KR101147412B1

KR101147412B1 - A composition for treating disease caused by neuronal insult comprising schwann cell-like cells that secreting high amount of growth factors as active ingredients

Info

Publication number: KR101147412B1
Application number: KR1020100023715A
Authority: KR
Inventors: 장미숙
Original assignee: 서울대학교산학협력단
Priority date: 2010-03-17
Filing date: 2010-03-17
Publication date: 2012-05-22
Also published as: KR20110104684A

Abstract

본 발명은 슈반세포를 유효성분으로 함유하는 신경 손상 세포 치료제에 관한 것으로, 구체적으로, 본 발명의 인간 중간엽 줄기세포로부터 분화된 슈반세포는 HGF(hepatocyte growth factor) 및 VEGF(vascular endothelial growth factor)를 과발현하고, 상기 HGF 및 VEGF의 분비를 통해 신경세포 및 손상된 척수조직 절편의 척수신경에서 신경섬유 및 세포의 성장 증가 및, 세포 사멸의 억제 효과를 나타내어 직접적으로 신경성장인자로서의 역할을 수행하는 것을 확인하였으므로, 본 발명의 분화된 슈반세포는 신경 손상 질환을 가지는 개체의 치료 또는 개선을 위해 개체내 HGF 또는 VEGF 전달용 조성물 및 신경계 손상을 치료하기 위한 유전적 조작없이 자가조직에서 유래한 세포 치료제로서 용이하게 이용할 수 있다.The present invention relates to a therapeutic agent for nerve injury cells containing Schwann cells as an active ingredient. Specifically, Schwann cells differentiated from human mesenchymal stem cells of the present invention are hepatocyte growth factor (HGF) and vascular endothelial growth factor (VEGF). Overexpressing HGF and VEGF through the secretion of nerve cells and spinal cord tissue sections of the damaged spinal cord of the nerve fibers and cells to increase the growth and suppression of cell death to act directly as a growth factor As confirmed, the differentiated Schwann cells of the present invention are a composition for delivery of HGF or VEGF in a subject for treatment or improvement of a subject having a neurological disorder and a cell therapeutic agent derived from autologous tissue without genetic manipulation for treating a nervous system injury. It can be used easily.

Description

A composition for treating neuronal damage cells containing pseudo-schwann cells that secrete growth factors as an active ingredient.

본 발명은 신경 손상 세포 치료용 조성물에 관한 것이다.
The present invention relates to a composition for treating neuronal damage cells.

슈반세포(Schwann cells)는 말초신경계에서 신경을 수초화 할 수 있는 신경교(glia) (아교 또는 교) 세포이다. 슈반세포는 뷩너 띠(Bungner band)를 형성함으로써 신경 손상 후 신경 재생에 있어 중요한 역할을 한다. 더 나아가, 슈반세포는 손상된 말초 신경섬유의 재생을 촉진시키는 다양한 성장인자 또는 사이토카인(cytokine)을 분비한다(Bunge, 1994; Jessen and Mirsky, 1999, 2005). 게다가, 척수손상 모델에서 슈반세포의 이식은 신경섬유 재생을 강화하고 기능적 회복을 증진시킨다(Bunge, 1994; Keirstead et al., 1999; Pearse et al., 2004; Takami et al., 2002; Xu et al., 1995). 따라서, 중추신경계에서 신경 재생을 위한 슈반세포의 이식이 제안되어왔었지만, 이러한 접근은 슈반세포를 얻기 위해 외과적인 신경 조직 절취가 필요하므로 임상적인 세팅에서는 문제시된다. 또한, 치료상의 세포 수를 얻기 위해 슈반세포의 수를 늘리는 것도 어렵다.Schwann cells are glia (glia or glial) cells capable of myelinizing nerves in the peripheral nervous system. Schwann cells play an important role in nerve regeneration after nerve injury by forming a Bungner band. Furthermore, Schwann cells secrete various growth factors or cytokines that promote regeneration of damaged peripheral nerve fibers (Bunge, 1994; Jessen and Mirsky, 1999, 2005). In addition, transplantation of Schwann cells in a spinal cord injury model enhances nerve fiber regeneration and promotes functional recovery (Bunge, 1994; Keirstead et. al ., 1999; Pearse et al ., 2004; Takami et al ., 2002; Xu et al ., 1995). Thus, although transplantation of Schwann cells for nerve regeneration in the central nervous system has been proposed, this approach is problematic in clinical settings as surgical neural tissue cutting is required to obtain Schwann cells. It is also difficult to increase the number of Schwann cells in order to obtain therapeutic cell numbers.

골수 유래 중간엽 줄기세포(mesenchymal stem cells, MSC)는 실험실내에서 생장을 유지함과 동시에 자기재생을 할 수 있다. 이 다분화성 세포는 다양한 중배엽 세포로 분화할 수 있다(Bianco et al., 2001; Pittenger et al., 1999; Prockop, 1997). 게다가, MSC는 다양한 신경세포 표지와 기능적으로 신경세포의 활성을 가지는 유사 신경세포로 교차분화 할 수 있는 잠재성을 갖는다(Munoz-Elias et al., 2003; Sanchez-Ramos et al., 2000; Trzaska et al., 2007; Woodbury et al., 2000). 높은 가소성(plasticity)과 낮은 면역 거부 반응 때문에, 인간 중간엽 줄기세포(human mesenchymal stem cells, hMSC)의 응용은 손상된 신경계에 세포 치료를 위한 가치 있는 요인으로서 여겨진다(Thuret et al., 2006). 이전에 본 연구실은 이식된 hMSC가 생체외(ex vivo) 척수손상 모델에서 손상된 신경섬유의 성장과 척수조직 세포의 생존을 증가시킨다는 것을 입증하였다(Cho et al., 2009). 그러나, 줄기세포 유래 슈반세포를 신경손상 치료에 이용한다는 보고는 없다.
Bone marrow-derived mesenchymal stem cells (MSCs) are capable of self-renewal while maintaining growth in the laboratory. These multipotent cells can differentiate into a variety of mesodermal cells (Bianco et. al ., 2001; Pittenger et al ., 1999; Prockop, 1997). In addition, MSCs have the potential to cross-differentiate into neuronal neurons with various neuronal markers and functional neuronal activity (Munoz-Elias et al ., 2003; Sanchez-Ramos et. al ., 2000; Trzaska et al ., 2007; Woodbury et al ., 2000). Because of the high plasticity and low immune rejection response, the application of human mesenchymal stem cells (hMSCs) is considered to be a valuable factor for cell therapy in the damaged nervous system (Thuret et al ., 2006). Previously, the laboratory demonstrated that transplanted hMSCs increase the growth of damaged nerve fibers and the survival of spinal cord tissue cells in an ex vivo spinal cord injury model (Cho et. al ., 2009). However, there are no reports of using stem cell-derived Schwann cells to treat neuronal damage.

이에, 본 발명자들은 슈반세포의 특성을 가지도록 hMSC를 분화유도시켰으며, 상기 분화유도된 hMSC(shMSC)가 신경섬유 재생을 위해 영양인자를 공급할 수 있을 것이라는 가설을 평가하기 위해 연구를 진행하던 중, shMSC가 HGF(hepatocyte growth factor) 및 VEGF(vascular endothelial growth factor)를 과발현하는 것을 최초로 밝혔으며, 상기 HGF 및 VEGF의 분비를 통해 신경세포 및 손상된 척수조직 절편의 척수신경에서 직접적으로 신경성장인자로서의 역할을 수행하는 것을 확인함으로써 본 발명을 완성하였다.
Therefore, the present inventors induced hMSC differentiation to have the characteristics of Schwann cells, and during the study to evaluate the hypothesis that the differentiation-induced hMSC (shMSC) can supply nutrients for nerve fiber regeneration The first time shMSC overexpressed hepatocyte growth factor (HGF) and vascular endothelial growth factor (VEGF), the secretion of the HGF and VEGF resulted in neuronal and injured spinal cord tissue sections directly as nerve growth factor. The present invention has been completed by confirming to play a role.

본 발명의 목적은 인간 골수 유래 중간엽 줄기세포로부터 분화된 미성숙 슈반세포(immature schwann cell)를 유효성분으로 함유하는 개체내 HGF 또는 VEGF 전달용 조성물 및 신경 손상 세포 치료용 조성물을 제공하는 것이다. It is an object of the present invention to provide a composition for delivery of HGF or VEGF in a subject containing immature schwann cells differentiated from human bone marrow-derived mesenchymal stem cells as an active ingredient and a composition for treating neuronal damage cells.

본 발명의 다른 목적은 분화된 슈반세포를 신경 손상 질환을 가지는 개체내로 투여하는 단계를 포함하는 HGF 또는 VEGF의 개체내 운반 방법을 제공하는 것이다.
It is another object of the present invention to provide a method for intra-individual delivery of HGF or VEGF comprising administering differentiated Schwann cells into a subject having a neurologically damaging disease.

상기 목적을 달성하기 위하여, 인간 골수 유래 중간엽 줄기세포로부터 분화된 미성숙 슈반세포(immature schwann cell)를 유효성분으로 함유하는 개체내 HGF 또는 VEGF 전달용 조성물 및 신경 손상 세포 치료용 조성물을 제공한다.In order to achieve the above object, it provides a composition for delivery of HGF or VEGF in the individual and a composition for treating neuronal damage cells containing immature schwann cells differentiated from human bone marrow-derived mesenchymal stem cells as an active ingredient.

또한, 본 발명은 In addition,

1) 미분화 인간 중간엽 줄기세포(uhMSC)를 슈반세포로 분화시키는 단계; 및,1) differentiating undifferentiated human mesenchymal stem cells (uhMSC) into Schwann cells; And,

2) 상기 단계 1)에서 분화된 슈반세포를 신경 손상 질환을 가지는 개체내로 투여하는 단계를 포함하는 HGF 또는 VEGF의 개체내 운반 방법을 제공한다. 2) It provides a method for intra-individual delivery of HGF or VEGF comprising the step of administering the Schwann cells differentiated in step 1) into a subject having a neurological damage disease.

아울러, 본 발명은 미분화 인간 중간엽 줄기세포를 슈반세포로 분화시키는 단계를 포함하는 HGF 또는 VEGF의 생산 방법을 제공한다.
In addition, the present invention provides a method for producing HGF or VEGF comprising the step of differentiating undifferentiated human mesenchymal stem cells into Schwann cells.

본 발명의 인간 중간엽 줄기세포로부터 분화된 슈반세포는 HGF(hepatocyte growth factor) 및 VEGF(vascular endothelial growth factor)를 과발현하고, 상기 HGF 및 VEGF의 분비를 통해 신경세포 및 손상된 척수조직 절편의 척수신경에서 신경섬유 및 세포의 성장 증가 및, 세포 사멸의 억제 효과를 나타내어 직접적으로 신경성장인자로서의 역할을 수행하는 것을 확인하였으므로, 본 발명의 분화된 슈반세포는 신경 손상 질환을 가지는 개체의 치료 또는 개선을 위해 개체내 HGF 또는 VEGF 전달용 조성물 및 신경계 손상을 치료하기 위한 유전적 조작없이 자가조직에서 유래한 세포 치료제로서 용이하게 이용할 수 있다.
Schwann cells differentiated from human mesenchymal stem cells of the present invention overexpress hepatocyte growth factor (HGF) and vascular endothelial growth factor (VEGF), and spinal cord nerves of nerve cells and damaged spinal cord tissue sections through secretion of the HGF and VEGF. In the present invention, it was confirmed that the growth of nerve fibers and cells and the inhibitory effect of cell death have been shown to directly play a role as nerve growth factors. It can be easily used as a cell therapeutic agent derived from autologous tissues without genetic manipulation to treat the HGF or VEGF delivery in the subject and neurological damage.

