctcaaac-3' (서열목록 제 13 서열)]. 각 프라이머는 유전자 클로닝에 활용될 제한효소 자리를 함께 넣어 제작하였으며, 제한 효소자리는 각 프라이머 서열에 대문자와 밑줄로 표기하였다. HT1 유전자와 Cdk9 유전자를 확보하기 위한 PCR 조성은 주형 DNA (human tissue cDNA) 2㎕, 10X PCR 완충용액 5㎕, 각 2.5mM dNTP 혼합물 4㎕, 25μM 정방향 프라이머 1㎕, 25μM 역방향 프라이머 1㎕, Ex Taq 중합효소(Takara, Japan) 1㎕ (1 unit/㎕)와 36㎕의 물로 이루어져 있다. PCR 반응 조건은 우선 94℃에서 5분간 변성시키고, 94℃에서 30초, 52℃에서 1분, 그리고 72℃에서 1 분간의 반응을 25 주기(cycle)로 반복한 후, 72℃에서 5분간 연장시키는 반응을 이용하였다. PCR 반응 후 2㎕를 취하여, 2％ 아가로스 겔(agarose gel)을 이용하여 HT1 유전자는 760 bp에서 Cdk9 유전자는 1,116 bp에서 정확한 크기의 밴드(band)가 나타나는지 확인하였다. 나머지 DNA는 PCR 정제 키트 (purification kit)(Qiagen, USA)를 이용하여 DNA만을 회수하였다. In addition, to determine whether the HT1 protein binding aptamer can interfere with the binding of the HT1 protein and Cdk9 protein, we tried to secure the Cdk9 protein. The cDNA sequence of the Cdk9 gene could be confirmed by GenBank. Based on the sequence of the GenBank accession number AF366306, primers were designed to amplify the entire Cdk9 gene, and were ordered to Bioneer (Korea). The primer sequence is as follows (forward primer: 5'-aca GGATCC atggcaaagcagtacg-3 '(SEQ ID NO: 12), reverse primer: 5'-ata CTCGAG gaagacgcgctcaaac-3' (SEQ ID NO: 13)). Each primer was prepared with restriction enzyme sites to be used for gene cloning, and the restriction enzyme sites were capitalized and underlined in each primer sequence. PCR composition to obtain HT1 gene and Cdk9 gene was 2 μl template DNA (human tissue cDNA), 5 μl 10X PCR buffer, 4 μl each 2.5 mM dNTP mixture, 1 μl 25 μM forward primer, 1 μl 25 μM reverse primer, Ex It consists of 1 μl (1 unit / μl) of Taq polymerase (Takara, Japan) and 36 μl of water. PCR reaction conditions were first denatured at 94 ° C. for 5 minutes, repeated 30 seconds at 94 ° C., 1 minute at 52 ° C., and 1 minute at 72 ° C. for 25 cycles, and then extended at 72 ° C. for 5 minutes. Reaction was used. After the PCR reaction, 2 μl was taken, and a 2% agarose gel was used to determine whether a band of the correct size appeared in the HT1 gene at 760 bp and the Cdk9 gene at 1,116 bp. The remaining DNA was recovered only DNA using a PCR purification kit (Qiagen, USA).

실시예 2:Example 2: HT1 (human cyclinT1) 단백질 및 Cdk9 단백질 확보 Acquired HT1 (human cyclinT1) protein and Cdk9 protein

상기 실시예 1에서 기재한 방법에 따라 PCR을 수행하여 HT1 유전자 일부 및 Cdk9 유전자를 증폭하고, HT1 유전자는 제한효소 BamH I / Hind Ⅲ으로, Cdk9 유전자는 제한효소 BamH I / Xho I으로 자른 후, 같은 제한효소 조합으로 자른 pET 21a 벡터와 라이게이션(ligation)하였으며, 라이게이션된 DNA들은 E. coli BL21(DE3)에 전기천공법(electroporation)을 이용하여 형질전환(transformation) 하여 최종적으로 HT1 재조합 균주 및 Cdk9 재조합 균주를 제작하였다. 전기천공법에 사용한 전기천공기계는 BTX(USA)사의 ECM 630 이었으며, 전기천공의 조건은 Voltage: 1.8kV, Capacitance 25μF, Resistance 200ohms, 1mm gap cuvette으로 하였다. PCR was performed according to the method described in Example 1 to amplify a portion of the HT1 gene and Cdk9 gene, HT1 gene was cut with restriction enzyme Bam H I / Hin d Ⅲ, Cdk9 gene with restriction enzyme Bam H I / Xho I Ligation was performed with the pET 21a vector cut with the same restriction enzyme combination, and the ligated DNA was transformed into E. coli BL21 (DE3) using electroporation to finally recombine HT1. Strains and Cdk9 recombinant strains were made. The electroporation machine used for electroporation was ECM 630 of BTX (USA). Electroporation conditions were Voltage: 1.8kV, Capacitance 25μF, Resistance 200ohms, 1mm gap cuvette.

HT1 단백질과 Cdk9 목적 단백질을 순수정제하기 위하여 각 HT1 재조합 균주와 Cdk9 재조합 균주에 1 mM IPTG (Sigma, USA)를 첨가하여 37℃에서 목적 단백질의 과발현을 유도하였으며, C-말단 쪽에 6XHis가 붙은 상태로 대량 발현시켰다. 목적 단백질의 과발현이 유도된 재조합 균주를 초음파 분쇄하였으며, 금속이 킬레이팅된 수지(ProBondTM Nickel-Chelating Resin)를 이용하여 목적 단백질만을 순수 분리 정제하였다. SDS-PAGE를 통하여 IPTG 유도 여부와 효율, 그리고 목적 단백질의 정제 단백질의 순수도를 확인하였다 (도 1 참조).
In order to purify HT1 protein and Cdk9 target protein, 1 mM IPTG (Sigma, USA) was added to each of the HT1 and Cdk9 recombinant strains to induce overexpression of the target protein at 37 ° C, with 6XHis attached to the C-terminal side. Mass expression. The recombinant strain induced overexpression of the target protein was ultrasonically pulverized, and only the target protein was purified and purified using a metal chelated resin (ProBondTM Nickel-Chelating Resin). SDS-PAGE confirmed the IPTG induction and efficiency, and the purity of the purified protein of the target protein was confirmed (see Figure 1).