도 1은 인간 중간엽 줄기세포의 슈반세포 유도 후 세포 형태와 슈반세포 표지 유전자의 변화를 현미경 및 정량적 RT-PCR로 확인한 결과를 나타낸 도이다:
(A) 인간 골수 유래 중간엽 줄기세포(Human bone marrow-derived mesenchymal stem cell; hMSC)를 슈반세포(schwann cell)로 분화를 유도하는 과정에서 세포의 형태 변화를 관찰한 현미경 사진;
(B) 분화시킨 hMSC에서 슈반세포 특이 유전자(GFAP, P0, S100, CNPase 및 p75NTR)의 PCR 산물의 gel 사진;
(C) 슈반세포 특이 유전자의 PCR 결과에서 각 유전자의 mRNA 수준을 밀도계(densitometry)계로 정량한 그래프(* P<0.05, ** P<0.001 versus uhMSC. † P<0.05 versus shMSC).
도 2는 shMSC에서 슈반세포 표지 단백질의 발현을 세포면역화학분석을 통해 확인한 도이다:
(A) 분화시킨 hMSC에서 슈반세포 표지 단백질(GFAP, P0, S100, CNPase 및 p75NTR)의 세포면역형광염색 현미경 사진;
(B) 세포면역형광염색 현미경 사진에서 각 단백질의 형광 세기를 측정한 그래프(* p<0.05, ** p<0.001 versus uhMSC. †† p<0.001 versus shMSC).
도 3은 shMSC에서 분화가 진행되어 세포 주기의 정지가 일어나는 것을 세포면역화학분석을 통해 확인한 도이다:
(A) uhMSC, shMSC 및 shMSC+GM에서 세포면역형광염색법으로 p75NTR(빨간색) 및 브로모데옥시유리딘(Bromodeoxyuridine; BrdU)(녹색)을 염색한 현미경 사진;
(B) 상기 (A)의 현미경 사진에서 BrdU 양성 세포의 비율을 나타낸 그래프;
(C) 상기 (A)의 현미경 사진에서 p75NTR(+)/BrdU(-)세포의 비율을 나타낸 그래프(* p<0.05, ** p<0.001 versus uhMSC. †† p<0.001 versus shMSC).
도 4a 및 도 4a는 shMSC로부터 다양한 성장 인자의 분비를 성장인자 분석 어레이를 통해 분석한 결과를 나타낸 도이다:
(A) 배지, uhMSC-CdM 및 shMSC-CdM에서 성장인자 마이크로어레이 분석 결과;
(B) 상기 (A)의 결과에서 각 성장인자의 상대적 발현수준을 양성대조군에 대한 상대값으로 나타낸 그래프;
(C) 상기 (A)의 결과에서 각 성장인자의 상대적 발현을 배지에서 탐지된 양과 비교한 표(* p<0.05, ** p<0.001 versus Media Alone. † p<0.05, †† p<0.001 versus uhMSC-CdM);
(D) uhMSC, shMSC 및 shMSC+GM에서 HGF의 발현을 ELISA로 확인한 결과를 나타낸 그래프;
(E) uhMSC, shMSC 및 shMSC+GM에서 VEGF의 발현을 ELISA로 확인한 결과를 나타낸 그래프(* p<0.05, ** p<0.001 versus CdM).
(F) shMSC가 유도분화 배양액(SCIM) 및 일반 성장 배양액(GM)에서 HGF 생산을 확인한 ELISA 결과;
(G) shMSC가 유도분화 배양액(SCIM) 및 일반 성장 배양액(GM)에서 VEGF 생산을 확인한 ELISA 결과;
(H) uhMSC, shMSC, shMSC+SCIM 및 shMSC+GM에서 HGF 및 VEGF의 발현을 정량적 RT-PCR로 확인한 gel 사진;
(I) 상기 (H) 결과에서 HGF의 발현량을 GAPDH에 대한 상대량으로 보정한 그래프;
(J) 상기 (H) 결과에서 VEGF의 발현량을 GAPDH에 대한 상대량으로 보정한 그래프(* P<0.05, ** P<0.001 versus uhMSC).
도 5는 shMSC가 동시배양된 Neuro2A 세포의 신경돌기(neurite)의 성장과 증식(proliferation)을 촉진시키는 것을 신경돌기의 정량분석 및 트립판 블루 염색을 통해 확인한 결과를 나타낸 도이다:
(A) Neuro2A 세포 및 인간 중간엽 줄기세포의 동시배양 모식도;
(B) shMSC가 동시배양된 Neuro2A 세포의 신경돌기를 관찰한 현미경 사진;
(C) 상기 (B)의 결과에서 Neuro2A 세포에서 최소 한개 세포체 지름 길이 이상의 신경돌기를 가지는 세포의 비율을 나타낸 그래프;
(D) 상기 (B)의 결과에서 Neuro2A 세포에서 세포당 신경돌기 길이의 총합을 나타낸 그래프(* P<0.05, ** P<0.001 versus Media. † P<0.05, †† P<0.001 versus uhMSC. # P<0.05, ## P<0.001 versus shMSC);
(E) shMSC가 동시배양된 Neuro2A 세포를 트립판 블루로 염색하여 각 그룹의 Neuro2A 세포의 평균 수를 나타낸 그래프;
(F) shMSC가 동시배양된 Neuro2A 세포를 트립판 블루로 염색하여 각 그룹의 사멸된 Neuro2A 세포의 비율을 나타낸 그래프(* P<0.05, ** P<0.001 versus Media. † P<0.05, †† P<0.001 versus uhMSC. # P<0.05, ## P<0.001 versus shMSC).
도 6a 및 도 6b은 shMSC의 이식이 손상 척수조직 절편 모델에서 척수 신경의 성장과 세포 생존을 증가시키는 것을 조직면역화학염색 및 TUNEL 분석을 통해 확인한 결과를 나타낸 도이다:
(A) shMSC의 이식이 손상 척수조직 절편 모델에서 척수 신경의 성장을 조직면역화학염색한 현미경 사진;
(B) 상기 (A)의 결과에서 통합 광학 밀도를 대조군 척수조직 절편에 의해 표준화시킨 그래프(* P<0.05, ** P<0.001 versus Control. †† P<0.001 versus lysolecithin-treated slices(LPC). ## P<0.001 versus LPC+uhMSC. §§ P<0.001 versus LPC+shMSC);
(C) shMSC의 이식이 손상 척수조직 절편 모델에서 세포 생존을 증가시키는 것을 TUNEL 분석을 통해 확인한 현미경 사진;
(D) 상기 (C)의 결과에서 TUNEL-양성 세포를 정량 분석한 그래프(** P<0.001, versus Control. †† P<0.001 versus LPC. # P<0.05, ## P<0.001 versus LPC+uhMSC).
도 7a 및 도 7b는 Neuro2A 세포와 손상 척수조직 절편 모델에서 외인성 HGF 및 VEGF의 신경 영양 인자로서의 효과를 신경돌기의 정량분석, 트립판 블루 염색 및 조직면역화학염색을 통해 확인한 결과를 나타낸 도이다. :
(A)재조합 HGF를 첨가하여 배양한 Neuro2A 세포에서 최소 한개 세포체 지름 길이 이상의 신경돌기를 가지는 세포의 비율을 나타낸 그래프;
(B)재조합 HGF를 첨가하여 배양한 Neuro2A 세포에서 세포당 신경돌기 길이의 총합을 나타낸 그래프;
(C)재조합 VEGF를 첨가하여 배양한 Neuro2A 세포에서 최소 한개 세포체 지름 길이 이상의 신경돌기를 가지는 세포의 비율을 나타낸 그래프;
(D)재조합 VEGF를 첨가하여 배양한 Neuro2A 세포에서 세포당 신경돌기 길이의 총합을 나타낸 그래프(* p<0.05, ** p<0.001 versus 미처리 Neuro2A 세포. † p<0.05, †† p<0.001 versus HGF와 VEGF 동시 처리된 Neuro2A 세포);
(E) 외인성 HGF 및/또는 VEGF 단백질이 손상된 척수조직 절편의 신경돌기 성장을 증가시키는 것을 확인한 현미경 사진;
(F) 상기 (E)의 결과에서 HGF 및/또는 VEGF 단백질의 농도에 따라 NF-M 면역형광 염색된 신경섬유의 상대적인 통합 광학 밀도(IOD) 값을 대조군 척수조직 절편으로 표준화시킨 그래프(* P<0.05, ** P<0.001 versus control. † P<0.05, †† P<0.001 versus 라이소레시틴 처리된 척수조직(LPC));
(G) 인간 골수 유래 중간엽 줄기세포에서 분화된 슈반세포가 손상척추신경에서 HGF 및 VEGF를 분비하여 신경 영양 인자로서 기능하는 메카니즘을 나타낸 도.1 is a diagram showing the results of microscopic and quantitative RT-PCR changes in cell morphology and Schwann cell marker genes after Schwann cell induction of human mesenchymal stem cells:
(A) micrographs of morphological changes of human bone marrow-derived mesenchymal stem cells (hMSC) in the process of inducing differentiation into Schwann cells;
(B) gel photographs of PCR products of Schwann cell specific genes (GFAP, P0, S100, CNPase and p75NTR) in differentiated hMSCs;
(C) In the PCR results of Schwann cell specific genes, the mRNA level of each gene was quantified by densitometry (* P <0.05, ** P <0.001 versus uhMSC. † P <0.05 versus shMSC).
Figure 2 is a diagram confirming the expression of Schwann cell marker protein in the shMSC through cell immunochemical analysis:
(A) cell immunofluorescence staining micrographs of Schwann cell marker proteins (GFAP, P0, S100, CNPase and p75NTR) in differentiated hMSCs;
(B) A graph measuring the fluorescence intensity of each protein in cell immunofluorescence staining micrographs (* p <0.05, ** p <0.001 versus uhMSC. †† p <0.001 versus shMSC).
Figure 3 is a diagram confirming through the cell immunochemical analysis that the differentiation progresses in the shMSC occurs the cell cycle:
(A) micrographs staining p75NTR (red) and bromodeoxyuridine (BrdU) (green) by cell immunofluorescence staining in uhMSC, shMSC and shMSC + GM;
(B) a graph showing the proportion of BrdU positive cells in the micrograph of (A);
(C) A graph showing the ratio of p75NTR (+) / BrdU (−) cells in the micrograph of (A) (* p <0.05, ** p <0.001 versus uhMSC. †† p <0.001 versus shMSC).
4A and 4A show the results of analyzing the growth factor secretion of various growth factors from shMSC through a growth factor analysis array:
(A) growth factor microarray analysis results in medium, uhMSC-CdM and shMSC-CdM;
(B) a graph showing the relative expression level of each growth factor in the results of (A) as a relative value for the positive control group;
(C) Table comparing the relative expression of each growth factor in the results of (A) with the amount detected in the medium (* p <0.05, ** p <0.001 versus Media Alone. † p <0.05, †† p <0.001 versus uh MSC-CdM);
(D) a graph showing the result of confirming the expression of HGF by ELISA in uhMSC, shMSC and shMSC + GM;
(E) Graph showing the results of ELISA expression of VEGF in uhMSC, shMSC and shMSC + GM (* p <0.05, ** p <0.001 versus CdM).
(F) ELISA results in which shMSC confirmed HGF production in induced differentiation culture (SCIM) and normal growth culture (GM);
(G) ELISA results in which shMSC confirmed VEGF production in induced differentiation culture (SCIM) and normal growth culture (GM);
(H) gel pictures confirming the expression of HGF and VEGF by quantitative RT-PCR in uhMSC, shMSC, shMSC + SCIM and shMSC + GM;
(I) a graph of correcting the amount of HGF expression relative to GAPDH in the (H) result;
(J) A graph of correcting the expression level of VEGF by the relative amount with respect to GAPDH in the (H) result (* P <0.05, ** P <0.001 versus uhMSC).
Figure 5 shows the results confirmed by quantitative analysis and trypan blue staining of neurites shMSC promote the growth and proliferation of neurites (neurite) of co-cultured Neuro2A cells:
(A) Schematic diagram of co-culture of Neuro2A cells and human mesenchymal stem cells;
(B) micrographs observing neurites of Neuro2A cells cocultured with shMSCs;
(C) a graph showing the proportion of cells having neurites at least one cell body diameter or longer in Neuro2A cells in the results of (B);
(D) A graph showing the sum of neurites per cell in Neuro2A cells from the results of (B) (* P <0.05, ** P <0.001 versus Media. † P <0.05, †† P <0.001 versus uhMSC. # P <0.05, ## P <0.001 versus shMSC);
(E) a graph showing the average number of Neuro2A cells in each group by staining Neuro2A cells cocultured with shMSC with trypan blue;
(F) A graph showing the percentage of killed Neuro2A cells in each group by staining Neuro2A cells co-cultured with shMSC (* P <0.05, ** P <0.001 versus Media. † P <0.05, †† P <0.001 versus uhMSC. # P <0.05, ## P <0.001 versus shMSC).
6A and 6B show the results of tissue immunochemical staining and TUNEL analysis showing that transplantation of shMSC increases spinal nerve growth and cell survival in an injured spinal cord tissue section model:
(A) Tissue immunohistostaining of spinal nerve growth in an injured spinal cord tissue section model of transplantation of shMSC;
(B) A graph in which the integrated optical density was normalized by control spinal cord tissue sections from the results of (A) (* P <0.05, ** P <0.001 versus Control. †† P <0.001 versus lysolecithin-treated slices (LPC) ## P <0.001 versus LPC + uhMSC.§§ P <0.001 versus LPC + shMSC);
(C) micrographs confirmed by TUNEL analysis that transplantation of shMSC increased cell survival in an injured spinal cord tissue section model;
(D) A graph quantitatively analyzing TUNEL-positive cells from the results of (C) (** P <0.001, versus Control. †† P <0.001 versus LPC. # P <0.05, ## P <0.001 versus LPC + uhMSC).
Figures 7a and 7b is a diagram showing the results confirmed by the quantitative analysis of the neurites, trypan blue staining and tissue immunohistochemical staining effect of exogenous HGF and VEGF as neurotrophic factors in Neuro2A cells and damaged spinal cord tissue section model. :
(A) a graph showing the proportion of cells with neurites at least one cell body diameter in length in Neuro2A cells cultured with recombinant HGF;
(B) a graph showing the total length of neurites per cell in Neuro2A cells cultured with recombinant HGF;
(C) a graph showing the proportion of cells having neurites at least one cell body diameter in length in Neuro2A cells cultured with recombinant VEGF;
(D) Graph showing total sum of neurites per cell in Neuro2A cells cultured with recombinant VEGF (* p <0.05, ** p <0.001 versus untreated Neuro2A cells. † p <0.05, †† p <0.001 versus Neuro2A cells co-treated with HGF and VEGF);
(E) micrographs confirming that exogenous HGF and / or VEGF proteins increase neurite growth in damaged spinal cord tissue sections;
(F) The graph of normalizing the relative integrated optical density (IOD) values of NF-M immunofluorescent stained neurons according to the concentration of HGF and / or VEGF protein in the results of (E) as control spinal cord tissue sections (* P <0.05, ** P <0.001 versus control. † P <0.05, †† P <0.001 versus lysolecithin-treated spinal cord tissue (LPC));
(G) Schwann cells differentiated from human bone marrow-derived mesenchymal stem cells secrete HGF and VEGF in the injured spinal nerve to show a mechanism that functions as a neurotrophic factor.

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 인간 골수 유래 중간엽 줄기세포로부터 분화된 미성숙 슈반세포(immature schwann cell)를 유효성분으로 함유하는 개체내 HGF 또는 VEGF 전달용 조성물 및 신경 손상 세포 치료용 조성물을 제공한다.
The present invention provides a composition for delivery of HGF or VEGF in a subject and a composition for treating neuronal damage cells containing immature schwann cells differentiated from human bone marrow-derived mesenchymal stem cells as an active ingredient.

상기 분화된 슈반세포는 슈반세포의 분화 단계(lineage) 중 미성숙(immature) 슈반세포인 것이 바람직하나, 이에 제한되는 것은 아니며 유사 슈반세포(schwann-like cell)라면 모두 사용가능하다.The differentiated Schwann cells are preferably immature Schwann cells during the differentiation of Schwann cells (lineage), but is not limited thereto, and any Schwann-like cells may be used.

상기 분화된 슈반세포는 미분화 인간 중간엽 줄기세포(Untreated hMSC; uhMSC)로부터 하기 a) 내지 c)의 단계를 포함하는 방법으로 분화된 것이 바람직하나 이에 제한되는 것은 아니며, 미분화 포유동물 중간엽 줄기세포 또는 피부-유래 1차 세포(skin-derived primary cell)로부터 슈반세포로의 분화에 사용되는 방법이라면 모두 사용가능하다:The differentiated Schwann cells are preferably differentiated from undifferentiated human mesenchymal stem cells (Untreated hMSC; uhMSC) by a method comprising the steps of a) to c), but are not limited thereto, undifferentiated mammalian mesenchymal stem cells Or any method used for differentiation from skin-derived primary cells to Schwann cells:

a) 10% FBS 및 1 mM β-머캅토에탄올(mercaptoethanol)을 함유하는 DMEM 배지로 24시간 동안 1차 배양하는 단계;a) primary culture for 24 hours in DMEM medium containing 10% FBS and 1 mM β-mercaptoethanol;

b) 10% FBS 및 280 ng/ml 레티노산(retinoic acid)을 함유하는 DMEM 배지로 72시간 동안 2차 배양하는 단계; 및, b) secondary culture for 72 hours in DMEM medium containing 10% FBS and 280 ng / ml retinoic acid; And,

c) 10% FBS, 10 μ/ml 폴스콜린(forskolin), 10 ng/ml 인간 bFGF, 5 ng/ml PDGF-AA 및 200 ng/ml 인간 헤레귤린-β1(heregulin-β1)을 함유하는 DMEM 배지로 8일 동안 3차 배양하는 단계.c) DMEM medium containing 10% FBS, 10 μ / ml forskolin, 10 ng / ml human bFGF, 5 ng / ml PDGF-AA and 200 ng / ml human Heregulin-β1 (heregulin-β1) Tertiary incubation for 8 days.

상기 조성물은 신경 손상 질환 또는 허혈성 질환을 가지는 개체의 치료 또는 개선을 위해 투여될 수 있다. 상기 신경 손상 질환은 뇌졸중 (stroke), 파킨슨씨병, 알츠하이머병, 피크병 (Pick's disease), 헌팅톤병 (Huntington's disease), 근위축성 측면 경화증 (Amyotrophic lateral sclerosis), 외상성 중추 신경계 질환 (traumatic central nervous system diseases) 및 척수 손상 질환 (spinal cord injury disease)으로 이루어진 군으로부터 선택되는 어느 하나의 질병, 바람직하게는 척수 손상 질환이나 이에 제한되는 것은 아니다. 상기 허혈성 질환은 외상, 이식시의 거부반응, 허혈성 뇌혈관장애, 허혈성 신장질환, 허혈성 폐질환, 감염증에 관련되는 허혈성 질환, 사지의 허혈성 질환 및 허혈성 심질환으로 이루어진 군으로부터 선택되는 것이 바람직하나, 이에 제한되는 것은 아니다.
The composition may be administered for the treatment or amelioration of an individual having a neurological or ischemic disease. The nerve injury diseases include stroke, Parkinson's disease, Alzheimer's disease, Pick's disease, Huntington's disease, Amyotrophic lateral sclerosis, traumatic central nervous system diseases ) And spinal cord injury disease, preferably, but not limited to any one disease selected from the group consisting of spinal cord injury disease. The ischemic disease is preferably selected from the group consisting of trauma, transplant rejection, ischemic cerebrovascular disorder, ischemic kidney disease, ischemic lung disease, ischemic disease related to infectious disease, ischemic disease of the extremities and ischemic heart disease. It is not limited.

본 발명의 구체적인 실시예에서, 본 발명자들은 미분화된 인간 골수 유래 중간엽 줄기세포(uhMSC)를 슈반세포(Schwann cell)로 분화를 유도하여 유사 슈반세포의 형태로 변화(도 1의 A 참조), 슈반세포 특이 유전자의 발현(도 1의 B 참조) 및 슈반세포 표지 단백질의 발현(도 2의 A 및 도 2의 B 참조)을 확인하였고, 세포 주기의 정지(Cell cycle arrest)가 분화유도된 인간 중간엽 줄기세포(shMSC)에서 일어난 것을 알 수 있었다(도 3의 A 및 도 3의 B 참조). 상기 결과로부터, uhMSC에서 분화가 진행되어 세포 분열이 감소되었고, 슈반세포의 형태, 유전자 및 단백질 발현 양상을 나타내지만, 그 형태가 완벽하게 수초화된(myelinated) 슈반세포의 형태는 아니므로 슈반세포 분화 과정 중 미성숙(immature) 슈반세포로 분화된 것을 알 수 있었다. In a specific embodiment of the present invention, the present inventors induced differentiation of undifferentiated human bone marrow-derived mesenchymal stem cells (uhMSC) into Schwann cells to change to the form of pseudo-schwan cells (see FIG. 1A), Expression of Schwann cell-specific genes (see FIG. 1B) and Schwann cell marker proteins (see FIG. 2A and FIG. 2B) were confirmed, and cell cycle arrest induced differentiation in humans. Mesenchymal stem cells (shMSC) was found to occur (see Fig. 3 A and 3 B). From the above results, the differentiation progressed in uhMSC and cell division was reduced, and Schwann cell differentiation was exhibited, although the form, gene and protein expression of Schwann cell were not completely myelinated, but Schwann cell differentiation. It was found that the process differentiated into immature Schwann cells.

또한, 본 발명자들은 상기에서 분화시킨 shMSC 세포에서 분비되는 인간 성장인자를 분석한 결과, uhMSC보다 shMSC에서 HGF(hepatocyte growth factor), VEGF(vascular endothelial growth factor), IGFBP-1(insulin-like growth factor binding protein-1), IGFBP-2, IGFBP-4, IGFBP-6 및 SCF(stem cell factor)의 발현이 증가되어 있는 것을 확인하였으며(도 4a의 A 내지 도 4a의 C 참조), 특히, HGF 및 VEGF의 발현이 10배 이상 증가하였고(도 4a의 D 및 도 4a의 E 참조), shMSC의 HGF 및 VEGF 분비는 일반 성장 배양액에서 배양하였을 때에도 5일 동안 높게 유지되며(도 4b의 F 및 도 4b의 G 참조), 이는 mRNA의 발현량이 증가하기 때문임을 확인하였다(도 4b의 H 내지 도 4b의 J 참조).In addition, the present inventors analyzed human growth factors secreted from the differentiated shMSC cells, hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and insulin-like growth factor (GFGF-1) in shMSC than uhMSC. binding protein-1), IGFBP-2, IGFBP-4, IGFBP-6 and SCF (stem cell factor) was found to increase the expression (see Fig. 4a A to 4a C), in particular, HGF and Expression of VEGF increased more than 10-fold (see D in FIG. 4A and E in FIG. 4A), and HGF and VEGF secretion of shMSC remained high for 5 days even when cultured in normal growth culture (F and 4B in FIG. 4B). Of G), it was confirmed that this is because the expression level of mRNA is increased (see H of Figure 4b to J of Figure 4b).

또한, 본 발명의 구체적 실시예에서 본 발명자들은 uhMSC로부터 분화된 성장인자를 과분비하는 shMSC가 신경세포에 미치는 영향을 분석한 결과, shMSC를 신경세포(Neuro2A)와 동시배양(co-culture)하였을 때, 신경돌기(neurite)의 성장 및 세포 성장 및 생존을 증가시키는 효과가 있음을 확인하였고, 상기 효과는 HGF 및/또는 VEGF에 대한 항체에 의해 감소되는 것을 관찰하여, shMSC의 신경세포에 대한 신경성장인자로서의 효과는 shMSC에서 분비되는 HGF 및 VEGF에 의해 유도되는 것임을 알 수 있었다(도 5의 B 내지 도 5의 F 참조).In a specific embodiment of the present invention, the present inventors analyzed the effect of shMSC over-secreting growth factors differentiated from uhMSC on neurons, and when co-cultured shMSC with neurons (Neuro2A) In addition, it was confirmed that there is an effect of increasing the growth and cell growth and survival of neurite, the effect is reduced by the antibody to HGF and / or VEGF, the shMSC neuronal growth of neurons It can be seen that the effect as a factor is induced by HGF and VEGF secreted from shMSC (see F of Fig. 5 B).

또한, 본 발명의 구체적 실시예에서 본 발명자들은 상기에서 확인한 shMSC의 신경세포에 대한 신경성장인자로서의 효과가 ex vivo에서도 동일하게 작용하는지 국립서울대학교 실험동물운영위원회의 승인을 받아 실험한 결과, 스프라그-돌리(Sprague-Dawley) 래트로부터 채취한, 라이소레시틴을 처리하여 손상시킨 요추(lumbar) 척수조직절편(LPC)에서 shMSC를 이식했을 경우, uhMSC를 이식한 경우보다 신경돌기 성장 및 세포사멸 억제 효과가 현저하게 높은 것을 확인하였다(도 6a의 A 내지 도 6b의 D 참조). 상기 shMSC 이식에 의한 손상된 척수조직절편의 신경돌기 성장 증가는 HGF 및/또는 VEGF에 대한 항체를 처리하였을 때 유의하게 감소하였으나, shMSC의 척수조직 절편의 세포 사멸 억제 효과는 HGF 및/또는 VEGF에 대한 항체 처리 여부에 유의한 차이를 보이지 않은 것으로부터 shMSC의 척수조직 절편에 대한 신경성장인자로서의 효과는 shMSC에서 분비되는 HGF 및 VEGF에 의해 유도되는 것이지만, 리소레시틴에 의한 척수조직 절편 세포의 세포사멸 보호 효과는 HGF 및 VEGF의 분비에 의한 효과와 독립적인 것을 알 수 있었다(도 6a의 A 내지 도 6b의 D 참조). In addition, in a specific embodiment of the present invention, the present inventors have been tested with the approval of the Seoul National University Laboratory Animal Steering Committee whether the effect of the shMSC as a neuronal growth factor on the neurons identified above ex vivo. Transplantation of shMSCs in lumbar spinal cord tissue (LPC) damaged by lysolecithin treated from Sprague-Dawley rats, compared to uhMSC implantation, neurites growth and apoptosis It was confirmed that the inhibitory effect was remarkably high (see A of FIG. 6A to D of FIG. 6B). Increasing neurite outgrowth of damaged spinal cord tissue sections by shMSC transplantation was significantly reduced when HGF and / or VEGF were treated with antibodies, whereas the inhibitory effect of shMSC on spinal cord tissue sections was inhibited by HGF and / or VEGF. The effect of shMSC as a neuronal growth factor on spinal cord tissue fragmentation from the absence of significant difference in antibody treatment was induced by HGF and VEGF secreted by shMSC, but lysocithin protects apoptosis of spinal cord tissue cell. The effect was found to be independent of the effect by the secretion of HGF and VEGF (see D in Fig. 6A to 6B).

아울러, 본 발명의 구체적 실시예에서 상기에서 확인한 shMSC의 신경세포의 신경돌기 및 세포 성장 증가 및 손상 척수조직 절편의 신경돌기 성장 및 세포사멸 억제 효과가 shMSC가 분비하는 성장인자에 의한 것인지 확인하기 위하여 신경세포 또는 척수조직절편에 재조합 HGF 또는 VEGF 단백질을 처리하여 분석한 결과, 외인성 HGF 및/또는 VEGF 단백질에 의해 신경세포 및 척수조직절편의 신경돌기 성장 및, 신경세포 생장이 증가되는 것을 확인하였다(도 7a의 A 내지 도 7b의 F 참조).In addition, in a specific embodiment of the present invention, to confirm whether the neurite and cell growth increase and neuronal dendritic growth and apoptosis inhibitory effect of the neural cells of the shMSC identified above are due to the growth factor secreted by shMSC As a result of treatment with recombinant HGF or VEGF protein in nerve cells or spinal cord tissue sections, it was confirmed that exogenous HGF and / or VEGF proteins increase neurite growth and nerve cell growth of nerve cells and spinal cord tissue sections ( 7A to 7B).

상기 결과로부터 인간 골수 유래 중간엽 줄기세포에서 분화된 유사 슈반세포가 다양한 성장인자를 과분비하여 신경세포의 신경돌기 및 세포 성장을 증가시키는 효과를 가지는 것을 확인하였며, 상기 효과를 이용하여 in vitro뿐만 아니라 ex vivo에서도 신경 재생을 유도할 수 있다는 것을 증명하였다(도 7b의 G 참조). 또한, 본 발명에서 shMSC에서 HGF 및 VEGF의 분비를 처음으로 확인하였으므로, 본 발명의 분화된 hMSC를 신경 손상 질환을 가지는 개체내로 HGF 및 VEGF를 운반용 조성물로서 유용하게 사용할 수 있다.From the above results, it was confirmed that similar Schwann cells differentiated from human bone marrow-derived mesenchymal stem cells have an effect of increasing the neurites and cell growth of neurons by oversecreting various growth factors. But also proved that ex vivo can induce neuronal regeneration (see G of Figure 7b). In addition, since the secretion of HGF and VEGF in the shMSC in the present invention for the first time, the differentiated hMSC of the present invention can be usefully used as a transport composition for HGF and VEGF into a subject having a neurological disorder.