실시예 3: RNAExample 3: RNA 앱타머 라이브러리(library)의 제작 Creation of the Aptamer Library

단계 1:    Step 1: PCR 방법을 이용한 랜덤(random) RNA 라이브러리 증폭Random RNA Library Amplification Using PCR Method

HT1 (human cyclinT1)과 특이적으로 결합하는 RNA 앱타머를 제작하기 위하여 40 개의 랜덤 서열(random sequence)을 dA : dG : dC : dT = 1.5 : 1.15 : 1.25 : 1 비율로 포함하고 있는 100 bp의 주형 DNA [5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3' (서열목록 제 14 서열)]; 와 이를 증폭할 수 있는 프라이머 한 쌍을 바이오니아(bioneer, 한국)에서 주문 제작하였다 [정방향 프라이머: 5'-GGTAATACGACTCACTATAGG GAGATACCAGCTTATTCAATT-3' (서열목록 제 15 서열), 역방향 프라이머: 5'-AGATTGCACTTACTATCT -3' (서열목록 제 16 서열)]. 정방향 프라이머에는 T7 프로모터 서열을 넣고 합성하여 in vitro 에서 DNA 서열에서 RNA 서열로 전환할 수 있도록 하였다. DNA 라이브러리는 PCR (Biorad, USA)을 이용하여 증폭하였다. PCR에 의한 100bp DNA 라이브러리의 증폭을 위한 반응액 조성은 주형 DNA 5-10 ㎕, 10X PCR 완충용액 10 ㎕, 각 2.5 mM dNTP 혼합물 8 ㎕, 25μM 정방향 프라이머 1㎕, 25μM 역방향 프라이머 1㎕, 5M 베타인 (betain) 20㎕, Ex Taq 중합효소(Takara, Japan) 1㎕ (1unit/㎕)와 49 - 54㎕의 물로 구성하였다. PCR 반응 조건은 우선 94℃에서 5분간 변성시키고, 94℃에서 30초, 52℃에서 1분, 그리고 72℃에서 1 분간 반응을 4 주기(cycle) 반복한 후, 72℃에서 5분간 연장시키는 반응을 이용하였다. PCR 반응 완료 후 2㎕를 취하여, 2％ 아가로스 겔(agarose gel)을 이용하여 정확한 크기의 밴드가 나타나는지 확인하였다. 나머지 DNA는 PCR 정제 키트 (purification kit) (Qiagen, USA)를 이용하여 DNA 만을 회수하였다(도 2 참고).
In order to construct RNA aptamers that specifically bind to HT1 (human cyclinT1), 100 bp of 40 random sequences were included at a ratio of dA: dG: dC: dT = 1.5: 1.15: 1.25: 1 Template DNA [5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3 '(SEQ ID NO: 14 sequence)]; Bioneer and a pair of primers designed to amplify this order was prepared in (bioneer, Korea) [forward primer: 5'-GG TAATACGACTCACTATAGG GAGATACCAGCTTATTCAATT-3 '( SEQ ID No. 15 sequence), reverse primer: 5'-AGATTGCACTTACTATCT -3 (SEQ ID NO: 16 sequence)]. In the forward primer, the T7 promoter sequence was added and synthesized to convert from DNA sequence to RNA sequence in vitro . DNA libraries were amplified using PCR (Biorad, USA). The composition of the reaction solution for amplification of 100bp DNA library by PCR was 5-10 μl of template DNA, 10 μl of 10X PCR buffer, 8 μl of each 2.5 mM dNTP mixture, 1 μl of 25 μM forward primer, 1 μl of 25 μM reverse primer, 5 M beta 20 μl of phosphorus, 1 μl of Ex Taq polymerase (Takara, Japan) (1 unit / μl) and 49-54 μl of water were used. PCR reaction conditions were first denatured at 94 ° C. for 5 minutes, followed by 4 cycles of reaction for 30 seconds at 94 ° C., 1 minute at 52 ° C., and 1 minute at 72 ° C., and then extended at 72 ° C. for 5 minutes. Was used. After completion of the PCR reaction, 2 μl was taken, and 2% agarose gel (agarose gel) was used to determine whether the correct size band appeared. The remaining DNA was recovered only DNA using a PCR purification kit (Qiagen, USA) (see Figure 2).

단계 2:    Step 2: 시험관내 전사 (In vitro transcription ( in vitro in vitro transcription) 기법을 이용한 RNA 라이브러리의 제조Preparation of RNA Library Using Transcription Technique

PCR 기법을 이용하여 증폭한 dsDNA 라이브러리를 RNA 라이브러리로 제조하기 위하여 시험관내 전사를 실시하였다. 시험관내 전사 시료는 상기 단계 1을 통해 획득한 주형(template) DNA 20 ㎍, 10X PCR 완충용액 8㎕, 50mM rATP 1.6㎕, 75mM rGTP 1㎕, 75mM rCTP 1㎕, 75mM rUTP 1㎕, T7 중합효소 8㎕ (1unit/㎕), Nuclease free water를 이용하여 시료를 80 ㎕로 맞추었다. 시험관내 전사 조건은 우선 37℃에서 4 시간 동안 반응 시킨 후, DNA를 제거하기 위하여 DNase I을 1㎕ (1unit/㎕)을 첨가한 후, 37℃에서 1시간 동안 반응시켰다. RNA 라이브러리를 시험관내에서 전사 반응시킨 후 2 ㎕를 취하여, 2％ 아가로스 겔을 이용하여 정확한 크기의 밴드가 나타나는지 확인하였으며, 나머지 RNA에는 1/10 부피의 3M NaOAc (pH4.5)와 2-3 부피의 100％ 에탄올을 첨가하여 -70℃에서 1 시간 반응시킨 후, 4℃에서 13,000 rpm으로 20 분간 원심분리하여 RNA만을 회수하였다. 회수된 RNA는 공기 중에서 건조시킨 후, 10 ㎕의 Nuclease free water에 녹였다.
In vitro transcription was performed to prepare dsDNA libraries amplified using the PCR technique into RNA libraries. In vitro transcription samples were obtained using the template DNA obtained in Step 1, 20 μg, 10 μl PCR buffer 8 μl, 50 mM rATP 1.6 μl, 75 mM rGTP 1 μl, 75 mM rCTP 1 μl, 75 mM rUTP 1 μl, T7 polymerase. 8 μl (1 unit / μl), the sample was adjusted to 80 μl using Nuclease free water. In vitro transcription conditions were first reacted at 37 ° C. for 4 hours, and then 1 μl (1 unit / μl) of DNase I was added to remove DNA, followed by reaction at 37 ° C. for 1 hour. After the RNA library was transcribed in vitro, 2 µl was taken to confirm that the band of the correct size appeared using a 2% agarose gel, and 1/10 volume of 3M NaOAc (pH4.5) and 2- After adding 3 volumes of 100% ethanol and reacting at -70 ° C for 1 hour, only RNA was recovered by centrifugation at 4 ° C at 13,000 rpm for 20 minutes. The recovered RNA was dried in air and then dissolved in 10 μl of Nuclease free water.