본 발명의 세포 치료용 조성물은 바람직하게는 약학적 조성물이며, 당업자에게 공지의 방법으로 제재화하는 것이 가능하다. 예를 들면, 필요에 따라 물 혹은 그외 약학적으로 허용가능한 액과의 무균성 용액, 또는 현탁액제의 주사제의 형태로 비경구적으로 사용할 수 있다. 예를 들면, 약리학상 허용되는 담체 혹은 매체, 구체적으로는 멸균수나 생리식염수, 식물유, 유화제, 현탁제, 계면활성제, 안정제, 부형제, 비히클(vehicle), 방부제, 결합제 등과 적절히 조합하여 일반적으로 인정된 제약 실시에 요구되는 단위 용량 형태로 혼화하는 것에 의해 제재화하는 것으로 여겨진다. 상기 제재에 있어서 유효 성분량은 지시받은 범위의 적당 용량을 얻을 수 있도록 하는 것이다. 또, 주사를 위한 무균 조성물은 주사용 증류수와 같은 비히클을 이용해 통상의 제재 실시에 따라 처방할 수 있다. 이때 주사용 수용액으로는 예를 들면, 생리 식염수, 포도당이나 그외 보조약을 포함한 등장용액, 예를들면, D-소르비톨, D-만노스, 염화나트륨을 들 수 있어 적당한 용해 보조제, 예를 들면 알코올, 구체적으로 에탄올, 폴리알코올, 예를 들면 프로필렌 글리콜, 폴리에틸렌 글리콜, 비이온성 계면활성제, 예를 들면 폴리소르베이트 80(TM), HCO-50으로 병용할 수 있다. 유성액으로서는 참기름, 콩기름을 들 수 있어 용해 보조제로서 안식향산벤질, 벤질 알코올과 병용할 수 있다. 또, 완충제, 예를 들면 인산염 완충액, 초산나트륨 완충액, 무통화제, 예를 들면 염산 프로카인, 안정화제, 예를 들면 벤질 알코올, 페놀, 산화방지제와 배합할 수 있다. 조제된 주사액은 통상 적당한 앰플에 충전시킨다.The cell therapy composition of the present invention is preferably a pharmaceutical composition, and can be formulated by methods known to those skilled in the art. For example, it can be used parenterally in the form of an injection as a sterile solution or suspension with water or other pharmaceutically acceptable liquid, if necessary. For example, pharmaceutically acceptable carriers or media, specifically sterile water or physiological saline, vegetable oils, emulsifiers, suspending agents, surfactants, stabilizers, excipients, vehicles, preservatives, binders and the like, as appropriately combined It is considered to be sanctioned by blending into the unit dosage form required for pharmaceutical implementation. In the above preparation, the active ingredient amount is such that an appropriate dose in the range indicated can be obtained. In addition, a sterile composition for injection may be prescribed in accordance with conventional preparations using a vehicle such as distilled water for injection. At this time, the aqueous solution for injection may include, for example, isotonic solution containing physiological saline, glucose or other supplements, for example, D-sorbitol, D-mannose, sodium chloride, and suitable dissolution aids such as alcohol, Ethanol, polyalcohols such as propylene glycol, polyethylene glycol, nonionic surfactants such as polysorbate 80 (TM) and HCO-50. Examples of the oily liquid include sesame oil and soybean oil, and it can be used in combination with benzyl benzoate and benzyl alcohol as a dissolution aid. It can also be combined with buffers such as phosphate buffers, sodium acetate buffers, analgesics such as procaine hydrochloride, stabilizers such as benzyl alcohol, phenols, antioxidants. The prepared injection solution is usually filled in a suitable ampoule.

환자의 체내에의 투여는 바람직하게는 비경구투여이며, 구체적으로는 손상부위에의 1회 투여가 기본이지만 여러차례 투여도 좋다. 또, 투여시간은 단시간이라도 장시간 지속 투여라도 좋다. 더욱 구체적으로는 주사제형, 경피투여형 등을 들 수 있다.The administration to the body of the patient is preferably parenteral administration. Specifically, once administration to the damaged area is basic, multiple administrations may be used. In addition, the administration time may be a short time or a long time continuous administration. More specifically, there may be mentioned injection, transdermal administration and the like.

본 발명의 약학적 조성물이 적용될 수 있는 개체는 척추동물이고 바람직하게는 포유동물이며, 그보다 바람직하게는 쥐, 토끼, 기니아피크, 햄스터, 개, 고양이와 같은 실험동물이고, 가장 바람직하게는 침팬지, 고릴라와 같은 유인원류 동물이다.
The subject to which the pharmaceutical composition of the invention can be applied is a vertebrate and preferably a mammal, more preferably an experimental animal such as a rat, rabbit, guinea pig, hamster, dog, cat, most preferably a chimpanzee, Ape-like animals such as gorillas.

또한, 본 발명은 In addition,

1) 미분화 인간 중간엽 줄기세포를 슈반세포로 분화시키는 단계; 및,1) differentiating undifferentiated human mesenchymal stem cells into Schwann cells; And,

2) 상기 단계 1)에서 분화된 슈반세포를 신경 손상 질환을 가지는 개체내로 투여하는 단계를 포함하는 HGF 및/또는 VEGF의 개체내 운반 방법을 제공한다.
2) It provides a method for intra-individual delivery of HGF and / or VEGF comprising the step of administering the Schwann cells differentiated in step 1) into a subject having a neurological damage disease.

상기 단계 1)의 분화는 하기 a) 내지 c)의 단계를 포함하는 분화 방법으로 이루어지는 것이 바람직하나 이에 제한되는 것은 아니며, 미분화 포유동물 중간엽 줄기세포 또는 피부-유래 1차 세포로부터 슈반세포로의 분화에 사용되는 방법이라면 모두 사용가능하다:Differentiation of step 1) is preferably made of a differentiation method comprising the steps of a) to c), but is not limited thereto, from undifferentiated mammalian mesenchymal stem cells or skin-derived primary cells to Schwann cells. Any method used for differentiation can be used:

a) 10% FBS 및 1 mM β-머캅토에탄올을 함유하는 DMEM 배지로 24시간 동안 1차 배양하는 단계;a) first incubation for 24 hours with DMEM medium containing 10% FBS and 1 mM β-mercaptoethanol;

b) 10% FBS 및 280 ng/ml 레티노산을 함유하는 DMEM 배지로 72시간 동안 2차 배양하는 단계; 및, b) secondary incubation for 72 hours in DMEM medium containing 10% FBS and 280 ng / ml retinoic acid; And,

c) 10% FBS, 10 μ/ml 폴스콜린, 10 ng/ml 인간 bFGF, 5 ng/ml PDGF-AA 및 200 ng/ml 인간 헤레귤린-β1(heregulin-β1)을 함유하는 DMEM 배지로 8일 동안 3차 배양하는 단계.c) 8 days in DMEM medium containing 10% FBS, 10 μ / ml foscholine, 10 ng / ml human bFGF, 5 ng / ml PDGF-AA and 200 ng / ml human Heregulin-β1 (heregulin-β1) During the third culture.

상기 단계 2)의 분화된 슈반세포는 미성숙 슈반세포인 것이 바람직하나, 이에 제한되는 것은 아니며 유사 슈반세포(schwann cell-like cell)라면 모두 사용가능하다. The differentiated Schwann cells of step 2) are preferably immature Schwann cells, but are not limited thereto, and any Schwann cell-like cells may be used.

상기 단계 2)의 신경 손상 질환은 뇌졸중, 파킨슨씨병, 알츠하이머병, 피크병, 헌팅톤병, 근위축성 측면 경화증, 외상성 중추 신경계 질환 및 척수 손상 질환으로 이루어진 군으로부터 선택되는 것이 바람직하고, 척수 손상 질환인 것이 더욱 바람직하나, 이에 제한되는 것은 아니다. The nerve injury disease of step 2) is preferably selected from the group consisting of stroke, Parkinson's disease, Alzheimer's disease, peak disease, Huntington's disease, amyotrophic lateral sclerosis, traumatic central nervous system disease and spinal cord injury disease, More preferably, but is not limited thereto.

상기 단계 2)의 분화된 슈반세포는 HGF 및 VEGF를 과분비하는 특성을 가지며, 본 발명의 방법은 신경 손상 질환을 가지는 개체의 치료 및 개선을 위해 본 발명의 분화된 슈반세포를 개체 내로 운반하기 위해 사용된다. The differentiated Schwann cells of step 2) have the property of over-secreting HGF and VEGF, and the method of the present invention provides for transporting the differentiated Schwann cells of the present invention into a subject for the treatment and amelioration of a subject having a neurological disorder. Used.

상기 단계 2)의 투여는 바람직하게는 비경구투여이며, 구체적으로는 손상부위에의 1회 투여가 기본이지만 여러차례 투여도 좋다. 또, 투여시간은 단시간이라도 장시간 지속 투여라도 좋다. 더욱 구체적으로는 주사제형, 경피투여형 등을 들 수 있다.The administration of step 2) is preferably parenteral administration. Specifically, once administration to the damaged area is basic, multiple administration may be performed. In addition, the administration time may be a short time or a long time continuous administration. More specifically, there may be mentioned injection, transdermal administration and the like.

본 발명의 방법이 적용될 수 있는 개체는 척추동물이고 바람직하게는 포유동물이며, 그보다 바람직하게는 쥐, 토끼, 기니아피크, 햄스터, 개, 고양이와 같은 실험동물이고, 가장 바람직하게는 침팬지, 고릴라와 같은 유인원류 동물이다. The subject to which the method of the invention can be applied is a vertebrate and preferably a mammal, more preferably an experimental animal such as a rat, rabbit, guinea pig, hamster, dog, cat, and most preferably chimpanzee, gorilla and It is the same anthropoid animal.

본 발명의 방법은 과학자 또는 의사에 의해서 적절히 수정되어 본 발명의 분화된 슈반세포를 개체로 투여하기위해 사용될 수 있다.
The method of the invention can be used to administer the differentiated Schwann cells of the invention to a subject as appropriately modified by a scientist or physician.

아울러, 본 발명은 미분화 인간 중간엽 줄기세포(uhMSC)를 슈반세포로 분화시키는 단계를 포함하는 HGF 또는 VEGF의 생산 방법을 제공한다.In addition, the present invention provides a method for producing HGF or VEGF comprising the step of differentiating undifferentiated human mesenchymal stem cells (uhMSC) into Schwann cells.

상기 분화는 하기 a) 내지 c)의 단계를 포함하는 방법으로 이루어지는 것이 바람직하나 이에 제한되는 것은 아니며, 미분화 포유동물 중간엽 줄기세포 또는 피부-유래 1차 세포로부터 슈반세포로의 분화에 사용되는 방법이라면 모두 사용가능하다:The differentiation preferably comprises a method comprising the steps of a) to c), but is not limited thereto, and is used for differentiation from undifferentiated mammalian mesenchymal stem cells or skin-derived primary cells to Schwann cells. If all are available:

c) 10% FBS, 10 μ/ml 폴스콜린(forskolin), 10 ng/ml 인간 bFGF, 5 ng/ml PDGF-AA 및 200 ng/ml 인간 헤레귤린-β1(heregulin-β1)을 함유하는 DMEM 배지로 8일 동안 3차 배양하는 단계.
c) DMEM medium containing 10% FBS, 10 μ / ml forskolin, 10 ng / ml human bFGF, 5 ng / ml PDGF-AA and 200 ng / ml human Heregulin-β1 (heregulin-β1) Tertiary incubation for 8 days.

이하, 본 발명을 하기 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by the following examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

미성숙 슈반세포로 분화 유도Induction of differentiation into immature Schwann cells

<1-1>인간 <1-1> human 중간엽Intermediate lobe 줄기세포의 분화 유도 Induction of differentiation of stem cells

본 발명자들은 Cambrex(미국)에서 구입한 인간 골수 유래 중간엽 줄기세포(Human bone marrow-derived mesenchymal stem cell; hMSC)를 유사 슈반세포(Schwann cell-like cell)로 분화를 유도하였다. 구체적으로, 미분화된 인간 골수 유래 중간엽 줄기세포(Untreated hMSC; uhMSC)는 DMEM-저포도당 배지, 10% FBS 및 1% 페니실린-스트렙토마이신 혼합물로 구성된 기본 성장배지와 함께 37℃, 5% CO₂의 세포 배양기에서 배양하였다. 세포 배양기에서 2일 동안 배양한 후 기본 성장배지를 1차 분화배지[(DMEM-저포도당 배지, 10% FBS, 1% 페니실린-스트렙토마이신 혼합물, 1 mM β-메르캅토에탄올(β-mercaptoethanol)]로 교체하여 24시간 동안 배양하였다. 이후, 상기 중간엽 줄기세포를 PBS(인산완충용액)으로 세척 후 2차 분화배지(DMEM-저포도당 배지, 10% FBS, 1% 페니실린-스트렙토마이신 혼합물, 0.28 μg/ml all-trans-retinoic acid)로 교체하여 배양하였다. 3일 후, 상기 중간엽 줄기세포를 PBS로 세척한 후 3차 분화배지[DMEM-저포도당 배지, 10% FBS, 1% 페니실린-스트렙토마이신 혼합물, 10 mM forskolin, 10 ng/ml 인간 섬유아세포 성장인자(human basic-fibroblast growth factor), 5 ng/ml 인간 혈소판 유도성장인자-AA(human platelet derived growth factor-AA), 200 ng/ml 헤레귤린1-베타1(heregulin-β1)]로 교체하여 8일 동안 배양하였다. 이때, 상기 3차 분화배지는 이틀에 한번 교체하였다. 분화유도를 위해 배양중인 hMSC의 형태를 현미경으로 관찰하였다. 분화유도 과정동안의 세포 생존율은 트립판 블루 염색을 통해 확인하였으며, 트립판 블루 염색이 되지 않은 세포(살아있는 세포)의 퍼센트로 측정되었다.The inventors induced the differentiation of human bone marrow-derived mesenchymal stem cells (hMSC) purchased from Cambrex (USA) into Schwann cell-like cells. Specifically, undifferentiated human bone marrow-derived mesenchymal stem cells (uhMSC) were treated at 37 ° C., 5% CO ₂ with a basic growth medium consisting of DMEM-low glucose medium, 10% FBS, and 1% penicillin-streptomycin mixture. The cells were cultured in a cell incubator. Primary growth medium after incubation for 2 days in cell culture medium ((DMEM-low glucose medium, 10% FBS, 1% penicillin-streptomycin mixture, 1 mM β-mercaptoethanol)] The mesenchymal stem cells were washed with PBS (phosphate buffer solution), followed by secondary differentiation medium (DMEM-low glucose medium, 10% FBS, 1% penicillin-streptomycin mixture, 0.28). 3 days later, the mesenchymal stem cells were washed with PBS, followed by tertiary differentiation medium (DMEM-low glucose medium, 10% FBS, 1% penicillin-). Streptomycin mixture, 10 mM forskolin, 10 ng / ml human basic-fibroblast growth factor, 5 ng / ml human platelet derived growth factor-AA, 200 ng / ml Heregulin-beta1 (heregulin-β1)] was incubated for 8 days, wherein the third The flower medium was replaced once every two days, and the morphology of the cultured hMSC was observed under the microscope for induction of differentiation. Cell viability during the differentiation induction process was confirmed by trypan blue staining, and cells without trypan blue staining ( Live cells).

그 결과, 도 1의 A에 나타난 바와 같이 uhMSC는 슈반세포 분화 유도 과정을 통해 시간이 경과할수록 형태적 변화와 함께 유사 슈반세포(Schwann cell-like cell)의 형태(elongated bipolar shape)로 변화됨을 관찰하였다. 특히, 분화 8일째 54%까지, 분화 12일째 80%이상 유사 슈반세포(분화된 인간 중간엽 줄기세포, Schwann cell induction medium-treated hMSC; shMSC)로 변화되었고, 분화유도 과정동안 대부분의 세포가 살아있음을 관찰하였다. 분화 유도 완료 후 3일 동안 일반 성장 배지에서 배양된 shMSC(shMSC+GM)의 약 50%가 유사 슈반세포의 형태를 유지하였다.
As a result, as shown in FIG. 1A, uhMSC is changed to elongated bipolar shape with morphological changes over time through Schwann cell differentiation induction process. It was. In particular, up to 54% at 8 days of differentiation and at least 80% at 12 days of differentiation were transformed to pseudo-schwann cells (differentiated human mesenchymal stem cells, Schwann cell induction medium-treated hMSCs; shMSCs). Was observed. About 50% of shMSCs (shMSC + GM) cultured in normal growth medium maintained the morphology of pseudo-Schban cells for 3 days after completion of differentiation induction.

<1-2>슈반세포 특이 유전자의 발현 확인<1-2> Expression of Schwann cell specific genes

상기 실시예 1-1에서 분화시킨 shMSC에서 슈반세포 특이 유전자(GFAP, P0, S100, CNPase 및 p75NTR)의 발현을 정량적 RT-PCR을 통해 확인하였다. 구체적으로, uhMSC, shMSC 및 shMSC+GM을 각각 트리졸 용액(Invitrogen, USA)을 이용하여 전체 RNA를 분리한 다음, MMLV 역전사효소(MMLV reverse transcriptase, Promega)를 이용하여 cDNA로 역전사(reverse transcription, RT)를 수행하였다. 상기의 반응 후 생성된 각 세포의 cDNA(200 ng)를 200 nM dNTPs, 100 pM의 각각의 유전자에 대한 프라이머 쌍(표 1) 및 0.5 U Taq DNA 중합효소를 사용하여 PCR하였다. 상기에서 생성된 PCR 산물은 2% 아가로스 젤 상에서 전기영동에 의해 확인하였다. 각 유전자의 mRNA 수준은 밀도계(densitometry)에 의해 정량화 되었고, 각 세포에 상응하는 GAPDH 수준에 의해 표준화되었다. 상기 실험은 독립적으로 최소 3번 반복되었으며 평균±표준오차로 표시되었다.Expression of Schwann cell specific genes (GFAP, P0, S100, CNPase and p75NTR) in the shMSC differentiated in Example 1-1 was confirmed by quantitative RT-PCR. Specifically, uhMSC, shMSC and shMSC + GM were isolated from the total RNA using Trizol solution (Invitrogen, USA), and then reverse transcription (c) reversed into cDNA using MMLV reverse transcriptase (Promega). RT) was performed. The cDNA (200 ng) of each cell generated after the reaction was PCR using 200 nM dNTPs, primer pairs for each gene of 100 pM (Table 1) and 0.5 U Taq DNA polymerase. The PCR product produced above was confirmed by electrophoresis on 2% agarose gel. MRNA levels of each gene were quantified by densitometry and normalized by GAPDH levels corresponding to each cell. The experiments were repeated at least three times independently and expressed as mean ± standard error.

그 결과, 도 1의 B 및 도 1의 C에서 나타난 바와 같이 uhMSC(음성 대조군)과 비교하였을 때 shMSC 및 shMSC+GM에서 슈반세포 특이 유전자인 GFAP, P0 및 p75NTR의 mRNA양이 증가된 것을 관찰하였다. 그러나 S100 및 CNPase의 전사인자는 모든 그룹에서 높은 수준으로 발현되었다. As a result, as shown in B of FIG. 1 and C of FIG. 1, it was observed that the mRNA levels of Schwann cell specific genes GFAP, P0 and p75NTR were increased in shMSC and shMSC + GM compared to uhMSC (negative control). . However, transcription factors of S100 and CNPase were expressed at high levels in all groups.

유전자 명칭Gene name 프라이머primer 서열(5'-3') Sequence (5'-3 ') 인간 GFAPHuman GFAP 정방향Forward 서열번호 1SEQ ID NO: 1 GTACCAGGACCTGCTCAATG GTACCAGGACCTGCTCAATG 역방향Reverse 서열번호 2SEQ ID NO: 2 TGTGCTCCTGCTTGGACTCCTT TGTGCTCCTGCTTGGACTCCTT 인간 P0Human P0 정방향Forward 서열번호 3SEQ ID NO: 3 CCCAGGCCATCGTGGTTTACCCCAGGCCATCGTGGTTTAC 역방향Reverse 서열번호 4SEQ ID NO: 4 GGTCTTGCCCACTATGTCTGGGGTCTTGCCCACTATGTCTGG 인간 CNPaseHuman CNPase 정방향Forward 서열번호 5SEQ ID NO: 5 AACAGAGGCTTCTCCCGAAAA AACAGAGGCTTCTCCCGAAAA 역방향Reverse 서열번호 6SEQ ID NO: 6 CAGCCAGGTCCTCATCGAG CAGCCAGGTCCTCATCGAG 인간 p75NTRHuman p75NTR 정방향Forward 서열번호 7SEQ ID NO: 7 CCTACGGCTACTACCAGGATG CCTACGGCTACTACCAGGATG 역방향Reverse 서열번호 8SEQ ID NO: 8 GGTGTGGACCGTGTAATCCAA GGTGTGGACCGTGTAATCCAA 인간 S100βHuman S100β 정방향Forward 서열번호 9SEQ ID NO: 9 TGGCCCTCATCGACGTTTTC TGGCCCTCATCGACGTTTTC 역방향Reverse 서열번호 10SEQ ID NO: 10 CAGTGTTTCCATGACTTTGTCCACAGTGTTTCCATGACTTTGTCCA 인간 GAPDHHuman GAPDH 정방향Forward 서열번호 11SEQ ID NO: 11 ACCACAGTCCATGCCATCAC ACCACAGTCCATGCCATCAC 역방향Reverse 서열번호 12SEQ ID NO: 12 TCCACCACCCTGTTGCTGTA TCCACCACCCTGTTGCTGTA

<1-3>슈반세포 표지 단백질의 발현 확인<1-3> Expression of Schwann cell marker protein

상기 실시예 1-1에서 분화시킨 shMSC에서 슈반세포 표지 단백질(GFAP, P0, S100, CNPase 및 p75NTR)의 발현을 세포면역형광염색법을 통해 확인하였다. 구체적으로, 커버슬립 위에 uhMSC, shMSC 및 shMSC+GM 세포를 4% 파라포름알데하이드로 실온에서 30분 동안 각각 고정시킨 후, 0.2% Triton X-100 및 1% 소혈청알부민(BSA)이 함유된 PBS를 이용하여 투과 가능하게 하였다. 이후, 5% 일반 염소 혈청이 포함된 PBS로 1시간 동안 세포를 배양하여 블로킹한 후, 하기 1차 항체를 사용하여 4℃에서 하룻밤동안 배양하였다: Expression of Schwann cell marker proteins (GFAP, P0, S100, CNPase and p75NTR) in the shMSC differentiated in Example 1-1 was confirmed by cell immunofluorescence staining. Specifically, uhMSC, shMSC and shMSC + GM cells were fixed on the coverslip with 4% paraformaldehyde for 30 minutes at room temperature, respectively, followed by PBS containing 0.2% Triton X-100 and 1% bovine serum albumin (BSA). It was made to permeate | transmit using. The cells were then incubated and blocked for 1 hour with PBS containing 5% normal goat serum, followed by overnight incubation at 4 ° C. using the following primary antibodies:

단일클론 마우스 항-GFAP(glial fibrillary acidic protein) 항체, 1:200(Chemico), Monoclonal mouse anti-glial fibrillary acidic protein (GFAP) antibody, 1: 200 (Chemico),

폴리클론 토끼 항-S100 항체 1:50(Dako), Polyclonal rabbit anti-S100 antibody 1:50 (Dako),

폴리클론 토끼 항-p75 뉴트로트로핀 수용체(neurotrophin receptor) 항체, 1:5,000(Invitrogen) 항체, 및,Polyclonal rabbit anti-p75 neurotrophin receptor antibody, 1: 5,000 (Invitrogen) antibody, and

단일클론 마우스 항-CNPase(2,3'-cyclic nucleotide 3'-phosphodiesterase) 항체, 1:3,000(Sternberger monoclonals). Monoclonal mouse anti-CNPase (2,3'-cyclic nucleotide 3'-phosphodiesterase) antibody, 1: 3,000 (Sternberger monoclonals).

PBS로 세척한 후, 상기 세포를 하기 2차 항체와 반응시켰다: After washing with PBS, the cells were reacted with the following secondary antibodies:

Alexa Fluor 488로 접합된 염소 항-마우스 항체, 1:500(Invitrogen) 및Goat anti-mouse antibody conjugated with Alexa Fluor 488, 1: 500 (Invitrogen) and

Alexa Fluor 546로 접합된 항-토끼 항체, 1:500(Invitrogen). Anti-rabbit antibody conjugated with Alexa Fluor 546, 1: 500 (Invitrogen).

모든 세포는 DAPI(4,6-diamidino-2-phenylindole)(Santa Cruz Biotechnology)로 대비 염색(파란색)하여 핵을 관찰하였고, 형광 마운팅 용액(Dako)으로 마운팅되었다. 면역형광염색은 레이저 주사 공초점 현미경 Fluoview FV300(Olympus)를 사용하여 분석하였다. 각 세포에서 50-200개 세포를 임의로 분석하여 각 슈반세포 표지 단백질의 발현을 정량적으로 분석하였다[GFAP(녹색), S100(빨간색), CNPase(녹색), p75NTR(빨간색)]. 상기 실험은 독립적으로 최소 5번 반복되었으며 평균±표준오차로 표시되었다.All cells were contrast stained (blue) with DAPI (4,6-diamidino-2-phenylindole) (Santa Cruz Biotechnology) to observe nuclei and mounted with fluorescent mounting solution (Dako). Immunofluorescence staining was analyzed using a laser scanning confocal microscope Fluoview FV300 (Olympus). 50-200 cells were randomly analyzed in each cell to quantitatively analyze the expression of each Schwann cell marker protein (GFAP (green), S100 (red), CNPase (green), p75NTR (red)). The experiments were repeated at least five times independently and expressed as mean ± standard error.

그 결과, 도 2의 A 및 도 2의 B에 나타난 바와 같이 uhMSC(음성 대조군)과 비교하였을 때 shMSC 및 shMSC+GM에서 GFAP, S100, CNPase 및 p75NTR 단백질의 발현이 유의적으로 증가된 것을 관찰하였다.
As a result, it was observed that the expression of GFAP, S100, CNPase and p75NTR protein was significantly increased in shMSC and shMSC + GM as compared to uhMSC (negative control) as shown in FIG. .

<1-4>분화된 미성숙 슈반세포의 세포 주기 분석<1-4> Cell Cycle Analysis of Differentiated Immature Schwann Cells

일반적으로 특정 세포로의 분화는 탈 세포주기 및 세포 생장의 정지가 동반된다. 본 발명자들은 uhMSC로부터 shMSC의 분화가 진행되었는지 확인하기 위하여 브로모데옥시유리딘(Bromodeoxyuridine) 혼성 실험을 통해 이를 확인하고자 하였다. 구체적으로 uhMSC, shMSC 및 shMSC+GM를 10 μM BrdU를 첨가한 배지에서 37℃에서 24시간 동안 배양하여 각각의 세포를 BrdU로 염색하였으며, 각 세포를 고정한 후 PBS로 세척한 다음, 2N HCl를 37℃에서 30분간 처리한 후 0.1M sodium borate(pH8.5)로 실온에서 10분간 중화하였다. 이후 상기 실시예 1-3과 동일한 방법으로 세포면역형광염색법을 수행하여 p75NTR(빨간색) 및 BrdU(녹색)를 관찰하였다. 이때, BrdU에 대한 1차 항체로 단일클론 마우스 항-BrdU, 1:200(Chemicon)를 사용하였다. 각 세포는 DAPI로 염색하여 핵을 관찰하였고(파란색), 각 세포에서 50-200개 세포를 임의로 분석하여 BrdU 양성 세포 또는 p75NTR(+)&BrdU(-)세포의 비율을 분석하였다. 상기 실험은 독립적으로 최소 3번 반복되었으며 평균±SEM으로 표시되었다.Differentiation into specific cells is usually accompanied by a decelling cell cycle and cell growth. The present inventors attempted to confirm this through bromodeoxyuridine hybridization experiment in order to confirm that the differentiation of shMSC from uhMSC has progressed. Specifically, uhMSC, shMSC and shMSC + GM were incubated for 24 hours at 37 ° C. in medium containing 10 μM BrdU, and each cell was stained with BrdU. After fixing each cell, the cells were washed with PBS, and then 2N HCl was 37 After 30 minutes of treatment at 0.1 ℃ sodium borate (pH8.5) was neutralized for 10 minutes at room temperature. Thereafter, cell immunofluorescence staining was performed in the same manner as in Example 1-3 to observe p75NTR (red) and BrdU (green). At this time, monoclonal mouse anti-BrdU, 1: 200 (Chemicon) was used as the primary antibody against BrdU. Each cell was stained with DAPI to observe the nucleus (blue) and 50-200 cells were randomly analyzed in each cell to analyze the ratio of BrdU positive cells or p75NTR (+) & BrdU (−) cells. The experiment was repeated at least three times independently and expressed as mean ± SEM.