실시예 4:Example 4: SELEX 기법을 이용한 HT1 (human cyclinT1) 단백질과 특이적으로 결합하는 RNA 앱타머 선별 RNA Aptamer Specific Binding to HT1 (human cyclinT1) Protein Using SELEX Technique

단계 1: Step 1: SELEX에 이용되는 각 용액의 조성Composition of each solution used in SELEX

2X 앱타머 선별 용액: 20mM Tris-HCl(pH7.4), 150mM NaCl, 5mM KCl, 1mM MgCl2, 1mM CaCl2; 2 × Aptamer Screening Solution: 20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5 mM KCl, 1 mM MgCl 2 , 1 mM CaCl 2 ;

필터 세척 용액: 1X DNA 앱타머 선별 용액, 0.1% tween 20 Filter Wash Solution: 1X DNA Aptamer Selection Solution, 0.1% tween 20

RNA 앱타머 용출 용액: 7M Urea, 100mM sodium citrate, 3mM EDTA
RNA Aptamer Elution Solution: 7M Urea, 100mM sodium citrate, 3mM EDTA

단계 2: Step 2: SELEX에 이용될 RNA 앱타머 구조 제작RNA aptamer structure for SELEX

HT1 단백질과 특이적으로 결합하는 RNA 앱타머를 선별하기 위하여 기 제작 확보한 RNA 108.96μg (3.2nmole)에 증류수를 200㎕가 되게 첨가하고, 2X 앱타머 선별 용액 200㎕을 첨가한 후 85℃에서 5분간 끓여 변성 시켰다가 상온에서 서서히 식혀 RNA 앱타머가 안정된 3차원 구조를 형성할 수 있도록 하였다.
To select RNA aptamers that specifically bind to HT1 protein, 200 μl of distilled water was added to 108.96 μg (3.2 nmole) of RNA, and 200 μl of 2X aptamer selection solution was added. Boiled for 5 minutes, denatured, and cooled slowly at room temperature to allow RNA aptamer to form a stable three-dimensional structure.

단계 3: Step 3: 니트로셀룰로오스 여과(Nitrocellulose filtration) 기반의 SELEX 방법을 이용한 HT1 단백질과 특이적으로 결합하는 RNA 앱타머 선별RNA aptamer screening specifically binding to HT1 protein using SELEX method based on nitrocellulose filtration

HT1 단백질과 특이적으로 결합하는 RNA 앱타머를 선별하기 위하여 기 확보된 HT1 단백질을 5.12μg (320 pmol)에 2X 앱타머 선별 용액 300 ㎕을 첨가한 후, tRNA (10 mg/㎖) 8 ㎕을 섞은 후, nuclease free water로 전체 볼륨을 600 ㎕로 맞추었다. 이어서, 상기 단계 2에서 확보된 RNA 앱타머 라이브러리와 섞어 전체 볼륨을 1 ㎖로 맞춘 후 4 ℃에서 12 시간 이상 반응 시켰다. 이어서, HT1 단백질과 특이적으로 결합하는 RNA 앱타머만을 특이적으로 선별하기 위하여 니트로셀룰로오스 여과(nitrocellulose filtration) 기법을 이용하였다. 니트로셀룰로오스 필터(nitrocellulose filter)상에 남아 있는 HT1 단백질과 특이적으로 결합하는 앱타머는 RNA 앱타머 용출 용액을 이용하여 회수한 후, 동일한 볼륨의 PCI ( Phenol : Chloroform : Isoamyl alcohol = 25:24:1)를 처리하여 HT1 단백질을 제거하였다. 이어서, 상층액은 회수하여 회수 용액의 1/10 부피의 3M NaOAc (pH4.5)와 2 - 3 부피의 100％ 에탄올을 첨가하여, -70℃에서 1 시간 반응시키고, 반응액은 4℃에서 13,000 rpm으로 20 분간 원심분리 하여 RNA 앱타머만을 회수하였다. 회수된 RNA는 공기 중에서 건조시킨 후, 10㎕의 Nuclease free water에 녹였다.
In order to select RNA aptamers that specifically bind to HT1 protein, 300 µl of 2X aptamer selection solution was added to 5.12 µg (320 pmol), and 8 µl of tRNA (10 mg / ml) was added. After mixing, the total volume was adjusted to 600 μl with nuclease free water. Subsequently, the total volume was adjusted to 1 ml by mixing with the RNA aptamer library obtained in step 2, followed by reaction at 4 ° C. for at least 12 hours. Subsequently, nitrocellulose filtration was used to specifically select only RNA aptamers that specifically bind to HT1 protein. The aptamer specifically binding to the HT1 protein remaining on the nitrocellulose filter was recovered using an RNA aptamer elution solution, and then the same volume of PCI (Phenol: Chloroform: Isoamyl alcohol = 25: 24: 1 ) To remove HT1 protein. Subsequently, the supernatant was recovered, and 1/10 volume of 3M NaOAc (pH4.5) and 2-3 volumes of 100% ethanol were added thereto, followed by reaction at -70 ° C for 1 hour, and the reaction solution at 4 ° C. Only RNA aptamer was recovered by centrifugation at 13,000 rpm for 20 minutes. The recovered RNA was dried in air and then dissolved in 10 μl of Nuclease free water.

단계 4: Step 4: 선택된 RNA 앱타머의 역전사반응 및 SELEX 기법의 반복Reverse transcription of selected RNA aptamers and repetition of SELEX techniques

에탄올을 농축시켜 확보한 RNA 앱타머 9 ㎕에 역방향 프라이머 (25μM) 1 ㎕를 첨가하여 65℃에서 5분간 가열하고 얼음에서 급속 냉각시킨 후, 4 ㎕의 5X 완충액, 2 ㎕의 10 mM dNTP 혼합물과 1㎕의 0.1 M DTT, RNase OUT 1㎕, DEPC-DW 1㎕, 역전사 효소 1㎕ (50 Unit/㎕)를 첨가하여 42℃에서 60 분간 반응시킨 후, 85℃에서 5분간 가열하고 얼음에서 급랭시켰다. 이렇게 얻은 cDNA를 주형으로하여 PCR 증폭시켜 다음 라운드을 위한 dsDNA를 준비하였다. 이어서, 상기 SELEX 과정을 반복하였다. 확보된 RNA의 PCR 산물 중 2㎕를 취하여, 2％ 아가로스 겔을 이용하여 정확한 크기의 밴드가 나타나는지 확인하였다.
1 μl of reverse primer (25 μM) was added to 9 μl of RNA aptamer obtained by concentrating ethanol, heated at 65 ° C. for 5 minutes, and rapidly cooled on ice. Then, 4 μl of 5X buffer, 2 μl of 10 mM dNTP mixture, 1 μl of 0.1 M DTT, 1 μl of RNase OUT, 1 μl of DEPC-DW, and 1 μl of reverse transcriptase (50 Unit / μl) were added and reacted at 42 ° C. for 60 minutes, then heated at 85 ° C. for 5 minutes and quenched on ice. I was. PCR amplification using the cDNA thus obtained as a template to prepare a dsDNA for the next round. Subsequently, the SELEX process was repeated. 2 μl of the PCR product of the obtained RNA was taken to confirm that a band of the correct size appeared using a 2% agarose gel.