그 결과, 도 3의 A 및 도 3의 B에서 나타난 바와 같이 uhMSC(음성 대조군)과 비교하였을 때 shMSC 및 shMSC+GM에서 생장 세포 표지인 BrdU 양성 세포의 수가 감소한 것을 관찰하였다.As a result, as shown in FIG. 3A and FIG. 3B, it was observed that the number of growth cell markers BrdU positive cells decreased in shMSC and shMSC + GM as compared with uhMSC (negative control).

또한, 도 3의 C에서 나타난 바와 같이 BrdU 음성인 동시에 슈반세포 표지인 p75NTR를 발현하는 세포의 비율이 shMSC에서 가장 높고, shMSC+GM에서도 uhMSC보다 높게 유지되고 있음을 확인하였다.
In addition, as shown in FIG. 3C, it was confirmed that the proportion of cells expressing p75NTR, which is a BrdU-negative and Schwann cell marker, was the highest in shMSC and maintained higher than uhMSC in shMSC + GM.

분화된 미성숙 슈반세포의 성장인자 분비 확인Confirmation of growth factor secretion of differentiated immature Schwann cells

<2-1>분화된 미성숙 슈반세포의 성장인자 분비 분석<2-1> Growth Factor Secretion Analysis of Differentiated Immature Schwann Cells

본 발명자들은 상기 실시예 1-1에서 분화시킨 shMSC세포에서 분비되는 인간 성장인자를 하기와 같이 분석하였다. 구체적으로, 조건 배지(CdM)를 준비하기 위해 uhMSC 및 shMSC를 PBS로 4번 세척 후 혈청이 없는 Neurobasal 배지(Gibco-BRL)에 배양하였다. 배양한지 18시간 후, 각 배지를 수집한 뒤 1500g에서 5분 동안 원심분리하여 세포 잔여물을 제거하였다. 상기 원심분리 후 수득한 각 세포 배양액의 상층액(uhMSC-CdM 및 shMSC-CdM)은 인간 성장인자 어레이(RayBiotech)을 사용하여 제조사의 지시법에 따라 분석하였다. 이때, 상기 세포 배양에 사용한 배지를 음성 대조군으로서 함께 측정하였다. 간단히 설명하면, 인간 성장인자 어레이 막을 블로킹 버퍼로 블로킹하고 4℃에서 하룻밤동안 1 ml의 조건 배지를 배양한 다음, 상기 막을 워싱버퍼I로 3번, 워싱버퍼II로 2번 각각 5분 동안 실온에서 세척하였다. 이후, 1 ml의 희석된 바이오틴 결합 항체를 첨가한 후 실온에서 2시간 동안 배양한 후 다시 막을 세척하고 마지막으로 희석된 HRP 결합 스트렙타비딘과 함께 실온에서 2시간 배양하였다. 상기 막은 Lumino 이미지 분석기인 LAS-3000(Fujifilm)을 사용하여 검출하였고, 신호의 세기는 밀도계(Bio-Rad)로 정량화하였다. 각 인간 성장인자의 상대적인 발현 수준은 같은 분석결과에 있는 양성 대조군(POS)의 염색 강도에 대한 각각의 슬롯의 염색 강도를 비교함으로서 분석되었다. 상기 분석 결과를 도 4a의 B에 양성 대조군에 대한 uhMSC-CdM 또는 shMSC-CdM의 성장인자 분비율(%)을, 도 4a의 C에 음성대조군에 대한 uhMSC-CdM 또는 shMSC-CdM의 성장인자 분비량(배수)를 나타내었으며, 상기 실험은 독립적으로 최소 3번 반복되었으며 평균±표준오차로 표시되었다.The present inventors analyzed human growth factors secreted from the shMSC cells differentiated in Example 1-1 as follows. Specifically, uhMSC and shMSC were washed four times with PBS and then cultured in serum-free Neurobasal medium (Gibco-BRL) to prepare condition medium (CdM). After 18 hours of incubation, each medium was collected and centrifuged at 1500 g for 5 minutes to remove cell residue. Supernatants (uhMSC-CdM and shMSC-CdM) of each cell culture obtained after the centrifugation were analyzed according to the manufacturer's instructions using a human growth factor array (RayBiotech). At this time, the medium used for the cell culture was measured together as a negative control. Briefly, the human growth factor array membranes were blocked with blocking buffer and incubated 1 ml of conditioned medium overnight at 4 ° C., and then the membranes were washed three times with washing buffer I and two times with washing buffer II at room temperature for 5 minutes each. Washed. Thereafter, 1 ml of diluted biotin-binding antibody was added, followed by 2 hours of incubation at room temperature, followed by washing the membrane and finally 2 hours of incubation with diluted HRP binding streptavidin. The membrane was detected using a Lumino image analyzer, LAS-3000 (Fujifilm), and the signal intensity was quantified by a density meter (Bio-Rad). The relative expression level of each human growth factor was analyzed by comparing the staining intensity of each slot against the staining intensity of the positive control (POS) in the same assay. The results of the analysis show the growth factor secretion rate (%) of uhMSC-CdM or shMSC-CdM for the positive control in B of Figure 4a, growth factor secretion of uhMSC-CdM or shMSC-CdM for the negative control in C of Figure 4a (Multiple), the experiments were repeated at least three times independently and expressed as mean ± standard error.

그 결과, 도 4a의 A 내지 도 4a의 C에 나타난 바와 같이 uhMSC-CdM보다 shMSC-CdM에서 (HGFhepatocyte growth factor), VEGF(vascular endothelial growth factor), IGFBP-1(insulin-like growth factor binding protein-1), IGFBP-2, IGFBP-4, IGFBP-6 및 SCF(stem cell factor)이 더 높게 발현되는 것을 관찰할 수 있었으며, 이를 직사각형으로 표시하였다.
As a result, as shown in A to 4A of FIG. 4A, in HMSH-CdM (HGF hepatocyte growth factor), VEGF (vascular endothelial growth factor), and IGFBP-1 (insulin-like growth factor binding protein-) than uhMSC-CdM 1), IGFBP-2, IGFBP-4, IGFBP-6 and SCF (stem cell factor) was observed to be higher expression, which was represented by a rectangle.

<2-2>분화된 미성숙 슈반세포의 <2-2> of differentiated immature Schwann cells HGFHGF 및 And VEGFVEGF 생산량 분석 Yield analysis

본 발명자들은 상기 실시예 2-1에서 확인한 uhMSC 및 shMSC의 성장인자 분비량 차이를 효소면역측정법 (enzyme linked immunosorbent assay)를 통해 확인하였다. 배지, uhMSC-CdM 또는 shMSC-CdM에 항-HGF 항체[마우스 항-human HGF(MAB294), R&D Systems] 또는 항-VEGF 항체[마우스 항-human VEGF antibody(MAB293), R&D Systems]를 처리하거나 처리하지 않은 그룹에서 HGF 또는 VEGF에 대한 ELISA Kit(RayBiotech)를 사용하여 ELISA를 수행하였다. 상기 실험은 독립적으로 최소 3번 반복되었으며 평균±표준오차로 표시되었다.The present inventors confirmed the growth factor secretion difference between uhMSC and shMSC identified in Example 2-1 through an enzyme linked immunosorbent assay. Treat or treat anti-HGF antibody [mouse anti-human HGF (MAB294), R & D Systems] or anti-VEGF antibody [mouse anti-human VEGF antibody (MAB293), R & D Systems] in medium, uhMSC-CdM or shMSC-CdM ELISA was performed using the ELISA Kit (RayBiotech) for HGF or VEGF in the non-group. The experiments were repeated at least three times independently and expressed as mean ± standard error.

그 결과, 도 4a의 D 및 도 4a의 E에 나타난 바와 같이 shMSC에서 생산되는 HGF 및 VEGF의 양은 uhMSC 보다 각각 약 10배 및 약 11배 증가함을 확인하였다.
As a result, it was confirmed that the amounts of HGF and VEGF produced in shMSC are increased by about 10 and about 11 times than uhMSC, respectively, as shown in D of FIG. 4A and E of FIG.

<2-3>분화된 미성숙 슈반세포의 배지별 <2-3> Different Media of Immature Schwann Cells HGFHGF 및 And VEGFVEGF 생산량 분석 Yield analysis

본 발명자들은 분화 유도완료 후 HGF 및 VEGF의 생산이 얼마동안 유지되는지 확인하기 위하여, shMSC을 유도분화 배양액(SCIM) 및 일반 성장 배양액(GM)에서 각각 0, 1, 3 및 5일 동안 배양한 후 상기 실시예 2-2와 동일한 방법으로 ELISA 분석을 실시하였다.In order to confirm how long production of HGF and VEGF is maintained after completion of differentiation induction, the present inventors incubated shMSC in induced differentiation culture (SCIM) and normal growth culture (GM) for 0, 1, 3 and 5 days, respectively. ELISA analysis was performed in the same manner as in Example 2-2.

그 결과, 도 4b의 F 및 도 4b의 G에 나타난 바와 같이 시간이 경과함에 따라 점점 HGF 및 VEGF의 분비량이 감소하지만, 5일째에도 여전히 uhMSC(Control)보다 분비량이 높게 유지되고 있음을 확인하였으며, 일반 성장 배양액보다 유도분화 배양액에서 더 분비량이 많음을 확인하다.
As a result, as shown in F of FIG. 4B and G of FIG. 4B, the secretion amount of HGF and VEGF gradually decreased with time, but it was confirmed that the secretion amount was still higher than that of uhMSC (Control) even on the 5th day. It is confirmed that the secretion amount is higher in the induced differentiation medium than the normal growth medium.

<2-4>분화된 미성숙 슈반세포의 <2-4> Differentiation of immature Schwann cells HGFHGF 및 And VEGFVEGF mRNAmRNA 발현량 분석 Expression analysis

본 발명자들은 상기 실시예 2-2 및 2-3에서 확인한 uhMSC의 분화에 따른 성장인자의 발현이 mRNA 단계부터 조절되는 것인지 정량적 RT-PCR을 통해 확인하였다. 구체적으로, 물, uhMSC, shMSC 또는, shMSC를 SCIM 또는 GM에서 1, 3 및 5일 동안 각각 배양한 군에서 서열번호 13으로 기재되는 센스 프라이머(5'-atgctcatggaccctggt-3') 및 서열번호 14로 기재되는 안티센스 프라이머(5'-gcctggcaagcttcatta-3')의 HGF에 대한 프라이머 쌍 및, 서열번호 15(5'-gccttgctgctctacctcca-3')로 기재되는 센스 프라이머 및 서열번호 16(5'-caaggcccacagggatttt-3')으로 기재되는 안티센스 프라이머의 VEGF에 대한 프라이머 쌍을 사용하여 상기 실시예 1-2와 동일한 방법을 사용하여 정량적 RT-PCR을 수행하였다.The present inventors confirmed by quantitative RT-PCR whether the expression of growth factors according to the differentiation of uhMSC identified in Examples 2-2 and 2-3 is regulated from the mRNA stage. Specifically, to the sense primer (5'-atgctcatggaccctggt-3 ') and SEQ ID NO: 14 described in SEQ ID NO: 13 in the group in which water, uhMSC, shMSC, or shMSC were incubated for 1, 3, and 5 days in SCIM or GM, respectively Primer pair for HGF of the antisense primer (5'-gcctggcaagcttcatta-3 ') described, and the sense primer set forth in SEQ ID NO: 15 (5'-gccttgctgctctacctcca-3') and SEQ ID NO: 16 (5'-caaggcccacagggatttt-3 ') Quantitative RT-PCR was performed using the same method as Example 1-2 above using primer pairs for VEGF of the antisense primers described above.

그 결과, 도 4b의 H 내지 도 4b의 J에 나타난 바와 같이 uhMSC과 비교하였을 때 배지의 종류에 상관없이 shMSC의 HGF 및 VEGF의 mRNA 발현량이 5일까지 높게 유지되는 것을 확인하였다.
As a result, it was confirmed that the mRNA expression levels of HGF and VEGF of shMSC were maintained high until 5 days, regardless of the type of medium, as shown in H-4 of FIG. 4B to J of FIG. 4B.

분화된 미성숙 슈반세포가 신경세포에 미치는 영향Effect of Differentiated Immature Schwann Cells on Neurons

본 발명자들은 uhMSC로부터 분화된 성장인자를 과분비하는 shMSC가 신경세포에 미치는 영향을 알아보기 위하여 하기 실험을 수행하였다. The present inventors performed the following experiment to investigate the effect of shMSC over-secreting growth factors differentiated from uhMSC on neurons.