단계 5: Step 5: 네가티브(Negative) SELEX을 통한 비특이적 RNA 앱타머 제거Nonspecific RNA Aptamer Removal with Negative SELEX

HT1 단백질이 아닌 니트로셀룰로오스 필터 (nitrocellulose filter)에 흡착하는 비특이적인 RNA 앱타머를 제거하기 위하여, SELEX 7회와 8회 사이에 HT1 단백질 없이 니트로셀룰로오스 필터에 RNA 앱타머 용액을 흘려주는 네가티브 (negative) SELEX을 진행하였다. 1X 앱타머 선별 용액을 이용하여 활성화된 니트로셀룰로오스 필터에 상온에서 식힌 RNA 앱타머를 반응시킨 후, 니트로셀룰로오스 필터에 결합하지 않고 나온 RNA 앱타머 용액을 8회 SELEX에 이용하였다. SELEX는 총 10회까지 진행하였으며, SELEX의 결합 조건은 횟수가 증가할수록 ssDNA 앱타머와 HT1의 반응 시간을 줄였으며, 횟수가 거듭될수록 반응 조건을 거칠게 하여 목표 물질인 HT1 단백질에 특이적으로 결합하는 앱타머를 얻고자 하였다. Negative flow of RNA aptamer solution into nitrocellulose filter without HT1 protein between SELEX 7 and 8 to remove nonspecific RNA aptamer adsorbed on nitrocellulose filter, not HT1 protein. SELEX was carried out. After reacting the cooled RNA aptamer at room temperature with the activated nitrocellulose filter using the 1X aptamer screening solution, the RNA aptamer solution which was not bound to the nitrocellulose filter was used for 8 times SELEX. SELEX was performed up to 10 times, and the binding condition of SELEX decreased the reaction time between ssDNA aptamer and HT1 as the number of times increased, and as the number of times increased, the reaction conditions were roughened to specifically bind to the target substance HT1 protein. I wanted to get an aptamer.

실시예 5: 실시간(Real time) PCR 방법을 이용한 친화성 테스트 Example 5: Affinity Test Using Real Time PCR Method

SELEX를 10회 까지 마친 후 SELEX 진행 여부 및 각 라운드에서 용리된 RNA 앱타머의 친화성을 정량적으로 확인하기 위하여 실시간 PCR을 수행하였다. 먼저 초기 DNA 라이브러리와 8 라운드, 9 라운드, 10 라운드에서 용리되어 역전사 후 확보한 각각의 cDNA 앱타머를 PCR을 통하여 증폭하고, 시험관내 전사 기법을 이용하여 RNA 앱타머를 확보하였다. 확보된 RNA 앱타머는 농도를 0㎍, 4㎍으로 나누어 HT1 단백질과 1시간 동안 반응시킨 후, 회수하였다. 회수 확보한 RNA 앱타머들은 역전사 기법을 이용하여 cDNA로 제작하였으며, 이렇게 획득된 cDNA 앱타머들은 Nano-drop을 이용하여 농도를 측정하였으며, 각 라운드에서 획득한 cDNA는 10-3, 10-4, 10-5 로 희석하여 실시간 PCR의 주형 DNA로 사용하였다. 실시간 PCR은 Biorad사의 iQ SYBR Green Supermix (Bio-rad, USA)를 이용하였으며, 실시간 PCR 반응 조건은 우선 94℃에서 5분간 변성시키고, 94℃에서 20초, 52℃에서 20초, 그리고 72℃에서 20 초간 반응을 40 주기 반복한 후, 72℃에서 5분간 연장시키는 반응 조건으로 반응을 진행하였다. Nano drop을 이용한 각 RNA에서 회수 확보된 cDNA의 농도는 135.2 pmol(8 라운드), 125.3 pmol(9 라운드), 100.3 pmol(10 라운드)이었으며, 실시간 PCR 결과는 10-4로 희석된 샘플을 주형 DNA로 이용한 실험에서만 결과를 획득할 수 있었다. 실시간 PCR 효율은 각 라운드별로 각각 89.40％, 85.78％, 80.94％였으며, 9 라운드와 10 라운드에서 획득한 cDNA를 주형 DNA로 이용한 실시간 PCR 결과의 효율이 85.78％, 90.94％로 8 라운드의 결과 보다 효율이 떨어지는 것으로 보아 더 이상 SELEX를 진행할 필요가 없음을 확인 할 수 있었다. 뿐만 아니라, Nano drop을 이용한 각 라운드별 회수 앱타머양 측정 결과와 실시간　PCR 결과를 토대로 8 라운드의 앱타머 후보군들이 HT1 단백질과 결합 효율이 가장 높다는 것을 확인할 수 있었다. 도 3은 니트로셀룰로오스 여과(nitrocellulose filtration) 기반의 SELEX 방법을 이용하여 총 10 라운들의 SELEX를 진행하며 획득한 각 라운드에서의 RNA 앱타머들의 친화성을 정량적으로 확인한 결과이다.
After completing SELEX up to 10 times, real-time PCR was performed to quantitatively confirm SELEX progress and affinity of the RNA aptamer eluted in each round. First, cDNA aptamers eluted in the initial DNA library and round 8, 9, and 10 rounds were reverse amplified, and then amplified by PCR, and RNA aptamers were obtained using in vitro transcription. The secured RNA aptamer was recovered by reacting with HT1 protein for 1 hour by dividing the concentration into 0 µg and 4 µg. The recovered RNA aptamers were prepared as cDNA using reverse transcription technique, and the obtained cDNA aptamers were measured for concentration using a nano-drop. The cDNA obtained in each round was 10 -3 , 10 -4 , diluted to 10 -5 were used as template DNA in real-time PCR. Real-time PCR was performed using Biorad's iQ SYBR Green Supermix (Bio-rad, USA), and real-time PCR reaction conditions were first denatured at 94 ° C. for 5 minutes, 20 seconds at 94 ° C., 20 seconds at 52 ° C., and 72 ° C. After 40 cycles of the reaction for 20 seconds, the reaction was carried out under the reaction conditions extending for 5 minutes at 72 ℃. The concentration of the recovered cDNA obtained from each RNA using a Nano drop was 135.2 pmol (8 rounds), 125.3 pmol (9 rounds), 100.3 pmol (10 rounds), respectively, and real-time PCR results of the sample diluted to 10-4 template DNA The results were obtained only in the experiments used. Real-time PCR efficiencies were 89.40%, 85.78%, and 80.94% for each round, respectively.The results of real-time PCR using cDNA obtained in rounds 9 and 10 as template DNA were 85.78% and 90.94%, respectively. As this falls, it was confirmed that there is no need to proceed with SELEX. In addition, 8 rounds of aptamer candidates were found to have the highest binding efficiency with HT1 protein, based on the measurement results of the rounded aptamer amount and the real-time PCR using the nano drop. 3 is a result of quantitatively confirming the affinity of RNA aptamers in each round obtained by performing SELEX of a total of 10 rounds using a nitrocellulose filtration-based SELEX method.