<3-1>분화된 미성숙 슈반세포에 의한 신경돌기 성장 증가 확인<3-1> Confirmation of neurite outgrowth by differentiated immature Schwann cells

신경 모세포종(neuroblastoma)인 Neuro2A 세포(ATCC # CCL-131)를 2 μg/ml 피브로넥틴(fibronectin)이 코팅된 6-웰 플레이트에 웰당 1.3×10⁵ 개의 세포를 깔고 성장배지에서 하룻밤동안 배양하였다. 그리고 Neuro2A 세포는 항-HGF 항체 또는 항-VEGF 항체를 처리하거나 처리하지 않은 Neurobasal 배지(0.5% FBS)로 배양하였다. Neuro2A 세포를 깔기 24시간 전에 uhMSC 및 shMSC를 1.0-μm 지름 크기 세포 배양 삽입체에 삽입체당 5×10⁴ 개의 세포 밀도로 각각 깔았으며, 각각의 배지에 배양되었다. 48시간 후, 배양 삽입체는 PBS로 3번 세척한 뒤, Neuro2A 세포가 담겨있는 6-웰 플레이트로 옮겼다(도 5의 A). 세포가 없는 음성 대조군 웰의 경우는 단지 0.5% FBS가 포함된 Neurobasal 배지만이 담겨있는 배양 삽입체만 포함하고 있으며 실험군과 동일한 조건아래 배양되었다. Neuro2A 세포가 담겨있는 6-웰 플레이트로 옮긴 uhMSC 또는 shMSC를 48시간 동안 배양한 다음, Neuro2A 세포를 위상차 현미경을 사용하여 분석하였다. 또한, 상기 분석 결과 Neuro2A 세포에서 최소 한개 세포체 지름 길이 이상의 신경돌기를 가지는 세포의 비율 및 세포당 신경돌기 길이의 총합을 도 5의 C 및 도 5의 D에 각각 나타내었다.Neuroblastoma Neuro2A cells (ATCC # CCL-131) were incubated overnight in growth medium with 1.3 × 10 ⁵ cells per well plated in 2 μg / ml fibronectin-coated 6-well plates. Neuro2A cells were cultured in Neurobasal medium (0.5% FBS) with or without anti-HGF antibody or anti-VEGF antibody. 24 hours prior to laying Neuro2A cells, uhMSC and shMSC were plated at 1.0 × μm diameter size cell culture inserts at 5 × 10 ⁴ cell densities per insert, respectively, and cultured in each medium. After 48 hours, the culture inserts were washed three times with PBS and then transferred to 6-well plates containing Neuro2A cells (FIG. 5A). Negative control wells without cells contained culture inserts containing only Neurobasal medium containing only 0.5% FBS and were cultured under the same conditions as the experimental group. UhMSC or shMSCs transferred to 6-well plates containing Neuro2A cells were incubated for 48 hours, and then Neuro2A cells were analyzed using a phase contrast microscope. In addition, as a result of the analysis, the ratio of cells having neurites at least one cell body diameter in length and the total number of neurites per cell in Neuro2A cells are shown in FIGS. 5C and 5D, respectively.

그 결과, 도 5의 B 내지 도 5의 D에 나타난 바와 같이 uhMSC와 비교하였을 때 shMSC와 동시배양(co-culture)된 Neuro2A 세포에서 신경돌기(neurite)의 길이가 더 길었으며, 상기와 같은 효과는 HGF 및/또는 VEGF에 대한 항체에 의해 감소되는 것을 확인하였다.
As a result, the length of the neurites was longer in the Neuro2A cells co-cultured with shMSC as compared to uhMSC, as shown in B of FIG. Was found to be reduced by antibodies to HGF and / or VEGF.

<3-2>분화된 미성숙 슈반세포에 의한 신경세포의 성장 및 생존 증가 확인<3-2> Confirmation of growth and survival of neurons by differentiated immature Schwann cells

상기 실시예 3-1과 동일한 조건에서 shMSC가 신경세포에 성장 및 생존에 미치는 영향을 트립판 블루 염색법을 통해 확인하였다. 각 그룹별로 Neuro2A 세포의 평균 수 및 사멸된 Neuro2A 세포의 비율을 도 5의 E 및 도 5의 F에 각각 나타내었다. 세포 사멸은 트립판 블루 염색이 된 세포(사멸 세포)의 퍼센트로 나타내었다. 각 그룹별로 최소 700개 세포를 임의의 영역에서 선택하여 분석하였고, 상기 실험은 독립적으로 최소 3번 반복되었으며 평균±표준오차으로 표시되었다.The effect of shMSC on growth and survival in neurons was confirmed by trypan blue staining under the same conditions as in Example 3-1. The mean number of Neuro2A cells and the percentage of killed Neuro2A cells in each group are shown in E of FIG. 5 and F of FIG. 5, respectively. Apoptosis was expressed as percentage of trypan blue stained cells (killed cells). At least 700 cells in each group were selected and analyzed in an arbitrary region, and the experiment was repeated at least three times independently and expressed as mean ± standard error.

그 결과, 도 5의 E 및 도 5의 F에 나타난 바와 같이 uhMSC와 비교하였을 때 shMSC와 동시배양(co-culture)된 Neuro2A 세포의 성장 증가 및 세포사 감소 효과를 확인하였으며, 상기와 같은 효과는 HGF 및/또는 VEGF에 대한 항체에 의해 감소되는 것을 확인하였다.
As a result, as shown in E of FIG. 5 and F of FIG. 5, the growth and cell death reduction effects of co-cultured Neuro2A cells with co-cultured with shMSC were confirmed as compared to uhMSC. And / or reduced by antibodies to VEGF.

분화된 미성숙 슈반세포가 손상 척수조직 절편에 미치는 영향Effect of Differentiated Immature Schwann Cells on Injured Spinal Cord Tissue Slices

<4-1>분화된 미성숙 슈반세포에 의한 손상 척수조직의 신경돌기 성장 증가 확인<4-1> Increased growth of neurites in damaged spinal cord tissue by differentiated immature Schwann cells

본 발명자들은 상기 실시예 3-1 및 실시예 3-2에서 확인한 shMSC의 신경세포의 신경돌기 성장 증가 효과가 ex vivo에서도 동일하게 작용하는지 확인하기 위하여 국립서울대학교 실험동물운영위원회의 승인 하에서 하기 실험을 수행하였다. 구체적으로, 척수조직 절편은 16일령 스프라그-돌리(Sprague-Dawley) 래트를 애버틴(avertin)으로 마취하였고, 래트의 요추(lumbar) 척수를 멸균 조건에서 채취하였다. 상기 척수에서 신경근(nerve root) 및 결합조직을 차가운 6.4 mg/ml 포도당이 함유된 Hank's balanced salt solution(Gibco-BRL)를 사용하여 제거한 후, 척수를 McIlwain tissue chopper(Mickle Laboratory Engineering)를 이용하여 400μm 두께의 절편으로 절단한 후 탈수초화된 신경조직 절편(LPC)을 제조하였다. 4개 절편을 한 개 막 삽입체(Millicell-CM; Millipore)에 조심스럽게 놓고, 50% Eagle's minimum essential medium(Gibco-BRL), 25% Hank's balanced salt solution, 25% horse serum(Gibco-BRL), 6.4 mg/ml 포도당 및 20 mM HEPES(Sigma-Aldrich)을 포함하는 배지 1 ml이 담긴 6 웰 플레이트에 막 삽입체를 놓았다. 상기 조직절편은 37℃, 5% CO₂ 배양기에서 배양되었고 배양배지는 1주일에 2번 교체하였다. 배양 7일에, 척수조직절편을 0.5 mg/ml 라이소레시틴(lysophosphatidyl choline, lysolecithin)으로 17시간 동안 처리하였다. 그리고 항-HGF 항체 또는 항-VEGF 항체를 처리하거나 처리하지 않은 새 배지로 교체하였다. 중간엽 줄기세포를 이식하기 위해서, uhMSC 또는 shMSC는 트립신 처리 후 2,000 g에서 3분간 원심분리를 시행하였고, 침전된 세포를 PBS에서 현탁한 후 세포(1.5 μl 당 3×10⁴개 세포)를 미세모세관 피펫이 연결된 흡입관 부품(aspirator tube assembly)을 이용하여 각 척수조직절편의 하부(ventral) 부분으로 직접 각각의 세포를 이식하였다. 조직 면역형광염색 분석을 하기 위해, 척수조직절편을 4% 파라포름알데하이드로 4℃에서 하룻밤동안 고정하였고, 0.5% Triton X-100, 1% 소혈정알부민(BSA)이 함유된 PBS를 실온에서 10분 처리하여 투과 가능하게 하였다. 0.1% Triton X-100, 3% 소혈정알부민(BSA)이 포함된 PBS로 1시간 동안 조직절편을 배양하여 블로킹한 후, 토끼 항-신경미세섬유(neurofilament, NF)-M(1:500, 척수조직 절편의 신경섬유(Axon) 염색, Chemicon) 및 마우스 항-인간 핵 항체(1:500, 이식된 인간 중간엽 줄기세포 염색, Chemicon)를 각각 사용하여 4℃에서 하룻밤동안 배양하여 이를 염색하였다. 항-NF-M 항체에 대한 2차 항체는 Alexa 546 항체(빨간색)를, 항-인간 핵 항체에 대한 2차 항체는 Alexa 488 항체(녹색)를 사용하여 상기와 동일하게 시행되었다. z-Stack 이미지는 3-4 μm 간격으로 레이저 주사 공초점 현미경을 사용하여 얻었다. 신경미세섬유-M 면역형광은 z-Stack 레이저 주사 공초점 현미경을 통해 관찰되었고, Image J 소프트웨어(National Institutes of Health)를 사용하여 morphometric image analysis(integrated optical density, IOD)로 정량화하였다. 현미경으로 관찰한 결과를 도 6a의 A에 나타내었고, 척수조직 절편에서 NF-M이 염색된 신경섬유의 상대적인 통합 광학 밀도(integrated optical density, IOD)를 도 6a의 B에 나타내었다. 도 6a의 A에서 척수조직 절편(SC) 및 이식된 중간엽 줄기세포는 경계선으로 표시되었다. 상기 통합 광학 밀도는 대조군 척수조직 절편에 의해 표준화되었으며, 막대 그래프는 최소 7개 조직 절편의 평균±표준오차를 나타낸다.The present inventors under the approval of the Seoul National University Experimental Animal Steering Committee in order to confirm whether the effect of increasing the neurite outgrowth of neurons of the shMSC confirmed in Example 3-1 and Example 3-2 ex vivo Was performed. Specifically, spinal cord tissue sections were anesthetized with 16-day-old Sprague-Dawley rats with avertin, and the lumbar spinal cord of rats was taken under sterile conditions. After removing the nerve root and connective tissue from the spinal cord with a cold 6.4 mg / ml glucose containing Hank's balanced salt solution (Gibco-BRL), the spinal cord was removed with 400 μm using McIlwain tissue chopper (Mickle Laboratory Engineering). After cutting into thick sections, demyelinated nerve tissue sections (LPCs) were prepared. Carefully place 4 sections in one membrane insert (Millicell-CM; Millipore), 50% Eagle's minimum essential medium (Gibco-BRL), 25% Hank's balanced salt solution, 25% horse serum (Gibco-BRL), The membrane insert was placed in a 6 well plate containing 1 ml of medium containing 6.4 mg / ml glucose and 20 mM HEPES (Sigma-Aldrich). The tissue sections were incubated in a 37 ° C., 5% CO ₂ incubator and the culture medium was replaced twice a week. On the 7th day of culture, spinal cord tissue sections were treated with 0.5 mg / ml lysocithin (lysophosphatidyl choline, lysolecithin) for 17 hours. And replaced with fresh medium with or without anti-HGF antibody or anti-VEGF antibody. To transplant the mesenchymal stem cells, uhMSC or shMSC were centrifuged at 2,000 g for 3 minutes after trypsin treatment, and the cells (3 × 10 ⁴ cells per 1.5 μl) were finely suspended after the precipitated cells were suspended in PBS. Each cell was directly implanted into the ventral portion of each spinal cord tissue section using an aspirator tube assembly to which a capillary pipette was connected. For tissue immunofluorescence staining analysis, spinal cord tissue sections were fixed overnight at 4 ° C. with 4% paraformaldehyde, and PBS containing 0.5% Triton X-100, 1% bovine serum albumin (BSA) was added at room temperature for 10 minutes. The treatment was carried out for minutes. After blocking by incubating tissue sections for 1 hour with PBS containing 0.1% Triton X-100, 3% bovine serum albumin (BSA), rabbit anti-neurofilament (NF) -M (1: 500, Axon staining, Chemicon and mouse anti-human nuclear antibody (1: 500, transplanted human mesenchymal stem cell staining, Chemicon) of spinal cord tissue sections were incubated overnight at 4 ° C for staining. . Secondary antibodies against anti-NF-M antibodies were run in the same manner as above using Alexa 546 antibody (red) and secondary antibodies against anti-human nuclear antibody (Alexa 488 antibody (green)). z-Stack images were obtained using a laser scanning confocal microscope at 3-4 μm intervals. Neurofibro-M immunofluorescence was observed through a z-Stack laser scanning confocal microscope and quantified by morphometric image analysis (integrated optical density, IOD) using Image J software (National Institutes of Health). The microscopic results are shown in A of FIG. 6A, and the relative integrated optical density (IOD) of NF-M stained nerve fibers in spinal cord tissue sections is shown in B of FIG. 6A. Spinal cord tissue sections (SCs) and transplanted mesenchymal stem cells in A of FIG. 6A are indicated by border lines. The integrated optical density was normalized by control spinal cord tissue sections and the bar graph represents the mean ± standard error of at least seven tissue sections.

그 결과, 도 6a의 A 및 도 6a의 B에 나타난 바와 같이 LPC만 있는 경우와 비교하여 LPC에 uhMSC를 이식한 경우 3.5배, LPC에 shMSC를 이식한 경우 5.5배 신경돌기 성장이 각각 증가하였으며, 상기 shMSC 이식에 의한 LPC의 신경돌기 성장 증가는 HGF 및/또는 VEGF에 대한 항체를 처리하였을 때 유의하게 감소하는 것을 확인하였다.
As a result, as shown in FIG. 6A and FIG. 6A B, folds of folds were increased by 3.5 times when uhMSC was implanted in LPC and 5.5 times when MSMS was implanted in LPC. The increase in neurite outgrowth of LPC by shMSC transplantation was found to significantly decrease when treated with antibodies to HGF and / or VEGF.

<4-2>분화된 미성숙 슈반세포에 의한 손상 척수조직의 세포사멸 억제 확인<4-2> Confirmation of inhibition of apoptosis of damaged spinal cord tissue by differentiated immature Schwann cells

본 발명자들은 상기 실시예 3-1 및 실시예 3-2에서 확인한 shMSC의 세포 사멸 억제 효과가 ex vivo에서도 동일하게 작용하는지 확인하기 위하여 하기 실험을 수행하였다. 구체적으로, 상기 실시예 4-1과 동일한 방법으로 탈수초화된 신경조직 절편(LPC)을 제조하였다. 4개 절편을 한 개 막 삽입체에 조심스럽게 놓고, 50% Eagle's minimum essential medium(Gibco-BRL), 25% Hank's balanced salt solution, 25% horse serum(Gibco-BRL), 6.4 mg/ml 포도당 및 20 mM HEPES(Sigma-Aldrich)을 포함하는 배지 1 ml이 담긴 6 웰 플레이트에 막 삽입체를 놓았다. 상기 조직절편은 37℃, 5% CO₂ 배양기에서 배양되었고 배양배지는 1주일에 2번 교체하였다. 배양 7일에, 척수조직절편을 0.5 mg/ml 라이소레시틴(lysolecithin)으로 17시간 동안 처리하였다. 그리고 항-HGF 항체 또는 항-VEGF 항체를 처리하거나 처리하지 않은 새 배지로 교체하였다. 중간엽 줄기세포를 이식하기 위해서, uhMSC 또는 shMSC는 트립신 처리 후 2,000 g에서 3분간 원심분리를 시행하였고, 침전된 세포를 PBS에서 현탁한 후 세포(1.5 μl 당 3×10⁴개 세포)를 미세모세관 피펫이 연결된 흡입관 부품(aspirator tube assembly)을 이용하여 각 척수조직절편의 하부(ventral) 부분으로 직접 각각의 세포를 이식하였다. 각 그룹에서 라이소레시틴(lysolecithin)에 의해 매개된 세포 사멸을 In Situ Cell Death Detection Kit(Roche Diagnostics)를 사용하여 제조사의 지시에 따라 TUNEL(Terminal deoxynucleotidyl transferase dUTP nick-end labeling) 염색(빨간색)을 수행하였다. 이때, DAPI 염색(파란색)으로 핵을 관찰하였다. 상기 결과를 현미경 사진으로 관찰하여 도 6b의 C에 나타내었으며(화살표 머리: TUNEL-양성 세포), 상기 100배 확대의 현미경 사진으로부터 척수조직절편의 하부 부분의 TUNEL-양성 세포의 수를 측정하여 세포사멸 정도를 그래프로 도 6b의 D에 나타내었다. 막대그래프는 최소 5개 조직 절편의 평균±표준오차를 나타낸다.The present inventors carried out the following experiment to confirm whether the cell death inhibitory effect of the shMSC confirmed in Example 3-1 and Example 3-2 work the same in ex vivo. Specifically, a demyelized neural tissue section (LPC) was prepared in the same manner as in Example 4-1. Carefully place 4 sections in one membrane insert, 50% Eagle's minimum essential medium (Gibco-BRL), 25% Hank's balanced salt solution, 25% horse serum (Gibco-BRL), 6.4 mg / ml glucose and 20 The membrane insert was placed in a 6 well plate containing 1 ml of medium containing mM HEPES (Sigma-Aldrich). The tissue sections were incubated in a 37 ° C., 5% CO ₂ incubator and the culture medium was replaced twice a week. On day 7 of culture, spinal cord tissue sections were treated with 0.5 mg / ml lysolecithin for 17 hours. And replaced with fresh medium with or without anti-HGF antibody or anti-VEGF antibody. To transplant the mesenchymal stem cells, uhMSC or shMSC were centrifuged at 2,000 g for 3 minutes after trypsin treatment, and the cells (3 × 10 ⁴ cells per 1.5 μl) were finely suspended after the precipitated cells were suspended in PBS. Each cell was directly implanted into the ventral portion of each spinal cord tissue section using an aspirator tube assembly to which a capillary pipette was connected. Cell death mediated by lysolecithin in each group was subjected to terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining (red) using the In Situ Cell Death Detection Kit (Roche Diagnostics) according to the manufacturer's instructions. Was performed. At this time, nuclei were observed by DAPI staining (blue). The results were observed microscopically as shown in C of FIG. 6B (arrow head: TUNEL-positive cells), and the number of TUNEL-positive cells in the lower part of spinal cord tissue sections was measured from the 100-fold magnification of the cells. The degree of killing is shown graphically in D of FIG. 6B. The bar graph represents the mean ± standard error of at least five tissue sections.

그 결과, 도 6b의 C 및 도 6b의 D에 나타난 바와 같이 LPC에 uhMSC를 이식한 경우와 비교하였을 때 shMSC를 이식한 경우에서 라이소레시틴 처리에 의해 증가된 척수조직 절편의 세포 사멸이 더욱 감소되는 것을 확인하였다. 그러나 상기 shMSC의 척수조직 절편의 세포 사멸 억제 효과는 HGF 및/또는 VEGF에 대한 항체 처리 여부에 유의한 차이를 보이지 않았다.
As a result, as shown in C of FIG. 6B and D of FIG. 6B, cell death of the spinal cord tissue increased by lysolecithin treatment was further reduced in the shMSC transplantation compared with the uhMSC implantation in the LPC. It confirmed that it became. However, the apoptosis inhibitory effect of the shMSC spinal cord tissue showed no significant difference between HGF and / or VEGF antibody treatment.

HGFHGF 및 And VEGFVEGF 가 신경세포 및 손상 척수조직에 미치는 영향Effect on neuronal and damaged spinal cord tissue

본 발명자들은 상기 실시예 3-1 내지 4-2에서 확인한 shMSC의 신경세포의 신경돌기 및 세포 성장 증가 및 손상 척수조직 절편의 신경돌기 성장 및 세포사멸 억제 효과가 shMSC가 분비하는 성장인자에 의한 것인지 확인하기 위하여 하기 실험을 수행하였다.The inventors of the present invention confirmed that the neurite outgrowth and cell growth of the neurons and the inhibitory effect of the neurite outgrowth and apoptosis of the damaged spinal cord tissue fragments of the shMSCs identified in Examples 3-1 to 4-2 were caused by the growth factors secreted by shMSCs. The following experiment was performed to confirm.

<5-1><5-1> HGFHGF 및 And VEGFVEGF 에 의한 신경세포의 신경돌기 성장 증가 확인Increase of neurite outgrowth of neurons

본 발명자들은 0, 12.5, 25, 50 및 100 ng/ml의 재조합 HGF 또는 VEGF 단백질(R&D Systems)을 각각 배지에 첨가하여 48시간 동안 배양한 Neuro2A 세포에서 위상차 현미경을 사용하여 최소 한개 세포체 지름 길이 이상의 신경돌기를 가지는 세포의 비율 및 세포당 신경돌기 길이의 총합을 도 7a의 A 및 도 7a의 B에 각각 나타내었다.We added at least one cell body diameter length using a phase contrast microscope in Neuro2A cells cultured for 48 hours with 0, 12.5, 25, 50 and 100 ng / ml of recombinant HGF or VEGF protein (R & D Systems) respectively added to the medium. The sum of the proportion of cells with neurites and the length of neurites per cell is shown in FIGS. 7A and 7A, respectively.

그 결과, 도 7a의 A 및 도 7a의 B에 나타난 바와 같이 100 ng/ml HGF 및 50 ng/ml VEGF를 처리한 Neuro2A 세포에서 신경돌기 길이의 성장이 가장 높았다.
As a result, as shown in A of FIG. 7A and B of FIG. 7A, the growth of neurite length was highest in Neuro2A cells treated with 100 ng / ml HGF and 50 ng / ml VEGF.

<5-2><5-2> HGFHGF 및 And VEGFVEGF 에 의한 신경세포의 성장 및 생존 증가 확인Growth and survival of neurons

본 발명자들은 0, 12.5, 25, 50 및 100 ng/ml의 재조합 HGF 및/또는 VEGF 단백질(R&D Systems)을 각각 배지에 첨가하여 48시간 동안 배양한 Neuro2A 세포를 트립판 블루로 염색하여 상기 단백질이 세포의 성장 및 생존에 미치는 영향을 확인하였다. 전체 세포수 및 생존세포의 비율을 각각 도 7a의 C 및 도 7a의 D에 나타내었다. 세포 생존률은 트립판 블루 염색이 되지 않은 세포(살아있는 세포)의 퍼센트로 측정되었다. 실험은 독립적으로 최소 3번 반복되었으며 평균±표준오차로 표시되었다.We added 0, 12.5, 25, 50 and 100 ng / ml of recombinant HGF and / or VEGF protein (R & D Systems) to the medium, respectively, and stained with Trypan Blue for Neuro2A cells cultured for 48 hours. The effect on cell growth and survival was confirmed. The total cell number and the proportion of viable cells are shown in C of FIG. 7A and D of FIG. 7A, respectively. Cell viability was measured as percentage of cells that were not trypan blue stained (live cells). The experiment was repeated at least three times independently and expressed as mean ± standard error.

그 결과, 도 7a의 C 및 도 7a의 D에 나타난 바와 같이 외인성 HGF 및/또는 VEGF 단백질은 Neuro2A 세포의 신경돌기 성장 및 세포 생장을 증가시키는 것을 확인하였다.
As a result, it was confirmed that exogenous HGF and / or VEGF protein increases neurite outgrowth and cell growth of Neuro2A cells as shown in C of FIG. 7A and D of FIG. 7A.

<5-3><5-3> HGFHGF 및 And VEGFVEGF 에 의한 손상 척수 조직의 신경돌기 성장 증가 확인Increased growth of neurites in damaged spinal cord tissue

상기 실시예 4-1과 동일한 방법으로 척수조직 절편의 신경섬유를 NF-M 항체 및 Alexa 546 항체(빨간색)로 염색하였다. 배양 7일째의 척수조직 절편을 0.5 mg/ml 라이소레시틴(lysolecithin)으로 17시간 동안 처리한 다음, 0, 12.5, 25, 50 및 100 ng/ml의 재조합 HGF 및/또는 VEGF 단백질을 각각 포함하는 배지에서 1주일간 배양하였다. 이후, 척수조직 절편에서 NF-M 면역형광 염색된 신경섬유의 상대적인 상대적인 통합 광학 밀도(IOD) 값을 상기 실시예 4-1과 동일한 방법으로 측정하였고, 상기 통합 광학 밀도는 대조군 척수조직 절편으로 표준화되었다. 그래프 가로축의 농도 단위(ng/ml)는 HGF 단독, VEGF 단독, 또는 HGF+VEGF의 혼합 농도를 지칭한다. 막대그래프는 최소 5개 조직 절편의 평균±표준오차를 나타낸다.The nerve fibers of spinal cord tissue sections were stained with NF-M antibody and Alexa 546 antibody (red) in the same manner as in Example 4-1. Spinal cord tissue sections at day 7 of treatment were treated with 0.5 mg / ml lysolecithin for 17 hours and then each containing 0, 12.5, 25, 50 and 100 ng / ml recombinant HGF and / or VEGF protein, respectively. The medium was incubated for 1 week. Thereafter, relative relative integrated optical density (IOD) values of NF-M immunofluorescent stained nerve fibers in spinal cord tissue sections were measured in the same manner as in Example 4-1, and the integrated optical density was normalized to control spinal cord tissue sections. It became. Concentration units on the graph abscissa (ng / ml) refer to HGF alone, VEGF alone, or a mixed concentration of HGF + VEGF. The bar graph represents the mean ± standard error of at least five tissue sections.

그 결과, 도 7b의 E 및 도 7b의 F에서 나타난 바와 같이 외인성 HGF 및/또는 VEGF 단백질이 손상된 척수조직 절편의 신경돌기 성장을 증가시키는 것을 확인하였다.As a result, it was confirmed that exogenous HGF and / or VEGF protein increased neurite growth of damaged spinal cord tissue sections as shown in E of FIG. 7B and F of FIG. 7B.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims

delete

Human bone marrow-derived mesenchymal stem cells (MSCs),
a) primary culture for 24 hours in DMEM medium containing 10% FBS and 1 mM β-mercaptoethanol;
b) secondary culture for 72 hours in DMEM medium containing 10% FBS and 280 ng / ml retinoic acid; And,
c) DMEM medium containing 10% FBS, 10 mM forskolin, 10 ng / ml human bFGF, 5 ng / ml PDGF-AA, and 200 ng / ml human Heregulin-β1 (heregulin-β1) 8 A composition for treating neuronal damage cells comprising immature schwann cells obtained by culturing in a method including tertiary culturing for one day as an active ingredient.

delete

The method of claim 6, wherein the nerve injury is stroke, Parkinson's disease, Alzheimer's disease, Pick's disease, Huntington's disease, Amyotrophic lateral sclerosis, Traumatic central nervous system disease ( Traumatic central nervous system diseases) and spinal cord injury (spinal cord injury disease) composition for cell treatment, characterized in that selected from the group consisting of.

delete

The composition of claim 6, wherein the immature Schwann cells overexpress expression of hepatocyte growth factor (HGF) or vascular endothelial growth factor (VEGF).