실시예 6: HT1 단백질과 특이적으로 결합하는 RNA 앱타머 후보군의 클로닝Example 6: Cloning of Candidate RNA Aptamers Specific to HT1 Protein

HT1 단백질과 특이적으로 결합하는 RNA 앱타머 후보군을 확보하기 위하여 실시간 PCR을 통하여 HT1 단백질과의 결합 효율이 가장 높은 것으로 판단된 8 라운드의 cDNA 앱타머에 대해 정방향 프라이머: 5'-GGTAATACGACTCAC TATAGGGAGATACCAGCTTATTCAATT-3'(서열목록 제 15 서열)와 역방향 프라이머: 5'-AGATTGCACTTACTATCT-3' (서열목록 제 16 서열)를 이용한 PCR 수행하였다. PCR을 통하여 확보된 dsDNA는 RBC의 T&A 클로닝 키트를 이용하여 TA 클로닝을 수행하였다. TA 클로닝은 T-벡터 (25 ng/㎕) 2㎕와 PCR 산물 (20 ng/㎕) 5㎕, 리가아제(3 unit) 1㎕, 10X 라이게이션 버퍼 A 1㎕, 10X 라이게이션 버퍼 B 1㎕을 섞어서 4℃ 에서 16 시간 동안 반응시키는 조건을 이용하였다. TA 클로닝한 라이게이트(ligate) 10 ㎕는 200㎕의 DH5α와 섞은 후 42℃에서 1분 30초 동안 열충격 (heat shock)을 주고 얼음에 두었다. 여기에 800㎕의 LB broth 800㎕을 첨가한 후, 37℃에서 1 시간 동안 배양하였다. 배양한 후, 200㎕의 용액을 취하여 앰피실린 (ampicillin, 50 ng/ml), X-gal (50 ㎍/ml), IPTG (5 ㎍/ml)이 포함되어 있는 LB 배양 플레이트(LB plate)에 스프레딩하고, 37℃에서 15 시간 동안 배양시킨 후 흰색 콜로니만을 선별하여 솔젠트(solgent, Korea)에 의뢰하여 앱타머의 염기서열을 결정하였다. 하기의 표 1은 니트로셀룰로오스 여과(nitrocellulose filtration) 기반의 SELEX 방법을 활용하여 획득한 HT1 결합 RNA 앱타머 후보군 9개에 대한 서열을 나타낸 것이다.
Forward primer: 5'-GGTAATACGACTCAC TATAGGGAGATACCAGCTTATTCAATT-3 for 8 rounds of cDNA aptamers determined to have the highest binding efficiency with HT1 protein by real-time PCR in order to obtain RNA aptamer candidates that specifically bind to HT1 protein. PCR was performed using '(SEQ ID NO: 15 sequence) and reverse primer: 5'-AGATTGCACTTACTATCT-3' (SEQ ID NO: 16 sequence). The dsDNA obtained through PCR was subjected to TA cloning using TBC's T & A cloning kit. TA cloning was performed with 2 μl of T-vector (25 ng / μl) and 5 μl of PCR product (20 ng / μl), 1 μl of ligase (3 unit), 1 μl of 10 × ligation buffer A, 1 μl of 10 × ligation buffer B The mixture was used to react for 16 hours at 4 ℃. 10 μl of TA cloned ligate was mixed with 200 μl of DH5α and subjected to a heat shock at 42 ° C. for 1 minute and 30 seconds and placed on ice. 800 μl of LB broth was added thereto and then incubated at 37 ° C. for 1 hour. After incubation, 200 μl of the solution was taken and placed in an LB culture plate (LB plate) containing ampicillin (ampicillin, 50 ng / ml), X-gal (50 μg / ml) and IPTG (5 μg / ml). After spreading and incubating at 37 ° C. for 15 hours, only white colonies were selected and commissioned by Solgent, Korea to determine the nucleotide sequence of the aptamer. Table 1 below shows the sequences for nine HT1 binding RNA aptamer candidate groups obtained using the SELEX method based on nitrocellulose filtration.

클론 이름Clone name 선택된 서열 Selected sequence 서열 크기Sequence size Kd
(nM) Kd
(nM) HT1-1HT1-1 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUAACAACGCGCCAACUAUAAAUCUAUUCGAUACCCUGGUGCAGAUAGUAAGUGCAAUCU
(서열목록 제1서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUAACAACGCGCCAACUAUAAAUCUAUUCGAUACCCUGGUGCAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 1) 100bp100bp 23.7
± 1.3523.7
± 1.35 HT1-2HT1-2 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUUAAAGACUGGCCUAACCGGGUGGCCAUGAGGGGAUGGUUCAGAUAGUAAGUGCAAUCU
(서열목록 제2서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUUAAAGACUGGCCUAACCGGGUGGCCAUGAGGGGAUGGUUCAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 2) 100bp100bp 13.3
± 2.3513.3
± 2.35 HT1-3HT1-3 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUAGAGAGCCCCCCAGGUCGCUUUAUCCAUUUCACGGUGCCCUAGAUAGUAAGUGCAAUCU
(서열목록 제3서열) GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUAGAGAGCCCCCCAGGUCGCUUUAUCCAUUUCACGGUGCCCUAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 3) 101bp101 bp 15.8
± 2.0515.8
± 2.05 HT1-4HT1-4 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUAGCCACACGGCUAGCUUGAGUUACCACUCAUACUGGCUCGAGAUAGUAAGUGCAAUCU
(서열목록 제4서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUAGCCACACGGCUAGCUUGAGUUACCACUCAUACUGGCUCGAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 4) 100bp100bp 5.05
± 1.195.05
± 1.19 HT1-5HT1-5 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCUGGCUCAGCACAGCACGUACAGUAGAUCAUCCCCUGUCGAGAUAGUAAGUGCAAUCU
(서열목록 제5서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCUGGCUCAGCACAGCACGUACAGUAGAUCAUCCCCUGUCGAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 5) 100bp100bp 223.11
± 5.11223.11
± 5.11 HT1-6HT1-6 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCAGUAAGCUACUUUCGACUCUACCCCCACUCGGCCCCUGUAGAUAGUAAGUGCAAUCU
(서열목록 제6서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCAGUAAGCUACUUUCGACUCUACCCCCACUCGGCCCCUGUAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 6) 100bp100bp 89.7
± 4.3189.7
± 4.31 HT1-7HT1-7 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUUUCCGCUAGGGGAACAUGAUCAACAUGGACCAAGUAAACAGAUAGUAAGUGCAAUCU
(서열목록 제7서열) GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUUUCCGCUAGGGGAACAUGAUCAACAUGGACCAAGUAAACAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 7) 99bp99bp 13.8
± 3.4113.8
± 3.41 HT1-8HT1-8 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCUCAAAAUCCAUGUCAGCGACAAGCCAACCACACGCCCCUAGAUAGUAAGUGCAAUCU
(서열목록 제8서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCUCAAAAUCCAUGUCAGCGACAAGCCAACCACACGCCCCUAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 8) 100bp100bp 2.19
± 2.752.19
± 2.75 HT1-9HT1-9 GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCAAUGCCUAGAUGUGUAAUGUCACAUUGUCCUGCCCGGUCAGAUAGUAAGUGCAAUCU
(서열목록 제9서열)GGUAAUACGACUCACUAUAGGGAGAUACCAGCUUAUUCAAUUCAAUGCCUAGAUGUGUAAUGUCACAUUGUCCUGCCCGGUCAGAUAGUAAGUGCAAUCU
(SEQ ID NO: 9) 100bp100bp 6.44
± 1.086.44
± 1.08

실시예 7:Example 7: HT1 단백질 결합 RNA 앱타머의 구조 결정 Structural Determination of HT1 Protein Binding RNA Aptamers

HT1 단백질 결합 RNA 앱타머 후보군들의 구조는 Rensselear polytechnic institute 에서 제공하는 DNA mfold 프로그램을 활용하여 이미지화 할 수 있었다 (도 4a 내지 도 4d 참조).
The structures of HT1 protein binding RNA aptamer candidate groups could be imaged using the DNA mfold program provided by Rensselear polytechnic institute (see FIGS. 4A to 4D).

실시예 8:Example 8: SPR을 이용한 HT1 단백질과 결합하는 앱타머 후보군의 친화도 테스트Affinity testing of aptamer candidates that bind to HT1 protein using SPR

단계 1: Step 1: HT1HT1 단백질과 특이적으로 결합하는  Specifically bound to proteins 앱타머Aptamer 후보군들의 각 친화도 테스트를 위한  For testing the affinity of each candidate HT1HT1 단백질 코팅  Protein coating CM5CM5 칩 제작 실험 Chip making experiment

HT1 단백질과 실시예 6에서 획득한 앱타머 후보군과의 친화도를 정량하기 위하여, 본 발명자들은 SPR 검출 시스템 기기인 BIAcore 2000(BIACORE)을 이용하여 표면 플라즈몬 공명 (Surface Plasmon Resonance, SPR) 실험을 실시하였다. HT1 단백질과 앱타머 후보군과의 친화도를 확인하기 위하여, 표면이 카르복실기로 코팅된 센서 칩 CM5 (GE Healthcare)을 이용하였다. 센서 칩 CM5는 0.1M의 N-히드록시석신이미드(N-hydroxysuccinimide, NHS)와 0.4M의 N-에틸-N'-(디메틸 아미노프로필)카르보이미드(N-ethyl-N'-(dimethyl aminopropyl)carbodiimide, EDC) 혼합액을 5 ㎕/min의 속도로 10분 동안 칩에 흘려 활성화시켜 카르복실기를 반응성이 더 좋은 N-히드록시석신이미드에스테르(N-hydroxysuccinimide ester)로 바꾸었다. NHS-에스테르로 활성화된 센서 칩 CM5의 표면에 HT1 단백질을 고정하기 위하여 10 mM 글라이신-HCl (pH 4.5) 완충액에 500 ㎍/㎖의 농도로 녹아 있는 HT1 단백질 용액을 5㎕/min의 속도로 10분 동안 처리하여 칩 표면을 HT1 단백질로 코팅하였다. HT1 단백질이 고정된 센서칩은 1M 에탄올아민 하이드로클로라이드(pH8.5)로 불활성화시켜 다른 시약 및 RNA 앱타머가 칩 표면에 직접 붙는 것을 방지하였으며, 각 실험 후 센서 칩은 10 mM EGTA로 재생시켰다. 속도 변수는 BIA 평가프로그램 (BIACORE)으로 수득하였다.
In order to quantify the affinity between the HT1 protein and the aptamer candidate group obtained in Example 6, the inventors conducted a Surface Plasmon Resonance (SPR) experiment using BIAcore 2000 (BIACORE), an SPR detection system device. It was. In order to confirm the affinity between the HT1 protein and the aptamer candidate group, a sensor chip CM5 (GE Healthcare) whose surface was coated with a carboxyl group was used. The sensor chip CM5 is 0.1M N-hydroxysuccinimide (NHS) and 0.4M N-ethyl-N '-(dimethyl aminopropyl) carbodiimide (N-ethyl-N'-(dimethyl) The mixture of aminopropyl) carbodiimide (EDC) was flowed into the chip at a rate of 5 μl / min for 10 minutes to change the carboxyl group to more reactive N-hydroxysuccinimide ester. In order to fix the HT1 protein on the surface of the sensor chip CM5 activated with NHS-ester, a solution of HT1 protein dissolved in 500 mM / ml in 10 mM glycine-HCl (pH 4.5) buffer at a rate of 5 µl / min was used. The chip surface was coated with HT1 protein by treatment for minutes. The HT1 protein-immobilized sensor chip was inactivated with 1M ethanolamine hydrochloride (pH8.5) to prevent other reagents and RNA aptamers from sticking directly to the chip surface. After each experiment, the sensor chip was regenerated with 10 mM EGTA. Rate variables were obtained with the BIA Assessment Program (BIACORE).

단계 2: Step 2: HT1 단백질 결합 RNA 앱타머 후보군의 친화력 측정Affinity Measurement of HT1 Protein Binding RNA Aptamer Candidates

HT1 단백질과 가장 좋은 친화도를 가지는 앱타머를 선별하기 위하여 각 후보군의 RNA 앱타머를 HBS2P 완충액(GE Healthcare)에 녹여 각 10 nM에서 300 nM의 농도로 정량하여 확보하였다. 확보된 RNA 앱타머는 85℃에서 5분간 반응시킨 후, 상온에서 천천히 냉각시켜 안정한 3차원 구조를 형성시켰다. 제조한 RNA 앱타머는 아무것도 붙지 않은 센서칩 (채널 1), HT1 단백질이 고정된 센서칩 (채널 2)에 RNA 앱타머 후보군을 다양한 농도(300nM, 200nM, 100nM, 50nM, 10nM)로 주입함으로써 HT1 단백질 결합 RNA 앱타머 후보군의 HT1 단백질에 대한 친화도를 정량화할 수 있었다. 각 HT1 단백질 결합 RNA 앱타머 후보군에 대한 HT1 단백질 해리상수 (Kd, dissociation)를 측정한 결과, HT1 단백질 결합 RNA 앱타머 후보군 중 HT1-8의 해리상수가 2.19 ㅁ 2.75 x 10-9M으로 가장 높은 친화도 값을 보였다(표 1 참고).
In order to select aptamers having the best affinity with the HT1 protein, RNA aptamers of each candidate group were dissolved in HBS2P buffer (GE Healthcare) and quantified and secured at concentrations of 10 nM to 300 nM. The obtained RNA aptamer was reacted at 85 ° C. for 5 minutes, and then slowly cooled at room temperature to form a stable three-dimensional structure. The prepared RNA aptamer is injected into the HT1 protein by injecting RNA aptamer candidates at various concentrations (300nM, 200nM, 100nM, 50nM, 10nM) into a sensor chip (channel 1) and a HT1 protein-fixed sensor chip (channel 2). The affinity for the HT1 protein of the binding RNA aptamer candidate group could be quantified. The HT1 protein dissociation constant (Kd, dissociation) of each HT1 protein-binding RNA aptamer candidate group was measured.The HT1-8 dissociation constant of the HT1 protein-binding RNA aptamer candidate group was 2.19 ㅁ 2.75 x 10 -9 M. Affinity values were shown (see Table 1).

실시예 9:Example 9: 젤 이동분석법을 이용한 HT1 단백질 결합 RNA 앱타머와 HT1 단백질간의 결합친화도 분석 Binding affinity analysis between HT1 protein-binding RNA aptamer and HT1 protein using gel transfer assay

니트로셀룰로오스 여과 기반의 SELEX 방법을 이용하여 획득한 HT1 결합 RNA 앱타머 후보군 9개와 HT1 단백질간의 결합력을 확인하기 위하여 젤 이동분석법을 실시하였다. 이를 위하여 확보한 9개의 HT1 결합 RNA 앱타머 후보군을 시험관 내 전사 수행시에 rUTP 대신 75mM Cy5-UTP을 사용하여 표지하였으며, Cy5로 표지된 HT1 결합 RNA 앱타머 후보군은 동일 부피의 PCI (Phenol:Chloroform:Isoamyl alcohol = 25:24:1)와 에탄올을 이용하여 HT1 결합 RNA 앱타머 후보군만을 순수하게 분리 정제하였다. Cy5로 표지된 HT1 결합 RNA 앱타머 (160 pmol)는 HT1 단백질 (16 pmol) 또는 Cdk9 (16 pmol)과 4℃에서 1시간 동안 반응시킨 후, 복합체는 5％ 비-변성겔(non-denaturing gel)에 로딩하고 플루오로-이미지 (fluoro-image) 분석기를 이용하여 분석하였다(도 5 참고).
Gel transfer analysis was performed to confirm the binding force between nine HT1 binding RNA aptamer candidate groups and HT1 protein obtained using SELEX method based on nitrocellulose filtration. Nine HT1 binding RNA aptamer candidates secured for this purpose were labeled with 75mM Cy5-UTP instead of rUTP when performing in vitro transcription, and Cy5 labeled HT1 binding RNA aptamer candidates had the same volume of PCI (Phenol: Chloroform). : Isoamyl alcohol = 25: 24: 1) and ethanol were used to isolate and purify only HT1 binding RNA aptamer candidates. Cy5-labeled HT1 binding RNA aptamer (160 pmol) was reacted with HT1 protein (16 pmol) or Cdk9 (16 pmol) at 4 ° C. for 1 hour, after which the complex was a 5% non-denaturing gel. ) And analyzed using a fluoro-image analyzer (see FIG. 5).

실시예 10:Example 10: HT1 단백질 결합 앱타머 후보군을 이용한 HT1 단백질과 Cdk9 단백질간의 결합 방해 확인 Confirmation of Binding Interference between HT1 Protein and Cdk9 Protein Using HT1 Protein Binding Aptamer Candidates

HT1 단백질 결합 앱타머 후보군이 HT1 단백질과 Cdk9 단백질간의 결합을 방해할 수 있는지를 확인하기 위하여 도트 블롯팅(dot blotting) 실험을 수행하였다. 이를 위하여 기 선별된 4개의 HT1 단백질 결합 앱타머 후보군(160 pmol)은 5 ng의 HT1 단백질과 4℃에서 12 시간 동안 반응시켰다. 반응 후 HT1 단백질 결합 앱타머 후보군과 HT1 단백질 복합체는 메탄올로 활성화된 PVDF 막에 스폿팅(spotting)하였다. 이후 PVDF 막은 PBS (pH 7.2)로 15분 동안 실온에서 세척하였으며, 이후 5％ 탈지유(skim milk)를 이용하여 비특이적인 반응이 일어날 수 있는 막을 블로킹 하였다. 이어서, 스폿팅이 되어 있는 막은 Cdk9 단백질과 특이적으로 결합하는 항체, 퍼옥시다아제(peroxidase)가 결합되어 있는 토끼 IgG 항체 순으로 순차적으로 반응시켰으며, 반응과 반응 사이에는 0.5％ 트윈(tween) 20이 포함되어 있는 PBS를 이용하여, 막을 세척하였다. 반응이 끝난 막(membrane)에서 시그널은 ECL 키트 (GE Healthcare)를 이용하여 확인하였다(도 6 참고).
Dot blotting experiments were performed to determine whether HT1 protein binding aptamer candidates could interfere with the binding between HT1 protein and Cdk9 protein. For this purpose, the four selected HT1 protein binding aptamer candidate groups (160 pmol) were reacted with 5 ng of HT1 protein at 4 ° C. for 12 hours. After the reaction, the HT1 protein binding aptamer candidate group and the HT1 protein complex were spotted onto the PVDF membrane activated with methanol. The PVDF membrane was then washed with PBS (pH 7.2) for 15 minutes at room temperature, and then blocked using a 5% skim milk to block non-specific reactions. Subsequently, the spotted membrane was sequentially reacted with an antibody that specifically binds to the Cdk9 protein, followed by a rabbit IgG antibody that binds to the peroxidase, followed by a 0.5% tween 20 between the reactions. The membrane was washed using PBS containing this. Signals from the finished membranes were confirmed using an ECL kit (GE Healthcare) (see FIG. 6).

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (11)

HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드.
RNA oligonucleotide having a sequence of any one of SEQ ID NOS: 1 to 9, which binds to HT1 (Human cyclin T1) protein.
삭제delete HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질과 Cdk9 (cyclin-dependent kinase 9) 단백질과의 결합 저해제.
HT1 (Human cyclin T1) sequence binding to the HT1 protein comprising a RNA oligonucleotide having a sequence of any one of the first to ninth sequence binding inhibitor of Cdk9 (cyclin-dependent kinase 9) protein.
HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 유효성분으로 포함하는 HIV (Human Immunodeficiency Virus)의 증식 억제제.
Proliferation inhibitor of HIV (Human Immunodeficiency Virus) comprising an RNA oligonucleotide having a sequence of any one of the first to ninth sequence sequence binding to HT1 (Human cyclin T1) protein as an active ingredient.
HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 유효성분으로 포함하는 AIDS (Acquired Immunodeficiency Syndrome) 예방 또는 치료용 약제학적 조성물.
A pharmaceutical composition for preventing or treating AIDS (Acquired Immunodeficiency Syndrome) comprising an RNA oligonucleotide having a sequence of any one of the first to ninth sequences as an active ingredient, which binds to a human cyclin T1 (HT1) protein.
HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질 검출용 조성물.
Sequence list for binding to HT1 (Human cyclin T1) protein HT1 protein detection composition comprising an RNA oligonucleotide having any one of the first to ninth sequence.
HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드가 고정화된 기판을 포함하는 HT1 단백질 검출용 마이크로어레이.
Microarray for detecting HT1 protein comprising a substrate immobilized with an RNA oligonucleotide having a sequence of any one of SEQ ID NOs: 1 to 9 to bind to HT1 (Human cyclin T1) protein.
HIV의 감염 진단에 필요한 정보를 제공하기 위해 HT1 단백질의 발현 수준을 측정하는 방법으로서 다음의 단계를 포함하는 것을 특징으로 하는 방법:
(a) 인체로부터 분리된 생물학적 시료와 HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 접촉시키는 단계; 및
(b) 상기 RNA 올리고뉴클레오타이드에 결합된 HT1 단백질을 검출하는 단계.
A method for measuring the expression level of HT1 protein to provide information necessary for diagnosing infection of HIV, the method comprising the following steps:
(a) contacting a biological sample isolated from a human body with an RNA oligonucleotide having any one of SEQ ID NOS: 1 to 9 to bind to a HT1 (Human cyclin T1) protein; And
(b) detecting the HT1 protein bound to the RNA oligonucleotide.
HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 포함하는 HT1 단백질 분리용 조성물.
Sequence list for binding to HT1 (Human cyclin T1) protein HT1 protein isolation composition comprising an RNA oligonucleotide having any one of the first to ninth sequence.
다음의 단계를 포함하는 것을 특징으로 하는 HT1 단백질을 분리하는 방법:
(a) 시료와 HT1 (Human cyclin T1) 단백질에 결합하는 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 RNA 올리고뉴클레오타이드를 접촉시켜 RNA 올리고뉴클레오타이드와 HT1 단백질의 복합체를 형성시키는 단계; 및
(b) 상기 복합체를 회수하여 RNA 올리고뉴클레오타이드로부터 HT1 단백질을 분리하는 단계.
A method for separating HT1 protein comprising the following steps:
(a) contacting a sample with an RNA oligonucleotide having any one of SEQ ID NOS: 1 to 9 to bind to a HT1 (Human cyclin T1) protein to form a complex of the RNA oligonucleotide and the HT1 protein; And
(b) recovering the complex to separate HT1 protein from RNA oligonucleotides.
다음의 단계를 포함하는 HT1 단백질과 Cdk9 단백질과의 결합을 저해하는 물질을 스크리닝 하는 방법:
(a) 후보물질의 존재하에 HT1 단백질과 서열목록 제 1 서열 내지 제 9 서열 중 어느 하나의 서열을 갖는 HT1 (Human cyclin T1) 단백질에 결합하는 RNA 올리고뉴클레오타이드를 인큐베이션(incubation)하는 단계; 및
(b) 상기 RNA 올리고뉴클레오타이드에 결합된 HT1 단백질의 양을 측정하는 단계로서, 후보물질의 존재하에서 상기 RNA 올리고뉴클레오타이드에 결합되는 HT1 단백질의 양이 후보물질의 부존재하에서 보다 감소되는 경우 상기 후보물질이 HT1 단백질과 Cdk9 단백질과의 결합을 억제할 수 있는 물질임을 지시하는 단계.
A method for screening a substance that inhibits binding of HT1 protein to Cdk9 protein, comprising the following steps:
(a) incubating an RNA oligonucleotide that binds to a HT1 protein and to a HT1 (Human cyclin T1) protein having any one of SEQ ID NOs: 1-9 in the presence of a candidate; And
(b) measuring the amount of HT1 protein bound to the RNA oligonucleotide, wherein if the amount of HT1 protein bound to the RNA oligonucleotide in the presence of the candidate is reduced in the absence of the candidate, Indicating a substance capable of inhibiting the binding of the HT1 protein and Cdk9 protein.
KR1020100078695A 2010-08-16 2010-08-16 RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use KR101191994B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100078695A KR101191994B1 (en) 2010-08-16 2010-08-16 RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100078695A KR101191994B1 (en) 2010-08-16 2010-08-16 RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use

Publications (2)

Publication Number Publication Date
KR20120057697A KR20120057697A (en) 2012-06-07
KR101191994B1 true KR101191994B1 (en) 2012-10-18

Family

ID=46609452

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100078695A KR101191994B1 (en) 2010-08-16 2010-08-16 RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use

Country Status (1)

Country Link
KR (1) KR101191994B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5582981A (en) 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5582981A (en) 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Biol. Cell. 2008. Vol. 100, No. 2, pp. 83-95

Also Published As

Publication number Publication date
KR20120057697A (en) 2012-06-07

Similar Documents

Publication Publication Date Title
JP4441618B2 (en) How to detect influenza virus
KR102242874B1 (en) Aptamers that bind to il-6 and their use in treating or diagnosing il-6 mediated conditions
Zhang et al. Direct binding to nucleic acids by Vpr of human immunodeficiency virus type 1
US20120129720A1 (en) Aptamer that recognizes peptide
JP6495927B2 (en) Aptamers that bind to the HGF receptor
KR101291737B1 (en) Aptamer specific to Severe Acute Respiratory Syndrome (SARS)-Coronavirus nucleocapsid and pharmaceutical composition comprising the same
AU2008301890A1 (en) Compositions and methods for the identification of inhibitors of retroviral infection
Bassett et al. Lessons learned and yet-to-Be learned on the importance of RNA structure in SARS-CoV-2 replication
WO2019035763A1 (en) Aptamers for detection of zika flaviviral protein
KR101191994B1 (en) RNA Aptamer Capable of Binding to Human cyclin T1 Protein and Its Use
KR20120092938A (en) Dna aptamer specifically binding to alpha-fetoprotein and its use
Davydova et al. Reporter-recruiting bifunctional aptasensor for bioluminescent analytical assays
JP2009544326A (en) Nucleic acid ligand capable of binding to internalin B or internalin A
Nechaev et al. Dissection of the bacteriophage T4 late promoter complex
KR101716053B1 (en) RNA aptamer specifically binding to NACA protein and uses thereof
KR101384178B1 (en) Aptamer specific to influenza virus ns1 protein and pharmaceutical composition comprising the same
JP2008531036A (en) Genotype analysis and phenotype analysis method for hepatitis B showing resistance to antiviral molecules
Sheridan et al. Tat and the HIV-1 promoter: a model for RNA-mediated regulation of transcription
KR20160019573A (en) Aptamer specific to influenza virus h1 protein, sensing method using the aptamer, vector for the aptamer, and composition for diagnosis and activity inhibition comprising the aptamer
Jain et al. DNA aptamers in COVID-19 research
US20090233985A1 (en) Compositions and methods for inhibiting hiv infections by inhibiting lerepo4 and glipr
US20220119812A1 (en) Micro rna interactions as therapeutic targets for covid-19 and other viral infections
KR20240133744A (en) Aptamer for detecting variants of target analyte, method for making same and use thereof
JP2002320481A (en) Method for amplifying and detecting hiv-1 rna
WO2006087536A1 (en) Compounds

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20151006

Year of fee payment: 4

LAPS Lapse due to unpaid annual fee